Journal of Biotechnology 174 (2014) 1–6

Contents lists available at ScienceDirect

Journal of Biotechnology
journal homepage: www.elsevier.com/locate/jbiotec

Enhancing expression of the classical swine fever virus glycoprotein

E2 in yeast and its application to a blocking ELISA
Chih-Yuan Cheng a,1 , Ching-Wei Wu a,1 , Guang-Jan Lin a , Wei-Cheng Lee b ,
Maw-Sheng Chien b,∗∗ , Chienjin Huang a,∗
a
Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road,
Taichung 40227, Taiwan, ROC
b
Graduate Institute of Veterinary Pathobiology, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227,
Taiwan, ROC

a r t i c l e i n f o a b s t r a c t

Article history: Classical swine fever virus (CSFV) infection is a severe swine disease, often causing large economic losses.
Received 15 November 2013 A Pichia pastoris yeast-expressed CSFV glycoprotein E2 (yE2) has been shown to induce a protective
Received in revised form immune response against the virus. To improve the expression level of yE2, the first codon of E2 gene,
20 December 2013
Arg (CGG), which is the least used in P. pastoris, was optimized to the most favorite codon AGA. The
Accepted 8 January 2014
yield of E2 protein was remarkably increased in the codon optimized strain (N342). Three truncated E2
Available online 24 January 2014
subunits encoding the N-terminal 330 (N330), 301 (N301), and 190 (N190) residues, respectively, were
also constructed. The immunogenicity of each recombinant E2 subunits was confirmed by immunization
Keywords:
Classical swine fever virus
of pigs, and all immunized groups demonstrated high neutralizing antibody titers after boost immu-
Subunit marker vaccine nization, which lasted for a long period of time. In addition, a monoclonal antibody (MAb), 1B6, specific
Codon optimization to yE2, was generated and shown to recognize CSFV-infected cells. A panel of swine sera were tested
Monoclonal antibody by peroxidase-conjugated MAb 1B6-based blocking enzyme-linked immunosorbent assay (ELISA) using
Blocking ELISA N330 as coated antigen, and the assay demonstrated high sensitivity and specificity. The recombinant
yE2 subunits may provide potential subunit vaccine candidates and useful diagnostic reagents for CSFV
with easy manipulation and low cost.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction
Classical swine fever virus (CSFV) is a small enveloped virus
belonging to the genus Pestivirus of the Flaviviridae family
(Lindenbach et al., 2007). CSFV infection results in a highly conta-
gious and severe disease characterized by fever (CSF), often causing
large economic losses in the pig industry worldwide. The CSFV
genome is a positive sense single-stranded RNA comprising a single,
long, open-reading-frame (ORF) that encodes a polyprotein. This
polyprotein is co- and post-translationlly processed by cellular and
viral protease to yield all final viral proteins. Structural proteins
include a nucleocapsid protein C and three envelope glycoproteins,
Erns , E1, and E2 (Rümenapf et al., 1993).
The glycoprotein E2 represents the most significant target for
inducing the production of neutralizing antibodies in the host, and
∗ Corresponding author. Tel.: +886 4 22853906; fax: +886 4 22851741.
∗∗ Co-corresponding author. Tel.: +886 4 22851940.
E-mail addresses: mschien@dragon.nchu.edu.tw (M.-S. Chien),
cjhuang@dragon.nchu.edu.tw, jin827.huang@gmail.com (C. Huang).
1
These authors contributed equally to the article.
can also protect pigs against CSF in different ways (Bouma et al.,
2000; Dong and Chen, 2007; Hulst et al., 1993). Currently, commer-
cially available CSF E2 subunit vaccines have been developed using
the baculovirus expression system (Bouma et al., 1999; de Smit
et al., 2001; Moormann et al., 2000), but the required insect cell cul-
ture is costly and the purification procedures are time consuming.
