Medical Mycology, 2014, 52, 565–576

doi: 10.1093/mmy/myu022
Advance Access Publication Date: 20 June 2014
Original Article

Original Article

Aspergillus pragensis sp. nov. discovered during

molecular reidentification of clinical isolates
belonging to Aspergillus section Candidi

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
Vit Hubka1,2,∗ , Pavlina Lyskova3 , Jens C. Frisvad4 , Stephen W. Peterson5 ,
Magdalena Skorepova6 and Miroslav Kolarik1,2
1
Department of Botany, Faculty of Science, Charles University in Prague, Benátská 2, 128 01 Praha 2,
Czech Republic, 2 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the AS CR,
v.v.i., Vı́deňská 1083, 142 20 Praha 4, Czech Republic, 3 Laboratory of Medical Mycology, Department of
Parasitology, Mycology and Mycobacteriology Prague, Public Health Institute in Ústı́ nad Labem, Czech
Republic, 4 Department for Systems Biology, Technical University of Denmark, Soltofts Plads, Building
221, DK-2800 Lyngby, Denmark, 5 Bacterial Foodborne Pathogens and Mycology Research Unit, National
Center for Agricultural Utilization Research, Peoria, IL, USA and 6 Department of Dermatology and Ven-
erology, First Faculty of Medicine, Charles University in Prague and General University Hospital in Prague,
Czech Republic
*To whom correspondence should be addressed. Vit Hubka, Department of Botany, Faculty of Science, Charles University
in Prague, Czech Republic, Benátská 2, 128 01 Praha 2. Tel: (+420) 739663218; Fax: (+420) 296442347;
E-mail: hubka@biomed.cas.cz
The EMBL (European Molecular Biology Laboratory database) accession numbers for the internal transcribed spacer,
β-tubulin, and calmodulin of the ex-type strain of Aspergillus pragensis sp. nov. are FR727138, HE661604, and FR751452,
respectively.
The MycoBank (http://www.mycobank.org) accession numbers for Aspergillus pragensis sp. nov. is MB800371.
Received 26 December 2013; Revised 8 February 2014; Accepted 3 March 2014

Abstract
The identity of nine clinical isolates recovered from Czech patients and presumptively
identified as Aspergillus sp. section Candidi based on colony morphology was revised
using sequences of β-tubulin, calmodulin gene sequence, and internal transcribed spacer
rDNA. Six isolates were from suspected and proven onychomycosis, one from otitis ex-
terna, and two associated with probable invasive aspergillosis. The results showed that
one Aspergillus candidus isolate was the cause of otitis externa, and both isolates ob-
tained from sputa of patients with probable invasive aspergillosis were reidentified as
A. carneus (sect. Terrei) and A. flavus (sect. Flavi). Three isolates from nail scrapings were
identified as A. tritici, a verified agent of nondermatophyte onychomycosis. One isolate
from toenail was determined to be A. candidus and the two isolates belonged to a hith-
erto undescribed species, Aspergillus pragensis sp. nov. This species is well supported
by phylogenetic analysis based on β-tubulin and calmodulin gene and is distinguishable

Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2014. This work 565
is written by US Government employees and is in the public domain in the US.
566 Medical Mycology, 2014, Vol. 52, No. 6

from other members of sect. Candidi by red-brown reverse on malt extract agar, slow
growth on Czapek–Dox agar and inability to grow at 37◦ C. A secondary metabolite analy-
sis was also provided with comparison of metabolite spectrum to other species. Section
Candidi now encompasses five species for which a dichotomous key based on colony
characteristics is provided. All clinical isolates were tested for susceptibilities to selected
antifungal agents using the Etest and disc diffusion method. Overall sect. Candidi mem-
bers are highly susceptible to common antifungals.
Key words: Aspergillus candidus, Aspergillus tritici, antifungal susceptibility testing, nondermatophyte onychomy-
cosis, otomycosis, polyphasic approach.

