cj1998 Elsevier Science B.V.

All rights reserved

Biotechnology Annual Review. 1
Volume 4.
M.R. El-Gewely, editor.

Transgenic animal bioreactors in biotechnology and production

of blood proteins
Henryk Lubon
Plasma Derivatives Department, Holland Laboratory, American Red Cross, Rockville, Maryland; De-
partment of Biochemistry, The George Washington University,Washington, D. C. USA; and Department
~

of Genetics, Educational University, Kielce, Poland

Abstract. The regulatory elements of genes used to target the tissue-specific expression of heterol-
ogous human proteins have been studied in vitro and in transgenic mice. Hybrid genes exhibiting
the desired performance have been introduced into large animals. Complex proteins like protein C,
factor IX, factor VIII, fibrinogen and hemoglobin, in addition to simpler proteins like ctl-antitryp-
sin, antithrombin 111, albumin and tissue plasminogen activator have been produced in transgenic
livestock. The amount of functional protein secreted when the transgene is expressed at high levels
may be limited by the required posttranslational modifications in host tissues. This can be overcome
by engineering the transgenic bioreactor to express the appropriate modifying enzymes. Genetically
engineered livestock are thus rapidly becoming a choice for the production of recombinant human
blood proteins.

Keywords: a-lactalbumin, ct 1-antitrypsin, antithrombin 111, P-lactoglobulin, bioreactors, factor VIII,

factor IX, furin, livestock, mammary gland, nuclear factor 1, plasma, posttranslational modifica-
tions, protein C, recombinant, tissue plasminogen activator, transgenic animal bioreactor.

Introduction

The best gift one can give another human being is the gift of life, of blood. Fatal-
ities due to blood loss from injuries caused by accidents or war, postpartum
hemorrhage, surgical intervention or genetic disorders have always accompanied
humans. It was no surprise that physicians started developing blood transfusion
methods in the 17th century, first with blood from animals and then from
humans [I]. Modern blood transhsion developed at the beginning of the 20th
century was a consequence of the monumental discovery of blood groups [2]
and the introduction of anticoagulants. The first transhsion with preserved blood
was performed in World War I. The first blood bank was established in 1936 dur-
ing the Spanish Civil War and a blood banking system was adopted by other
countries during World War 11. That war was also a “plasma war”. But even
before the war, blood collected in hospitals was being regularly stored and trans-
fused. With organized blood collection came innovations in the preservation of
blood components. Most of the 13 million pints of blood collected by the Ameri-

Address for correspondence: Henryk Lubon PhD, 15601 Crabbs Branch Way, Rockville, M D 20855,
USA. Tel.: + 1-301-738-0782. Fax: + 1-301-738-0708. E-mail: lubon@usa.redcross.org
2

can Red Cross between 1941 and 1945 was processed into dried plasma [3].
Component and derivative therapy started during World War I1 when Cohn’s
group developed a method of plasma fractionation [4] as preserving fresh blood
was difficult. Blood-derived products, being highly concentrated and more
stable, were soon partially substituted for whole blood. With the availability of cel-
lular components such as red cells, platelets, leucocytes, and plasma products
[5], surgical procedures became less risky, increasing the demand for these prod-
ucts. The discovery of disease-associated protein deficiencies and abnormalities,
such as coagulation factor VIII (FVIII) in hemophilia A, factor IX (FIX) in
hemophilia B, and more recently, of von Willebrand factor, protein C (HPC), pro-
tein S and factor V disorders have led to increased demands for plasma fractions
and highly purified proteins. Blood and its derivatives have saved countless lives
in the 20th century, and today’s broad spectrum of clinical applications [6] will
expand in the future [7,8].
Blood and plasma-derived therapies brought with them the drawback of the
transmission of human blood-borne infectious agents [9- 1 13. For example,
between 1977 and 1985, more than 50% of hemophiliacs were infected with the
human immunodeficiency virus and AIDS-related deaths accounted for 57% of
their mortality in a recent study [12]. Even though today blood, plasma and plas-
ma-derived products are safer than ever before, several lots of albumin, immuno-
globulin products for intravenous use, human factor VIII (FVIII) concentrates
and al-antitrypsin (AAT) were voluntarily withdrawn from the market in 1995
because of the threat of Creutzfeldt-Jakob disease. In the early 198Os, recombi-
nant DNA technology brought with it great expectations of producing human
blood proteins in bacterial and yeast hosts. However, yields were low and/or
complex eukaryotic posttranslational modifications could not be performed
[ 13- 151. Nonetheless, human serum albumin is under development in yeast
[ 161. Proteins produced in mammalian cell systems may be correctly modified,
but the levels secreted leave much to be desired [ 17-20], Today, only three recom-
binant blood proteins are available from tissue culture sources - FVIII [21,22],
factor IX [23] and factor VIIa [24]. These proteins are free of human pathogens,
but are far more expensive than plasma-derived products [6,7,25].
Transgenic animal bioreactors (TABs) for the “farming”of pharmaceutical pro-
teins were first proposed in 1982 [26,27] following the successhl transfer of
recombinant DNA by microinjection into the pronuclei of fertilized mouse
embryos [28]. The integration of DNA into host chromosomes and germline
transmission [29-341 resulted in tissue-specific expression, and the generation
of animals with unique genotypes and phenotypes [35,36]. The creation of trans-
genic mice was succeeded by the generation of transgenic rabbits, sheep, pigs
[37,38], goats [39] and cows [40,41]. The classic paper from L. Hennighausen’s
group [42] on the expression of human tissue plasminogen activator (tPA) in
mouse milk described a milestone in the implementation of the “farming” con-
cept for blood proteins. Several reviews have recently been published on TABs
[43-501. In this paper, the author will focus on his work which led him to study
 3

