Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89

Contents lists available at ScienceDirect

Progress in Neuro-Psychopharmacology & Biological

Psychiatry
journal homepage: www.elsevier.com/locate/pnp

Crack cocaine addiction, early life stress and accelerated cellular aging
among women
Mateus Luz Levandowski a,1, Saulo Gantes Tractenberg a,1, Lucas Araújo de Azeredo a, Tatiana De Nardi a,
Diego L. Rovaris b, Claiton H.D. Bau b, Lucas B. Rizzo c, Pawan Kumar Maurya c, Elisa Brietzke c,
Audrey R. Tyrka d, Rodrigo Grassi-Oliveira a,⁎
a
Developmental Cognitive Neuroscience Lab (DCNL), Biomedical Research Institute (IPB), Pontifical Catholic University of Rio Grande do Sul (PUCRS), Brazil
b
Department of Genetics, Instituto de Biociências, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, Brazil
c
Research Group in Behavioral Neuroscience of Bipolar Disorder, Department of Psychiatry, Federal University of São Paulo (Unifesp), São Paulo, SP, Brazil
d
Mood Disorders Research Program and Laboratory for Clinical and Translational Neuroscience, Department of Psychiatry and Human Behavior, Brown University, USA

a r t i c l e i n f o a b s t r a c t

Article history: Background: Early life stress (ELS) and addiction are related to age-related diseases and telomere shortening.
Received 19 April 2016 However, the role of telomere length (TL) in crack cocaine addiction remains unknown. The purpose of this
Received in revised form 19 June 2016 study was to investigate the TL in a sample of crack cocaine dependent-women who reported an ELS history
Accepted 19 June 2016 and in a community-based sample of elderly women as a reference group for senescence.
Available online 21 June 2016
Methods: This study included treatment seeking crack cocaine dependents women (n = 127) and elderly women
without a psychiatric diagnosis (ELD, n = 49). The crack cocaine sample was divided in two groups according to
Keywords:
Aging
their Childhood Trauma Questionnaire (CTQ) scores: presence of history of childhood abuse and neglect (CRACK-
Child abuse ELS) and absence of ELS history (CRACK). TL was assessed by T/S ratio obtained from peripheral blood DNA using
Cocaine quantitative PCR assay.
Senescence Results: CRACK and CRACK-ELS subjects exhibited shortened TL in comparison to the ELD group, despite their
Substance-related disorders younger age. Among crack cocaine sample, CRACK-ELS group had significantly shorter telomeres than the
Telomere CRACK group. Correlation analysis within crack cocaine group indicated that TL was negatively correlated with
emotional abuse scores.
Conclusions: These results support previous findings associating telomere shortening with both ELS and drug ad-
diction. This study suggests new evidence of a distinct biological phenotype for drug-dependent women with
ELS. The results support the biological senescence hypothesis underpinning ELS experience.
© 2016 Elsevier Inc. All rights reserved.

1. Introduction
The burden of cocaine addiction is estimated to be around 16 disabil-
ity adjusted life years (DALYs) per 100.000 individuals (Degenhardt et
al., 2014), and an increased mortality rate of up to 8 times higher than
that expected in a similar population without drug abuse history
(Barrio et al., 2013). Long-term cocaine use contributes to important
health problems, including coronary artery disease (Degenhardt et al.,
2011), major depressive disorder (Herrero et al., 2008), cognitive de-
cline (Verdejo-Garcia et al., 2007; Viola et al., 2015), and. In addition, co-
caine use has been associated with increased peripheral inflammatory
mediators (Araos et al., 2015; Fox et al., 2012; Levandowski et al.,
⁎ Corresponding author at: Faculdade de Psicologia, Psychology Department, Pontifical
Catholic University of Rio Grande do Sul, Avenida Ipiranga, 6681, Prédio 11, Sala 936,
Partenon, Porto Alegre, Brazil.
1
These authors contributed equally to this work.
2014) and age-related atrophy in grey matter volume (Ersche et al.,
2013) both of which are commonly seen in association with aging and
age-related disorders (Sander et al., 2008).
Prior reports have linked cocaine abuse and other substances (i.e., al-
cohol and heroin) with acceleration of normal aging, suggesting a role
for immunoscenecense and accelerated telomere shortening (Beach et
al., 2014; Cheng et al., 2013; Pavanello et al., 2011; Reece, 2007; Yang
et al., 2013). Telomeres are long nucleotide repeats located at the end
of chromosomes that preserve genetic information by mitigating non-
homologous recombination and nucleolytic degradation (Blackburn,
2005). Telomere shortening is a natural physiologic process that occurs
in aging (Harley et al., 1990), and is also associated with several age-re-
lated diseases, such as Alzheimer Disease (Panossian et al., 2003), major
depression (Ridout et al., 2016), cardiovascular (Yang et al., 2009) and
autoimmune disorders (Hohensinner et al., 2011).
Recently, two studies found accelerated cellular aging in heroin ad-
dicts. One study found lower telomerase activity, a reverse transcriptase