Introduction didi and are proposed as a new species, Aspergillus

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
pragensis.
Aspergillus spp. within the section Candidi (established by
Gams et al. [1] for the previous “A. candidus group” ac-
cording to Thom and Raper [2]) are widely distributed in
nature and the human environment. On the basis of the Materials and methods
last revision, which combined molecular data, morphol- Cultivation and preservation of isolates
ogy, physiology, and profiles of secondary metabolites, the
Strains were grown on malt extract agar (MEA; malt ex-
section encompasses four white or yellow spored, mod-
tract from Oxoid, Basingstoke, UK), Czapek yeast au-
erately xerophilic, biseriate species [3]. Aspergillus can-
tolysate agar (CYA; yeast extract from Fluka, Buchs,
didus is the best-known member of sect. Candidi and
Switzerland), and Czapek–Dox agar (CZA) in plates at
is most commonly encountered on stored grains, grain
25◦ C in the dark and sealed with Parafilm. For me-
products, seeds, spices, nuts, and dried products (e.g.
dia formulation, see Samson et al. [19]. Micromorphol-
meat and fruits) [4]. Aspergillus candidus growth de-
ogy was examined using MEA cultures at 25◦ C, and
creases germinability of contaminated grain [5,6]; pro-
development was assessed at 37◦ C and 40◦ C on MEA
duces many bioactive compounds [7–9] that have proba-
plates sealed with Parafilm. All isolates were deposited
ble toxic potential, at least for animals [10,11]; and has
into the Culture Collection of Fungi (CCF), Department
the potential to be used in food manufacturing processes
of Botany, Charles University, Prague. Selected isolates
[12–15], making A. candidus an economically significant
were deposited in the Culture Collection at the Center
species.
for Microbial Biotechnology (IBT), Technical University of
A wide spectrum of infections have been attributed to
Denmark, Kongens Lyngby; Agricultural Research Service
A. candidus including onychomycosis, otomycosis, pul-
Culture Collection (NRRL), Peoria, IL, USA; and Centraal-
monary aspergilloma, and invasive aspergillosis [16]. How-
bureau voor Schimmelcultures (CBS), Utrecht, the Nether-
ever, many of these infections could be caused by other
lands. A dried culture derived from the ex-holotype iso-
species as A. candidus is unable to grow at 37◦ C. For
late was deposited into the herbarium of the Mycological
example, A. tritici [3] in sect. Candidi could be the true
Department, National Museum, Prague (PRM).
causal agent of some of these infections. Aspergillus tritici,
recently revived species [3], has been reported only once
as an etiological agent of human infection, namely, ony-
Molecular studies
chomycosis [17]. Other previously reported infections at-
tributed to A. candidus could be caused by white-spored DNA was isolated using ArchivePure DNA yeast and a
mutants of species belonging to other Aspergillus sections, Gram2+ kit (5PRIME Inc., Gaithersburg, MD, USA) as
for example, A. flavus, A. fumigatus, and A. terreus. Also, described by Hubka et al. [20]. The mixture (25 μl vol)
significant health risks could be associated with exposure contained 50 ng of genomic DNA, 20 pmol of each primer,
to grain dust that is heavily contaminated by A. candidus 0.2 mM of dNTPs (dNTP master mix; Invitek, Berlin,
spores [18]. Germany), and 1 U of M Maximo Taq DNA polymerase
In this study, we assessed the phylogenetic position with the respective buffer (GeneOn GmbH, Nuernberg,
of nine white-spored Aspergillus isolates collected be- Germany).
tween 2007 and 2013 from Czech patients. Two of The internal transcribed spacer (ITS) region of the rDNA
these isolates were phylogenetically and phenotypically (ITS1–5.8S-ITS2 cluster) was amplified using the primer
distinct from other species described in sect. Can- sets ITS1F (5 -CTTGGTCATTTAGAGGAAGTAA) or
Hubka et al.
ITS5 (5 - GGAAGTAAAAGTCGTAACAAGG) and
ITS4 (5 -TCCTCCGCTTATTGATATGC) or ITS4S
(5 -CCTCCGCTTATTGATATGCTTAAG). A par-
tial β-tubulin gene (benA) was amplified using the
primers Bt2a (5 -GGTAACCAAATCGGTGCTGCTTTC)
and Bt2b (5 -ACCCTCAGTGTAGTGACCCTTGGC)
and partial calmodulin gene using the primers CF1M
(5 -AGGCCGAYTCTYTGACYGA) and CF4 (5 -
TTTYTGCATCATRAGYTGGAC). The reaction mixtures
were subjected to 32 cycles under the following tempera-
ture regimes: 1 cycle at 95◦ C for 3 min, 55◦ C for 30 s, 72◦ C
for 1 min; followed by 30 cycles at 95◦ C for 30 s, 55◦ C for
30 s, 72◦ C for 1 min; and a final cycle at 95◦ C for 30 s,
55◦ C for 30 s, 72◦ C for 10 min. Polymerase chain reaction
product purification and sequencing were performed at
Macrogen Europe (Amsterdam, the Netherlands) using the
terminal primers.
The sequences were inspected and alignments were
performed as described by Hubka and Kolařı́k [21].
Maximum-likelihood analysis was conducted using MEGA
5.2 [22] with 1000 bootstrap replicates. A suitable substi-
tution model was determined for each locus using MEGA
5.2. Additional alignment characteristics are listed in
Figure 1. Sequences were deposited into the EMBL database
under the accession numbers listed in Table 1 (bold print)
and Figure 1.
Secondary metabolites analysis
The extracts were prepared according to Houbraken
et al. [23], which involved high-performance liquid chro-
matography with diode-array detection [24], updated by
Houbraken et al. [23]. Fungi were incubated for 1 week at
25◦ C in darkness on CYA and yeast extract sucrose agar
(YES) agars for metabolite analysis. For media formulation,
see Samson et al. [19].
Antifungal susceptibility testing
The in vitro antifungal drug susceptibility of each of the
seven clinical isolates of Aspergillus sect. Candidi was as-
sessed using the Etest and disc diffusion method, accord-
ing to the following procedure. The isolates were grown
on MEA until mature spores were produced (1–2 weeks).
The inoculum consisted of a homogenous suspension of
spores (optical densities ranged from 0.09 to 0.11, equiva-
lent to 80%–82% transmittance) with addition of one drop
of Tween 20. Suspensions were applied to the surfaces of
90-mm agar plates by dipping a sterile swab into the sus-
pension and streaking the swab across the surface of the
plates in three directions. The plates were dried at ambi-
567
ent temperature for 20 min. Next, Etest strips (bioMérieux,
Marcy l’Etoile, France) were applied to the surface of the in-
oculated plates with Roswell Park Memorial Institute 1640
medium (RPMI 1640; Trios, Prague, Czech Republic) in-
cubated at 35◦ C or 25◦ C (A. candidus and A. pragensis
did not grow at 35◦ C) and read after 48 h. Neo-Sensitabs
tablets (Rosco, Taastrup, Denmark) were placed on the
surface of the inoculated plates with RPMI 1640 medium
and Mueller–Hinton agar (MHA; Trios, Prague, Czech Re-
public). Candida krusei American Type Culture Collection
(ATCC) 6258, C. parapsilosis ATCC 22019, C. albicans
ATCC 90028, and Paecilomyces variotii ATCC-MYA 3630
were used as quality-control strains.
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
Results
Molecular analysis
Nine clinical isolates, initially identified as members of As-
pergillus sect. Candidi, were recovered from samples col-
lected from Czech patients between 2007 and 2013. The
tentative identifications were based on morphology (white
sporulation), and seven of the isolates were confirmed as
Aspergillus sect. Candidi members using sequences of the
following three loci: β-tubulin, calmodulin, and ITS rDNA
(Table 1). The remaining two isolates associated with prob-
able invasive aspergillosis (according to European Orga-
nization for Research and Treatment of Cancer/Invasive
Fungal Infections Cooperative Group and the National In-
stitute of Allergy and Infectious Diseases Mycoses Study
Group criteria [25]) were reidentified as A. carneus CCF
4725 (sect. Terrei; EMBL accession number HG915892)
and A. flavus AK 103/11 (sect. Flavi; EMBL accession
number HG916682). The isolates from sect. Candidi in-
cluded six that were probably involved in onychomycosis
and proven onychomycosis (Summerbell et al. [26]) and one
isolate in otitis externa. The results showed that A. candidus
was a cause of otitis externa. Most of the isolates from nail
scrapings were identified as A. tritici (n = 3), a species also
verified as an agent of nondermatophyte onychomycosis.
One isolate from toenail was identified as A. candidus and
two isolates belonged to the new species that is proposed
here, that is, A. pragensis.
Using the BLAST similarity search, the β-tubulin gene
of A. pragensis CCF 3962T (HE661604) shared 95% iden-
tical base pairs (434/457 bp; EU014091) with the ex-type
strain of A. campestris NRRL 13001T ; A. taichungensis
IBT 19404T showed 94% (430/458 bp; EU076297), A.
candidus NRRL 303T 91% (426/466 bp; EU014089), and
A. tritici CBS 266.81T 91% (420/460 bp; EU076293) sim-
ilarity. Partial calmodulin gene sequence of CCF 3962T
568 Medical Mycology, 2014, Vol. 52, No. 6

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016

Figure 1. Maximum likelihood trees showing relationships of Aspergillus pragensis to other species of sect. Candidi. Best scoring trees are shown
for each locus. The thick branches denote 95% bootstrap support or higher; only bootstrap values >60% are shown. Ex-type isolates are designated
by a superscript T. Aspergillus floridensis (sect. Nigri) CCF 4046 was used as the outgroup.
 Hubka et al.

