See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/5540810

Characterization of knockdown resistance in DDT-and pyrethroid-resistant

Culex quinquefasciatus populations from Sri Lanka

Article  in  Tropical Medicine & International Health · May 2008

DOI: 10.1111/j.1365-3156.2008.02033.x · Source: PubMed

CITATIONS READS

48 231

5 authors, including:

Charles S Wondji Priyanka de Silva

Liverpool School of Tropical Medicine University of Peradeniya
285 PUBLICATIONS   4,283 CITATIONS    48 PUBLICATIONS   159 CITATIONS   

SEE PROFILE SEE PROFILE

Janet Hemingway Hilary Ranson

Liverpool School of Tropical Medicine Liverpool School of Tropical Medicine
458 PUBLICATIONS   21,829 CITATIONS    397 PUBLICATIONS   19,951 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Vector Resistance Surveillance and Monitoring View project

Molecular characterisation of pyrethroid resistance in Anopheles albimanus View project

All content following this page was uploaded by S H P Parakrama Karunaratne on 01 November 2017.

The user has requested enhancement of the downloaded file.

Tropical Medicine and International Health doi:10.1111/j.1365-3156.2008.02033.x

volume 13 no 4 pp 548–555 april 2008

Characterization of knockdown resistance in DDT- and

pyrethroid-resistant Culex quinquefasciatus populations from
Sri Lanka
Charles S. Wondji1, W. A. P. Priyanka De Silva2, Janet Hemingway1, Hilary Ranson1 and S. H. P. Parakrama
Karunaratne2

1 Liverpool School of Tropical Medicine, Liverpool, UK

2 Department of Zoology, University of Peradeniya, Peradeniya, Sri Lanka

Summary DDT and pyrethroid resistance in Culex quinquefasciatus have been previously reported in Sri Lanka,
but the mechanisms involved have yet to be characterized. We report the presence of two mutant alleles
of the sodium channel gene, the target site for both DDT and pyrethroid insecticides. Both mutations
resulted in classic knockdown resistance (kdr) L1014F mutation because of either an A-to-T substitution
or an A-to-C substitution. We developed two alternative assays to distinguish between the two
mutations and used these to screen 214 individuals from nine geographic locations throughout Sri
Lanka. Very high levels of kdr mutations were found throughout the country. A predominance of the
A-to-C mutation was observed over the A-to-T with an average allele frequency of 50% and 2%,
respectively. In addition to these non-synonymous kdr substitutions, we also found an indel (TCACA) in
the intron downstream of the kdr mutation. After genotyping this indel in 136 individuals, we found no
evident correlation between kdr genotypes and intronic indel. The presence of two alternative kdr
mutations has implications for the reliance on single molecular diagnostics for detection of resistance in
field populations. Furthermore, the high levels of these kdr mutations in C. quinquefasciatus populations
throughout Sri Lanka are of concern for the future of pyrethroid-based control programmes on this
island.

keywords Culex quinquefasciatus, pyrethroid, insecticide resistance, sodium channel, knockdown

resistance, Sri Lanka

populations from Sri Lanka and prompted the current

Introduction
The mosquito Culex quinquefasciatus is an important
vector of many parasitic and viral agents of human
diseases. In Sri Lanka, as in many countries in Southeast
Asia, C. quinquefasciatus is the main vector of the
parasitic worm Wuchereria bancrofti, the agent of
lymphatic filariasis (LF) (Jayasekera et al. 1991). Control
of this vector has relied extensively on the application of
insecticides (McCarroll & Hemingway 2002) and hence
the emergence of insecticide resistance represents a major
concern for plans to control or eradicate LF (Ottesen
et al. 1997).
Resistance to organochlorine, organophosphate and
carbamate insecticides is well documented and widespread
in populations of C. quinquefasciatus (Hemingway et al.
1990; Pasteur & Raymond 1996; Karunaratne & Hem-
ingway 2001). More recent bioassay data indicated a high
level (around 80%) of pyrethroid resistance in Culex
study (SHPP Karunaratne, unpublished data).
Knockdown resistance (kdr), which results from muta-
tions in the voltage-gated sodium channel, the target site of
DDT and pyrethroid insecticides, is widespread in many
insect species (Williamson et al. 1996; Dong 1997; Mar-
tinez-Torres et al. 1998, 1999). This resistance phenotype
is most commonly caused by a substitution of a leucine
codon (1014) in the S6 hydrophobic segment of domain II
which reduces the affinity of target site for insecticides
(O’Reilly et al. 2006). In Culex and Anopheles mosquitoes,
two alternative substitutions, L1014F and L1014S, both
associated with pyrethroid resistance, have been detected
(Martinez-Torres et al. 1998, 1999; Ranson et al. 2000).
Other metabolic resistance mechanisms involving P450
monooxygenases, glutathione S-transferases and carboxy-
lesterases have also been implicated in pyrethroid resis-
tance in mosquitoes, but the detailed molecular basis of
such resistance is unknown.

