Journal of Functional Foods 53 (2019) 227–236

Contents lists available at ScienceDirect

Journal of Functional Foods

journal homepage: www.elsevier.com/locate/jff

The immune-modulation and gut microbiome structure modification T

associated with long-term dietary supplementation of Lactobacillus
rhamnosus using 16S rRNA sequencing analysis
Yaser Gamallata,1, Xiaomeng Rena,1, Abdo Meyiaha, Meiqi Lia, Xinxiu Rena, Yazeed Jamalata,
Siyuan Songa, Luhan Xiea, Bashir Ahmadb, Abdullah Shopita, Haithm Mousac, Yufang Maa,
⁎ ⁎
Yi Xina, , Dapeng Dingc,
a
Department of Biotechnology, College of Basic Medical Science, Dalian Medical University, Dalian, Liaoning 116044, China
b
Department of Pathology and Pathophysiology, College of Basic Medical Science, Dalian Medical University, Dalian, Liaoning 116044, China
c
Department of Clinical Laboratory Medicine, First Affiliated Hospital of Dalian Medical University, Dalian 116011, China

A R T I C LE I N FO A B S T R A C T

Keywords: Probiotic dietary supplementation plays a crucial role in shaping gut microbiota and boost immune-responses.
Lactobacillus rhamnosus (LBR) We herein investigated the potential effect of long-term dietary-supplementation of Lactobacillus rhamnosus
Probiotic (LBR) on gut microbiome structure, metabolome functions, and serum-profile. Our results revealed, LBR long-
Gut microbiome term supplementation reduces the body weight gain, ameliorates serum cytokines and attenuates serum lipo-
16S rRNA
proteins profile. Moreover, LBR enhances biofilms-aerobics. Gut microbiome 16S rRNA analysis revealed LBR
KEGG orthologs
intervention significantly increased the relative abundance of Limnobacter, Turicibacterales, Enterococcus, and
Vagococcus. On the contrary, the abundance of Helicobacteraceae, Rikenellaceae, Roseburia, Dorea, Anaerostipes,
Coprococcus, Lachnospira, Oscillospira, Ruminococcaceae, Clotridiales, S24_7, Bacteroidia and Bacteroidetes found
decreased in LBR treated group. Functional comparison revealed LBR exhibited higher level of energy produc-
tion and conversion, amino acid transport and metabolism functions. Our findings demonstrate that the LBR
dietary supplementation found to be beneficially modulating the immune-response, enhances lipoprotein me-
tabolism, and ameliorates the microbial composition structure and functions.

1. Introduction
The general understanding of gut microbiome as well as the rational
use of probiotics as food supplement received high attentions of re-
search communities in the recent decades (Floch, 2018). Basically,
pathogens cause infections and strongly associated with developing or
promoting disease (Oliveira et al., 2017). Gut microbiome contributes
to the host health directly or indirectly by alters both genetic and
epigenetic factors (Zou, Fang, & Lee, 2018). While dysbiosis alters the
bowel microenvironment, initiate many external systemic disease and
metabolic syndrome (Zou et al., 2018). In fact, there is no clear un-
derstanding of healthy microbiota compositions, because each in-
dividual has a unique composition and distribution structure of the core
microbiota (Bubnov, Spivak, Lazarenko, Bomba, & Boyko, 2015; De
Angelis et al., 2013).
Gut microbiota is an ecologically balanced system dominated by
five bacterial phyla (Ghoshal et al., 2018). Firmicutes contain about
50–60% and included Lactobacillus, Streptococcaceae, and Clostridiales.
The other phyla including Bacteroidetes, Actinobacteria, Proteobacteria,
and Fusobacteria (Floch, 2018; Ghoshal et al., 2018). Despite, com-
mensal microorganisms are essential in intestinal secretions, immune
response, and food metabolism (Cox & Dalloul, 2015; Harata et al.,
2017; Harper, Naghibi, & Garcha, 2018; He & Shi, 2017). In the past
decade’s probiotics dietary supplementation especially, Lactobacillus
species subjected to intensive researches as well as Bifidobacterium,
Bacteroides and Lactococcus as probiotic strains. They found favorably
manipulate the general health through modify gut composition, forms a
harbor that postulated host colon ecosystems, induce immune system
modulation, enhanced the epithelial barrier mucosal functions, and
produce beneficial metabolites (Gamallat et al., 2016; Gill, Shu, Lin,
Rutherfurd, & Cross, 2001; Maldonado Galdeano, Novotny Nunez,
Carmuega, de Moreno de LeBlanc, & Perdigon, 2015; Ren et al., 2017).

⁎
Corresponding authors.
E-mail addresses: jimxin@hotmail.com (Y. Xin), 18098877269@163.com (D. Ding).
1
Contrubuted equally in this study.