Table 1. Aspergillus strains from section Candidi examined in this study.

GenBank/European Molecular Biology
Laboratory accession numbersb
Species name Strain numbersa Year of isolation Source, Patient Clinical manifestation and significance
and location (age/M, F) ITS benA caM
Clinical isolates
A. candidus CCF 3996 = CBS 134394 2010, Prague External auditory Otitis externa FR727137 FR775325 HE716843
canal, 53/M
CCF 4659 2012, Hustopeče Toenail, 52/F Probable contamination, growth in pure culture in the first HG915889 HG916672 HG916681
sampling, DM negative, repeated sampling negative
A. pragensis CCF 3962T = 2007, Prague Toenail, 58/M Probable posttraumatic onychomycosis, DM positive for NDP FR727138 HE661604 FR751452
NRRL 62491T = hyphae, growth of fungus in pure culture in the first sampling,
CBS 135591T = not verified by repeated sampling
IBT 32274T
CCF 4654 = 2013, Prague Toenail, 59/M Contamination, negative DM, did not grow in pure culture HG915888 HG916673 HG916680
NRRL 62822 = IBT 32701
A. tritici CCF 4658 2008, Prague Toenail, 61/F Probable onychomycosis, DM positive for NDP hyphae, HG915891 HG916675 HG916676
growth of fungus in pure culture, sampling was not repeated
CCF 3853 = IBT 32725 2008, Prague Toenail, 62/M Proven onychomycosis, positive DM for NDP hyphae, growth FR727136 FR775327 HE661598
in pure culture in the first as well as the second sampling
CCF 4653 2012, Prague Toenail, 58/F Probable onychomycosis, fluorescence microscopy positive for HG915890 HG916674 HG916677
NDP hyphae, growth of fungus in pure culture, not verified by
repeated sampling

Other isolates examined in this study

A. campestris NRRL 13001T = 1979, North Dakota, USA Topsoil –c EF669577 EU014091 EF669535
CBS 348.81T =
ATCC 44563T =
IMI 259099T =
IFM 50931T
A. candidus NRRL 303T = Received by Raper and Unknown – EF669592 EU014089 EF669550
CBS 566.65T = Fennell in 1909 from Prof.
ATCC 1002T = Westerdijk
IMI 091889T
A. taichungensis IBT 19404T 1994, Taichung City, Soil – EU076301 EU076297 HG916679
Taiwan
A. tritici CBS 266.81T India Wheat grain – EU076302 EU076293 HG916678

ITS, Internal transcribed spacer of rDNA; DM, direct microscopy; F, female; M, male; NDP, nondermatophyte.
a
Culture collection abbreviations: ATCC, American Type Culture Collection; CBS, Centraalbureau voor Schimmelcultures; CCF, Culture Collection of Fungi; IBT, Culture Collection at Center for Microbial Biotechnology;
IMI, CABI’s collection of fungi and bacteria, Egham, UK; IFM, Collection at the Medical Mycology Research Center, Chiba University, Japan; NRRL, Agricultural Research Service Culture Collection.
b
sequences determined for this study are in bold print.
c
“–” not clinical isolate
569

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
570
(FR751452) showed 97% similarity to both A. candidus
NRRL 303T (548/565 bp; EF669550) and A. campestris
NRRL 13001T (547/565 bp; EF669535); A. tritici CBS
266.81T (541/569 bp; HG916678) and A. taichungensis
IBT 19404T (540/566 bp; HG916679) shared 95% simi-
larity. The ITS rDNA region of A. pragensis isolates was
identical to that of A. candidus isolates; the ex-type of
A. campestris and A. taichungensis had only one unique
position in comparison with A. pragensis and A. can-
didus. Aspergillus tritici isolates had two unique po-
sitions, differentiating them from A. candidus and
A. pragensis.
The isolates of A. pragensis formed a well-supported
clade in phylogenetic analysis based on β-tubulin (benA)
and calmodulin gene (Fig. 1). The interspecies relationships
were not resolved using ITS rDNA sequence, which has
very low discriminatory power among species belonging to
Aspergillus sect. Candidi.
Secondary metabolite analysis
Isolates of A. pragensis were compared relative to the pro-
duction of secondary metabolites with the ex-type strains
of species from sect. Candidi (Table 2) and found to be
quite different. They both produced members of the chlor-
flavonin and terphenyllin biosynthetic families, as do most
species in sect. Candidi, but CCF 4654 additionally pro-
duced 6-epi-stepacidin, formerly found in A. taichungensis.
The “polar compound X” has until now only been found in
A. pragensis CCF 3962T and in isolate IBT 12659, which
is phylogenetically close to A. tritici (Frisvad and Hubka,
Table 2. Secondary metabolites produced by Aspergillus pragensis and other species belonging to Aspergillus section Candidi.
Species Strain numbersa
A. pragensis CCF 3962T = CBS 135591T =
IBT 32274T = NRRL 62491T
CCF 4654 = IBT 32701
A. campestris CBS 348.81T = IMI 259099T =
NRRL 13001T = IBT 13382
A. candidus CBS 566.65T = IMI 091889 T =
NRRL 303 T = IBT 28566T
A. taichungensis IBT 19404T = PF 1167T
A. tritici CBS 266.81T = IBT 21956T
a
Culture collection abbreviations: PF, collection of Division of Geoscience, Osaka University, Japan; other abbreviations are listed in Table 1.
b
The exact chemical structure of some extrolites is not yet known and they are provisionally designated (e.g. DOT“, compound X, etc.). They were identified by
characteristic ultraviolet spectra and retention times (Supplementary Table 1).
Medical Mycology, 2014, Vol. 52, No. 6
unpublished data). Ultraviolet (UV) spectra and retention
times of metabolites found in species from sect. Candidi are
listed in Supplementary Table 1.
Antifungal susceptibility testing
Drug susceptibility test results from the disc diffusion
method for seven clinical isolates belonging to sect. Candidi
are summarized in Table 3. Zone diameter categories for
the isolates were assigned as susceptible (S), intermediate
(I), and resistant (R), according to the manufacturer’s in-
structions (Supplementary Table 2). All isolates tested were
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
found to be susceptible to common antifungal agents used
specifically to treat superficial human infections. When us-
ing Etest, the isolates of A. candidus and A. tritici showed
low minimal inhibitory concentrations (MICs) to azole
derivates and amphotericin B, whereas elevated MICs for
azole derivates were noted for both A. pragensis isolates
(Table 4).
Taxonomy
Aspergillus pragensis sp. nov. Hubka, Frisvad & M. Kolařı́k
(Fig. 2), MB800371
Description: Colonies on MEA attaining a diameter of 9–
11 mm in 7 d (16–18 after 14 d) at 25◦ C, white, very slight
pinkish tint may be present, colonies slightly elevated in the
center with submerged margins, floccose, no production of
diffusible pigment, reverse red-brown (visible after 14–21
d). Colonies on CYA attaining a diameter of 11–13 mm
in 7 d (22–24 after 14 d) at 25◦ C, white, conical, floccose,
Secondary metabolitesb
Chlorflavonin, polar compound X, terphenyllin,
3-hydroxyterphenyllin
Chlorflavonin, metabolite, DOT“, 6-epi-stephacidin A,
terphenyllin
Aspergillazine A, candidusin B and C, chlorflavonin,
terphenyllin, 3-hydroxyterphenyllin
Aspergillazine A, candidusin A and B, chlorflavonin,
dechlorochlorflavonin, terphenyllin, 3-hydroxyterphenyllin
Candidusin C, terphenyllin, 3-hydroxyterphenyllin
Candidusin B and D, dechlorochlorflavonin, terphenyllin,
3-hydroxyterphenyllin, xanthoascin
Hubka et al. 571

