G Model

JGAR-146; No. of Pages 6

Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Journal of Global Antimicrobial Resistance

journal homepage: www.elsevier.com/locate/jgar

Isolation of carbapenem-resistant Pseudomonas spp. from food

Marcus Ho-yin Wong a,b, Edward Wai chi Chan a,b, Sheng Chen a,b,*
a
Shenzhen Key Laboratory for Food Biological Safety Control, Food Safety and Technology Research Centre, The Hong Kong Polytechnic University Shenzhen
Research Institute, Shenzhen, PR China
b
State Key Laboratory of Chirosciences, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University,
Hung Hom, Kowloon, Hong Kong

A R T I C L E I N F O A B S T R A C T

Article history: Pseudomonas spp. are ubiquitous in nature. Carbapenem resistance in environmental isolates of
Received 8 January 2015 members of this genus is thought to be rare but the exact resistance rate is unknown. In this study,
Received in revised form 10 March 2015 carbapenem-resistant Pseudomonas spp. were isolated from chicken and pork samples and the
Accepted 13 March 2015
mechanisms underlying the carbapenem resistance in these strains were investigated. A total of 16
carbapenem-resistant Pseudomonas aeruginosa, Pseudomonas putida and Pseudomonas otitidis isolates
Keywords: were recovered from eight samples of chicken and pork. The isolates exhibited meropenem minimum
Carbapenem
inhibitory concentrations (MICs) of 8 to 32 mg/L and imipenem MICs of <0.5–16 mg/L yet did not
Pseudomonas aeruginosa
Pseudomonas putida
harbour any acquired carbapenemase genes. Meropenem resistance in various strains was found to be
Pseudomonas otitidis mediated by efflux systems only, whereas overexpression of MexAB–OprM efflux pump and lack of OprD
Food porin were responsible for carbapenem resistance in P. aeruginosa. The intrinsic metallo-b-lactamase
gene blaPOM in P. otitidis and overexpression of the TtgABC efflux system in P. putida were also responsible
for carbapenem resistance in these organisms. In conclusion, this study reports for the first time the
isolation of carbapenem-resistant P. aeruginosa, P. otitidis and P. putida strains from food. The resistance
mechanisms of these strains are rarely due to production of carbapenemases. Further selection of such
carbapenem-resistant Pseudomonas spp. in the environment and the risk by which they are transmitted
to clinical settings are of great public health concern.
ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All
rights reserved.

1. Introduction treatment of infections caused by such pathogens exceedingly

Pseudomonas spp. are ubiquitous in the environment, with
Pseudomonas aeruginosa being the most common opportunistic
pathogen in this genus. This organism is a common causative agent
of various opportunistic infections, especially among cystic fibrosis
and burns patients as well as immunocompromised people [1].
Similarly, Pseudomonas putida may cause urinary tract infections in
immunocompromised patients as well as bacteraemia in neonatal
and cancer patients [2,3]. In contrast, Pseudomonas otitidis is a
relatively novel micro-organism identified in 2006 and is
responsible for causing otic infections [4]. Multidrug resistance,
including resistance to b-lactams, fluoroquinolones and amino-
glycosides, is frequently observed among P. aeruginosa [5].
Resistance has also emerged in P. putida and P. otitidis, rendering
* Corresponding author at: State Key Laboratory of Chirosciences, Department of
Applied Biology and Chemical Technology, The Hong Kong Polytechnic University,
Hung Hom, Kowloon, Hong Kong. Tel.: +852 3400 8795; fax: +852 2364 9932.
E-mail address: sheng.chen@polyu.edu.hk (S. Chen).
difficult [2,6].
Carbapenem antimicrobials are considered the last resort for
treatment of infections caused by multidrug-resistant pathogens.
However, carbapenem resistance in different bacterial species is
increasingly common worldwide and has become a major public
health problem. In most cases, bacteria developed carbapenem
resistance by means of taking up exogenous carbapenemase genes;
however, P. aeruginosa is capable of establishing intrinsic
carbapenem resistance through self-regulated physiological
changes instead of acquisition of resistance elements. Common
resistance mechanisms include overexpression of efflux systems
and AmpC b-lactamase as well as mutational inactivation of the
outer membrane protein OprD [7]. It remains to be seen whether
other Pseudomonas spp. possess the ability to become carbapenem-
resistant by such physiological and genetic changes. To date, it is
known that carbapenem resistance in P. putida and P. otitidis,
respectively, is associated with acquisition of metallo-b-lacta-
mases (MBLs) and the production of an intrinsic MBL POM-1,
which to some extent confers carbapenemase activities [3,4].