https://doi.org/10.1016/j.jff.2018.12.029
Received 19 October 2018; Received in revised form 19 December 2018; Accepted 19 December 2018
1756-4646/ © 2018 Elsevier Ltd. All rights reserved.
Y. Gamallat et al.
Lactobacillus rhamnosus (LBR) one of the well-known probiotic
strains (Kant et al., 2014), it has been early considered as subspecies of
L. casei (Nigar et al., 2018). Also, it used in diary fermented products
and cheese (Kant et al., 2014). It has been received tremendous studies
in the past decades for treating or preventing human disease
(Schnadower et al., 2018). In clinical studies, LBR has been reported
with a beneficial use in prevents of infections (Grompone et al., 2012),
decreased obesity, and lower high cholesterol (Lee, Lo, & Pan, 2013),
and activate dendritic cells and macrophages (Fong, Kirjavainen, Wong,
& El-Nezami, 2015).
The 16S rRNA sequencing approaches helps in identifying micro-
organisms, and understanding the potential interaction, composition,
and the functions associated between health and disease. Moreover, the
functional profiling of the microbial communities using computational
approach database accurately predicts the gene functions from 16S
rRNA sequencing results (Langille et al., 2013).
In this study, we investigated the effect of long-term dietary sup-
plementation of Lactobacillus rhamnosus on gut microbiota structure and
functions as well as the serum lipoprotein profile and associated Th1
Th2 immune response system. The rat animal model used in our ex-
periment but not mice due to that rats has high life span for long term
experiment, and oral gavage can be given with more accuracy
throughout the experiment period as well as for investigating blood and
serum profile rats given a satisfactory volume of blood compared to
mice.
2. Materials and methods
2.1. Ethical statement
All animal experiments was performed in this study is approved by
the Dalian Medical University Animals Care and Use Committee
(Approval Number: SYXK 2016–2018), and comply with the national
and institution guidelines for experimental animals handling.
2.2. Sprague Dawley rats
Four-week-old, female Sprague Dawley Rats were provided by the
Animal Centre of Dalian Medical University. Animals were maintained
in plastic cages at 22 ± 2 °C in a 12 h light/dark cycle with free access
to standard rats’ food and water. The experimental protocols were re-
viewed and approved by Animals Research Ethics Committee of Dalian
Medical University.
2.3. Experimental design
Animals were randomly divided into two groups (each group n = 6
rats): Control (GCO) group, and Lactobacillus rhamnosus CGMCC (LBR)
provided by the Chinese General Microbial Collection Center
(Shanghai, China) were maintained and sub-cultured in our lab. Briefly,
LBR were grown using MRS medium at 37 °C under aerobic condition.
For oral inoculation, the medium contain LBR were centrifuged and
washed with sterile cold PBS, and re-suspended in sterile 0.09% saline
solution to contain 1 × 109 CFU/ml. The GLR group received daily for
30 weeks intragastric gavage contain about one billion CFU Lactobacilli
suspended in 1 ml saline solution, and GCO control group were given
vehicle solution only. The animals body weight was monitored weekly.
The animals were sacrificed under euthanasia at week 30. Serum and
faecal samples were aseptically stored in sterile tubes at −80 °C.
2.4. Serum analysis
The blood serum was obtained from the experimental animals after
anesthesia and allowed to clot for similar period to ensure the accuracy
of biochemistry profile between the experimental groups. The serum
samples were analyzed using HITACHI 7600 series automatic analyzer
228
Journal of Functional Foods 53 (2019) 227–236
(Hitachi High-Technologies Co., Tokyo, Japan) for the following para-
meters; Glucose level (Glu), Alanine Transaminase (ALT), Aspartate
Transaminase (AST), Creatine (Cre), total proteins (TP), Albumin
(ALB), Alkaline Phosphate (ALP), Triglycerides (TG), low density lipo-
protein cholesterol (LDL-C), and high-density lipoprotein cholesterol
(HDL-C).
2.5. Cytokines analysis
Serum cytokines were performed according to manufacturer in-
structions using Aimplex Cytometric beads array Th1/Th2/Th17 cyto-
kine kit (Aimplex Bioscience., China) for investigating; IL-4, IL-10, IL-2,
IL-6, IFN-γ, TNF-α and IL-17a. Calibration curve were constructed by
serial dilution of cytokine standards. Then the samples serum cytokines
sandwich mixture was forms on the capture beads produces fluorescent
signal acquired on BD FACS cytometer (BD BIOSCIENCE, USA).
2.6. Fecal microbiota 16S rRNA sequencing and analysis
Fecal genomic DNA was extracted using PowerMax fecal DNA ex-
traction kit (MoBio Laboratories). The V4 hypervariable region of the
16S rRNA gene was amplified using universal microbial primers 515F
and 806R (Forward primer, CAAGCAGAAGACGGCATACGAGATGTGA
CCTGGAGTTCAGACGTGTGCTCTTCCGATCT (barcode) ACTCCTACGG
GAGGCAGCAG; Reverse primer AATGATACGGCGACCACCGAGATCTA
CACTCTTTCCCTACACGACGC TCTTCCGATCT (barcode) GGACTACH-
VGGGTWTCTAAT) according to Fadrosh et al. (2014). Briefly, the PCR
products were separated on agarose gel and purified using Agencourt
AMPure XP 60 ml Kit (Beckman Coulter, USA), libraries were prepared
for sequencing using Miseq reagent kit (Illumina, USA) and sequenced
with Illumina HiSeq 4000 (Illumina sequencer, USA). Sequence data
reads and picking operational taxonomic unit (OTU) with additional
quality scripts including; dereplication, clusters, and detection of chi-
meras was performed using QIIME software version 1.9 and Vsearch
v1.11.1. The OTUs was assigned for each individual dataset using
SILVA128 database if threshold reached 97% similarity reads. Subse-
quently, GreenGene database were used to classify the algorithm into
their respective OTUs. The phenotypes of the microbe’s parameters
were analyzed using BugBase, a bioinformatics tools to determines
high-level phenotypes present in microbiome samples. The diversity
and abundance of the different microorganism in each experimental
sample were assigned using QIIME software. Taxonomic and phylo-
genic tree was presented using GraPhlAn (Asnicar, Weingart, Tickle,
Huttenhower, & Segata, 2015). Linear discriminant analysis effect size
(LEfSe) were used to estimate the size of components abundance and to
identify communities or species that have significant difference in the
classification of the samples. Community composition heatmap and
UPGAMA clustering analysis were sorted according to the abundance
distribution of the taxonomic unit or the degree of similarity between
the samples was performed using QIIME software. Furthermore, we
presented the key species of the microbial communities with significant
difference of OTUs level as heatmap. Finally, the correlation network
analyzed based on the interrelationship between microorganisms co-
occurrence or co-exclusion were analyzed according to Faust and Raes
(2012).
2.7. Metabolome functional profiling analysis
The functional profiling of gut microbiome was analyzed using 16S
rRNA sequence data and was processed using GreenGene database from
KEGG orthologous (KO) and clusters of orthologous (COG) were ana-
lyzed as early described by Parks et al. The output file was further
analyzed and graphically presented using statistical analysis of meta-
genomic profiles (STAMP v2.1.3) software package (Parks, Tyson,
Hugenholtz, & Beiko, 2014). Functional annotations of prokaryotic taxa
were analyzed using (FAPROTAX) database to establish the relevant
Y. Gamallat et al. Journal of Functional Foods 53 (2019) 227–236