Table 3. Disk diffusion method (NeoSensitabs tablets) results after 48 h and 72 h of incubation.a

Antifungal agent: Inhibition zone diameter (mm) on RPMI 1640/MHA

Species and strain number
Clotrimazole Econazole Ciclopiroxolamine Terbinafine Nystatin

A. candidusb CCF 3996 20/24/S 32/39/S 32/24/S 41/40/S 20/19/S

(25◦ C, 72 h) CCF 4659 17/26/I-S 39/41/S 33/24/S 30/35/S 20/18/S
A. pragensisb CCF 3962 25/23/S 35/33/S 35/24/S 42/39/S 18/19/S
(25◦ C, 72 h) CCF 4654 23/22/S 29/31/S 32/23/S 32/37/S 17/18/S
A. tritici CCF 4658 28/31/S 34/36/S 30/20/S 44/48/S 21/18/S
(35◦ C, 48 h) CCF 3853 25/28/S 35/40/S 22/20/S 39/45/S 18/16/S
CCF 4653 35/42/S 44/41/S 30/20/S 44/41/S 16/14/S-I

CCF, Culture Collection of Fungi in Prague; I, intermediate; MHA, Mueller–Hinton agar; RPMI 1640, Roswell Park Memorial Institute 1640 medium; R, resistant;
S, susceptible.

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
a
Zone diameter interpretations are listed in Supplementary Table 1.
b
The species is not able to grow at 35◦ C (recommended for antifungal susceptibility testing by manufacturer).

Table 4. Minimal inhibitory concentrations of different antifungals against clinical isolates of Aspergillus from section Candidi
determined by Etest and evaluated after 48 h of incubation.

Antifungal agent, minimal inhibitory concentrations (μg/ml)

Species and strain number
Amphotericin B Voriconazole Itraconazole Posaconazole

A. candidusa CCF 3996 0.25 0.75 0.38 0.125

(25◦ C, 48 h) CCF 4659 0.19 0.38 0.25 0.25
A. pragensisa CCF 3962 0.38 1.5 1.5 1
(25◦ C, 48 h) CCF 4654 0.5 2 3 1
A. tritici CCF 4658 0.25 0.19 0.38 0.094
(35◦ C, 48 h) CCF 3853 0.25 0.125 0.125 0.002
CCF 4653 0.19 0.047 0.064 0.012

CCF, Culture Collection of Fungi in Prague.

a
The species is not able to grow at 35◦ C (recommended for antifungal susceptibility testing by manufacturer).

radially sulcate, no production of diffusible pigment, re-
verse light brown. Colonies on CZA slow-growing attaining
a diameter of 3–8 mm in 7 d (6–10 after 14 d) at 25◦ C,
white, first submerged, plane, floccose; intensive diffusible
grayish-blue to brown-black pigment produced in medium
creating a conspicuous halo surrounding the colony espe-
cially in older cultures, reverse first uncolored, later becom-
ing grayish blue to grey-black. Purple, purple-black to black
sclerotia develop after several weeks of cultivation (usually
after 4–6 weeks), most notably on MEA and CZA. No
growth on MEA at 37◦ C.
Mycelium composed of hyaline, branched, septate,
smooth-walled, 1.5–2.5 μm wide hyphae. Conidial heads
white, radiate, conidiophores hyaline, smooth-walled, usu-
ally 90–600 μm (but up to 1200 μm) long and 3.5–
4.5 μm (–5.5 μm) wide, nonseptate or occasionally with
septum, diminutive conidiophores rarely present and arising
from aerial mycelium, vesicles predominantly globose, 9–21
μm diameter metulae wedge-shaped or cylindrical 4.5–10.5
× 3.5–5.5 μm, covering one half to two thirds of the vesicle,
commonly enlarged and twice as large as the normal metu-
lae, phialides ampuliform, 6–8.5 × 2.5–3.5 μm; conidia
white in mass, globose, 2.5–3.5 μm, smooth.
Diagnosis: The species has white colonies and globose coni-
dia in contrast to yellow colonies and ellipsoidal conidia of
A. campestris. In addition, sclerotia were not observed in
A. campestris but are readily produced by A. pragensis. As-
pergillus tritici and A. taichungensis are able to grow at
37◦ C in contrast to A. pragensis. Very slow growth on all
media (especially on CZA) and red-brown reverse on MEA
distinguish A. pragensis from all species in sect. Candidi,
including A. candidus.
Etymology: adj. pragensis -e relating to the locality of iso-
lation.
Type: Czech Republic, Prague, scrapings from the toenail
of 58-year-old man, 2007, Dr. Magdalena Skořepová as
2876/07 (PRM 922702, a dried herbarium specimen – holo-
type; PRM 922703–922704 – isotypes; CCF 3962T = CBS
135591T = NRRL 62491T = IBT 32274T – culture ex-
holotype).
572 Medical Mycology, 2014, Vol. 52, No. 6

Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016

Figure 2. Morphology of the ex-holotype isolate of Aspergillus pragensis CCF 3962T . (a) Colonies incubated 14 d at 25◦ C on malt extract agar (MEA),
Czapek yeast autolysate agar, and Czapek–Dox agar (CZA) (from the left to right) and reverse; (b) colonies on CZA after 8 weeks of incubation and
reverse; (c) detail of colony on MEA after 6 weeks of incubation with black sclerotia and observed under stereomicroscope; (d) conidial heads on
MEA; (e) detail of colony on CZA after 8 weeks of incubation with purple-black sclerotia; (f) detail of sclerotia under stereo microscope; (g–i, k–m)
biseriate conidiophores, enlarged metulae are apparent on the left conidiophore in the part “h”; (j) section through the sclerotium; (n) smooth and
globose conidia. Scale bars = 10 μm.
Hubka et al.
Dichotomous key to the Aspergillus species belonging to the
sect. Candidi based on colony morphology and diameter on
MEA at 25◦ C, 37◦ C, and 40◦ C:
1a) growth at 37◦ C on MEA after 7 d . . . . . . . . . . . . . . . . . . . 2
1b) no growth at 37◦ C on MEA after 7 d. . . . . . . . . . . . . . . .3
2a) no growth on MEA at 40◦ C after 7 d . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. taichungensis
2b) growth on MEA at 40◦ C after 7 d . . . . . . . . . . . . A. tritici
3a) colonies on MEA at 25◦ C sulfur yellow. . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. campestris
3b) colonies on MEA whitish . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
4a) colonies reverse on MEA at 25◦ C after 14–21 d
red-brown . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. pragensis
4b) colonies reverse on MEA at 25◦ C after 14–21 d whitish
or yellowish brown . . . . . . . . . . . . . . . . . . . . . . A. candidus
Discussion
Clinical importance of section Candidi
Species of Aspergillus are important causative agents of
a broad spectrum of human as well as animal infections
[16]. With respect to the overall importance of the genus
Aspergillus in medical mycology, the significance of sect.
Candidi members is relatively low. However, the spectrum
of clinical entities that have been attributed to A. candidus
is surprisingly broad and comprises invasive aspergillosis
[27], granuloma of the brain [28], sphenoid sinusitis [29],
otitis externa [30–34], and onychomycosis [35–40].
The occurrence of A. candidus and its relatives in clini-
cal samples is relatively common due to wide distribution
of these species in the human environment. The major-
ity of isolates originate from suspected superficial lesions
such as onychomycosis and otitis externa (Table 1), in fact,
but many isolates represent skin, nail, and laboratory con-
taminants. In addition, the confirmation of nondermato-
phyte onychomycosis requires the isolation of the etiologi-
cal agent in two consecutive nail specimens, at least one of
which must be microscopically positive [26]. This criterion
makes the confirmation of many clinical cases impossible
because many patients are treated by antifungals before the
second specimen is taken and patients object to sequence
sample collection. Because of this, the majority of isolates
listed in Table 1 must be considered contaminants, includ-
ing both isolates of A. pragensis. The clinical significance of
isolates from nail was confirmed only for A. tritici isolate
CCF 3853, while A. candidus CCF 3996 was confirmed as
the cause of otomycosis.
Aspergillus candidus as well as A. tritici show very good
susceptibility to some common antifungal agents used to
treat onychomycosis and otomycosis (Table 3). The MICs
of antifungals that are most commonly used in treatment
573
of systemic infections were also low for A. tritici and
A. candidus; this is in contrast to A. pragensis isolates that
showed elevated MICs for azole derivates (Table 4). Our
results are also in agreement with previous susceptibility
testing results of Wildfeuer et al. [41] and Ahmadi et al.
[40].
As described in this study, species from sect. Candidi are
able to cause superficial infections. However, the correct
identification of isolates associated with systemic infections
[27–29], even to the section level, is questionable. While
the identification of A. candidus in all these cases could be
regarded as correct in the context of contemporary taxon-
omy, it must be remembered that the fungus is unable to
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
grow at 37◦ C [3]. Therefore, A. tritici is the more probable
cause of systemic infections because it is able to grow at
37◦ C and is common in clinical material (A. taichungensis
seems to be a very rare species). In addition, many well-
known agents of invasive infections such as A. fumigatus,
A. flavus, and A. terreus are known to produce white-spored
mutants [42–44] and can be misidentified as members of
sect. Candidi. These mutants can be induced, for example,
by UV mutagenesis, and probably have decreased virulence
[45,46]. White-spored strains of A. fumigatus can be dif-
ferentiated by strictly uniseriate conidial heads and pyri-
form vesicle. Conidial heads of A. terreus are biseriate, and
A. flavus usually has mixed uniseriate and biseriate heads
in a single culture. All three species can be simply differen-
tiated from all members of sect. Candidi by their ability to
grow at 45◦ C. White-spored A. flavus strains seem to be the
most common among these species [3], and one such isolate
was included in this study (AK 103/11). Aspergillus carneus
and A. niveus (both sect. Terrei) are naturally white-spored
species and uncommon agents of human infections [47–
50] that also could be misidentified as species from sect.
Candidi, as was an isolate of A. carneus (CCF 4725) from
probable invasive aspergillosis. Unfortunately, the case re-
ports published in the past and associated with A. candidus
contain, in general, very little data on the morphology and
physiology of isolated fungus, making retrospective identi-
fication impossible. Detail morphological and physiological
description of the isolated fungus was included in two cases