Recently, we constructed a recombinant E2 protein using the yeast
Pichia pastoris secreted expression system. This yeast-expressed E2
(yE2) could induce a protective immune response against lethal
challenge infection (Lin et al., 2012, 2009). The advantages of this
eukaryotic expression system include simple manipulation, easy
purification, and less cost (Cereghino and Cregg, 2000). However,
several genetic and physiological factors determine the productiv-
ity of a recombinant system (Hohenblum et al., 2003). Synonymous
codon usage bias differences, one major factor among others, sig-
nificantly affects heterologous gene expression (Sinclair and Choy,
2002; Su et al., 2007). To improve the expression yield of yE2, the
first codon CGG (Arg) of the E2 gene, which is the least used in P.
pastoris, was optimized to the most favorite codon AGA, and sev-
eral truncated mutants were also constructed and evaluated for
their immunogenicities in pigs. The expressed E2 recombinant pro-
tein was further utilized as an antigen to generate a monoclonal

0168-1656/$ – see front matter © 2014 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.jbiotec.2014.01.007
2 C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6
Table 1
Sequences of oligonucleotides used for cloning the defined coding region of the CSFV
E2 protein.
Oligonucleotide Sequence in 5 –3 directiona Restriction site
yE2N1F TTATCGATTAGACTAGCCTGCAAGG ClaI
yE2N190F GTATCGATTAGACTAGCCTGCAAG ClaI
yE2N342R CGCTCTAGAAATTCTGCGAAGTAAT XbaI
yE2N330R CGCTCTAGATCCAGGTCAAACCAGT XbaI
yE2N301R CGCTCTAGAGTTTTTGCGTAATTGA XbaI
yE2N190R CGGAATTCTTTCACACATGTCCAG EcoRI
a
The sequences recognized by the restriction enzyme are boxed and the first
codon of the E2 gene was optimized to AGA and is underlined.
antibody specific to CSFV E2 and establish a blocking ELISA for
detecting swine antibodies against E2.
2. Materials and methods
2.1. Construction of recombinant expression plasmids
Plasmid pGAPZ␣C/E2dc containing the CSFV E2 gene encod-
ing the amino acid (a.a.) residues 1–342 without the C-terminal
transmembrane region of vaccine LPC strain was constructed
previously (Lin et al., 2009). The defined coding region corre-
sponding to the a.a. residues 1–342, 1–330, 1–301, and 1–190
of E2 was amplified by polymerase chain reaction (PCR) using
the specific primer pair yE2N1F/yE2N342R, yE2N1F/yE2N330R,
yE2N1F/yE2N301R, and yE2N190F/yE2N190R, with the first argi-
nine codon changed to AGA, respectively (Table 1). The PCR reaction
was carried out as described previously (Lin et al., 2009). The
amplified E2 gene fragment was gel-purified and then treated with
appropriate restriction enzymes for cloning into the yeast expres-
sion vector pGAPZ␣C (Invitrogen) to construct the expression
plasmid pGAPZ␣C/E2N342, pGAPZ␣C/E2N330, pGAPZ␣C/E2N301,
and pGAPZ␣C/E2N190, respectively. The recombinant E2 proteins
were expressed as fusion to a C-terminal peptide containing the
myc epitope and a polyhistidine tag. The accuracy of the ORF of the
E2 coding sequences was confirmed by DNA sequencing.
2.2. Expression of E2 protein in Pichia pastoris
Recombinant expression plasmids were transformed into P. pas-
toris SMD1168 competent cells using a Pichia EasyCompTM Kit
(Invitrogen) according to the manufacturer’s instructions. Trans-
formed cells were then plated onto yeast extract peptone dextrose
(YPD; 1% yeast extract, 2% peptone, 2% glucose) agar containing
100 ␮g/ml Zeocin (Invitrogen) and incubated at 30 ◦ C for 2–3 days
until single colonies were formed. A single colony of recombinant
yeast was inoculated in 5 ml YPD medium and incubated at 30 ◦ C
in a shaking incubator (250 rpm) overnight. Then 0.1 ml of the
overnight culture was transferred to 50 ml fresh YPD medium in
a 250 ml baffled flask and continuously incubated for 4 days. The
supernatants were clarified by centrifugation (20 min, 12,000 × g,
4 ◦ C) and the secreted protein was concentrated by ultrafiltration
using Centricon YM-10 or 30 (Millipore) filter devices, followed
by dialysis against phosphate-buffered saline (PBS). The protein
concentration was determined by a Bradford protein assay kit
(Bio-Rad).