http://dx.doi.org/10.1016/j.pnpbp.2016.06.009
0278-5846/© 2016 Elsevier Inc. All rights reserved.
84 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89
that limits telomere shortening, in abstinent heroin addicts compared
with healthy controls without a history of substance abuse (Cheng et
al., 2013). Moreover, this finding was inversely correlated with structur-
al integrity of gray and white matter of the prefrontal cortex. The second
study found reduced leukocyte telomere length (TL) in heroin users in
comparison to controls (Yang et al., 2013). Considering that both heroin
(Zhou et al., 2000) and crack cocaine (Zaparte et al., 2015) addiction are
associated with increased oxidative stress, and this could lead to dam-
age to telomere DNA and accelerated telomere shortening (Kawanishi
and Oikawa, 2004), it is reasonable to hypothesize that crack cocaine
addiction could also accelerate telomere shortening processes. Howev-
er, to our knowledge, there is no previous study investigating TL in crack
cocaine users.
Early life stress (ELS) is another important factor that has been as-
sociated with accelerated telomere shortening (Price et al., 2013; S. J.
Ridout et al., 2015). Moreover, high rates of early life trauma have
been described among women with crack cocaine dependence
(Bertoni et al., 2014) and they are often more susceptible to the com-
plications of crack cocaine compared to their male counterparts
(Bastos and Bertoni, 2014). Furthermore, women with crack cocaine
addiction with a severe ELS history present distinct behavioral
(Francke et al., 2013), immune (Levandowski et al., 2013, 2014)
and neurotrophic (Viola et al., 2014) phenotypes when compared
to those without such early life exposure.
Thus, the current study was designed to investigate the TL in a
sample of crack cocaine dependent women with and without a histo-
ry of ELS. In order to test our hypothesis about accelerated aging, we
recruited a group of elderly women as a reference group. This refer-
ence group allows us, for the first time, to test if drug addiction with
and without ELS exposure could be related to cellular senescence.
Therefore, our hypothesis is that crack cocaine dependent women
reporting ELS will exhibit accelerated cellular senescence, as mea-
sured by TL.
2. Material and methods
2.1. Study design
This study had a cross-sectional design and included 127 female
crack cocaine dependent women and 49 elderly women without mental
disorders (ELD). Crack cocaine users were split into two distinct groups
in according with presence (CRACK-ELS, n = 93) or absence (CRACK,
n = 34) of severe ELS history. All participants provided written in-
formed consent before inclusion in the study, which was approved by
the Ethical Committees of the participating institutions.
2.2. Participants
2.2.1. Women with crack cocaine addiction
Women with crack cocaine addiction were recruited from a public
and voluntary detoxification treatment (21 days of inpatient treatment
at a public hospital from southern Brazil). The inclusion criteria were as
follows: (1) age between 18 and 55 years; (2) diagnosis of crack use dis-
order according to the Diagnostic and Statistical Manual of Mental Dis-
orders 4th edition (DSM-IV); (3) absence of psychotic syndromes and
other severe medical condition and (4) absence of corticosteroids, anti-
biotics or anti-inflammatory drug use. All participants were treated in
an inpatient abstinence controlled environment, so they had no access
to alcohol, cigarettes or other drugs.
All participants were receiving a symptom-driven cocaine detoxifi-
cation medication protocol, composed of neuroleptics, analgesics, anti-
depressants or mood stabilizers. All data (clinical assessment and
blood draw) were collected at the 4th day post-admission in order to
avoid ongoing cocaine intoxication.
2.2.2. Elderly women
Elderly women were recruited from community-based elder sup-
port groups from the same region of Brazil. Considering our hypothesis,
we chose to include elderly individuals as a reference group for cellular
senescence (Sander et al., 2008). All elderly subjects were assessed for
the following inclusion criteria: (1) absence of history of ELS; (2) no cur-
rent symptoms suggestive of dementia or other neurological disorders;
(3) no current or past cancer diagnosis and (4) no unstable or severe
medical condition. We did not exclude individuals who were in regular
treatment regarding chronic diseases, including diabetes (n = 6), hy-
pertension (n = 3), osteoporosis (n = 15), rheumatoid arthritis (n =
14) and thyroid disorders (n = 15) due to the high prevalence of
these clinical conditions in Brazilian aging samples (Schmidt et al.,
2011).
2.3. Clinical assessment
The clinical characteristics of both crack cocaine and elderly group
were assessed by well-trained psychologists through clinical interview.
Information concerning social-demographic status, height, weight and
clinical health history were also obtained. Body mass index [BMI =
weight (kg)/height2 (m2)] was calculated and included in the protocol.
Psychiatric diagnoses were assessed using semi-structured clinical
interview following the Diagnostic and Statistical Manual of Mental Dis-
orders, 4th edition (DSM-IV) criteria. In addition, self-administered
questionnaires were used to assess symptoms severity. The Beck De-
pression Inventory (BDI-II) (Gorenstein and Andrade, 1996) and the
Geriatric Depression Scale – Short Form (GDS-15) were used to measure
the severity of depressive symptoms in crack cocaine and elderly
groups, respectively. Cocaine Selective Severity Assessment (CSSA),
adapted for crack users (Kampman et al., 1998; Kluwe-Schiavon et al.,
2015), was used to evaluate the severity of the withdrawal symptoms
during detoxification. The Addiction Severity Index version 6 (ASI-6)
(Kessler et al., 2012) was also assessed to obtain information regarding
patterns of crack cocaine use, age of onset and crack cocaine abuse
severity.
2.4. Early life stress
A history of ELS was assessed using the validated Portuguese version
of Childhood Trauma Questionnaire (CTQ) (Grassi-Oliveira et al., 2014)
which includes assessment of sexual, physical and emotional abuse and
physical and emotional neglect during early life. CTQ contains a five-
point Likert-type scale, including 5 subscales. ELS was classified as mod-
erate to severe according to the cutoff point postulated by Bernstein and
Fink (1998).
2.5. Telomere length (TL) assessment
Genomic DNA was isolated from peripheral blood. Prior to genotyping,
DNA concentrations in samples were assessed using NanoDrop 1000
(Thermo Fisher Scientific, Wilmington, US) and set to 50 ng/ul. TL was
measured as previously described by Cawthon (Cawthon, 2009). Briefly,
the TL measurement via quantitative PCR (qPCR) involves determining
the ratio of the telomere (T) repeat copy number to a single-copy gene
(S) copy number (T/S ratio) using a standard curve. This ratio is propor-
tional to the average TL. Telomere (T) and albumin (S) PCRs were
performed on the same plate using a monochrome multiplex qPCR. One
master mix was prepared containing SYBR® Select Master Mix (Life
Technologies, USA) and primers for telomeres (Tel-g: 5′ ACA
CTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT 3′ and Tel-c: 5′
TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA 3′) and for
albumin (Alb-u: 5′ CGGCGGCGGGCGGCGCGGGC`TGGGCGGAAATGCTG
CACAGAATCCTTG 3′; Alb-d: 5′ GCCCGGCCCGCCGCGCCCGTCCCGCCGGA
AAAGCATGGTCGCCTGTT 3′. Prior to the experiment, primer sets were
tested thoroughly to determine reaction efficiency, specificity, and the
 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89 85