Fig. 1. LBR attenuates body weight gain Serum lipoprotein and ameliorates serum cytokines. (A) Represents group mean body weight trend over 30 weeks. (B) Beads
cytokines expression from serum cytokines of LBR and GCO group. (C) Serum lipoprotein profile. data shown as mean ± SEM. * significant p value < 0.05.

ecological and metabolic functions into putative functional profiles 3. Results

based on the identified taxa in the experimental samples (Louca,
Parfrey, & Doebeli, 2016). 3.1. LBR dietary supplementation suppressed the body weight gain

The effect of dietary supplementation of LBR on body weight gain

2.8. Statistical analysis
Statistical analysis of the data was performed using GraphPad Prizm
(v 6.04). Unpaired t test was applied to compare between the groups.
All values were provided as Mean ± SEM or Mean ± SD. p value <
0.05 were considered significant. The significant different between
groups from 16S rRNA data was performed using Kruskal-Wallis test
from R stats package. Comparison of OTU numbers and phenotype were
performed Mann-Whitney test.
were monitored weekly. There was significant suppress weight gain
difference between LBR group and GCO group (Fig. 1A). At the be-
ginning of the study the groups initial weight was 128.4 ± 8.790 and
138.0 ± 6.504 (p value 0.202) in GCO and GLR groups respectively.
However, at the end of the experiment the weight of animals was
265.8 ± 4.564 and 248.3 ± 4.924 (p value 0.013) respectively. The
mean different in weight gain in GCO and GLR group were
137.4 ± 9.403 and 110.3 ± 8.006 respectively (p value 0.0002).

229
Y. Gamallat et al. Journal of Functional Foods 53 (2019) 227–236

3.2. Long term LBR supplementation ameliorates the Th1 Th2 immune 3.3. LBR long term supplementation effect on serum lipoproteins metabolism
system and metabolites

Serum macrophages and fibroblasts are potential markers for im-
mune boost against infections and antigens activity. Cytokines beads
analysis between GCO and GLR group indicated that after long-term
supplementation of LBR an elevated serum proportion level; IL-4
(3.79 ± 0.63 vs 6.61 ± 0.43, p value 0.002), IL-6 (5.45 ± 0.9 vs
9.19 ± 1.6, p value 0.034), IFN-γ (1.02 ± 0.11 vs 2.5 ± 0.77, p value
0.043), and IL-2 (1.79 ± 0.19 vs 2.29 ± 0.19, p value 0.04), but de-
plete serum TNF-α (2.92 ± 0.13 vs 2.33 ± 0.25, p value 0.0337), and
IL-10 (3.27 ± 0.38 vs 1.16 ± 0.15, p value 0.0002). But there was no
significant difference between the groups in serum IL-17a. Thus, an
immune-modulation in Th1 Th2 cytokines were seen between GCO and
GLR group (Fig. 1B).
In order to evaluate the safety aspects of long-term supplementation
of LBR we analyzed three different potential functions; liver functions
test (AST, ALT), kidney functions (Cre, ALB, Globulin, TP, and ALP) and
general serum lipoproteins profile contents such as; LDL-C, HDL-C, TG
and glucose level. Our results revealed long-term administration of LBR
enhanced the lipoproteins metabolism decreased serum glucose level
(11.43 ± 1.4 vs 6.17 ± 0.72), TG (1.02 ± 0.22 vs 0.76 ± 0.12),
ALP (96.00 ± 11 vs 29.67 ± 2.5), LDL-C (96.00 ± 11.67 vs
29.67 ± 2.5), and ALT (73.83 ± 14.04 vs 53.67 ± 13.22) between
GCO and GLR respectively. Moreover, LBR treatment raised the serum
level of HDL-C (0.68 ± 0.082 vs 0.79 ± 0.07). There was no differ-
ence in serum levels of the ALB, Cre and globulin (Fig. 1C).

Fig. 2. LBR dietary supplementation effect on gut microbiome structure and composition. (A) BugBase analysis characterize microbiome phenotype level; forms
biofilm; anaerobic; contain mobile elements aerobic; facultatively anaerobic; potentially pathogens; stress tolerance; gram positive and gram negative micro-
organism. (B) LBR supplementation effect on gut microbiome phylum level. (C) family and class taxonomic level respectively presented by histogram (D) GraPhlAn
analysis represents class and genus species tree. (E) linear discriminant analysis (LDA) bar based on effect size LEfSe analysis at log 10 presents the key microbiome.