http://dx.doi.org/10.1016/j.jgar.2015.03.006
2213-7165/ß 2015 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6

2 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx

The incidence of carbapenem resistance in foodborne isolates is
estimated to be low as carbapenems are not used in animal
farming. However, carbapenem-resistant micro-organisms in food
production animals have become detectable recently [8,9].
Dissemination of this category of potential pathogens between
environmental and nosocomial settings is of particular concern.
This study describes the isolation of carbapenem-resistant
Pseudomonas spp. from retail meat products in Hong Kong as
well as an analysis of the genetic and physiological basis of their
resistance phenotypes.
2. Materials and methods
2.1. Bacterial isolation and confirmation
A total of 16 chicken and pork meat samples (8 of each) were
purchased from two different supermarkets on four separate
sampling dates in Hong Kong during the summer of 2011. The
samples were homogenised and enriched in Peptone Water (Oxoid
Ltd., Basingstoke, UK) for 24 h at 37 8C with shaking, followed by
direct spreading on MacConkey agar (Oxoid Ltd.) containing 2 mg/
L meropenem (Santa Cruz Biotech, Dallas, TX). Two colonies were
recovered from each plate and were purified and identified by
API20E (bioMé rieux, Craponne, France) and 16S rRNA sequencing.
Isolates whose 16S rRNA sequencing results were ambiguous were
further subjected to confirmation by the VITEK1 2 system
(bioMérieux). Multilocus sequence typing (MLST) was performed
and interpreted on P. aeruginosa isolates according to the PubMLST
scheme (http://pubmlst.org/paeruginosa/). 16S rRNA sequences of
P. putida isolates were aligned by the ClusterW2 algorithm and a
phylogenetic tree was compiled by the maximum-likelihood
algorithm approach using BioEdit software (http://www.mbio.
ncsu.edu/bioedit/bioedit.html). Pulsed-field gel electrophoresis
(PFGE) was performed as described previously [10]. Briefly,
agarose-embedded DNA was digested with XbaI (New England
Bio-Labs, Ipswich, UK) at 37 8C for 1.5 h. The restriction fragments
were separated by electrophoresis in 0.5 TBE [Tris–borate–
ethylene diamine tetra-acetic acid (EDTA)] buffer at 14 8C for
18 h using a CHEF-DR1 II Electrophoresis System (Bio-Rad,
Hercules, CA) with pulse times of 0.5–30 s. The gels were stained
with GelRedTM (Biotium, Hayward, CA) and DNA bands were
visualised with ultraviolet transillumination (Bio-Rad). Fragment
patterns were interpreted as described previously [11].
2.2. Antimicrobial susceptibility and carbapenemase activity testing
Antimicrobial susceptibility testing was carried out by the agar
dilution method with the antimicrobials listed in Table 1. Results
were interpreted following Clinical and Laboratory Standards
Institute (CLSI) guidelines [12]. Escherichia coli ATCC 25922 and
ATCC 35218 and P. aeruginosa ATCC 27853 were used as quality
control strains. The minimum inhibitory concentrations (MICs) of
the efflux pump inhibitor phenylalanine–arginine b-naphthyla-
mide (PAbN) for the isolates was determined by the broth
microdilution method. Involvement of efflux systems in reduced
carbapenem susceptibility was tested by determining the mer-
openem MIC in the presence and absence of PAbN at a
concentration of 40 mg/mL [13]. The carbapenemase activity of
all isolates was tested by the Modified Hodge test (MHT) against
meropenem and imipenem using E. coli ATCC 25922 as the
indicator organism as described previously [12]. The Carba NP test
was performed on the four P. otitidis isolates as described
previously [14]. A P. aeruginosa clinical strain carrying blaIMP
was used in all tests as a positive control.
2.3. PCR screening and real-time PCR
Carbapenemase genes that can be acquired by horizontal
transfer, including blaIMP, blaVIM, blaOXA, blaSIM, blaKPC, blaSPM,
blaDIM, blaGIM and blaNDM, were screened by PCR as described
previously [15]. The intrinsic MBL blaPOM in P. otitidis was detected
by PCR and the corresponding nucleotide sequence was deter-
mined as described previously [4]. Total RNA was extracted using
an RNeasy Protect Bacteria Mini Kit (QIAGEN, Hilden, Germany),
followed by DNase treatment. The quality and quantity of RNA was
examined using a NanoDrop spectrophotometer (Thermo Fisher
Scientific Inc., Hemel Hempstead, UK). Then, 1 mg of RNA was