absence of primer-dimers. The final primer concentrations were 900 ηM
for Tel-g, Alb-u, and Alb-d. The final Tel-c primer concentration was 600
ηM. The final volume of the reaction was 25 uL per well for all markers.
The standard curve was composed based on a 5-point serial dilution
of reference DNA from a single person, and the dilution ranged from 150
to 1.85 ηg. The qPCRs were done on ViiA™ 7 Real-Time PCR System with
96-well block (Life Technologies, USA). The thermal cycling profile for
telomere amplification consisted of Stage 1: 15 min at 95 °C; Stage 2:
2 cycles of 15 s at 94 °C, 15 s at 49 °C; and Stage 3: 35 cycles of 15 s at
94 °C, 10 s at 68 °C, 19 s at 74 °C with signal acquisition, 10 s at 85 °C,
19 s at 88 °C with signal acquisition. The 74 °C reads provided the Ct
values for the amplification of the telomere template, and the 88 °C
reads provided the Ct values for the amplification of the albumin tem-
plate. The specificity of products synthesis was verified by melting
curve analysis.
2.6. Statistical analysis
All variables were tested for distribution normality using the Kolmo-
gorov-Smirnov test. Demographic and clinical characteristics of groups
were compared using Student's t-test and one-way ANOVA when ap-
propriated. In a first step, one-way ANOVA was used to compare TL be-
tween ELD, CRACK and CRACK-ELS groups. BMI and education did not
reach the threshold for confounding effects, which was defined by the
association with both the outcome (TL) and the study factor (groups).
Due to the lack of homoscedasticity in this analysis, the Welch's correc-
tion was performed. Tukey post hoc test was used to compare differ-
ences between groups accounting for multiple testing.
In a second step, an analysis restricted to the CRACK and CRACK-ELS
groups was performed to explore the role of different types of ELS on TL
by using one-way ANOVA with Tukey post hoc test. BMI, education, de-
pressive symptoms, age of onset drug abuse, and craving symptoms did
not meet the criterion for confounding effects in this analysis. We also
performed Pearson/Spearman correlations between CTQ total and sub-
scales score and TL. All statistical analyses were performed with Statis-
tical Package for the Social Sciences version 17.0 (SPSS, Chicago, IL,
USA). Since two independent steps were carried out, we calculated
corrected p-values (corrected p-value = p-value × 2) for one-way
ANOVAs. In the correlation analyses, we have calculated corrected p-
values by taking into account the 11 Pearson/Spearman correlations
performed (corrected p-value = p-value × 11).
3. Results
Table 1 summarizes the demographic and clinical characteristics of
the samples. Within the crack cocaine dependent groups, we found dif-
ferences regarding BMI and depression, with higher scores in the
CRACK-ELS group. In addition, as expected, the ELD group was more
than twice as old and had more years of formal education than the
crack cocaine groups.
Differences in TL were statistically significant between groups (Fig.
1) as determined by Welch's ANOVA (F(2,81.68) = 15.964, corrected
p b 0.001). The post hoc test revealed that CRACK-ELS (Tukey,
p b 0.001) and CRACK (Tukey, p = 0.021) groups had significantly
shorter TL than ELD group. CRACK-ELS group had significantly shorter
TL than CRACK group (Tukey, p = 0.035). Although demographic and
clinical characteristics did not meet criteria for confounding effects,
we carried out an analysis of covariance adjusting for age, educational
level and BMI. These variables were not significant in this model and
the group effects remained significant (F(2,158) = 6.310, p 0.002).
The frequency of each type of ELS is shown in Fig. 2A. The largest
proportion of crack cocaine dependent women reported exposure to
both childhood neglect and childhood abuse. When we investigated
TL in distinct ELS types within crack cocaine groups (Fig. 2B), we
found that users reporting exposure to abuse-only forms of childhood
maltreatment (Tukey, p = 0.023) as well as abuse combined with ne-
glect exposure (Tukey, p b 0.012) had shorter telomere than users with-
out ELS (F(3,123) = 4.104, corrected p = 0.016). In addition, we did not
find a statistical difference between TL of users reporting neglect-only
exposure and users without ELS (Tukey, p b 0.201), possibly due to a
Type-II error, given the small sample size in this group.
Correlation analysis within CRACK and CRACK-ELS groups indicated
that TL was negatively correlated with Emotional Abuse CTQ subscale
score (r = −0.257, corrected p = 0.044). Moreover, TL was not corre-
lated with depression or craving symptoms, BMI, education level, age
of onset drug abuse within crack cocaine groups.

Table 1
Demographic and clinical characteristics of crack cocaine (n = 127) and elderly (n = 49) groups.

CRACK-ELS CRACK ELD

(n = 93) (n = 34) (n = 49) Statistics p value Pairwise comparison

Demographics
Age 29.5 (7.7)a 26.2 (6.3)b 68.3 (7.4)c F2,173 = 490.67 b0.001 a,b b c
BMI 24.9 (4.3)a 21.5 (5.6) b 26.2 (4.4) c F2,173 = 10.997 b0.001 b b a,c
Educational level 7.5 (2.9)a 8.0 (3.1) b 10.9 (4.3) c F2,170 = 15.795 b0.001 a,b b c
Depression assessment

BDI 21.4 (7.1) 14.9 (9.6) – t(121) = −2.252 0.040 –

GDS – – 3.4 (2.8) – – –
Crack cocaine assessment

Age of first use of crack 21.2 (9.7) 20.6 (9.5) – t(104) = −0.298 0.766 –
Withdraw prior treatment admission 2.68 (4.7) 2.41 (3.7) – t(109) = −0.310 0.779 –
CSSA 47.0 (14.9) 46.5 (16.2) – t(110) = 0.038 0.631 –
ASI drugs 64.6 (11.0) 63.0 (10.1) – t(104) = 0.638 0.525
CTQ

Total score 59.5 (19.0)a 33.2 (6.1)b 19. 7 (6.0)c F2,173 = 130.16 b0.001 abbbc

Note: Values are showed as mean ± SD. CRACK-ELS, Crack Cocaine Dependents with history of Early Life Stress; CRACK, Crack Cocaine Dependents without history of Early Life Stress; ELD,
Elderly Group; ASI-6, Addiction Severity Index; BDI, Beck Depression Inventory; BMI, Body Mass Index; CSSA, Cocaine Selective Severity Assessment; CTQ, Childhood Trauma Questionnaire;
F, ANOVA; t, unpaired t test. Pairwise comparison showing P b 0.01 where:
a
CRACK-ELS.
b
CRACK.
c
ELD.
86 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89

Fig. 1. Comparison of telomere length of ELD, CRACK and CRACK-ELS groups. Horizontal
lines indicate mean values. Mean and SD values: ELD (1.50; SD 0.42), CRACK (1.33; SD
0.16), CRACK-ELS (1.19; SD 0.21). **, p b 0.001.* p b 0.05.