230
Y. Gamallat et al.
3.4. LBR modulates the gut microbiota phenotypes and composition
The sequencing analysis of 16S rRNA revealed all samples got a
goods coverage in GLR and GCO group. The alpha diversity analysis
between GCO and GLR group shown a significant difference in the
Shannon, Chao1, and ace indices for evenness and richness (p value
0.03, 0.042, 0.040; respectively). BugeBase microbial phenotypes
analysis revealed significant increased in biofilms aerobics relative
abundance (p value 0.004) and mobile elements (p value 0.002) in GLR
group as well as gram positive relative abundance (p value 0.008).
Notably, LBR deplete potential pathogens relative abundance (p value
0.004) and gram-negative microbes (p value 0.008) as shown in
(Fig. 2A). The LBR supplementation effect on gut microbiome phylum,
family and genus distribution presented in Fig. 2B and C. Moreover, the
significant class and genus composition presented using Graphlan
(Fig. 2D). Finally, we analyzed and identified the key taxons using
LEfSe analysis (Fig. 2E), our data shown that the abundance level de-
creased by LBR observed including; S24-7, Rikenellaceae, Anaerostipes,
Dorea, Coprococcus, Lachnospira, Roseburia, Oscilospira, and Helico-
bacteriaceae. However, Lactobacillaceae, Enterococcus, Vagococcus, Tur-
icibacter, and Liminobacter were significantly increased. Collectively,
our results suggested LBR has a potential effect to modify gut micro-
biota composition. We further investigate the taxonomic composition
level difference of microbial communities within individual samples
shift found similar upon LBR consumption. Furthermore, there was no
Fig. 3. Microbiome composition heat maps with clustering analysis. (A) The data of each taxonomic level are clustered according to the abundance distribution of the
taxonomic unit or the degree of similarity between the samples, and the clustering results sorted separately according to the taxonomic units and samples abundance
clustering was performed using QIIME software. (B) heatmap of the key microbiome different markers for each sample OTU size abundance at p value < 0.05.
231
Journal of Functional Foods 53 (2019) 227–236
significant deviation observe in the clustering of the data as shown in
Fig. 3A and B. The correlation between taxa genus self-matrix out
presented in Fig. 4.
3.5. LBR ameliorates the gut metabolites functional profile in the rat model
Long term supplementation of LBR modulate the gut metabolites
using KEGG pathways ortholog and Cog, the results obtained from the
16S rRNA sequencing suggested that LBR may improve nutrients ab-
sorption and energy utilization compared to GCO group (Fig. 5).
Moreover, the gut microbiome of GLR group were significantly showing
a high abundance of amino acid transport and metabolism, glycolysis/
gluconeogenesis, citrate cycle (TCA), energy production and conver-
sion, Valine, Leucine biosynthesis, Folate and Fatty acids biosynthesis,
Retinol; Glycine; Serine; and threonine metabolism. On the other side,
LBR depletes glycosphingolipid, and lipopolysaccharide biosynthesis,
Flagellar assembly, Bacterial motility proteins, Polyketide sugar unit
biosynthesis. Together, the LBR supplementation exhibited wide range
of metabolites bioactivity significance compared to GCO group (Sup-
plementary Fig. 1). Our results revealed increased level of glucose lipid
metabolism, and down regulated the contents level which can cause
gastric damage indicating that LBR may help in GIT detoxification.
Supplementary data associated with this article can be found, in the
online version, at https://doi.org/10.1016/j.jff.2018.12.029.
Y. Gamallat et al. Journal of Functional Foods 53 (2019) 227–236

Fig. 3. (continued)

4. Discussion
Probiotics supplementation is an emerging expansion of gut com-
position, clinically it has been suggested to improved bowel in-
flammation, metabolic disorder and antibiotic associated with
dysbiosis, also some conditions due to food poisoning and malnutrition
(Maldonado Galdeano et al., 2015; Zelaya, Laino, Villena, Alvarez, &
Aguero, 2013). In addition, functional foods including probiotics not
helps only in maintaining healthier gut structure and composition but
also maintaining physiological functions of the host, including

232
Y. Gamallat et al. Journal of Functional Foods 53 (2019) 227–236

Fig. 4. LBR supplementation effect on correlation network analysis of gut microbiome. (A) Self matrix out map based on the interrelationship among microbial
members. The node represents the dominant genera and identified in different colors. The line between nodes indicates the correlation between the two genera. The
red and green line indicates positive and negative correlation, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred
to the web version of this article.)

modulates energy metabolism, lipid, sugar and amino acid, and en-
hances the immune system as shown in the current study.
Lactobacillus rhamnosus is one of most probiotics’ species received
attention in the last decade for various disease management and pre-
ventions (Schneider et al., 2014). To our best knowledge this is the first
study using 16S rRNA fecal bacterial genomic sequencing on long term
supplementation of Lactobacillus rhamnosus CGMCC using bioinfor-
matics tools to investigate the effect and functional relationship as well
as the gut metabolome and microbiome structure composition and
functions. Our results further revealed gut microbiota could be altars
not only by genetic factors but environmental factors may over this
circumstance. It is evidenced that the microbiome structure of the gut
are crucially contribute to host health and disease (Fong et al., 2015).
In the current study after 30 weeks of daily oral supplementation of
LBR we found a decreased body weight trend, and enhanced lipid
metabolism as well as no harmful effect on liver, or kidney functions
compared with normal group. Lee et al has reported similar findings
using Lactobacillus spp. on obese mice model (Lee et al., 2013). Kim
et al. studied the effect of LBR on high fat diet mice (Kim et al., 2016).
Both reports support our findings that LBR may decrease body mass and
improve systemic fat metabolism.
Furthermore, LBR treated rats exhibited immuno-modulation com-
pared to control group, LBR upregulated production of serum cytokines
IFN-γ, IL-2, IL-4, IL-6, IL-17a, and diminished serum TNF-α and IL-10.
These results suggesting a potential immuno modulating activity com-
pared with GCO group. The LBR fed group showing an immune