Table 1
Isolation source and minimum inhibitory concentrations (MICs) of Pseudomonas spp. isolates in this study.
a b
Strain ID Species Source PFGE type MIC (mg/L)c

PIP FEP CTZ CIP [4] LEV [8] PMB [8] AMK CHL [32] IPM [8] IPM/ MEM [8] MEM/
[128] [32] [32] [64] PAbN PAbN

E1-6 POTI C1 J <8 <2 <4 0.5 <0.1 1 8 8 2 1 16 2

E1-7 POTI C1 K <8 <2 <4 0.5 <0.1 1 8 32 2 2 32 1
E1-8 PPUT P1 A 16 <2 <4 0.5 <0.1 <0.5 8 128 1 <0.5 8 2
E1-9 POTI P1 M <8 <2 <4 0.5 <0.1 1 8 8 2 1 16 2
E1-12 PPUT C2 C 64 4 <4 2 2 1 8 128 1 <0.5 8 4
E1-13 PPUT C2 B2 32 <2 <4 1 2 <0.5 32 64 4 <0.5 16 2
E1-14 PPUT C3 B2 16 <2 <4 0.5 0.5 <0.5 8 64 1 <0.5 8 2
E1-15 PPUT C3 E1 16 <2 <4 1 2 <0.5 8 128 1 <0.5 8 2
E1-16 PPUT P2 B1 16 <2 <4 0.5 <0.1 <0.5 8 128 1 <0.5 8 2
E1-17 PAER P2 – <8 4 <4 0.5 0.5 1 8 64 16 4 16 1
E1-18 PPUT P2 B1 <8 <2 <4 0.5 <0.1 1 8 128 1 <0.5 8 4
E1-19 PPUT P2 B1 16 <2 <4 0.5 <0.1 <0.5 8 64 1 <0.5 8 2
E1-21 PPUT P3 B3 32 <2 <4 0.5 2 <0.5 8 128 1 <0.5 16 0.5
E1-23 PPUT P3 B3 16 <2 <4 0.5 <0.1 <0.5 8 64 1 <0.5 8 0.5
E3-17 PPUT C4 E2 <8 <2 <4 0.5 <0.1 <0.5 8 64 1 <0.5 8 2
E3-19 POTI C5 D <8 <2 <4 0.5 <0.1 1 8 16 1 1 32 2

POTI, Pseudomonas otitidis; PPUT, Pseudomonas putida; PAER, Pseudomonas aeruginosa; PFGE, pulsed-field gel electrophoresis; PIP, piperacillin; FEP, cefepime; CTZ,
ceftazidime; CIP, ciprofloxacin; LEV, levofloxacin; PMB, polymyxin B; AMK, amikacin; CHL, chloramphenicol; IPM, imipenem; PAbN, phenylalanine–arginine
b-naphthylamide; MEM, meropenem.
a
C1–C5, chicken samples 1–5; P1–P3, pork samples 1–3.
b
Fragment patterns differing by six or more bands were regarded as different clones. Each clone is designated with a letter (e.g. A, B, C). Subtypes of each clone (difference
less than six bands) were shown as a letter with a number (e.g. B1, B2).
c
Numbers in brackets represent the Clinical and Laboratory Standards Institute (CLSI) breakpoint of the antimicrobials [12].

Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
G Model
JGAR-146; No. of Pages 6
M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
subjected to reverse transcription using a Life Technologies High
Capacity cDNA Kit (Life Technologies, Grand Island, NY). Quantita-
tive reverse transcription PCR (qRT-PCR) was conducted on an iQ5
iCycler (Bio-Rad) using SYBR Select Master Mix (Life Technologies).
Expression of mexB, mexD, mexE and ampC was normalised with
the rpsL gene using primers described elsewhere and was
compared with P. aeruginosa PAO1 type strain [16]. Expression
of ttgA was normalised with the 16S rRNA gene and was compared
with P. putida ATCC 12633 type strain. Data were analysed by the
comparative CT method [17]. The full length of the oprD gene in P.
aeruginosa and P. putida isolates was amplified by PCR using
primers oprD-F (50 -CGCCGACAAGAAGAATAGC) and oprD-R (50 -
GTCGATTACAGGATCGACAG) for P. aeruginosa, and oprD-PT-FL1
(50 -GTTAGCCGTGTCGATTGCCT) and oprD-PT-FL2 (50 -CGCAGCGG-
TACTCTTCCTA) for P. putida.
2.4. Nucleotide accession
The oprD sequences obtained from this study can be accessed
on GenBank with the following accession nos.: P. aeruginosa E1-17,
KP262046; P. aeruginosa LESB58, CAW29111.1; P. putida ATCC
12633, KP025954; P. putida E1-8, KP025955; and P. putida E1-21,
KP025956.
3. Results and discussion
For this analysis, pork and chicken samples (eight of each) were
purchased from supermarkets in Hong Kong. A total of 16 isolates
were recovered from eight of the sixteen samples. The isolation
rates for chicken and pork were 63% (5/8) and 38% (3/8),
respectively. 16S rRNA sequencing confirmed that these isolates
were P. putida (n = 11), P. otitidis (n = 4) and P. aeruginosa (n = 1)
(Table 1). P. aeruginosa isolate E1-17 was found to be ST1756 by
MLST. This type has not been reported in P. aeruginosa of clinical
origin. Phylogenetic analysis was performed on 16S rRNA
sequences obtained from the 11 P. putida isolates in this study
and was compared with the type strain P. putida ATCC 12633 and P.
putida KT2440 (Fig. 1). It was found that 8 of the 11 isolates showed
99.7–99.9% identity with KT2440 and 99.1–99.2% identity with
ATCC 12633. One isolate (E3-17) had 99.9% identity with ATCC
12633, whereas the two remaining isolates (E1-13 and E1-15)
shared a slightly lower level of identity (97%) with the two P. putida
type strains. These two isolates were confirmed to be P. putida by
VITEK1 2. XbaI-PFGE typing revealed that the P. otitidis isolates
belonged to different clones, whereas seven clones among 11
Fig. 1. 16S rRNA phylogenetic tree depicting the relative genetic relatedness of 11 Pseudomonas putida isolates in this study as well as two P. putida type strains (ATCC 12633
and KT2440).
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
3
P. putida isolates were observable (Table 1). The identical PFGE
patterns (type B1 and B3) may be due to duplicate isolates, except
E1-13 and E1-14 which share the same PFGHE pattern (B2) that
were isolated from independent samples.
Antimicrobial susceptibility testing showed that the isolates
were susceptible to all antimicrobials tested except imipenem and
meropenem; interestingly, all of the tested isolates were resistant
to meropenem (MIC 8 mg/L), yet only P. aeruginosa E1-17 was
resistant to imipenem (MIC = 16 mg/L). The MIC of imipenem for
other isolates ranged from 1 mg/L to 4 mg/L. An MIC 512 mg/L of
the efflux pump inhibitor PAbN for all isolates was observed, and
addition of PAbN abolished the meropenem resistance phenotype
in all isolates with a 2–32-fold reduction in the MIC. Although it is
believed that drug efflux was not the major mechanism of
imipenem resistance, PAbN was found to attenuate imipenem
resistance in P. aeruginosa E1-17 by four-fold (16–4 mg/L). In
contrast, attenuation of imipenem resistance with the efflux pump
inhibitor was not obvious (0–2-fold reduction in MIC) in P. putida
and P. otitidis. These results suggested that efflux systems played a
major role in carbapenem resistance in all Pseudomonas spp.
(Table 1). Production of carbapenemases against meropenem was
tested by the MHT using E. coli ATCC 25922 as the indicator strain,
with the results being negative for all isolates. Consistently, all
isolates were negative in PCR screening of carbapenemase genes.
Expression of multiple efflux systems (mexAB, mexCD and mexEF),