2.3. Western blotting analysis
Yeast-secreted proteins were treated in equal volumes of the
unreduced 2× sample buffer (125 mM Tris–Cl [pH 6.8], 20% glyc-
erol, 4% SDS, 0.25% bromophenol blue). Proteins were separated
by 12% sodium dodecyl sulfate-polyacrylamide gel electrophore-
sis (SDS-PAGE) and transferred by electroblotting onto PolyScreen
PVDF transfer membrane (NEN) using semi-dry transfer cell (Bio-
Rad) according to the manufacturer’s instruction. The membrane
was then treated sequentially with blocking solution (PBS contain-
ing 5% non-fat skim milk), with 1000-fold dilution of monoclonal
antibody (MAb) WH303 specific to CSFV E2 (Veterinary Laboratory
Agency), and 5000-fold dilution of anti-mouse IgG goat antibody
conjugated to horseradish peroxidase (Zymed). Finally, the mem-
brane was soaked in a chromogen/substrate solution (TMB single
solution, Zymed) for color development.
2.4. Immunization of pigs
Fifteen 6-week-old specific-pathogen-free (SPF) piglets were
randomly allotted to four E2 subunit immunized groups and a
control group (n = 3 for each group). Each piglet was immunized
intramuscularly into the neck region with one dose of vaccine twice
at 3-week intervals. Each dose of vaccine contained 300 ␮g total
secreted proteins of each expressed E2 variants, including the N342,
N330, N301, and N190 groups or normal saline (the control group)
in a 1:1 water-in-oil emulsion with the adjuvant ISA563 (SEPPIC).
2.5. Serological examination
Serum blood samples were collected from each pig before vacci-
nation and at biweekly intervals after vaccination. Serum samples
were tested for CSFV E2-specific antibodies with a commercial
E2 blocking ELISA (HerdChek CSFV Antibody Test Kit, IDEXX Lab-
oratories) according to the manufacturer’s instruction. The CSFV
neutralizing antibody titers in serum were determined by the
serum neutralization test as described previously (Lin et al., 2009).
Replicates of two-fold dilutions of heat-inactivated (30 min, 56 ◦ C)
serum samples (50 ␮l) were mixed with 200 TCID50 CSFV LPC strain
(50 ␮l) in a microtitration plate, and incubated at 37 ◦ C for 1 h.
After adding 1 × 104 PK-15 cells (100 ␮l) and incubating at 37 ◦ C
for 72 h, the cells were subjected to immunofluorescence staining
with the MAb WH303. Neutralizing antibody titers were presented
as the reciprocal of the highest dilution that completely inhibited
replication of the virus.
2.6. Preparation of the monoclonal antibody against E2
Five 6-week-old female BALB/c mice were immunized subcuta-
neously with 100 ␮l of a mixture of 50 ␮g purified N342 and an
equal volume of Freund’s complete adjuvant (Sigma). A similar
immunization was given 2 weeks later using Freund’s incom-
plete adjuvant. After an additional 3 weeks, the immunized mice
intraperitoneally received a final booster with 200 ␮l of 30 ␮g puri-
fied N342 without adjuvant. The fusion was carried out 5 days later
according to the methods described previously (Huang et al., 1994).
The hybridoma secreting specific antibody to E2 was selected
by ELISA and further characterized by indirect immunofluores-
cence (IIF) analysis with CSFV-infected PK-15 cells (ATCC-CCL33)
as described previously (Wu et al., 2013). The subclass of the MAb
was determined by Mouse MonoAb-ID kit (Zymed).
2.7. Preparation of horseradish peroxidase (HRP) linked MAb
against E2 conjugate
The MAb was purified by the Protein A/G affinity column (Pierce)
followed by conjugating with HRP using SureLINKTM Activated HRP
(KPL) according to the manufacturer’s instruction.
2.8. Blocking ELISA for detecting antibody against E2
ELISA plates (Corning) were coated at 4 ◦ C overnight with 50 ␮l
of 1 ␮g/ml purified N330 in coating buffer (carbonate buffer, pH
 C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6 3

Fig. 1. Schematic diagram of the expressed coding regions of E2 recombinant subunits. Bars represent expressed coding sequences. The amino acid residue numbers at both
termini and the first codon for arginine are indicated. Potential glycosylation sites are indicated by an asterisk, and the epitope recognized by the MAb WH303 is indicated
by a gray box. The conformational antigenic domains B ± C and D ± A characterized by van Rijn et al. (1994) are also showed.