233
Y. Gamallat et al.
Fig. 5. Metabolic Pathways Functional Analysis (A) COG functional predictions from KEGG database level 3 presented with the confidence interval proportion of the
differences, and the p-value indicated on the right side between LBR and GCO groups. (B) Boxplot represented significant functions between groups KEGG level 3. (C)
STAMP analysis of KEGG level 3. (D) Heatmap analysis using FABROTAX database presented for establishing metabolic and other ecological relevant functions in
samples.
response possibly due to natural/acquired immune-response and im-
mune-tolerance associated with bacterial supplementation (Bubnov
et al., 2015; Cox & Dalloul, 2015; Xu & Zhang, 2015). Fong and col-
leagues reported Lactobacillus rhamnosus induces maturation of den-
dritic cells, macrophages and monocytes (Fong et al., 2015). These
activations of immune cytokines fortified barrier function and enhances
pathogen clearance (Westerik, Reid, Sybesma, & Kort, 2018; Wu et al.,
2018). IFN-γ is a critical cytokine against viral and bacterial infections
observed upregulated in GLR group. IL-4 promote Th2 stability and
differentiation, its upregulated in response to allergens following T cell
activation. Increase in IL-4 stimulate T cells and B cells helps to de-
crease pro-inflammatory activity of macrophages and stimulate down-
stream anti-inflammatory pathways (McLeod, Baker, & Ryan, 2015).
Notably, IL-6 seen upregulated in LBR treated animals, IL-6 involved in
lymphocytes and monocytes differentiation, acts as pro-inflammatory
and anti-inflammatory cytokine, its play an essential role in B cells
transition into Ig-secreting cells (Harakal, Rival, Qiao, & Tung, 2016).
IL-10 is an anti-inflammatory cytokine, its down regulate MHC class II
antigens and enhances B cells proliferations a survival (Dennis, Blatner,
Gounari, & Khazaie, 2013). While TNF- α induce inflammatory cyto-
kines initiate the cascade of destructive events which induces several
pro-inflammatory genes (Koni & Flavell, 1998). LBR exert anti-in-
flammatory activity by down regulating both TNF- α, IL-10 and
downstream inflammatory response mediated through upregulation of
234
Journal of Functional Foods 53 (2019) 227–236
IL-2, IL-6, TNF- α. High production of IL-2 also was noted in LBR
treated animals, IL-2 is a natural cytokine and part of natural response
to microbial infection (Liao, Lin, & Leonard, 2011), over expression of
IL-2 in GLR group may has essential function in the immune tolerance,
also it’s up-regulation promoting regulatory T cells and prevents auto
immune disease. IL-2 recombinant protein treatment (aldesleukin) ap-
proved by FDA for the treatment of melanoma and renal cancer (Noble
& Goa, 1997). It has been used also in clinical trials as booster for
chronic viral infection vaccines (Shaker & Younes, 2009). Thus, the
immune activity by LBR may stimulate varies immune response asso-
ciated with production of several cytokines.
The effect of LBR supplementation on gut microbiome structure and
composition was further evaluated with 16S rRNA sequencing. Our
results revealed an enrichment of the abundance of Bacilli a gram-po-
sitive bacterium contains; Bacillales and Lactobacillales belong to
Firmicutes phylum. These promoting metabolic function and plays
important role in maintaining gut integrity, preventing pathogens and
their metabolites (Mendes et al., 2018). As observed in the current
study, the abundance of other Bacilli class was altered by LBR observed
including; Turcibacteraceae and Lactobacillales (vagocuccus) which has
been reported decreased in high diet fats models (Evans et al., 2014;
Kim et al., 2016). Taken together, the alteration of gut microbiome
composition by LBR suggest active metabolism of lipoproteins which
diminished fat dependent microbes and decreased risk of obesity or
Y. Gamallat et al.
related microbes, and these further supported with the results from
blood lipoproteins and glucose metabolites (Ivanovic et al., 2015). LBR
supplementation decrease the abundance of Lachnospiraceae (Anaeros-
tipes, Dorea, Coprococcus, Roseburia, Lachnosepira) and Rhuminococaceae
(Oscillospira), and their reduction often related to fat metabolism as
they are highly observed in obese models (Kameyama & Itoh, 2014;
Nova, Perez de Heredia, Gomez-Martinez, & Marcos, 2016). Anaeros-
tipes is a bacterial genes occurs in human gut found to be functioned as
acetate utilizing, and butyrate-producing bacterium (Kant,
Rasinkangas, Satokari, Pietila, & Palva, 2015). Decreased level of Ru-
minococcus, Helicobacteriaceae also was reported in probiotics treated
groups (Kafshdooz et al., 2017). Moreover, we observed an increased
abundance of Limnobacter, a motile bacteria with ability to oxidize
thiosulphate but not reported in clinical studies (Nguyen & Kim, 2017).
These findings suggested that LBR dietary supplementation remodeling