4. Discussion

The current study provides novel evidence of shortened TL in crack

cocaine dependent women, especially in those reporting ELS exposure.
These findings support recent behavioral findings suggesting that crack
cocaine use may confer a “fast-track” aging process (Sanvicente-Vieira
et al., in press). Here we demonstrated that both crack cocaine groups
(with and without a prior history of ELS) have shortened TL when com-
pared with elderly women without mental disorders. The rationale to
compare crack cocaine groups with elderly women was based on the
expectation that TL in these individuals could be a reliable marker of cel-
lular aging processes, since TL shortens progressively across the lifespan
(Hohensinner et al., 2011).
Telomere shortening has been found in many mental disorders, in-
cluding mood disorder patients (K. K. Ridout et al., 2016), anxiety and
posttraumatic stress disorder (Lindqvist et al., 2015), schizophrenia
(Kao et al., 2008) and, recently, three studies that directly addressed
TL in substance abusers (Cheng et al., 2013; Pavanello et al., 2011;
Yang et al., 2013). Beyond investigating the associations between TL
and drug addiction, Cheng et al. (2013) also explored the role of telome-
rase activity. They found that not only TL, but also telomerase activity is
reduced in drug users. In addition, the reduction of telomerase activity
was correlated with structural damage in the right dorsolateral prefron-
tal cortex (DLPFC) and with the altered pattern of functional connectiv- Fig. 2. (A) ELS history distribution of crack cocaine participants and (B) Comparison of
ity between DLPFC and other brain regions associated with reward and telomere length among subtypes of early life stress in crack cocaine participants. No ELS
aging processes (Cheng et al., 2013). DLPFC has been strongly suggested (n = 34; 26.77%), Abuse (n = 30; 23.62%), Neglect (n = 10; 7.87%) and Abuse +
Neglect (n = 53; 41.73%). Mean and SD: No ELS (1.33; SD 0.16), Abuse (1.18; SD 0.19),
as one of the brain regions that undergoes an age-sensitive decline lead- Neglect (1.19; SD 0.23) and Abuse + Neglect (1.19; SD 0.15). *, p b 0.05 in comparison
ing to the deterioration of cognitive functioning (Reuter-Lorenz and to No ELS group.
Lustig, 2005; Salat et al., 2004). Thus, we believe the earlier cell senes-
cence could explain, at least in part, the adverse effects of the drug ad-
diction on long-term health outcomes. users, we divided our crack cocaine sample according to ELS experi-
A possible mechanism that contribute to shortening TL involves the ences. We found that TL among the CRACK-ELS group was shorter in
drug-induced oxidative stress and enhance of proinflammatory media- comparison to CRACK and ELD groups. Moreover, previous reports
tors in response to antioxidants reduction (Araos et al., 2015; Kovacic, shown that subtypes of maltreatment are also associated with short-
2005; Levandowski et al., 2014; Zaparte et al., 2015; Zhou et al., 2000). ened TL (Tyrka et al., 2016; Tyrka et al., 2010). In this study, we found
These mediators are known to damage telomeric DNA and accelerate that abuse-only forms and abuse combined with neglect has shortened
the rate of telomere shortening per cell division (Houben et al., 2008). telomeres, however we failed to find data regarding neglect-only forms.
Moreover, oxidative stress has been suggested to be associated with Although, this result could be a Type-II error given a small sample size in
withdrawal symptoms in crack cocaine dependents (Zaparte et al., the subgroup of neglect-only.
2015). These findings are in accordance with several studies that show
In addition to prior reports that revealed shortened TL in substance shortened telomeres in adults who suffered childhood maltreatment
abuse, a study from Tyrka and colleagues (Tyrka et al., 2016) suggested (Price et al., 2013; S. J. Ridout et al., 2015). Moreover, chronic diseases
that early adverse experiences could also accelerate cellular aging are more common in adults with an ELS history (Nusslock and Miller,
among clinical populations. In order to advance the understanding of 2015; Tyrka et al., 2015). These diseases may be developed across the
cellular mechanisms underlying ELS programming in crack cocaine lifespan through complex interactions between gene and environment
 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89
(Nusslock and Miller, 2015; Tyrka et al., 2015). However, there is evi-
dence that age-related diseases in adults have their origins in early life
experience during sensitive neurobiological periods (Kuh and New
Dynamics of Ageing Preparatory, 2007; Sander et al., 2008). Indeed,
there is a large body of research overlap between neurobiological char-
acteristics of ELS and aging, such as hippocampal volume decline (Staff
et al., 2012), low grade of inflammation (Nusslock and Miller, 2015) and
shortened TL (S. J. Ridout et al., 2015). This could explain a wide range of
chronic diseases of aging in adults with a history of ELS.
This study has strengths that should be highlighted. First, the major-
ity of studies examining ELS effects in TL and other biological mediators
are from North American or European upper income countries (Zahran
et al., 2015). It could limit the generalization to distinct socioeconomic