548 ª 2008 Blackwell Publishing Ltd

Tropical Medicine and International Health volume 13 no 4 pp 548–555 april 2008

C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus

The objective of this study was to detect additional

kdr mutations other than the A-to-T already identified at
codon 1014 in C. quinquefasciatus and to develop tools to
rapidly detect these mutations and to assess their role in
conferring DDT and pyrethroid resistance in this species in
Sri Lanka. We designed two diagnostic methods. One is
applicable in all laboratories including those in resource-
poor settings and the other, while very robust and allowing
high throughput, requires specialized equipment not widely
available in tropical countries. We used these tools to
conduct a preliminary survey of the distribution of kdr
mutations in C. quinquefasciatus in Sri Lanka.

Materials and methods

Mosquito samples and bioassays
Samples of C. quinquefasciatus, which were used to study
the polymorphism of the sodium channel gene, were
collected from Kegalle and Kurunegala in Sri Lanka. For a
preliminary study of the distribution of the kdr mutation
in Sri Lanka, more samples were later collected in
Colombo, Hambantota, Matale, Kandy, Moneragala,
Puttalam and Anuradapura (Figure 1). Larvae of C.
quinquefasciatus were collected in different breeding sites
and reared in the insectary. Bioassays were performed on
3-day-old adults using the standard WHO test kit method
for both DDT at 4% for samples from Kegalle and
permethrin at 0.25% for 1 h for samples from Kurune-
gala. Control tests were carried out by exposing females to
untreated papers. Figure 1 Map of Sri Lanka with areas of mosquito collection.

Amplification and sequencing of sodium channel gene

fragment
Genomic DNA from 20 adult females resistant to per-
methrin (from Kurunegala) and DDT (from Kegalle) was
extracted using the LIVAK method as described previously
(Collins et al. 1987). A fragment of sodium channel gene
from these mosquitoes was amplified by PCR using two
primers (kdr forward GTG GAT CGA ATC CAT GTG
and kdr reverse AGC AAG GCT AAG AAA AGG TT). Ten
picomole of each of these primers was added to a PCR
reaction containing 1· HotStar Taq Buffer, 0.2 mm
dNTPs, 1.5 mm MgCl2, 1U HotStar Taq (Qiagen) and
10 ng genomic DNA. Amplification was performed with
the following conditions: 1 cycle at 95 C for 15 min; 35
cycles of 94 C for 30 s, 52 C for 30 s and elongation at
72 C for 1 min; followed by 1 cycle at 72 C for 10 min.
PCR products were purified using the QIAquick PCR
purification kit (Qiagen) and directly sequenced on both
the strands using a Beckman CEQ 8000 automatic
sequencer. Sequences were searched for polymorphisms
using BioEdit and ClustalW alignment software (Thomp-
son et al. 1994).
New diagnostics for knockdown resistance in Culex
quinquefasciatus
The hot ligation oligonucleotide assay (HOLA) method
involves a PCR amplification of the target DNA fragment
followed by a heated oligonucleotide ligation in presence of
a detector primer labelled with biotin and a reporter primer
labelled with fluorescein. The mutation is detected after a
coloured reaction in a plate’s well between a horseradish
peroxidase-conjugated anti-fluorescein and TMB
(3,3¢,5,5¢-Tetramethylbenzidine), which is its substrate.
Detailed protocols describing this method have been
published previously (Lynd et al. 2005; Wondji et al. 2005;
Black et al. 2006). A reporter primer and three nucleotide-
specific detector primers were designed and used for the