the gut metabolome related microbiome structure.
We further used the bioinformatics tools to annotate the metabo-
lome functions from 16S rRNA sequencing data, our results revealed
LBR modulate the basic energy metabolism of fat, sugar and amino
acids these maybe due to transformation of many physiological sig-
naling such as anabolism activity, and TCA cycle, decrease of this
function related to metabolic disorders and suggested a potential pro-
tective role of LBR. The observed variations of metabolites in the me-
tabolome profile are correlated with serum lipoproteins profile. It’s also
evidenced that LBR may protects intestine epithelial barriers cells from
trypsin-pepsin induced enteropathy in rats (Orlando et al., 2018) and
gastritis (Schnadower et al., 2018), and also has antimicrobial activity
(Sun, Lu, Li, Sun, & Huang, 2018) and strong adhesion and aggregation
properties which forms a protective biofilm (Klopper, Deane, & Dicks,
2018).
Overall, we observed enhanced lipid metabolism as well as nutrients
absorption and energy utilization maintaining gut integrity, preventing
pathogens and their metabolites, remodeling the gut metabolome
functions.
Acknowledgement
The study was financially supported by the National Natural Science
Foundation of China (81373875) and Liaoning Provincial Program for
Top Discipline of Basic Medical Science (2012CB518803).
Competing interests
All the authors declare that they have no competing interests.
References
Asnicar, F., Weingart, G., Tickle, T. L., Huttenhower, C., & Segata, N. (2015). Compact
graphical representation of phylogenetic data and metadata with GraPhlAn. PeerJ, 3,
e1029. https://doi.org/10.7717/peerj.1029.
Bubnov, R. V., Spivak, M. Y., Lazarenko, L. M., Bomba, A., & Boyko, N. V. (2015).
Probiotics and immunity: Provisional role for personalized diets and disease pre-
vention. EPMA Journal, 6(1), 14. https://doi.org/10.1186/s13167-015-0036-0.
Cox, C. M., & Dalloul, R. A. (2015). Immunomodulatory role of probiotics in poultry and
potential in ovo application. Beneficial Microbe, 6(1), 45–52. https://doi.org/10.
3920/BM2014.0062.
De Angelis, M., Piccolo, M., Vannini, L., Siragusa, S., De Giacomo, A., Serrazzanetti, D. I.,
... Francavilla, R. (2013). Fecal microbiota and metabolome of children with autism
and pervasive developmental disorder not otherwise specified. PLoS One, 8(10),
e76993. https://doi.org/10.1371/journal.pone.0076993.
Dennis, K. L., Blatner, N. R., Gounari, F., & Khazaie, K. (2013). Current status of inter-
leukin-10 and regulatory T-cells in cancer. Current Opinion in Oncology, 25(6),
637–645. https://doi.org/10.1097/CCO.0000000000000006.
Evans, C. C., LePard, K. J., Kwak, J. W., Stancukas, M. C., Laskowski, S., Dougherty, J., ...
Ciancio, M. J. (2014). Exercise prevents weight gain and alters the gut microbiota in a
mouse model of high fat diet-induced obesity. PLoS One, 9(3), e92193. https://doi.
org/10.1371/journal.pone.0092193.
Fadrosh, D. W., Ma, B., Gajer, P., Sengamalay, N., Ott, S., Brotman, R. M., & Ravel, J.
(2014). An improved dual-indexing approach for multiplexed 16S rRNA gene se-
quencing on the Illumina MiSeq platform. Microbiome, 2(1), 6. https://doi.org/10.
1186/2049-2618-2-6.
235
Journal of Functional Foods 53 (2019) 227–236
Faust, K., & Raes, J. (2012). Microbial interactions: From networks to models. Nature
Reviews Microbiology, 10(8), 538–550. https://doi.org/10.1038/nrmicro2832.
Floch, M. H. (2018). The role of prebiotics and probiotics in gastrointestinal disease.
Gastroenterology Clinics of North America, 47(1), 179–191. https://doi.org/10.1016/j.
gtc.2017.09.011.
Fong, F. L. Y., Kirjavainen, P., Wong, V. H. Y., & El-Nezami, H. (2015).
Immunomodulatory effects of Lactobacillus rhamnosus GG on dendritic cells, macro-
phages and monocytes from healthy donors. Journal of Functional Foods, 13, 71–79.
https://doi.org/10.1016/j.jff.2014.12.040.
Gamallat, Y., Meyiah, A., Kuugbee, E. D., Hago, A. M., Chiwala, G., Awadasseid, A., ...
Xin, Y. (2016). Lactobacillus rhamnosus induced epithelial cell apoptosis, ameliorates
inflammation and prevents colon cancer development in an animal model.
Biomedicine and Pharmacotherapy, 83, 536–541. https://doi.org/10.1016/j.biopha.
2016.07.001.
Ghoshal, U. C., Gwee, K. A., Holtmann, G., Li, Y., Park, S. J., Simadibrata, M., ... Cohen, H.
(2018). The role of the microbiome and the use of probiotics in gastrointestinal
disorders in adults in the Asia-Pacific region - background and recommendations of a
regional consensus meeting. Journal of Gastroenterology and Hepatology, 33(1), 57–69.
https://doi.org/10.1111/jgh.13840.
Gill, H. S., Shu, Q., Lin, H., Rutherfurd, K. J., & Cross, M. L. (2001). Protection against
translocating Salmonella typhimurium infection in mice by feeding the immuno-en-
hancing probiotic Lactobacillus rhamnosus strain HN001. Medical Microbiology and
Immunology, 190(3), 97–104.