countries (Henrich et al., 2010). Brazil, for example, presented a repre-
sentative portion of the population living below the poverty line in
2014, with higher estimates of childhood maltreatment in comparison
to other countries (Viola et al., 2016). In addition, there is a critical pub-
lic health issue regarding crack cocaine addiction (Dias et al., 2011).
Thus, our study contributes to the cross-cultural evidence regarding
premature aging in a sample composed by women at high risk of child-
hood trauma. Second, we compared TL and ELS between two groups of
women with the same diagnosis, but with distinct early life experiences.
This contributes for evidences of heterogeneity in clinical presentation
in crack cocaine dependence. Finally, we also compared our groups of
crack cocaine dependents with a group with elderly women. This allows
us, for the first time, to show that women with drug addiction and ELS
have greater cellular senescence than women with no mental illness
or ELS who are more than twice their age.
Our results should be understood in the context of some limitations.
T/S ratio was based on average TL and cannot reflect the direct measure
of telomeric region. However, this widely used method provides results
that are highly correlated with the gold-standard southern blot and
other methods (Aubert et al., 2012), and has the advantage that it can
be performed at higher throughput and low cost (Shalev, 2012). Our
study also did not measure telomerase activity, which could have an im-
pact on the current findings. It is known that telomerase influences the
rate of change in TL of peripheral blood mononuclear cells (Lin et al.,
2015). Additionally, the cross-sectional design does not allow assess-
ment of within-individual changes in TL over the lifespan. This approach
is only able to estimate how the cellular aging processes may proceed
based on measurement of individuals with a range of ages and expo-
sures. However, given that our design included a reference group of el-
derlies, our results provide substantial support for an advanced cellular
aging process. Finally, the ELS measurement by CTQ is limited because it
is a self-report questionnaire of early life events. It has been demonstrat-
ed that of early life events questionnaires are dependent on an integrate
functioning of autobiographic memory (Mowlds et al., 2010). Indeed,
we cannot exclude the possibility of an under- or over-estimation of
early life self-report events. However, there are indications suggesting
a significant effect of perceived stress in TL (Mathur et al., 2016). Ac-
cording to these findings is not the intensity or chronicity of stressor
per se, but rather an influence of individual's perception that could af-
fects TL. Finally, we investigated only a sample of crack cocaine depen-
dent women. Thus, this data could not be generalized for crack
cocaine males considering that male and female have distinct biological
and behavioral outcomes in response to cocaine addiction (Quinones-
Jenab, 2006) and that women are more susceptible to complications
due crack cocaine use (Bastos and Bertoni, 2014).
5. Conclusions
In summary, the current study provides a new evidence of shorter TL
in crack cocaine dependent-women in comparison with elderly women.
Moreover, this study demonstrates that ELS has an effect on telomere
when we divided our sample. TL has been previously suggested as a
marker of cellular aging, especially in psychiatry populations, and linked
87
to adverse life experiences effects over development (Tyrka et al., 2016).
Together, this evidence supports a recent hypothesis that subjects with
psychiatric disorders who report a history of ELS present a distinct clin-
ical and neurobiological profile, called an ecophenotype (Teicher and
Samson, 2013).
This ecophenotype could in part explain why treatment of crack co-
caine addiction is challenging, given the high prevalence of early trauma
exposure in this population. Our findings highlight the complex interac-
tion of cellular, molecular and biological events increasing vulnerability
to mental disorders due ELS. Future longitudinal studies coupled with
cellular and molecular approaches and age-matched healthy controls
with and without ELS could bring us a step closer to getting a clear pic-
ture on the role of TL in response to ELS across the lifespan.
Author disclosures
This study was supported by MCT/CT-Saúde (DECIT/SCTIE/MS),
‘Conselho Nacional de Desenvolvimento Científico e Tecnológico’
(CNPq) (Grant number 402723/2010-4) and ‘Fundação de Amparo à
Pesquisa do Estado do Rio Grande do Sul’ (FAPERGS) (Grant number
11/1302-7). The funding source had no involvement in study design,
in the collection, analysis and interpretation of data, in the writing of
the report, and in the decision to submit the paper for publication.
Contributors
MLL, RGO and SGT designed the study. MLL, RGO, SGT and TCN col-
lected the sample. DLR, CHDB, LAA, LBR and PKM extracted DNA from
blood and measured telomere length. MLL and SGT drafted the first ver-
sion of the manuscript. All contributors have made a substantial intel-
lectual contribution to the work. All authors have participated in
manuscript writing by reviewing drafts and approving this final version.
Conflict of interest
No conflicts of interest declared concerning the publication of this
article.