ª 2008 Blackwell Publishing Ltd 549

Tropical Medicine and International Health
C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus
hot ligation reaction (Table 1). Aliquots were made for
each of the three oligonucleotide pairs containing 1 lm
detector and 1 lm reporter. Three microlitres of PCR
product from the reaction described above was mixed with
2 ll of 10· ampligase buffer, 50 nm detector and reporter
mix and 0.05 U ⁄ ll Ampligase enzyme (Epicentre, Mad-
ison, WI, USA) and water to bring the total volume of the
reaction to 20 ll. The reaction conditions were 95 C for
5 min, 25 cycles of 94 C for 1 min, 63 C for 2 min, with
a final hold at 4 C. Each specimen’s genotype was
determined following the protocol described in detail by
Lynd et al. (2005).
For the pyrosequencing method, 3 sequence-specific
primers were designed to genotype the kdr mutation
(Table 1) using the software provided by Pyrosequencing
AB (http://www.pyrosequencing.com). The sequence to
analyse was 5¢-TTA ⁄ C ⁄ TGTC GTGAGTATTCCAG-3¢
and the dispensation order was 5¢-TACaGTCGT-3¢. The
lower case of nucleotide ‘a’ means that it is negative
control and should not be incorporated in the target DNA.
A target DNA fragment was first amplified by PCR as
described previously (Wondji et al. 2007) using the for-
ward and the biotinylated reverse primers presented in
Table 1. Pyrosequencing reactions were performed as
described by Wondji et al. (2007) according to the man-
ufacturer’s instructions using the PSQ 96 SNP Reagent Kit
(Biotage AB) and the sequencing primer shown in Table 1.
The genotype was determined using the SNP Software
(Biotage AB).
Genotyping of intronic indel
A 5-bp indel was identified in the intronic region that
immediately follows the kdr mutation between base pairs
253 and 257 of this intron. The pyrosequencer was used to
Primers Oligo sequences 5¢-3¢
kdr pyrosequencing
Forward TGTCCTGCATTCCGTTCTTC
Reverse CTAATGCGCACACTAGATCATTCG
Sequencing CACCGTAGTGATAGGAAAT
HOLA method
Reporter AAATTTCCTATCACTACGGTG
Detector ‘T’ CTTCAGACTGGAATACTCACGACA
Detector ‘A’ CTTCAGACTGGAATACTCACGACT
Detector ‘C’ CTTCAGACTGGAATACTCACGACG
Indel pyrosequencing
Forward CCTAAAGGTGCAATTGTCTTGG
Reverse CGCATGCGAGATTCCAATC
Sequencing CGTTGTTTTGACAGCTC
550
volume 13 no 4 pp 548–555 april 2008
genotype individuals for the presence of this indel follow-
ing the protocol described earlier and using the primers
listed in Table 1.
Results
Bioassays were carried out with samples from Kegalle and
Kurunegala and resulted in 99% survival rate using 4%
DDT papers (149 alive over 150 tested) and 0.25%
permethrin (148 alive over 150 tested).
A 400-bp fragment of the sodium channel gene was
sequenced from 20 C. quinquefasciatus individuals from
Kurunegala, who had survived 1 h of exposure to 0.25%
permethrin. Two polymorphic sites were identified within
this sequence. The first site was at the third position of
codon 1014, where we observed the A-to-T mutation,
inducing a change of leucine to phenylalanine, as previ-
ously reported by Xu et al. (2005) in the same species.
However, some individuals contained an alternative
phenylalanine codon at this position, encoded by TTC.
This A-to-C kdr mutation has not been previously reported
in mosquitoes (Davies et al. 2007). The second polymor-
phic site was in the intron, around 260-bp downstream of
the kdr mutation, where we observed a 5-bp insertion
(TCACA) in 8 of the 15 individuals.
Optimization of knockdown resistance diagnostics
The pyrosequencing method monitors DNA synthesis in
real time by recording bioluminescence resulting from a
cascade of reactions triggered by the incorporation of a
nucleotide. In this study, the assay was used to detect the
three potential nucleotides (A ⁄ C ⁄ T) at the third coding
position of the 1014 codon in a single reaction. The
histograms for each possible genotype at codon 1014 were
Table 1 Oligonucleotide sequences used
Modifications in both pyrosequencing and HOLA
methods
5¢-Biotin
5¢-Phosphorylation
3¢-Fluorescein
5¢-Biotin
5¢-Biotin
5¢-Biotin
5¢-Biotin
ª 2008 Blackwell Publishing Ltd
Tropical Medicine and International Health volume 13 no 4 pp 548–555 april 2008