of onychomycosis due to “A. candidus” [37,38]. The abil-
ity to grow at 37◦ C and some other phenotypic features
strongly suggest that these cases were caused by A. tritici.
Sequence-based identification
The barcoding ITS locus [51] is not sufficiently informa-
tive to discriminate species from sect. Candidi, and only
A. tritici can be unequivocally differentiated from other
species (this study and Varga et al. [3]). The reliability of the
single unique position in differentiation of A. taichungensis
574
and A. campestris from A. candidus should be confirmed in
the future on a larger number of isolates; at this time, it is
based only on the sequences of the ex-type isolates. Low dis-
criminatory power of the rDNA genes is not only restricted
to sect. Candidi but also is present in many other sections
across the genus Aspergillus [20,21,52–56]. In contrast,
β-tubulin and calmodulin belong to the traditional genetic
markers used for phylogenetic analyses and discrimination
of closely related Aspergillus species [3,53,56–61]; in some
species, these genes also show a considerable level of in-
traspecific variability, making them useable for population
studies [62]. This is also true for members of Aspergillus
sect. Candidi whose species can be clearly distinguished by
these two genes (Fig. 1). The identity of any of the iso-
lates connected with medically significant cases in the past
was not verified by molecular methods. The sequence of
large subunit of rDNA deposited for the causal agent of
onychomycosis attributed to A. candidus by Ahmadi et al.
[40] is not sufficient either for species identification or for
narrowing of species spectrum because the species share
identical LSU sequence (based on data published by Peter-
son [58]). Based on colony morphology, only A. campestris
could be unambiguously excluded; other data on micro-
and macromorphology were insignificant for species identi-
fication. Because of this, the two cases of proven infections
reported here and caused by A. candidus and A. tritici rep-
resent the first proven infections where the members of sect.
Candidi were reliably identified to the species level.
Secondary metabolites
Earlier studies showed that A. candidus, A. campestris
(described originally in sect. Circumdati [63]) and A.
taichungensis (originally described without clear classi-
fication to section [64]) produce secondary metabolites
unique for sect. Candidi, that is, chlorflavonins, ter-
phenyllin and candidusins [65], and this resulted in their
transfer to sect. Candidi based on chemotaxonomic ev-
idence. Legitimacy of these transfers were later con-
firmed by molecular sequencing [3]. A revived species,
A. tritici [3,66], also produced secondary metabolites typi-
cal of sect. Candidi [3], as did the new species, A. pragensis.
The related terphenyllins, terprenins, and candidusins
are present in all five species (Table 2), while chlorflavonin,
dechlorochlorflavonin, or both are produced by isolates
in all species, except A. taichungensis (Table 2). One rea-
son for the common occurrence of terphenyllins and chlor-
flavonins may be that these antioxidant molecules can pro-
tect the white or light-yellow conidia from light and other
forms of radiation [9,15,67]. The dark-brown to purple or
black sclerotia produced by some strains of A. candidus,
Medical Mycology, 2014, Vol. 52, No. 6
A. pragensis, A. taichungensis, and A. tritici indicate that
they can form melanin as protection for their sclerotia, but
the melanins are apparently not produced in the conidia.
Aspergilazine A [68] is produced by A. candidus,
A. campestris, and A. taichungensis. Sphaeropsidin A [69]
was detected in one isolate of A. tritici. Barceloneic lac-
tone B [70] was detected in A. candidus. In addition,
6-epi-staphacidin A was detected in A. pragensis CCF
4654 (Table 2), but has been reported from A. taichungen-
sis [71] in addition to N-hydroxy-6-epi-stephacidin, 6-epi-
avrainvillamide, and 3-epi-notoamide. We did not detect
6-epi-stephacidin A in A. taichungensis IBT 19404T ; Cai
et al. [71] isolated this compound only from rice, a substrate
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
we did not use. When A. taichungensis was grown on a liq-
uid mannitol medium, it produced 15 terphenyllins [72];
however, the precursor of the stephacidins, brevianamide F
[73], was produced in the liquid mannitol medium. By us-
ing a battery of media, including rice, many more secondary
metabolites could probably be detected in the Aspergillus
sect. Candidi isolates listed in Table 2.
Acknowledgments
This research was supported by the Ministry of Education, Youth
and Sports (CZ.1.07/2.3.00/20.0055, CZ.1.07/2.3.00/30.0003, and
SVV project). Molecular genetic analyses were supported by the
project GAUK 607812. We thank Dr Milada Chudı́čková for isola-
tion of DNA and preparation of the cultivation media, Dr Stanislava
Dobiášová for supplying one clinical isolate and Dr Tetsuhiro
Matsuzawa (Chiba University) for translating Japanese written case
report. The mention of firm names or trade names does not imply
that they are endorsed or recommended by the US Department of
Agriculture over other firms or similar products not mentioned.
Declaration of interest
The authors report no conflicts of interest. The authors alone are
responsible for the content and the writing of the paper.
Supplementary material
Supplementary material is available at Medical Mycology online
(http://www.mmy.oxfordjournals.org/).
Supplementary Table 1. Absorption maxima, and bracketed reten-
tion indexes (RI) of secondary metabolites based on a series of
alkylphenones (Frisvad & Thrane, 1987).
Supplementary Table 2. Zone diameter (mm) interpretation in the
disk diffusion method for selected antifungal agents.
References
1. Gams W, Christensen M, Onions AH, Pitt JI, Samson RA. Infra-
generic taxa of Aspergillus. In: Samson RA, Pitt JI, eds. Advances
in Penicillium and Aspergillus Systematics. New York: Plenum
Press, 1985: 55–62.
Hubka et al.
2. Thom C, Raper KB. A Manual of the Aspergilli. Baltimore:
Williams & Wilkins, 1945.
3. Varga J, Frisvad JC, Samson RA. Polyphasic taxonomy of As-