Acknowledgements
We are thankful to the Developmental Cognitive Neuroscience Lab
(DCNL) research team and to the staff of the ‘Hospital Espírita de
Porto Alegre (HEPA)’ and ‘Hospital Mãe de Deus’ for all their support re-
garding data collection.
References
Araos, P., Pedraz, M., Serrano, A., Lucena, M., Barrios, V., Garcia-Marchena, N., ... Rodriguez
de Fonseca, F., 2015. Plasma profile of pro-inflammatory cytokines and chemokines
in cocaine users under outpatient treatment: influence of cocaine symptom severity
and psychiatric co-morbidity. Addict. Biol. 20 (4), 756–772. http://dx.doi.org/10.
1111/adb.12156.
Aubert, G., Hills, M., Lansdorp, P.M., 2012. Telomere length measurement-caveats and a
critical assessment of the available technologies and tools. Mutat. Res. 730 (1–2),
59–67. http://dx.doi.org/10.1016/j.mrfmmm.2011.04.003.
Barrio, G., Molist, G., de la Fuente, L., Fernandez, F., Guitart, A., Bravo, M.J., Itinere Working,
Group, 2013. Mortality in a cohort of young primary cocaine users: controlling the ef-
fect of the riskiest drug-use behaviors. Addict. Behav. 38 (3), 1601–1604. http://dx.
doi.org/10.1016/j.addbeh.2012.10.007.
Bastos, F.I., Bertoni, N., 2014. Pesquisa Nacional sobre o uso de crack: quem são os usuários
de crack e/ou similares no Brasil? quantos são nas capitais brasileiras? ICICT/FIOCRUZ,
Rio de Janeiro
Beach, S.R., Lei, M.K., Brody, G.H., Yu, T., Philibert, R.A., 2014. Nonsupportive parenting af-
fects telomere length in young adulthood among African Americans: mediation
through substance use. J. Fam. Psychol. 28 (6), 967–972. http://dx.doi.org/10.1037/
fam0000039.
Bernstein, D.P., Fink, L., 1998. Childhood trauma questionnaire: A retrospective self-report:
Manual. Psychological Corporation.
Bertoni, N., Burnett, C., Cruz, M.S., Andrade, T., Bastos, F.I., Leal, E., Fischer, B., 2014. Explor-
ing sex differences in drug use, health and service use characteristics among young
urban crack users in Brazil. Int. J. Equity Health 13 (1), 70. http://dx.doi.org/10.
1186/s12939-014-0070-x.
88 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89
Blackburn, E.H., 2005. Telomeres and telomerase: their mechanisms of action and the ef-
fects of altering their functions. FEBS Lett. 579 (4), 859–862. http://dx.doi.org/10.
1016/j.febslet.2004.11.036.
Cawthon, R.M., 2009. Telomere length measurement by a novel monochrome multiplex
quantitative PCR method. Nucleic Acids Res. 37 (3), e21. http://dx.doi.org/10.1093/
nar/gkn1027.
Cheng, G.L., Zeng, H., Leung, M.K., Zhang, H.J., Lau, B.W., Liu, Y.P., ... Lee, T.M., 2013. Heroin
abuse accelerates biological aging: a novel insight from telomerase and brain imaging
interaction. Transl. Psychiatry 3, e260. http://dx.doi.org/10.1038/tp.2013.36.
Degenhardt, L., Singleton, J., Calabria, B., McLaren, J., Kerr, T., Mehta, S., ... Hall, W.D., 2011.
Mortality among cocaine users: a systematic review of cohort studies. Drug Alcohol
Depend. 113 (2–3), 88–95. http://dx.doi.org/10.1016/j.drugalcdep.2010.07.026.
Degenhardt, L., Whiteford, H., Hall, W.D., 2014. The Global Burden of Disease projects:
what have we learned about illicit drug use and dependence and their contribution
to the global burden of disease? Drug Alcohol Rev. 33 (1), 4–12. http://dx.doi.org/
10.1111/dar.12088.
Dias, A.C., Araujo, M.R., Dunn, J., Sesso, R.C., de Castro, V., Laranjeira, R., 2011. Mortality
rate among crack/cocaine-dependent patients: a 12-year prospective cohort study
conducted in Brazil. J. Subst. Abus. Treat. 41 (3), 273–278. http://dx.doi.org/10.
1016/j.jsat.2011.03.008.
Ersche, K.D., Jones, P.S., Williams, G.B., Robbins, T.W., Bullmore, E.T., 2013. Cocaine depen-
dence: a fast-track for brain ageing? Mol. Psychiatry 18 (2), 134–135. http://dx.doi.
org/10.1038/mp.2012.31.
Fox, H.C., D'Sa, C., Kimmerling, A., Siedlarz, K.M., Tuit, K.L., Stowe, R., Sinha, R., 2012. Im-
mune system inflammation in cocaine dependent individuals: implications for med-
ications development. Humanist. Psychol. 27 (2), 156–166. http://dx.doi.org/10.
1002/hup.1251.
Francke, I.D., Viola, T.W., Tractenberg, S.G., Grassi-Oliveira, R., 2013. Childhood neglect and
increased withdrawal and depressive severity in crack cocaine users during early ab-
stinence. Child Abuse Negl. 37 (10), 883–889. http://dx.doi.org/10.1016/j.chiabu.
2013.04.008.
Gorenstein, C., Andrade, L., 1996. Validation of a Portuguese version of the Beck Depres-
sion Inventory and the State-Trait Anxiety Inventory in Brazilian subjects. Braz.
J. Med. Biol. Res. 29 (4), 453–457.
Grassi-Oliveira, R., Cogo-Moreira, H., Salum, G.A., Brietzke, E., Viola, T.W., Manfro, G.G., ...
Arteche, A.X., 2014. Childhood Trauma Questionnaire (CTQ) in Brazilian samples of
different age groups: findings from confirmatory factor analysis. PLoS One 9 (1),
e87118. http://dx.doi.org/10.1371/journal.pone.0087118.
Harley, C.B., Futcher, A.B., Greider, C.W., 1990. Telomeres shorten during ageing of human
fibroblasts. Nature 345 (6274), 458–460. http://dx.doi.org/10.1038/345458a0.
Henrich, J., Heine, S.J., Norenzayan, A., 2010. Most people are not WEIRD. Nature 466
(7302), 29. http://dx.doi.org/10.1038/466029a.
Herrero, M.J., Domingo-Salvany, A., Torrens, M., Brugal, M.T., Investigators, I., 2008. Psy-
chiatric comorbidity in young cocaine users: induced versus independent disorders.