Grompone, G., Martorell, P., Llopis, S., Gonzalez, N., Genoves, S., Mulet, A. P., ... Ramon,
D. (2012). Anti-inflammatory Lactobacillus rhamnosus CNCM I-3690 strain protects
against oxidative stress and increases lifespan in Caenorhabditis elegans. PLoS One,
7(12), e52493. https://doi.org/10.1371/journal.pone.0052493.
Harakal, J., Rival, C., Qiao, H., & Tung, K. S. (2016). Regulatory T cells control Th2-
dominant murine autoimmune gastritis. Journal of Immunology, 197(1), 27–41.
https://doi.org/10.4049/jimmunol.1502344.
Harata, G., Kumar, H., He, F., Miyazawa, K., Yoda, K., Kawase, M., ... Salminen, S. (2017).
Probiotics modulate gut microbiota and health status in Japanese cedar pollinosis
patients during the pollen season. European Journal of Nutrition, 56(7), 2245–2253.
https://doi.org/10.1007/s00394-016-1264-3.
Harper, A., Naghibi, M. M., & Garcha, D. (2018). The role of bacteria, probiotics and diet
in irritable bowel syndrome. Foods, 7(2), https://doi.org/10.3390/foods7020013.
He, M., & Shi, B. (2017). Gut microbiota as a potential target of metabolic syndrome: The
role of probiotics and prebiotics. Cell & Bioscience, 7, 54. https://doi.org/10.1186/
s13578-017-0183-1.
Ivanovic, N., Minic, R., Dimitrijevic, L., Radojevic Skodric, S., Zivkovic, I., & Djordjevic,
B. (2015). Lactobacillus rhamnosus LA68 and Lactobacillus plantarum WCFS1 differ-
ently influence metabolic and immunological parameters in high fat diet-induced
hypercholesterolemia and hepatic steatosis. Food & Function, 6(2), 558–565. https://
doi.org/10.1039/c4fo00843j.
Kafshdooz, T., Akbarzadeh, A., Majdi Seghinsara, A., Pourhassan, M., Nasrabadi, H. T., &
Milani, M. (2017). Role of probiotics in managing of helicobacter pylori infection: a
review. Drug Research (Stuttgart), 67(2), 88–93. https://doi.org/10.1055/s-0042-
116441.
Kameyama, K., & Itoh, K. (2014). Intestinal colonization by a Lachnospiraceae bacterium
contributes to the development of diabetes in obese mice. Microbes and Environments,
29(4), 427–430. https://doi.org/10.1264/jsme2.ME14054.
Kant, R., Rasinkangas, P., Satokari, R., Pietila, T. E., & Palva, A. (2015). Genome sequence
of the butyrate-producing anaerobic bacterium Anaerostipes hadrusPEL 85. Genome
Announcements, 3(2), https://doi.org/10.1128/genomeA.00224-15.
Kant, R., Rintahaka, J., Yu, X., Sigvart-Mattila, P., Paulin, L., Mecklin, J. P., ... von
Ossowski, I. (2014). A comparative pan-genome perspective of niche-adaptable cell-
surface protein phenotypes in Lactobacillus rhamnosus. PLoS One, 9(7), e102762.
https://doi.org/10.1371/journal.pone.0102762.
Kim, B., Park, K.-Y., Ji, Y., Park, S., Holzapfel, W., & Hyun, C.-K. (2016). Protective effects
of Lactobacillus rhamnosus GG against dyslipidemia in high-fat diet-induced obese
mice. Biochemical and Biophysical Research Communications, 473(2), 530–536. https://
doi.org/10.1016/j.bbrc.2016.03.107.
Klopper, K. B., Deane, S. M., & Dicks, L. M. T. (2018). Aciduric strains of Lactobacillus
reuteri and Lactobacillus rhamnosus, isolated from human feces, have strong adhesion
and aggregation properties. Probiotics and Antimicrobial Proteins, 10(1), 89–97.
https://doi.org/10.1007/s12602-017-9307-5.
Koni, P. A., & Flavell, R. A. (1998). A role for tumor necrosis factor receptor type 1 in gut-
associated lymphoid tissue development: Genetic evidence of synergism with lym-
photoxin beta. Journal of Experimental Medicine, 187(12), 1977–1983.
Langille, M. G., Zaneveld, J., Caporaso, J. G., McDonald, D., Knights, D., Reyes, J. A., ...
Huttenhower, C. (2013). Predictive functional profiling of microbial communities
using 16S rRNA marker gene sequences. Nature Biotechnology, 31(9), 814–821.
https://doi.org/10.1038/nbt.2676.
Lee, B.-H., Lo, Y.-H., & Pan, T.-M. (2013). Anti-obesity activity of Lactobacillus fermented
soy milk products. Journal of Functional Foods, 5(2), 905–913. https://doi.org/10.
1016/j.jff.2013.01.040.
Liao, W., Lin, J. X., & Leonard, W. J. (2011). IL-2 family cytokines: New insights into the
complex roles of IL-2 as a broad regulator of T helper cell differentiation. Current
Opinion in Immunology, 23(5), 598–604. https://doi.org/10.1016/j.coi.2011.08.003.
Louca, S., Parfrey, L. W., & Doebeli, M. (2016). Decoupling function and taxonomy in the
global ocean microbiome. Science, 353(6305), 1272–1277. https://doi.org/10.1126/
science.aaf4507.
Maldonado Galdeano, C., Novotny Nunez, I., Carmuega, E., de Moreno de LeBlanc, A., &
Perdigon, G. (2015). Role of probiotics and functional foods in health: Gut immune
stimulation by two probiotic strains and a potential probiotic yoghurt. Endocrine
Metabolic & Immune Disorders - Drug Targets, 15(1), 37–45.
Y. Gamallat et al.
McLeod, J. J., Baker, B., & Ryan, J. J. (2015). Mast cell production and response to IL-4
and IL-13. Cytokine, 75(1), 57–61. https://doi.org/10.1016/j.cyto.2015.05.019.
Mendes, M. C. S., Paulino, D. S., Brambilla, S. R., Camargo, J. A., Persinoti, G. F., &