9.6). The plate was then thoroughly washed with PBS contain-
ing 0.05% Tween-20 (PBST) and blocked with PBS containing 3%
bovine serum albumin (BSA) 37 ◦ C for 1 h. After washing, each well
received 50 ␮l of 2-fold dilution of tested swine serum in dilu-
tion buffer (PBS containing 1% BSA) and was incubated at 37 ◦ C for
1 h. Subsequently, the plate was thoroughly washed with PBST and
each well received 50 ␮l of 500-fold dilution of HRP-MAb anti-E2
conjugate in dilution buffer at 37 ◦ C for 45 min. Finally, the plate
was washed with PBST three times and PBS twice. Then, 100 ␮l of
freshly prepared chromogen/substrate solution (ABTS single solu-
tion, Zymed) was added into each well and the plate was incubated
at room temperature for 15 min. The optical density (OD) of each
well was read at 405 nm using a microplate reader (MRXII, Dynex).
Each sample was analyzed in duplicate, and the mean OD value
of each tested sample (ODTEST ) and that of the negative control
(ODNEG ) were calculated. The inhibition percentage of each sample
was calculated according to the following formula:
ODNEG − ODTEST
Blocking % = × 100
ODNEG
3. Results
3.1. Expression of CSFV E2 protein variants in Pichia pastoris
Various coding regions of the CSFV E2 gene with the first argi-
nine codon optimized to AGA were introduced into the genome of
the yeast P. pastoris using recombinant expression plasmids, includ-
ing pGAPZ␣C/E2N342, pGAPZ␣C/E2N330, pGAPZ␣C/E2N301, and
pGAPZ␣C/E2N190 for expressing different E2 recombinant pro-
teins. The yeast ␣-factor signal sequence efficiently channels into
a secretion pathway. Schematic diagrams of N342, N330, N301,
and N190 are shown in Fig. 1. Expressed recombinant E2 pro-
teins were analyzed by Western blotting analysis with MAb,
WH303, specific to E2 (Fig. 2A) N342 and N330 could form
homodimers about 110 kDa in size while N301 and N190 pre-
dominantly exhibited monomers about 52 and 43 kDa in size,
respectively. The expression level of N342 was further compared
with yE2 at 24 h-interval for 4 days. Remarkable increases of
yield in N342 were revealed during the entire expression course
(Fig. 2B).
3.2. Immunization of pigs
To evaluate the immunogenicity of various E2 recombinant
proteins, three 6-week-old SPF piglets of each group were immu-
nized intramuscularly with 300 ␮g of each total secreted protein.
All recombinant E2-immunized pigs showed strong antibody
responses and seroconverted to CSFV-E2-specific antibody after
booster vaccination, as determined by a commercial E2-blocking
ELISA test (40%), while no antibody was detected in the control
pigs (Fig. 3A) All of the N342, N330, N301, and N190 groups could
mount anamnestic responses following booster vaccination with
average neutralizing antibody titers of 1:1789, 1:1448, 1:1708, and

Fig. 2. Characterization of recombinant E2 proteins by Western blotting analysis. The culture supernatant of each recombinant E2 proteins including N190, N301, N330 and
N342 were harvested at 96 h (A). For comparison of the expression levels between the yE2 and codon optimized strain (N342), the culture supernatants of N342 and yE2
were harvested at 24 h, 48 h, 72 h, and 96 h, respectively (B). The expressed E2 proteins were separated by 12% SDS-PAGE in the absence of ␤-mercaptoethanol followed by
Western blotting analysis with the monoclonal antibody (WH303) specific to E2. The expected E2 protein is indicated by an arrow.
4 C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

Fig. 3. Time course of ELISA antibody development (A) and neutralizing antibody
(B) of variant E2 recombinant proteins immunized pigs after vaccination. All of the
pigs received a booster immunization (↓) at 3 weeks post-immunization.
1:2572, respectively that lasted for at least 12 weeks with titers
above the protective titer of 1:32 (Fig. 3B).