pergillus section Candidi based on molecular, morphological and
physiological data. Stud Mycol 2007; 59: 75–88.
4. Pitt JI, Hocking AD. Aspergillus and related teleomorphs. In: Pitt
J, Hocking A, eds. Fungi and Food Spoilage, 2nd edn. London:
Springer, 2009: 275–337.
5. Papavizas G, Christensen C. Grain storage studies. XXIX. Ef-
fect of invasion by individual species and mixtures of species
of Aspergillus upon germination and development of discolored
germs in wheat. Cereal Chem 1960; 37: 197–203.
6. Sinha R, Wallace H. Storage stability of farm-stored rapeseed
and barley. Can J Plant Sci 1977; 57: 351–365.
7. Takahashi C, Yoshihira K, Natori S, Umeda M. The structures
of toxic metabolites of Aspergillus candidus. I. The compounds
A and E, cytotoxic p-terphenyls. Chem Pharm Bull 1976; 24:
613–620.
8. Shahan TA, Sorenson W, Paulauskis JD, Morey R, Lewis DM.
Concentration- and time-dependent upregulation and release of
the cytokines MIP-2, KC, TNF, and MIP-1 α in rat alveolar
macrophages by fungal spores implicated in airway inflamma-
tion. Am J Respir Cell Mol Biol 1998; 18: 435–440.
9. Yen G-C, Chiang H-C, Wu C-H, Yeh C-T. The protective effects
of Aspergillus candidus metabolites against hydrogen peroxide-
induced oxidative damage to Int 407 cells. Food Chem Toxicol
2003; 41: 1561–1567.
10. Marasas W, Smalley E. Mycoflora, toxicity and nutritive value
of mouldy maize. Onderstepoort J Vet Res 1972; 39: 1–10.
11. Moreau C. Nervous and digestive disorders induced in animals
by food contaminated with molds of the genera Aspergillus,
Penicillium and Fusarium. Rev Mycol Paris 1979; 43: 227–238
[in French].
12. Grazia L, Romano P, Bagni A, Roggiani D, Guglielmi G. The
role of moulds in the ripening process of salami. Food Microbiol
1986; 3: 19–25.
13. Spotti E, Mutti P, Scalari F. Penicillium nalgiovense, P. gladioli,
P. candidum and Aspergillus candidus. Possibility of their use as
starter cultures. Industria Conserve 1994; 69: 237–241.
14. Sunesen L, Stahnke L. Mould starter cultures for dry sausages—
selection, application and effects. Meat Sci 2003; 65: 935–948.
15. Yen GC, Chang YC, Su SW. Antioxidant activity and active
compounds of rice koji fermented with Aspergillus candidus.
Food Chem 2003; 83: 49–54.
16. de Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clini-
cal Fungi, 3rd edn. CD-ROM ed. Utrecht: CBS-KNAW Fungal
Biodiversity Centre, 2009.
17. Hubka V, Kubatova A, Mallatova N et al. Rare and new aeti-
ological agents revealed among 178 clinical Aspergillus strains
obtained from Czech patients and characterised by molecular
sequencing. Med Mycol 2012; 50: 601–610.
18. Krysińska-Traczyk E, Dutkiewicz J. Aspergillus candidus: a res-
piratory hazard associated with grain dust. Ann Agric Environ
Med 2000; 7: 101–109.
19. Samson RA, Houbraken J, Thrane U, Frisvad JC, Andersen B.
Food and IndoorFungi. Utrecht: CBS KNAW Biodiversity Cen-
tre, 2010.
575
20. Hubka V, Kolařı́k M, Kubátová A, Peterson SW. Taxonomi-
cal revision of Eurotium and transfer of species to Aspergillus.
Mycologia 2013; 105: 912–937.
21. Hubka V, Kolařı́k M. β-tubulin paralogue tubC is frequently
misidentified as the benA gene in Aspergillus section Nigri tax-
onomy: primer specificity testing and taxonomic consequences.
Persoonia 2012; 29: 1–10.
22. Tamura K, Peterson D, Peterson N et al. MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evo-
lutionary distance, and maximum parsimony methods. Mol Biol
Evol 2011; 28: 2731–2739.
23. Houbraken J, Spierenburg H, Frisvad JC. Rasamsonia, a new
genus comprising thermotolerant and thermophilic Talaromyces
and Geosmithia species. Antonie Leeuwenhoek 2012; 101:
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
403–421.
24. Frisvad JC, Thrane U. Standardized high-performance liquid
chromatography of 182 mycotoxins and other fungal metabo-
lites based on alkylphenone retention indices and UV-VIS spectra
(diode array detection). J Chrom 1987; 404: 195–214.
25. De Pauw B, Walsh TJ, Donnelly JP et al. Revised definitions
of invasive fungal disease from the European Organization for
Research and Treatment of Cancer/Invasive Fungal Infections
Cooperative Group and the National Institute of Allergy and
Infectious Diseases Mycoses Study Group (EORTC/MSG) Con-
sensus Group. Clin Infect Dis 2008; 46: 1813–1821.
26. Summerbell RC, Cooper E, Bun U, Jamieson F, Gupta AK. Ony-
chomycosis: A critical study of techniques and criteria for con-
firming the etiologic significance of nondermatophytes. Med My-
col 2005; 43: 39–59.
27. Iwasaki K, Tategami T, Sakamoto Y, Yasutake T, Otsubo S. An
operated case report of pulmonary aspergillosis by sapprophytic
infection of Aspergillus candidus in congenital bronchial cyst of
right lower lobe. Kyobu Geka 1991; 44: 429–432 [in Japanese].
28. Linares G, McGarry PA, Baker RD. Solid solitary aspergillotic
granuloma of the brain. Report of a case due to Aspergillus
candidus and review of the literature. Neurology 1971; 21: 177–
184.
29. Avanzini F, Bigoni A, Nicoletti G. A rare case of isolated as-
pergilloma of the sphenoid sinus. Acta Otorhinolaryngol Ital
1991; 11: 483–489 [in Italian].
30. Yassin A, Maher A, Moawad M. Otomycosis: a survey in the
eastern province of Saudi Arabia. J Laryngol Otol 1978; 92:
869–876.
31. Falser N. Fungal infection of the ear—harmless saprophyte or
pathognomonic risk factor? Laryngol Rhinol Otol Ihre Gren-
zgeb 1983; 62: 140–146 [in German].
32. Garcı́a-Agudo L, Aznar-Marı́n P, Galán-Sánchez F et al. Oto-
mycosis due to filamentous fungi. Mycopathologia 2011; 172:
307–310.
33. Vennewald I, Schönlebe J, Klemm E. Mycological and histologi-
cal investigations in humans with middle ear infections. Mycoses
2003; 46: 12–18.
34. Vennewald I, Schönlebe J, Klemm E. Histological studies on
otomycosis. Mycoses 2002; 45: 47–52.
35. Piraccini BM, Tosti A. White superficial onychomycosis: epi-
demiological, clinical, and pathological study of 79 patients.
Arch Dermatol 2004; 140: 696–701.
576
36. Kaben U. Aspergillus candidus Link as the cause of onychomy-
cosis. Z Haut Geschlechtskr 1962; 32: 50–53 [in German].