C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus

predicted by the pyrosequencing software as shown in

Figure 2. As an example, for a T ⁄ T homozygote, a single
peak with a relative height of 3 is predicted. In T ⁄ C
heterozygotes, the relative height of the T peak will be
reduced to 2.5 (as T’s now represent 5 out of 6 bases in this
codon) and the C peak will have a relative height of 0.5. All
the six genotypes could be reliably scored using this
method (Figure 3).
Each of the three nucleotides observed at the third
coding position of codon 1014 could also be readily
detected by the HOLA method (Figure 4). Wild-type
individuals gave a positive signal only with the A detector
indicating the TTA genotype, whereas kdr individuals gave
a positive signal using the C and ⁄ or T detectors. The plates
were scored manually, and these results were confirmed
using a spectrophotometer at 650 nm.
For the preliminary study of kdr distribution, individual
C. quinquefasciatus collected from 9 field sites throughout
Sri Lanka were genotyped for the kdr mutation using both
the pyrosequencing and HOLA methods. In general, there
Figure 3 Representative pyrograms of the kdr mutation after the
was a high level of concordance between results obtained pyrosequencing assay. The observed genotypes are C ⁄ C, A ⁄ C,
from the two methods; although, after the initial run, A ⁄ A, A ⁄ T, C ⁄ T and T ⁄ T. The yellow areas indicate the nucleo-
discrepancies were observed in 21 out of 214 individuals. tides of interest (SNP).
For these 21 individuals, we suspected that a non-specific
ligation may have occurred in the HOLA method, and we
therefore increased the ligation temperature from 58 to

(a) (d)

(b) (e)
Figure 4 Example of the kdr genotype results from a HOLA
plate. Origin of samples used: Kegalle (1–3), Matale (4–6), Kandy
(7–9), Colombo (10–12); A ⁄ A, A ⁄ C, A ⁄ T and C ⁄ T, respectively,
indicate homozygote TTA, heterozygote TTA ⁄ TTC, heterozygote
TTA ⁄ TTT and TTC ⁄ TTT genotypes observed for the 12 samples
tested.

(c) (f)
63 C. This improved the concordance rate and left only 5
individuals showing a discrepancy in the genotype score
from the two methods. These 5 samples were sequenced
and the results confirmed scores from the pyrosequencer.
Details of these results are presented in Table 2.

Figure 2 Histograms of the kdr mutation pyrosequencing assay as

predicted by pyrosequencing software. The predicted genotypes
are C ⁄ C (A), A ⁄ C (B), A ⁄ A (C), A ⁄ T (D), C ⁄ T (E) and T ⁄ T (F).
The yellow areas indicate the nucleotides of interest (SNP). The
sequence to the right is included as a control to verify that the
reaction is functioning correctly.
Distribution of knockdown resistance frequencies
Of the six potential genotypes (A ⁄ A, A ⁄ C, C ⁄ C, A ⁄ T, C ⁄ T,
T ⁄ T) that could have been observed at the third codon of
residue 1014, A ⁄ A, A ⁄ C and C ⁄ C were by far the most

ª 2008 Blackwell Publishing Ltd 551

Tropical Medicine and International Health volume 13 no 4 pp 548–555 april 2008

C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus

Table 2 Frequency distribution of kdr mutations in samples from Sri Lanka

Genotypes (%)