3.3. Preparation of MAb specific to the CSFV E2
A stable hybridoma secreting antibody reacting specifically with
CSFV-infected cells in IIF (Fig. 4A) and yE2 subunits in Western blot-
ting analysis (Fig. 4B) was selected and cloned. This MAb, 1B6, was
determined to be the IgG1 subclass type, and also demonstrated
neutralizing antibody activity to all three different genotypes
of CSFV infection, including strain LPC, 96TD and 94.4, in the
neutralization assay (data not shown). The MAb was purified
and then coupled with HRP to generate the HRP-anti-E2 (1B6)
conjugate.
Fig. 5. Reactivities of swine sera to yE2 (N330) in the blocking ELISA (A) and the
comparison to a commercial ELISA kit (B).
3.4. Development of a blocking ELISA for detecting antibody
against E2
The optimal concentration of antigen coated on the plate was
determined by checkerboard titration. The best positive/negative
(P/N) ratio was obtained when the N330 was diluted at a concen-
tration of 1 ␮g/ml, the tested swine serum was diluted at 1:2, and
the HRP-anti-E2 (1B6) conjugate was diluted at 1:500 (data not
shown). A panel of swine serum samples collected from the Ani-
mal Disease Diagnostic Center, National Chung Hsing University
(NCHU) were determined by the commercial E2 blocking ELISA kit
(IDEXX). Fifty-two sera were tested by N330 and MAb 1B6-based
blocking ELISA and the results expressed as blocking % are shown in
Fig. 5A The blocking percentages of 17 negative sera ranged from
16.8% to 33.1% with an average of 23.9%, while 35 positive sera
ranged from 43.3% to 69.9% with an average of 60%. When the block-
ing percentage cut-off value was set at 40%, 17 negative sera were

Fig. 4. Characterization of the specificity of the MAb 1B6 by IIF (A) and Western blotting analysis (B). (A) Normal (PK-15) or CSFV-infected PK-15 (CSFV/PK-15) cells were
subjected to immunofluorescence staining with the MAb 1B6. (B) Yeast-expressed E2 subunit N190 (lane 1) and N330 (lane 2), and the wild-type yeast-secreted protein
(lane 3) were separated by 12% SDS-PAGE followed by Western blotting analysis with 1B6.
 C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6
determined as negative and resulted in a specificity of 100%, and
all the positive sera were positive with the corresponding sensi-
tivities of 100%. When the cut-off value was set more restricted
at 45% or 50%, the sensitivities were slightly decreased to 94.3%
(33/35) and 91.4% (32/35), respectively. A correlation coefficient
between our established blocking ELISA (NCHU) and the commer-
cial ELISA kit (IDEXX) was determined using the other 40 selected
serum samples with even distribution of blocking percentages
determined by IDEXX ELISA. A regression line was plotted between
the blocking percentages of the corresponding serum sample using
Microsoft Excel. High correlation (R = 0.9250) between two ELISAs
was demonstrated as shown in Fig. 5B.
4. Discussion
The yeast P. pastoris has been used as an efficient system for
recombinant protein production (Cereghino and Cregg, 2000). Sev-
eral factors such as gene dosage, promoter activity, codon usage of
the expressed gene, and protein processing and folding may influ-
ence the expression levels of heterologous proteins (Hohenblum
et al., 2004; Outchkourov et al., 2002). Low yield of human endo-
statin in P. pastoris has been attributed to translational inefficiencies
and synonymous codon usage bias which is the more probable
cause of the translational barriers (Sinclair and Choy, 2002; Su et al.,
2007). According to Zhang et al. (1991), there are eight low-usage
codons including AGG (Arg), CGA (Arg), CGG (Arg), CGC (Arg), CCG
(Pro), CUC (Leu), and GCG (Ala) in yeast. Among those synonymous
codons for Arg, CGG is the least-used (2%), while AGA is the most
favored (54%). Few codons of the CSFV E2 gene are low-usage in
yeast, though it was successfully expressed in our previous study
(Lin et al., 2009). To improve the yield of yE2, the first codon (CGG)
of E2 gene was optimized to AGA, and shorter coding regions were
also constructed. The expression level of yE2 increased remark-
ably after the first codon changed (Fig. 2B), while all the truncated
subunits demonstrated higher yields especially for N330 (Fig. 2A).
Successful translation passed the first codon of the heterologous
gene with high frequency and certainly circumvented the bottle-
neck of the P. pastoris expression system. More rare-usage codons
of E2 have now been altered and the expression levels are currently
under study.