37. Fragner P, Kubickova V. Onychomycosis due to Aspergillus can-
didus. Cesk Dermatol 1974; 49: 322–324 [in Czech].
38. Cornere B, Eastman M. Onychomycosis due to Aspergillus can-
didus: case report. N Z Med J 1975; 82: 13–15.
39. Zaror L, Moreno M. Onychomycosis due to Aspergillus can-
didus Link. Rev Argent Micol 1980; 3: 13–15 [in Spanish].
40. Ahmadi B, Hashemi SJ, Zaini F et al. A case of onychomycosis
caused by Aspergillus candidus. Med Mycol Case Rep 2012; 1:
45–48.
41. Wildfeuer A, Seidl H, Paule I, Haberreiter A. In vitro evaluation
of voriconazole against clinical isolates of yeasts, moulds and
dermatophytes in comparison with itraconazole, ketoconazole,
amphotericin B and griseofulvin. Mycoses 1998; 41: 309–319.
42. Raper KB, Fennell DI. The genus Aspergillus. Baltimore:
Williams & Wilkins Co., 1965.
43. Jackson JC, Higgins LA, Lin X. Conidiation color mutants of
Aspergillus fumigatus are highly pathogenic to the heterologous
insect host Galleria mellonella. PLoS One 2009; 4: e4224.
44. Cole RJ, Hill RA, Blankenship PD, Sanders TH. Color mutants
of Aspergillus flavus and Aspergillus parasiticus in a study of
preharvest invasion of peanuts. Appl Environ Microbiol 1986;
52: 1128–1131.
45. Jahn B, Koch A, Schmidt A et al. Isolation and characterization
of a pigmentless-conidium mutant of Aspergillus fumigatus with
altered conidial surface and reduced virulence. Infect Immun
1997; 65: 5110–5117.
46. Aufauvre-Brown A, Brown J, Holden D. Comparison of viru-
lence between clinical and environmental isolates of Aspergillus
fumigatus. Eur J Clin Microbiol Infect Dis 1998; 17: 778–780.
47. Auberger J, Lass-Flörl C, Clausen J et al. First case of break-
through pulmonary Aspergillus niveus infection in a patient after
allogeneic hematopoietic stem cell transplantation. Diagn Micro-
biol Infect Dis 2008; 62: 336–339.
48. Pore R, Larsh H. Experimental pathology of Aspergillus terreus-
flavipes group species. Med Mycol 1968; 6: 89–93.
49. Morquer R, Enjalbert L. A new agent aspergillosis in man. Rev
Mycol Paris 1957; 22: 130–154 [in French].
50. Morquer R, Enjalbert L. Morphological and physiological study
of a newly isolated Aspergillus involved in pulmonary infec-
tions in man. C R Soc Biol Paris 1957; 244: 1405–1408
[in French].
51. Schoch C, Seifert K, Huhndorf S et al. The nuclear ribosomal
internal transcribed spacer (ITS) region as a universal DNA bar-
code marker for fungi. Proc Natl Acad Sci U S A 2012; 109:
6241–6246.
52. Nováková A, Hubka V, Saiz-Jimenez C, Kolarik M. Aspergillus
baeticus sp. nov. and Aspergillus thesauricus sp. nov.: two
species in section Usti originating from Spanish caves. Int J Syst
Evol Microbiol 2012; 62: 2778–2785.
53. Jurjevic Z, Peterson SW, Horn BW. Aspergillus section Versi-
colores: nine new species and multilocus DNA sequence based
phylogeny. IMA Fungus 2012; 3: 59–79.
54. Peterson SW. Aspergillus and Penicillium identification using
DNA sequences: barcode or MLST? Appl Microbiol Biotechnol
2012; 95: 339–344.
Medical Mycology, 2014, Vol. 52, No. 6
55. Hubka V, Peterson SW, Frisvad JC et al. Aspergillus waksmanii
sp. nov. and Aspergillus marvanovae sp. nov., two closely related
species in section Fumigati. Int J Syst Evol Microbiol 2013; 63:
783–789.
56. Samson RA, Peterson SW, Frisvad JC, Varga J. New species in
Aspergillus section Terrei. Stud Mycol 2011; 69: 39–55.
57. Jurjević Ž, Peterson SW, Stea G et al. Two novel species of
Aspergillus section Nigri from indoor air. IMA Fungus 2012; 3:
159–173.
58. Peterson SW. Phylogenetic analysis of Aspergillus species using
DNA sequences from four loci. Mycologia 2008; 100: 205–226.
59. Yaguchi T, Matsuzawa T, Tanaka R et al. Two new species of
Neosartorya isolated from soil in Xinjiang, China. Mycoscience
2010; 51: 253–262.
Downloaded from http://mmy.oxfordjournals.org/ at UNAM Direccion General de Bibliotecas on May 27, 2016
60. Soares C, Rodrigues P, Peterson SW, Lima N, Venâncio A. Three
new species of Aspergillus section Flavi isolated from almonds
and maize in Portugal. Mycologia 2012; 104: 682–697.
61. Varga J, Due M, Frisvad JC, Samson RA. Taxonomic revision of
Aspergillus section Clavati based on molecular, morphological
and physiological data. Stud Mycol 2007; 59: 89–106.
62. Nováková A, Hubka V, Dudová Z et al. New species in As-
pergillus section Fumigati from reclamation sites in Wyoming
(USA) and revision of A. viridinutans complex. Fungal Divers
2014; 64: 253–274.
63. Christensen M. The Aspergillus ochraceus group: two new
species from western soils and a synoptic key. Mycologia 1982;
74: 210–225.
64. Yaguchi T, Someya A, Udagawa S. Aspergillus taichungensis, a
new species from Taiwan. Mycoscience 1995; 36: 421–424.
65. Rahbæk L, Frisvad JC, Christophersen C. An amendment of As-
pergillus section Candidi based on chemotaxonomical evidence.
Phytochemistry 2000; 53: 581–586.
66. Mehrotra BS, Basu M. Some interesting new isolates of As-
pergillus from stored wheat and flour. Nova Hedwigia 1976;
27: 597–607.
67. Yen G-C, Chang Y-C, Sheu F, Chiang H-C. Isolation and charac-
terization of antioxidant compounds from Aspergillus candidus
broth filtrate. J Agric Food Chem 2001; 49: 1426–1431.
68. Cai S, Kong X, Wang W et al. Aspergilazine A, a dike-
topiperazine dimer with a rare N-1 to C-6 linkage, from a
marine-derived fungus Aspergillus taichungensis. Tetrahedron
Lett 2012; 53: 2615–2617.
69. Yan T, Guo ZK, Jiang R et al. New flavonol and diterpenoids
from the endophytic fungus Aspergillus sp. YXf3. Planta Med
2013; 79: 348–352.
70. Liu S, Lu C, Huang J, Shen Y. Three new compounds from the
marine fungal strain Aspergillus sp. AF119. Record Nat Prod
2012; 6: 334–338.
71. Cai S, Luan Y, Kong X et al. Isolation and photoinduced conver-
sion of 6-epi-stephacidins from Aspergillus taichungensis. Org
Lett 2013; 15: 2168–2171.
72. Cai S, Sun S, Zhou H et al. Prenylated polyhydroxy-p-terphenyls
from Aspergillus taichungensis ZHN-7-07. J Nat Prod 2011; 74:
1106–1110.
73. Finefield JM, Frisvad JC, Sherman DH, Williams RM. Fungal
origins of the bicyclo [2.2.2] diazaoctane ring system of preny-
lated indole alkaloids. J Nat Prod 2012; 75: 812–833.