Addiction 103 (2), 284–293. http://dx.doi.org/10.1111/j.1360-0443.2007.02076.x.
Hohensinner, P.J., Goronzy, J.J., Weyand, C.M., 2011. Telomere dysfunction, autoimmunity
and aging. Aging Dis. 2 (6), 524–537.
Houben, J.M., Moonen, H.J., van Schooten, F.J., Hageman, G.J., 2008. Telomere length as-
sessment: biomarker of chronic oxidative stress? Free Radic. Biol. Med. 44 (3),
235–246. http://dx.doi.org/10.1016/j.freeradbiomed.2007.10.001.
Kampman, K.M., Volpicelli, J.R., McGinnis, D.E., Alterman, A.I., Weinrieb, R.M., D'Angelo, L.,
Epperson, L.E., 1998. Reliability and validity of the Cocaine Selective Severity Assess-
ment. Addict. Behav. 23 (4), 449–461.
Kao, H.T., Cawthon, R.M., Delisi, L.E., Bertisch, H.C., Ji, F., Gordon, D., ... Porton, B., 2008.
Rapid telomere erosion in schizophrenia. Mol. Psychiatry 13 (2), 118–119. http://
dx.doi.org/10.1038/sj.mp.4002105.
Kawanishi, S., Oikawa, S., 2004. Mechanism of telomere shortening by oxidative stress.
Ann. N. Y. Acad. Sci. 1019, 278–284. http://dx.doi.org/10.1196/annals.1297.047.
Kessler, F., Cacciola, J., Alterman, A., Faller, S., Souza-Formigoni, M.L., Cruz, M.S., ...
Pechansky, F., 2012. Psychometric properties of the sixth version of the Addiction Se-
verity Index (ASI-6) in Brazil. Rev. Bras. Psiquiatr. 34 (1), 24–33.
Kluwe-Schiavon, B., Tractenberg, S.G., Sanvicente-Vieira, B.R., Caroline Silva de Oliveira, A.,
Adriane Xavier, P., Carlos, J., Grassi-Oliveira, R., 2015. Psychometric properties of Co-
caine Selective Severity Assessment (CSSA) in crack users. J. Bras. Psiquiatria 64 (2),
115–121.
Kovacic, P., 2005. Role of oxidative metabolites of cocaine in toxicity and addiction: oxida-
tive stress and electron transfer. Med. Hypotheses 64 (2), 350–356. http://dx.doi.org/
10.1016/j.mehy.2004.06.028.
Kuh, D., New Dynamics of Ageing Preparatory, Network, 2007. A life course approach to
healthy aging, frailty, and capability. J. Gerontol. A Biol. Sci. Med. Sci. 62 (7), 717–721.
Levandowski, M.L., Viola, T.W., Tractenberg, S.G., Teixeira, A.L., Brietzke, E., Bauer, M.E.,
Grassi-Oliveira, R., 2013. Adipokines during early abstinence of crack cocaine in de-
pendent women reporting childhood maltreatment. Psychiatry Res. 210 (2),
536–540. http://dx.doi.org/10.1016/j.psychres.2013.07.007.
Levandowski, M.L., Viola, T.W., Wearick-Silva, L.E., Wieck, A., Tractenberg, S.G., Brietzke,
E., ... Grassi-Oliveira, R., 2014. Early life stress and tumor necrosis factor superfamily
in crack cocaine withdrawal. J. Psychiatr. Res. 53, 180–186. http://dx.doi.org/10.
1016/j.jpsychires.2014.02.017.
Lin, Y., Damjanovic, A., Metter, E.J., Nguyen, H., Truong, T., Najarro, K., ... Weng, N.P., 2015.
Age-associated telomere attrition of lymphocytes in vivo is co-ordinated with chang-
es in telomerase activity, composition of lymphocyte subsets and health conditions.
Clin. Sci. (Lond.) 128 (6), 367–377. http://dx.doi.org/10.1042/CS20140481.
Lindqvist, D., Epel, E.S., Mellon, S.H., Penninx, B.W., Revesz, D., Verhoeven, J.E., ...
Wolkowitz, O.M., 2015. Psychiatric disorders and leukocyte telomere length: under-
lying mechanisms linking mental illness with cellular aging. Neurosci. Biobehav. Rev.
55, 333–364. http://dx.doi.org/10.1016/j.neubiorev.2015.05.007.
Mathur, M.B., Epel, E., Kind, S., Desai, M., Parks, C.G., Sandler, D.P., Khazeni, N., 2016. Per-
ceived stress and telomere length: a systematic review, meta-analysis, and
methodologic considerations for advancing the field. Brain Behav. Immun. 54,
158–169. http://dx.doi.org/10.1016/j.bbi.2016.02.002.
Mowlds, W., Shannon, C., McCusker, C.G., Meenagh, C., Robinson, D., Wilson, A.,
Mulholland, C., 2010. Autobiographical memory specificity, depression, and trauma
in bipolar disorder. Br. J. Clin. Psychol. 49 (Pt 2), 217–233. http://dx.doi.org/10.
1348/014466509X454868.
Nusslock, R., Miller, G.E., 2015. Early-Life Adversity and physical and emotional health
across the lifespan: a neuroimmune network hypothesis. Biol. Psychiatry http://dx.
doi.org/10.1016/j.biopsych.2015.05.017.
Panossian, L.A., Porter, V.R., Valenzuela, H.F., Zhu, X., Reback, E., Masterman, D., ... Effros,
R.B., 2003. Telomere shortening in T cells correlates with Alzheimer's disease status.
Neurobiol. Aging 24 (1), 77–84.
Pavanello, S., Hoxha, M., Dioni, L., Bertazzi, P.A., Snenghi, R., Nalesso, A., ... Baccarelli, A.,
2011. Shortened telomeres in individuals with abuse in alcohol consumption. Int.
J. Cancer 129 (4), 983–992. http://dx.doi.org/10.1002/ijc.25999.
Price, L.H., Kao, H.T., Burgers, D.E., Carpenter, L.L., Tyrka, A.R., 2013. Telomeres and early-
life stress: an overview. Biol. Psychiatry 73 (1), 15–23. http://dx.doi.org/10.1016/j.
biopsych.2012.06.025.
Quinones-Jenab, V., 2006. Why are women from Venus and men from Mars when they
abuse cocaine? Brain Res. 1126 (1), 200–203. http://dx.doi.org/10.1016/j.brainres.
2006.08.109.
Reece, A.S., 2007. Evidence of accelerated ageing in clinical drug addiction from immune,
hepatic and metabolic biomarkers. Immun. Ageing 4, 6. http://dx.doi.org/10.1186/
1742-4933-4-6.
Reuter-Lorenz, P.A., Lustig, C., 2005. Brain aging: reorganizing discoveries about the aging
mind. Curr. Opin. Neurobiol. 15 (2), 245–251. http://dx.doi.org/10.1016/j.conb.2005.
03.016.
Ridout, K.K., Ridout, S.J., Price, L.H., Sen, S., Tyrka, A.R., 2016. Depression and telomere
length: a meta-analysis. J. Affect. Disord. 191, 237–247. http://dx.doi.org/10.1016/j.