The yeast-expressed E2 (yE2) is capable of inducing a complete
protective immune response and preventing horizontal transmis-
sion of CSFV, and appears to be a potential subunit marker vaccine
(Lin et al., 2012). The immunogenicity of each truncated yE2 recom-
binant proteins was evaluated by the immunization of pigs. All
of the recombinant yE2 subunit-immunized pigs, including N342,
N330, N301 and N190 groups, could mount anamnestic responses
following booster immunization with high neutralizing antibody
titers of an average above 1:1448 (Fig. 3B), that reveals much higher
efficacy than yE2-induced averaged neutralizing titer of 1:132 in
the previous study (Lin et al., 2009). A quantitative assay for CSFV
E2 glycoprotein is currently under construction. In addition, N301
and N190 are present predominantly monomer forms (Fig. 2A),
suggesting C-terminal truncation hampers formation of E2 homod-
imer, and the region of a.a. residues 302–330 is indispensible for
dimerization. Moreover, the N-terminal 190 residues, which con-
sist of major conformational antigenic domains, B ± C and D ± A,
(van Rijn et al., 1994) retain correct immunogenicity that is capa-
ble of inducing a high neutralizing antibody response. Therefore,
those recombinant yE2 subunits represent a potential subunit E2
marker vaccine candidate with advantages of easy manipulation
and low cost.
CSF is an economically important swine disease that has
received widespread attention. Detecting antibodies to Erns and
E2 in swine serum provides a direct measure of the immune
5
status of animals that have been vaccinated or CSFV infected (König
et al., 1995; Weiland et al., 1992). Currently, commercially available
diagnostic ELISA kits mostly use baculovirus-expressed recombi-
nant E2 or Erns as ELISA antigens (Moormann et al., 2000; Windisch
et al., 1996). However, the cost of insect cell culture and time-
consumption to purify the expressed product are major concerns. A
more economical yeast-expressed Erns (yErns )-based indirect sand-
wich ELISA was developed in a previous study and demonstrates
high sensitivity and specificity (Wu et al., 2011). In the present
study, a MAb specific to E2 (1B6)- and yE2 subunit (N330)-based
blocking ELISA was established. This assay demonstrates a high sen-
sitivity and specificity, and high correlation with a commercial CSFV
E2 blocking ELISA kit. It may offer a useful and inexpensive method
for routine diagnosis of swine antibody to E2.
Conflict of interest
None declared.
Acknowledgement
This work was supported in part by grant NSC101-2313-B-005-
012-MY3 from the National Science Council, Taiwan, Republic of
China.
References
Bouma, A., de Smit, A.J., de Kluijver, E.P., Terpstra, C., Moormann, R.J.M., 1999. Efficacy
and stability of a subunit vaccine based on glycoprotein E2 of classical swine
fever virus. Vet. Microbiol. 66, 101–114.
Bouma, A., De Smit, A.J., De Jong, M.C.M., De Kluijver, E.P., Moormann, R.J.M., 2000.
Determination of the onset of the herd-immunity induced by the E2 sub-unit
vaccine against classical swine fever virus. Vaccine 18, 1374–1381.
Cereghino, J.L., Cregg, J.M., 2000. Heterologous protein expression in the methy-
lotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24, 45–66.
de Smit, A.J., Bouma, A., de Kluijver, E.P., Terpstra, C., Moormann, R.J.M., 2001. Dura-
tion of the protection of an E2 subunit marker vaccine against classical swine
fever after a single vaccination. Vet. Microbiol. 78, 307–317.
Dong, X.N., Chen, Y.H., 2007. Marker vaccine strategies and candidate CSFV marker
vaccines. Vaccine 25, 205–230.
Hohenblum, H., Borth, N., Mattanovich, D., 2003. Assessing viability and cell-
associated product of recombinant protein producing Pichia pastoris with flow
cytometry. J. Biotechnol. 102, 281–290.
Hohenblum, H., Gasser, B., Maurer, M., Borth, N., Mattanovich, D., 2004. Effects of
gene dosage, promoters, and substrates on unfolded protein stress of recombi-
nant Pichia pastoris. Biotechnol. Bioeng. 85, 367–375.