TTA TTA ⁄ C TTC TTA ⁄ T TTC ⁄ T TTT

Location Number tested SS SR RR SR RR RR

Kegalle 31 15 (48) 8 (25) 6 (19) 2 (6) 0 0

Kurunegala 25 2 (8) 12 (48) 11 (44) 0 0 0
Hambantota 27 9 (33.3) 12 (44.4) 6 (22.2) 0 0 0
Matale 20 3 (15) 8 (40) 7 (35) 1 (5) 1 (5) 0
Kandy 18 11 (61.1) 6 (33.3) 0 0 1 (5.6) 0
Colombo 20 3 (15) 10 (50) 6 (30) 1 (5) 0 0
Moneragala 30 1 (3.3) 20 (66.7) 9 (30) 0 0 0
Puttalam 21 4 (19) 12 (57.1) 5 (23.8) 0 0 0
Anuradapura 22 4 (18.2) 9 (40.9) 8 (36.4) 0 0 1 (4.5)
Total 214 52 (24.3) 97 (45.3) 58 (27.1) 4 (1.87) 2 (0.94) 1 (0.47)

SS, homozygote susceptible genotype; RS, heterozygote susceptible ⁄ resistant genotype; RR, homozygote-resistant genotype. The fre-
quencies of genotypes are given in brackets.

predominant with 52, 97 and 58 individuals, respectively,

Detection of indel
from the total sample size of 214. All the three genotypes
involving the T nucleotide were found only at a very low The TCACA indel identified in the intron downstream of
frequency (4, 2 and 1 for A ⁄ T, C ⁄ T and T ⁄ T, respectively) the kdr mutation was genotyped in 136 samples from the
in the total sample. These results indicate that an A-to-C 9 locations to look for correlations between this indel
rather than A-to-T substitution is the major mutation and the kdr mutation. A PCR product of size 67 bp was
conferring kdr in Sri Lanka. This differs from the situation first obtained using the forward and reverse biotinylated
in the USA (Xu et al. 2005) or in West Africa (Chandre primers (Table 1) before the pyrosequencing reaction.
et al. 1998; Corbel et al. 2007) as well as in C. pipiens The three expected genotypes (TCACA ⁄ TCACA, TCA-
(Martinez-Torres et al. 1999), where only the A-to-T CA ⁄ ) and ) ⁄ )) were clearly identified by the pyrose-
substitution has been reported. quencing assay with observed peaks corresponding to the
Thirty of 31 individuals collected from Kegalle survived expected histograms (Figure 5). The distribution of these
exposure to the diagnostic dose of DDT, and yet 15 of 3 genotypes (Table 3) conforms to the expected ratios
these possess the susceptible genotype suggesting that kdr is
not the major cause of DDT resistance in this location.
(a)
Indeed, this absence of kdr alleles in DDT-resistant
individuals suggests that other mechanisms of resistance
such as the metabolic resistance mechanism could be
operating in these samples through the over-expression of
some detoxifying genes. In Kurunegala, 22 individuals out
(b)
of 25 survived an hour exposure to 0.25% permethrin.
Twelve of these were homozygotes for the kdr mutation,
TTC, and the remainder were heterozygotes (TTC ⁄ TTA).
Of the 3 susceptible individuals (those dead after bioassay
test), 2 individuals were heterozygotes and 1 of them was
homozygote susceptible. (c)

For the 7 other collection sites, where no bioassay was

carried out, the kdr allele varied in frequency from 17% to
64% for the A-to-C mutation and from 0% to 5% for the
A-to-T mutation. The A ⁄ C genotype was predominant in
all 7 samples. These results indicate that the kdr mutation
is common in field populations of C. quinquefasciatus of Figure 5 Expected histograms and observed programs of the
Sri Lanka. TCACA indel of the sodium channel gene by pyrosequencing.