ampC and oprD was tested by qRT-PCR for the P. aeruginosa E1-17
isolate in this study (Fig. 2). Expression of mexB, mexD, mexE and
mexX was found to be 3.08  0.6, 0.53  0.07, 0.83  0.1 and
0.11  0.03-fold that of P. aeruginosa PAO1, respectively. Expression
of ampC in E1-17 was comparable with that of PAO1 (1.21  0.2-fold).
Although it is believed that ampC is a major contributing factor in
carbapenem susceptibility, absence of ampC overexpression in
carbapenem-resistant P. aeruginosa has been reported previously
[18]. Expression of oprD was not detectable in E1-17. The full length
sequence of the oprD gene was obtained by PCR and no inactivation
mutations or insertion sequences were found. BLASTn analysis
revealed that the OprD protein was almost identical (with one amino
acid substitution) to that of P. aeruginosa strain LESB58. Other than non-
functional porin resulting from mutational events, absence of wild-
type OprD expression in carbapenem-resistant P. aeruginosa isolates is
not uncommon. This may be due to a shift of regulatory pathways or
disruption of promoter sequences [19]. Overall, this finding showed
that the carbapenem resistance mechanisms in P. aeruginosa were
mainly due to physiological changes and was consistent with what has
been observed among carbapenem-resistant P. aeruginosa strains
G Model
JGAR-146; No. of Pages 6
4 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 2. Expression levels of mexB, mexD, mexE, mexX and ampC genes in Pseudomonas
aeruginosa E1-17. Data were normalised and compared with those of P. aeruginosa
PAO1 type strain.
isolated in clinical settings [7,20]. Importantly, the isolation of
carbapenem-resistant P. aeruginosa strains in food that exhibited the
same resistance mechanisms as those of clinical origin indicates that
environmental P. aeruginosa strains can also develop such changes,
presumably due to induction and selection pressures exerted by
Fig. 3. Metallo-b-lactamase blaPOM sequences of Pseudomonas otitidis. E1-6, E1-7, E1-9 and E3-19 are P. otitidis isolates collected in this study and MCC10330 is a P. otitidis type
strain.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
antibiotics used in the treatment and growth promotion of food
animals.
The MBL gene blaPOM was detected in all four P. otitidis isolates.
Full-length sequences of the gene were obtained and aligned with
blaPOM-1 of P. otitidis type strain MCC10330 to investigate sequence
variability of the gene. The blaPOM genes were highly conserved in
the four P. otitidis isolates, with only one or two amino acid
differences compared with MCC10330 (Fig. 3). There was no
correlation between blaPOM amino acid substitutions and carba-
penem susceptibility, and the mutations found in these isolates
were not previously identified. It has been described that P. otitidis
constitutively expresses its intrinsic MBL, yet such expression had
no clear correlation with carbapenem susceptibility of the host
strain [4]. In this study, the carbapenem-hydrolysing activity of
blaPOM was evaluated by MHT and Carba NP test. Hydrolysis of
imipenem was observed in all P. otitidis isolates in a slower fashion
compared with a P. aeruginosa strain carrying blaIMP, although the
MHT produced a negative result, which may be attributed to the
low sensitivity of the assay. Furthermore, addition of PAbN was
capable of reducing the meropenem MIC. The results suggested
that the major contributors to carbapenem resistance in P. otitidis
may be both efflux systems and MBL blaPOM.
Carbapenem-resistant clinical P. putida strains have been
previously identified and characterised. The MIC for meropenem
G Model
JGAR-146; No. of Pages 6
M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
Fig. 4. Expression level of the ttgA gene of Pseudomonas putida E1-21 and E1-8. Data
were normalised by comparison with the P. putida ATCC 12633 type strain.
in these isolates can reach as high as 256 mg/L [2]. The underlying
mechanism of such resistance is mainly due to acquisition of
exogenous carbapenemase genes, including blaIMP and blaVIM [21].
The P. putida isolates in this study did not contain any external
carbapenemase genes, and addition of PAbN was able to suppress
the meropenem MIC by 2–32-fold. Efflux systems in P. putida that
cause carbapenem resistance have not been identified previously.