Huang, C., Chien, M.S., Landolt, M., Winton, J., 1994. Characterizatrion of the infec-
tious hematopoietic necrosis virus glycoprotein using neutralizing monoclonal
antibodies. Dis. Aquat. Org. 18, 29–35.
Hulst, M.M., Westra, D.F., Wensvoort, G., Moormann, R.J.M., 1993. Glycoprotein E1
of hog cholera virus expressed in insect cells protects swine from hog cholera.
J. Virol. 67, 5435–5442.
König, M., Lengsfeld, T., Pauly, T., Stark, R., Thiel, H.J., 1995. Classical swine fever virus
independent induction of protective immunity by two structural glycoproteins.
J. Virol. 69, 6479–6486.
Lindenbach, B.D., Thiel, H.J., Rice, C.M., 2007. Flaviviridae: the viruses and their repli-
cation. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology. , 5th ed. Lippincott
Williams & Wilkins, Philadelphia, pp. 1101–1152.
Lin, G.J., Liu, T.Y., Tseng, Y.Y., Chen, Z.W., You, C.C., Hsuan, S.L., Chien, M.S., Huang,
C., 2009. Yeast expressed classical swine fever virus glycoprotein E2 induces a
protective immune response. Vet. Microbiol. 139, 369–374.
Lin, G.J., Deng, M.C., Chen, Z.W., Liu, T.Y., Wu, C.W., Cheng, C.Y., Chien, M.S., Huang,
C., 2012. Yeast expressed classical swine fever E2 subunit vaccine candidate
provides complete protection against lethal challenge infection and prevents
horizontal virus transmission. Vaccine 30, 2336–2341.
Moormann, R.J.M., Bouma, A., Kramps, J.A., Terpstra, C., De Smit, H.J., 2000. Devel-
opment of a classical swine fever subunit marker vaccine and companion
diagnostic test. Vet. Microbiol. 73, 209–219.
Outchkourov, N.S., Stiekema, W.J., Jongsma, M.A., 2002. Optimization of the expres-
sion of equistatin in Pichia pastoris. Protein Expr. Purif. 1, 18–24.
Rümenapf, T., Unger, G., Strauss, J.H., Thiel, H.J., 1993. Processing of the envelope
glycoproteins of pestiviruses. J. Virol. 67, 3288–3294.
Sinclair, G., Choy, F.Y., 2002. Synonymous codon usage bias and the expression of
human glucocerebrosidase in the methylotrophic yeast, Pichia pastoris. Protein
Expr. Purif. 1, 96–105.
Su, C., Duan, X., Wang, X., Wang, C., Cao, R., Zhou, B., Chen, P., 2007. Heterologous
expression of FMDV immunodominant epitopes and HSP70 in P. pastoris and the
subsequent immune response in mice. Vet. Microbiol. 124, 256–263.
6 C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6
van Rijn, P.A., Miedema, G.K.W., Wensvoort, G., van Gennip, H.G.P., Moormann,
R.J.M., 1994. Antigenic structure of envelope glycoprotein E1 of hog cholera
virus. J. Virol. 68, 3934–3942.
Weiland, E., Ahl, R., Stark, R., Weiland, F., Thiel, H.J., 1992. A second envelop glyco-
protein mediates neutralization of a Pestivirus, hog cholera virus. J. Virol. 66,
3677–3682.
Windisch, J.M., Schneider, R., Stark, R., Weiland, E., Meyers, G., Thiel, H.J., 1996. RNase
of classical swine fever virus: biochemical characterization and inhibition by
virus-neutralizing monoclonal antibodies. J. Virol. 70, 352–358.
Wu, C.W., Chien, M.S., Liu, T.Y., Lin, G.J., Lee, W.C., Huang, C., 2011. Characterization
of the monoclonal antibody against classical swine fever virus glycoprotein Erns
and its application to an indirect sandwich ELISA. Appl. Microbiol. Biotechnol.
92, 815–821.
Wu, C.W., Chien, M.S., Huang, C., 2013. Characterization of the swine U6 promoter
for short hairpin RNA expression and its application to inhibition of virus repli-
cation. J. Biotechnol. 168, 78–84.
Zhang, S., Zubay, G., Goldman, E., 1991. Low-usage codons in Escherichia coli, yeast,
fruit fly and primates. Gene 105, 61–72.