552 ª 2008 Blackwell Publishing Ltd

Tropical Medicine and International Health volume 13 no 4 pp 548–555 april 2008

C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus

Table 3 Distribution of indel genotypes in relation with kdr mutations

kdr Genotypes

Location Number tested TTA TTA ⁄ C TTC TTA ⁄ T TTC ⁄ T TTT

Kegalle-DDT tested TCACA ⁄ TCACA 0 0 0 0 0 0 0

TCACA ⁄ ) 7 4 0 1 2 0 0
)⁄) 5 5 0 0 0 0 0
Kurunegala Permethrine tested TCACA ⁄ TCACA 1 0 1 0 0 0 0
TCACA ⁄ ) 11 0 5 6 0 0 0
)⁄) 7 1 4 2 0 0 0
Hambatota TCACA ⁄ TCACA 4 2 1 1 0 0 0
TCACA ⁄ ) 4 1 2 1 0 0 0
)⁄) 4 1 2 1 0 0 0
Kandy TCACA ⁄ TCACA 4 3 0 0 0 1 0
TCACA ⁄ ) 4 3 1 0 0 0 0
)⁄) 3 3 0 0 0 0 0
Colombo TCACA ⁄ TCACA 2 0 1 1 0 0 0
TCACA ⁄ ) 9 3 3 2 1 0 0
)⁄) 2 1 1 0 0 0 0
Moneragala TCACA ⁄ TCACA 10 1 5 4 0 0 0
TCACA ⁄ ) 7 0 2 5 0 0 0
)⁄) 2 0 2 0 0 0 0
Puttalama TCACA ⁄ TCACA 3 0 2 1 0 0 0
TCACA ⁄ ) 6 3 2 1 0 0 0
)⁄) 6 1 3 2 0 0 0
Anuradapura TCACA ⁄ TCACA 10 2 2 5 0 0 1
TCACA ⁄ ) 4 1 1 2 0 0 0
)⁄) 3 2 1 0 0 0 0
Matale TCACA ⁄ TCACA 2 0 0 2 0 0 0
1 (NG) – – – – – –
TCACA ⁄ ) 13 3 5 3 1 1 0
)⁄) 2 (NG) – – – – – –
Total TCACA ⁄ TCACA 36 8 12 14 0 1 1
1 (NG) – – – – – –
TCACA ⁄ ) 65 16 20 20 4 1 0
)⁄) 32 14 13 5 0 0 0
2 (NG) – – – – – –
136 38 45 39 4 2 1

NG, not genotyped.

under the model of Hardy–Weinberg equilibrium in 7

out of the 9 localities (P > 0.05 for each sample after
chi-square test). A deviation from the expected ratio was
observed in the two localities of Moneragala and
Anuradapura (v2 = 8.1, P = 0.018 and v2 = 10.5,
P = 0.005, respectively) with an excess of the TCA-
CA ⁄ TCACA genotype. No departure from the expected
ratios was observed for the total sample of 136
individuals. We did not observe a significant correlation
between this indel and the different kdr genotypes. The
TCACA ⁄ TCACA and the heterozygote indel genotype
were observed with five of the six kdr genotypes and the
homozygote ) ⁄ ) genotype was observed with three of
the kdr genotypes (Table 3).
Discussion
In this study, we analysed partial sequences of sodium
channel gene in field samples of C. quinquefasciatus to
determine the prevalence of kdr alleles in Sri Lanka.
Surprisingly, we identified two alternative substitutions at
the third position of codon 1014, both of which result in
the replacement of leucine with phenylalanine. As far as we
are aware, this is the first report of the occurrence of two
alternative phenylalanine codons at position 1014 in the
sodium channel gene within an insect species. A recent
comparative study of voltage-gated sodium channels in 65
insect species has shown that the A-to-C mutation was
present only in 2 species (Davies et al. 2007). These species