Nevertheless, a multidrug resistance–nodulation–cell division
(RND)-type efflux system (TtgABC) has been shown to reduce
susceptibility to chloramphenicol and meropenem [22,23] Expres-
sion of ttgA in two randomly selected P. putida isolates (E1-8 and
E1-21) was compared with that of P. putida ATCC 12633. The result
Fig. 5. Alignment of OprD amino acid sequences of four Pseudomonas putida isolates. E1-8 and E1-21 are P. putida food isolates collected in this study and ATCC 12633 and
KT2440 are P. putida type strains.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
5
showed that both isolates exhibited an ca. 500–2000-fold over-
expression of TtgA (E1-21, 444.67  64.92 and E1-8,
1942.13  345.31) suggesting that, in addition to other antimicro-
bials, this pump may also be able to extrude carbapenems (Fig. 4). A
previous study suggested that oprD in P. putida may also play a role in
reducing carbapenem susceptibility via mechanisms similar to those
observable in P. aeruginosa [7]. Examination of the oprD expression
level by qRT-PCR produced negative results owing to sequence
variation between the test strains and the control strain. Full-length
sequencing of oprD of E1-8 and E1-21 revealed that the sequences were
different from that of ATCC 12633. OprD amino acid sequences of E1-8
and E1-21 share 99% identity with another P. putida type strain KT2440,
yet only 83% homology with P. putida ATCC 12633 (Fig. 5). These
findings corroborate with the result of 16S rRNA sequence analysis [24].
The diversity of oprD sequences in P. putida has been described, but a
clear correlation between this phenomenon and imipenem suscepti-
bility could not be established [25]. As we were not able to perform
expression analysis owing to the lack of P. putida type strain KT2440,
the actual role of oprD in P. putida remains unclear.
It has been suggested that the use of antimicrobials as growth
promoters in animal farming would lead to selection of resistant
bacteria. However, carbapenems are not adopted in farming
practices. The isolation of carbapenem-resistant Pseudomonas spp.
from food indicates that members of this genus are able to become
resistant to carbapenems even in an environment with little
carbapenem selective pressure. One possible explanation is that
application of antimicrobials in farming would result in selection
of bacteria that are prone to develop cross-resistance, particularly
in Pseudomonas spp. in which carbapenem resistance is usually
attributable to self-induced physiological changes. Nevertheless,
the actual process by which such organisms are selected needs to
be determined.
G Model
JGAR-146; No. of Pages 6
6 M..-. Wong et al. / Journal of Global Antimicrobial Resistance xxx (2015) xxx–xxx
4. Conclusion
This study reports for the first time the isolation of carbapenem-
resistant P. aeruginosa, P. otitidis and P. putida from food. Further
selection and potential transmission of such organisms into
clinical settings may lead to the emergence of multidrug/pandrug
resistance, which may pose a serious public health threat.
Contributions
Marcus Ho Yin Wong contributed for conception and design of
study, acquisition of laboratory data, analysis of data, drafting the
manuscript, and final approval of manuscript. Edward Wai chi
Chan contributed for conception and design of study, analysis of
data, drafting the manuscript and final approval of manuscript.
Sheng Chen contributed for conception and design of study,
analysis of data, critical revision, and final approval of manuscript.
Funding
This work was supported by the Chinese National Key Basic
Research and Development (973) Program [2013CB127200] and
the Health and Medical Research Fund of the Food and Health
Bureau, Government of Hong Kong [12111612 to SC].
Conflict of interests
None declared.
Ethical approval
Not required.
References
[1] Morita Y, Tomida J, Kawamura Y. Responses of Pseudomonas aeruginosa to
antimicrobials. Front Microbiol 2014;4:422.
[2] Kumita W, Saito R, Sato K, Ode T, Moriya K, Koike K, et al. Molecular
characterizations of carbapenem and ciprofloxacin resistance in clinical iso-
lates of Pseudomonas putida. J Infect Chemother 2009;15:6–12.
[3] Horii T, Muramatsu H, Iinuma Y. Mechanisms of resistance to fluoroquinolones
and carbapenems in Pseudomonas putida. J Antimicrob Chemother
2005;56:643–7.
[4] Thaller MC, Borgianni L, Di Lallo G, Chong Y, Lee K, Dajcs J, et al. Metallo-b-