jad.2015.11.052.
Ridout, S.J., Ridout, K.K., Kao, H.T., Carpenter, L.L., Philip, N.S., Tyrka, A.R., Price, L.H., 2015.
Telomeres, early-life stress and mental illness. Adv. Psychosom. Med. 34, 92–108.
http://dx.doi.org/10.1159/000369088.
Salat, D.H., Buckner, R.L., Snyder, A.Z., Greve, D.N., Desikan, R.S., Busa, E., ... Fischl, B., 2004.
Thinning of the cerebral cortex in aging. Cereb. Cortex 14 (7), 721–730. http://dx.doi.
org/10.1093/cercor/bhh032.
Sander, M., Avlund, K., Lauritzen, M., Gottlieb, T., Halliwell, B., Stevnsner, T., ... Bohr, V.A.,
2008. Aging-from molecules to populations. Mech. Ageing Dev. 129 (10), 614–623.
http://dx.doi.org/10.1016/j.mad.2008.08.002.
Sanvicente-Vieira, B., Kommers-Molina, J., De Nardi, T., Francke, I., Grassi-Oliveira, R.,
2016. Crack-cocaine dependence and aging: effects on working memory. Rev.
Bras. Psiquiatr. 38 (1). http://dx.doi.org/10.1590/1516-4446-2015-1708 (in
press).
Schmidt, M.I., Duncan, B.B., Azevedo e Silva, G., Menezes, A.M., Monteiro, C.A., Barreto,
S.M., Menezes, P.R., 2011. Chronic non-communicable diseases in Brazil: burden
and current challenges. Lancet 377 (9781), 1949–1961. http://dx.doi.org/10.1016/
S0140-6736(11)60135-9.
Shalev, I., 2012. Early life stress and telomere length: Investigating the connection and
possible mechanisms: a critical survey of the evidence base, research methodology
and basic biology. BioEssays 34 (11), 943–952. http://dx.doi.org/10.1002/bies.
201200084.
Staff, R.T., Murray, A.D., Ahearn, T.S., Mustafa, N., Fox, H.C., Whalley, L.J., 2012. Childhood
socioeconomic status and adult brain size: childhood socioeconomic status influences
adult hippocampal size. Ann. Neurol. 71 (5), 653–660. http://dx.doi.org/10.1002/ana.
22631.
Teicher, M.H., Samson, J.A., 2013. Childhood maltreatment and psychopathology: a case
for ecophenotypic variants as clinically and neurobiologically distinct subtypes. Am.
J. Psychiatry 170 (10), 1114–1133. http://dx.doi.org/10.1176/appi.ajp.2013.
12070957.
Tyrka, A.R., Parade, S.H., Price, L.H., Kao, H.T., Porton, B., Philip, N.S., ... Carpenter, L.L., 2016.
Alterations of mitochondrial DNA copy number and telomere length with early ad-
versity and psychopathology. Biol. Psychiatry 79 (2), 78–86. http://dx.doi.org/10.
1016/j.biopsych.2014.12.025.
Tyrka, A.R., Price, L.H., Kao, H.T., Porton, B., Marsella, S.A., Carpenter, L.L., 2010. Childhood
maltreatment and telomere shortening: preliminary support for an effect of early
stress on cellular aging. Biol. Psychiatry 67 (6), 531–534. http://dx.doi.org/10.1016/
j.biopsych.2009.08.014.
Tyrka, A.R., Ridout, K.K., Parade, S.H., Paquette, A., Marsit, C.J., Seifer, R., 2015. Childhood
maltreatment and methylation of FK506 binding protein 5 gene (FKBP5). Dev.
Psychopathol. 27 (4 Pt 2), 1637–1645. http://dx.doi.org/10.1017/
S0954579415000991.
Verdejo-Garcia, A., Perez-Garcia, M., Sanchez-Barrera, M., Rodriguez-Fernandez, A.,
Gomez-Rio, M., 2007. Neuroimaging and drug addiction: neuroanatomical corre-
lates of cocaine, opiates, cannabis and ecstasy abuse. Rev. Neurol. 44 (7),
432–439.
Viola, T.W., Salum, G.A., Kluwe-Schiavon, B., Sanvicente-Vieira, B., Levandowski, M.L.,
Grassi-Oliveira, R., 2016. The influence of geographical and economic factors in esti-
mates of childhood abuse and neglect using the Childhood Trauma Questionnaire:
a worldwide meta-regression analysis. Child Abuse Negl. 51, 1–11. http://dx.doi.
org/10.1016/j.chiabu.2015.11.019.
Viola, T.W., Tractenberg, S.G., Kluwe-Schiavon, B., Levandowski, M.L., Sanvicente-Vieira,
B., Wearick-Silva, L.E., ... Grassi-Oliveira, R., 2015. Brain-derived neurotrophic factor
and delayed verbal recall in crack/cocaine dependents. Eur. Addict. Res. 21 (5),
273–278. http://dx.doi.org/10.1159/000430436.
 M.L. Levandowski et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry 71 (2016) 83–89
Viola, T.W., Tractenberg, S.G., Levandowski, M.L., Pezzi, J.C., Bauer, M.E., Teixeira, A.L.,
Grassi-Oliveira, R., 2014. Neurotrophic factors in women with crack cocaine depen-
dence during early abstinence: the role of early life stress. J. Psychiatry Neurosci. 39
(3), 206–214.
Yang, Z., Huang, X., Jiang, H., Zhang, Y., Liu, H., Qin, C., ... Ju, Z., 2009. Short telomeres and
prognosis of hypertension in a chinese population. Hypertension 53 (4), 639–645.
http://dx.doi.org/10.1161/hypertensionaha.108.123752.
Yang, Z., Ye, J., Li, C., Zhou, D., Shen, Q., Wu, J., ... Liu, Y., 2013. Drug addiction is associated
with leukocyte telomere length. Sci. Report. 3, 1542. http://dx.doi.org/10.1038/
srep01542.
Zahran, S., Snodgrass, J.G., Maranon, D.G., Upadhyay, C., Granger, D.A., Bailey, S.M., 2015.
Stress and telomere shortening among central Indian conservation refugees. Proc.
89
Natl. Acad. Sci. U. S. A. 112 (9), E928–E936. http://dx.doi.org/10.1073/pnas.
1411902112.
Zaparte, A., Viola, T.W., Grassi-Oliveira, R., da Silva Morrone, M., Moreira, J.C., Bauer, M.E.,
2015. Early abstinence of crack-cocaine is effective to attenuate oxidative stress and
to improve antioxidant defences. Psychopharmacology 232 (8), 1405–1413. http://
dx.doi.org/10.1007/s00213-014-3779-8.
Zhou, J.F., Yan, X.F., Ruan, Z.R., Peng, F.Y., Cai, D., Yuan, H., Xu, S.S., 2000. Heroin abuse and
nitric oxide, oxidation, peroxidation, lipoperoxidation. Biomed. Environ. Sci. 13 (2),
131–139.