ª 2008 Blackwell Publishing Ltd 553

Tropical Medicine and International Health
C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus
are Blattella germanica, the German cockroach (Dong
1997) and Myzus persicae, the green peach aphid (Marti-
nez-Torres et al. 1999). But the A-to-T mutation was not
detected in these two species confirming that the co-
occurrence of the A-to-T and A-to-C mutations in C.
quinquefasciatus is the first observation in insects so far. It
may be interesting to investigate in future studies if the A-
to-C mutation could confer a different level of pyrethroid
resistance than the A-to-T mutation despite the fact that
both the mutations lead to the same amino acid change.
Further investigation could also assess the level of resis-
tance conferred by the simultaneous co-occurrence of A-to-
C and A-to-T mutations in a population or in an
individual. Previously, in mosquitoes, two mutations have
been observed in the 1014 codon, but these lead to
alternative substitutions, either a serine or phenylalanine
(Martinez-Torres et al. 1999; Ranson et al. 2000).
The presence of these two alleles shows that kdr
mutation in C. quinquefasciatus has arisen at least twice.
The high predominance of the A-to-C mutation over the A-
to-T and the lack of reports of the A-to-C mutation in
other regions of the world may indicate that the A-to-C
mutation arose in Sri Lanka and that the A-to-T mutation
has been introduced recently in the country. However, it is
equally possible that the TTC codon is present in other C.
quinquefasciatus populations but has escaped detection.
Indeed, the occurrence of multiple kdr mutations within a
population has implications for the reliability of molecular
diagnostics that specifically detect a single resistance
mutation. Over reliance on such assays may lead to an
underestimate of the extent of kdr frequency. In this
prospect, the pyrosequencing method used in this study,
which is a real-time DNA mini-sequencing, presents an
advantage over other methods by being able to detect any
new mutation, including those not yet recorded, around the
targeted mutation.
We did not observe a correlation between the TCACA
indel and the kdr mutation genotypes. However, more
studies will need to investigate this relationship. For
example, by comparing the intronic sequence between
samples used in this study and those from other locations
in the world, it may be possible to estimate the
geographical and temporal origin of the kdr mutation.
We identified a new A-to-C kdr mutation in
C. quinquefasciatus. We have designed two diagnostic
methods (HOLA and pyrosequencing assay) that were able
to detect each of the three nucleotides A, C and T at the kdr
site and to provide a clear and distinctive genotype for each
case. Results obtained from the two methods correlated
well, but the pyrosequencing was more accurate of the two
assays. Pyrosequencing also enables a higher throughput
than the HOLA method, but it relies on specialized
554
volume 13 no 4 pp 548–555 april 2008
equipment, not readily available in disease endemic coun-
ties. By contrast, the HOLA method is very easy to set up
and implement in any basic laboratory and is a cheap
diagnostic method for field studies.
The present study highlights the genetic plasticity of
mosquito species and supports the need to constantly
monitor field populations of vectors across their geo-
graphical distribution for mutations conferring insecticide
resistance. Populations of C. quinquefasciatus should be
monitored around the world with one of the two methods
presented in this study to accurately detect the presence of
the kdr mutation. This accurate detection will improve
control programmes on this vector.
Acknowledgements
The authors would like to acknowledge Stuart Hall for
technical help.
References
Black WCt, Gorrochotegui-Escalante N & Duteau NM (2006)
Heated oligonucleotide ligation assay (HOLA): an affordable
single nucleotide polymorphism assay. Journal of Medical
Entomology 43, 238–247.
Chandre F, Darriet F, Darder M et al. (1998) Pyrethroid resistance
in Culex quinquefasciatus from west Africa. Medical and
Veterinary Entomology 12, 359–366.
Collins FH, Mendez MA, Rasmussen MO et al. (1987) A ribo-