lactamase production by Pseudomonas otitidis: a species-related trait. Anti-
microb Agents Chemother 2011;55:118–23.
[5] Pai H, Kim J, Kim J, Lee JH, Choe KW, Gotoh N. Carbapenem resistance
mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents
Chemother 2001;45:480–4.
[6] Lee K, Kim CK, Yong D, Yum JH, Chung MH, Chong Y, et al. POM-1 metallo-b-
lactamase-producing Pseudomonas otitidis isolate from a patient with chronic
otitis media. Diagn Microbiol Infect Dis 2012;72:295–6.
Please cite this article in press as: Wong M-, et al. Isolation of carbapenem-resistant Pseudomonas spp. from food. J Global Antimicrob
Resist (2015), http://dx.doi.org/10.1016/j.jgar.2015.03.006
[7] Rodrı́guez-Martı́nez JM, Poirel L, Nordmann P. Molecular epidemiology and
mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob
Agents Chemother 2009;53:4783–8.
[8] Woodford N, Wareham DW, Guerra B, Teale C. Carbapenemase-producing
Enterobacteriaceae and non-Enterobacteriaceae from animals and the envi-
ronment: an emerging public health risk of our own making? J Antimicrob
Chemother 2014;69:287–91.
[9] Rubin JE, Ekanayake S, Fernando C. Carbapenemase-producing organism in
food, 2014. Emerg Infect Dis 2014;20:1264–5.
[10] Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al. blaVIM-2 cassette-
containing novel integrons in metallo-b-lactamase-producing Pseudomonas
aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital.
Antimicrob Agents Chemother 2002;46:1053–8.
[11] Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al.
Interpreting chromosomal DNA restriction patterns produced by pulsed-field
gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol
1995;33:2233–9.
[12] Clinical and Laboratory Standards Institute. Performance standards for
antimicrobial susceptibility testing; twenty-third informational supplement.
Document M100-S23. Wayne, PA: CLSI; 2013.
[13] Szabó D, Silveira F, Hujer AM, Bonomo RA, Hujer KM, Marsh JW, et al. Outer
membrane protein changes and efflux pump expression together may confer
resistance to ertapenem in Enterobacter cloacae. Antimicrob Agents Che-
mother 2006;50:2833–5.
[14] Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing
Enterobacteriaceae. Emerg Infect Dis 2012;18:1503–7.
[15] Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection
of acquired carbapenemase genes. Diagn Microbiol Infect Dis 2011;70:
119–23.
[16] Dumas JL, van Delden C, Perron K, Kohler T. Analysis of antibiotic resistance
gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR.
FEMS Microbiol Lett 2006;254:217–25.
[17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
DD
real-time quantitative PCR and the 2 CT method. Methods 2001;25:
402–8.
[18] Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD
expression in carbapenem resistance of Pseudomonas aeruginosa clinical
isolates. Antimicrob Agents Chemother 2006;50:1633–41.
[19] Fournier D, Richardot C, Müller E, Robert-Nicoud M, Llanes C, Plésiat P, et al.
Complexity of resistance mechanisms to imipenem in intensive care
unit strains of Pseudomonas aeruginosa. J Antimicrob Chemother 2013;68:
1772–80.
[20] Hammami S, Ghozzi R, Burghoffer B, Arlet G, Redjeb S. Mechanisms of
carbapenem resistance in non-metallo-b-lactamase-producing clinical iso-
lates of Pseudomonas aeruginosa from a Tunisian hospital. Pathol Biol (Paris)
2009;57:530–5.
[21] Treviño M, Moldes L, Hernández M, Martı́nez-Lamas L, Garcı́a-Riestra C,
Regueiro BJ. Nosocomial infection by VIM-2 metallo-b-lactamase-producing
Pseudomonas putida. J Med Microbiol 2010;59:853–5.
[22] Martı́nez-Garcı́a E, de Lorenzo V. Engineering multiple genomic deletions in
Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of
Pseudomonas putida KT2440. Environ Microbiol 2011;13:2702–16.
[23] Fernández M, Conde S, de la Torre J, Molina-Santiago C, Ramos JL, Duque E.
Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440.
Antimicrob Agents Chemother 2012;56:1001–9.
[24] Nelson KE, Weinel C, Paulsen IT, Dodson RJ, Hilbert H, Martins dos Santos VA,
et al. Complete genome sequence and comparative analysis of the metaboli-
cally versatile Pseudomonas putida KT2440. Environ Microbiol 2002;4:799–
808.
[25] Chevalier S, Bodilis J, Jaouen T, Barray S, Feuilloley MG, Orange N. Sequence
diversity of the OprD protein of environmental Pseudomonas strains. Environ
Microbiol 2007;9:824–35.