Carvalheira, J. B. C. (2018). Microbiota modification by probiotic supplementation
reduces colitis associated colon cancer in mice. World Journal of Gastroenterology,
24(18), 1995–2008. https://doi.org/10.3748/wjg.v24.i18.1995.
Nguyen, T. M., & Kim, J. (2017). Limnobacter humi sp. nov., a thiosulfate-oxidizing,
heterotrophic bacterium isolated from humus soil, and emended description of the
genus Limnobacter Spring et al. 2001. Journal of Microbiology, 55(7), 508–513.
https://doi.org/10.1007/s12275-017-6645-7.
Nigar, S., Yamamoto, Y., Okajima, T., Sato, T., Ogita, T., & Shimosato, T. (2018). Immune
synergistic oligodeoxynucleotide from Lactobacillus rhamnosus GG enhances the im-
mune response upon co-stimulation by bacterial and fungal cell wall components.
Animal Science Journal, 89(10), 1504–1511. https://doi.org/10.1111/asj.13082.
Noble, S., & Goa, K. L. (1997). Aldesleukin (recombinant interleukin-2). BioDrugs, 7(5),
394–422. https://doi.org/10.2165/00063030-199707050-00007.
Nova, E., Perez de Heredia, F., Gomez-Martinez, S., & Marcos, A. (2016). The role of
probiotics on the microbiota: Effect on obesity. Nutrition in Clinical Practice, 31(3),
387–400. https://doi.org/10.1177/0884533615620350.
Oliveira, L. C., Silveira, A. M. M., Monteiro, A. S., Dos Santos, V. L., Nicoli, J. R., Azevedo,
V. A. C., ... Nardi, R. M. D. (2017). In silico prediction, in vitro antibacterial spectrum,
and physicochemical properties of a putative bacteriocin produced by Lactobacillus
rhamnosus strain L156.4. Frontiers in Microbiology, 8, 876. https://doi.org/10.3389/
fmicb.2017.00876.
Orlando, A., Linsalata, M., Bianco, G., Notarnicola, M., D'Attoma, B., Scavo, M. P., ...
Russo, F. (2018). Lactobacillus rhamnosus GG protects the epithelial barrier of Wistar
rats from the pepsin-trypsin-digested gliadin (PTG)-induced enteropathy. Nutrients,
10(11), https://doi.org/10.3390/nu10111698.
Parks, D. H., Tyson, G. W., Hugenholtz, P., & Beiko, R. G. (2014). STAMP: Statistical
analysis of taxonomic and functional profiles. Bioinformatics, 30(21), 3123–3124.
https://doi.org/10.1093/bioinformatics/btu494.
Ren, X., Zhu, Y., Gamallat, Y., Ma, S., Chiwala, G., Meyiah, A., & Xin, Y. (2017). E. coli
O124 K72 alters the intestinal barrier and the tight junctions proteins of guinea pig
intestine. Biomedicine and Pharmacotherapy, 94, 468–473. https://doi.org/10.1016/j.
236
Journal of Functional Foods 53 (2019) 227–236
biopha.2017.07.123.
Schnadower, D., Tarr, P. I., Casper, T. C., Gorelick, M. H., Dean, J. M., O'Connell, K. J., ...
Freedman, S. B. (2018). Lactobacillus rhamnosus GG versus placebo for acute gastro-
enteritis in children. New England Journal of Medicine, 379(21), 2002–2014. https://
doi.org/10.1056/NEJMoa1802598.
Schneider, A. C., Machado, A. B., de Assis, A. M., Hermes, D. M., Schaefer, P. G., Guizzo,
R., ... da Silveira, T. R. (2014). Effects of Lactobacillus rhamnosus GG on hepatic and
serum lipid profiles in zebrafish exposed to ethanol. Zebrafish, 11(4), 371–378.
https://doi.org/10.1089/zeb.2013.0968.
Shaker, M. A., & Younes, H. M. (2009). Interleukin-2: Evaluation of routes of adminis-
tration and current delivery systems in cancer therapy. Journal of Pharmaceutical
Sciences, 98(7), 2268–2298. https://doi.org/10.1002/jps.21596.
Sun, L., Lu, Z., Li, J., Sun, F., & Huang, R. (2018). Comparative genomics and tran-
scriptome analysis of Lactobacillus rhamnosus ATCC 11443 and the mutant strain SCT-
10-10-60 with enhanced L-lactic acid production capacity. Molecular Genetics and
Genomics, 293(1), 265–276. https://doi.org/10.1007/s00438-017-1379-0.
Westerik, N., Reid, G., Sybesma, W., & Kort, R. (2018). The probiotic Lactobacillus
rhamnosus for alleviation of helicobacter pylori-associated gastric pathology in East
Africa. Frontiers in Microbiology, 9, 1873. https://doi.org/10.3389/fmicb.2018.
01873.
Wu, J., Yang, K., Wu, W., Tang, Q., Zhong, Y., Gross, G., ... Cai, W. (2018). Soluble
mediators from Lactobacillus rhamnosus gorbach-goldin support intestinal barrier
function in rats after massive small-bowel resection. JPEN – Journal of Parenteral and
Enteral Nutrition, 42(6), 1026–1034. https://doi.org/10.1002/jpen.1044.
Xu, X., & Zhang, X. (2015). Effects of cyclophosphamide on immune system and gut
microbiota in mice. Microbiological Research, 171, 97–106. https://doi.org/10.1016/j.
micres.2014.11.002.
Zelaya, H., Laino, J., Villena, J., Alvarez, S., & Aguero, G. (2013). Lactobacillus rhamnosus
CRL1505 beneficially modulates the immuno-coagulative response after pneumo-
coccal infection in immunocompromised malnourished mice. Canadian Journal of
Microbiology, 59(10), 684–693. https://doi.org/10.1139/cjm-2013-0361.
Zou, S., Fang, L., & Lee, M. H. (2018). Dysbiosis of gut microbiota in promoting the
development of colorectal cancer. Gastroenterology Reports (Oxford), 6(1), 1–12.
https://doi.org/10.1093/gastro/gox031.