somal RNA gene probe differentiates member species of the
Anopheles gambiae complex. American Journal of Tropical
Medicine and Hygiene 37, 37–41.
Corbel V, N’Guessan R, Brengues C et al. (2007) Multiple insec-
ticide resistance mechanisms in Anopheles gambiae and Culex
quinquefasciatus from Benin, West Africa. Acta Tropica 101,
207–216.
Davies TG, Field LM, Usherwood PN & Williamson MS (2007)
A comparative study of voltage-gated sodium channels in the
Insecta: implications for pyrethroid resistance in Anopheline
and other Neopteran species. Insect Molecular Biology 16,
361–375.
Dong K (1997) A single amino acid change in the para sodium
channel protein is associated with knockdown-resistance (kdr)
to pyrethroid insecticides in German cockroach. Insect Bio-
chemistry and Molecular Biology 27, 93–100.
Hemingway J, Callaghan A & Amin AM (1990) Mechanisms of
organophosphate and carbamate resistance in Culex quinque-
fasciatus from Saudi Arabia. Medical and Veterinary Entomol-
ogy 4, 275–282.
Jayasekera N, Kalpage KS & De Silva CS (1991) The significance
of low density microfilaraemia in the transmission of Wuc-
hereria bancrofti by Culex (Culex) quinquefasciatus Say in Sri
Lanka. Transaction of the Royal Society of Tropical Medicine
and Hygiene 85, 250–254.
ª 2008 Blackwell Publishing Ltd
Tropical Medicine and International Health
C. S. Wondji et al. DDT and pyrethroid resistance in Culex quinquefasciatus
Karunaratne SH & Hemingway J (2001) Malathion resistance and
prevalence of the malathion carboxylesterase mechanism in
populations of mosquito vectors of disease in Sri Lanka. Bulletin
of the World Health Organization 79, 1060–1064.
Lynd A, Ranson H, McCall PJ et al. (2005) A simplified high-
throughput method for pyrethroid knock-down resistance (kdr)
detection in Anopheles gambiae. Malaria Journal 4, 1–5.
Martinez-Torres D, Chandre F, Williamson MS et al. (1998)
Molecular characterization of pyrethroid knockdown resistance
(kdr) in the major malaria vector Anopheles gambiae s.s. Insect
Molecular Biology 7, 179–184.
Martinez-Torres D, Chevillon C, Brun-Barale A et al. (1999)
Voltage-dependent Na+ channels in pyrethroid-resistant Culex
pipiens L mosquitoes. Pesticide Science 55, 1012–1020.
McCarroll L & Hemingway J (2002) Can insecticide resistance
status affect parasite transmission in mosquitoes? Insect Bio-
chemistry and Molecular Biology 32, 1345–1351.
O’Reilly AO, Khambay BP, Williamson MS et al. (2006) Model-
ling insecticide-binding sites in the voltage-gated sodium chan-
nel. Biochemistry Journal 396, 255–263.
Ottesen EA, Duke BO, Karam M & Behbehani K (1997) Strategies
and tools for the control ⁄ elimination of lymphatic filariasis.
Bulletin of the World Health Organization 75, 491–503.
Pasteur N & Raymond M (1996) Insecticide resistance genes in
mosquitoes: their mutations, migration, and selection in field
populations. Journal of Heredity 87, 444–449.
Corresponding Author Charles S. Wondji, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK.
Tel.: +44 151 705 3107; Fax: +44 151 705 3369; E-mail: c.s.wondji@liverpool.ac.uk
ª 2008 Blackwell Publishing Ltd
volume 13 no 4 pp 548–555 april 2008
Ranson H, Jensen B, Vulule JM et al. (2000) Identification of a
point mutation in the voltage-gated sodium channel gene of
Kenyan Anopheles gambiae associated with resistance to DDT
and pyrethroids. Insect Molecular Biology 9, 491–497.
Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Research 22,
4673–4680.
Williamson MS, Martinez-Torres D, Hick CA & Devonshire AL
(1996) Identification of mutations in the housefly para-type so-
dium channel gene associated with knockdown resistance (kdr)
to pyrethroid insecticides. Molecular and General Genetics 252,
51–60.
Wondji CS, Hunt RH, Pignatelli P et al. (2005) An integrated
genetic and physical map for the malaria vector Anopheles fu-
nestus. Genetics 171, 1779–1787.
Wondji CS, Morgan JC, Coetzee M et al. (2007) Mapping a
Quantitative Trait Locus conferring pyrethroid resistance in the
African malaria vector Anopheles funestus. BMC Genomics 8,
1–14.
Xu Q, Liu H, Zhang L & Liu N (2005) Resistance in the mos-
quito, Culex quinquefasciatus, and possible mechanisms for
resistance. Pest Management Science 61, 1096–1102.
555
View publication stats