TABs for the production of human blood proteins, present new data and share
his perspective on the subject.

Transgenic bioreactors - diversity to explore

The most widely recognized application of the TAB is the production of human
proteins of therapeutic importance. The real potential of TABs is significantly
broader (Fig. 1). The proteins of interest may be secreted into body fluids like
blood [51-541, urine [55], saliva [56], insect hemolymph [57,58]; into the diges-
tive tract [59,60], hair follicles [61], silk glands [62], urinary bladder [55], or the
extracellular matrix of tissues [63-651. The products may also be targeted for
intracellular sequestration in circulatory cells like erythrocytes [66-691, or in
avian eggs, to specific organelles [70-721 or for secretion in association with
lipids, as in the milk fat globule membranes [73]. Proteins may also be localized
on cell surfaces [74] or as structural components of tissue. Changing the compo-
sition of meat [43], milk [75] or skin [76], for instance, will add new nutritional
or commercial value to these products. Proteins for specific nutritional needs
could be produced in this way [49,77]. Some of these objectives may be accom-
plished by modulating the regulation of hormone, growth factor [43,76,78], or
biochemical pathways [60]. Enzymes secreted into the digestive tract can improve
the nutrient extraction and conversion processes, making animal feeding more
efficient and economical [59,79]. Peptides with bacteriostatic activity [80] can
prevent infections like mastitis minimizing financial losses connected with the
treatment of animals, and/or improve the stability of milk. Proteins secreted to
urine may change the composition of urine and perhaps one could ameliorate
the unpleasant odors associated with livestock operations, or more important,
use the altered urine for improved waste management. Novel mammalian cell
lines may be derived from tissues of transgenic animals [81] to produce human
proteins [82,83], while cells and organs may be used in xenotransplantation
[84-871.
Yodel (1) SECRETION INTO: (A) Body fluids
Animals: Milk
Blood
Urine
Saliva
(B) Extracellular matrix

Rats )2(-/ INTRACELLULAR

m\
Production SEQUESTRATION IN: (A) Clrcuiatoly cells
Animals: Erythrocytes
(B) Ogrnelles
(3) TISSUE-SPECIFIC
LOCALIZATION (A) Non-secreted structural
Pigs proteins
Rabbits (B) Proteins modifying
Sheep biochemical pathways
Goats
cows

Fzg. I. Diversity of the transgenic animal bioreactor.

4

The transgene

The performance of a transgene incorporated into a host genome is dependent

on a number of factors. Transcription is controlled by the complex interactions
of nuclear proteins with promoter and other regulatory sequences forming locally
active chromatin structures that direct cell- and tissue specificity, developmental
regulation and hormonal modulation of expression. The promoter is located just
upstream of the transcriptional start site, while enhancer elements can be located
at variable distances both up- and downstream of the transcriptional start site.
Tissue-specific promoter/enhancers are preferred for the production of heterol-
ogous proteins in transgenic animals [50] and for the modification of biochemical
pathways, endocrine and immune systems.
Transgenes are usually inserted randomly into the genome and their expression
is influenced by sequences surrounding their insertion site, producing “position
effects”. This variability in temporal and spatial pattern, and in expression level
has been frequently observed [88,89]. Dominant/locus control regions (LCRs)
act as general chromatin regulators and buffer the transgene [90]. LCRs act in
concert with other regulatory elements, controlling the transcriptional status of
the entire gene locus or chromatin domain. This confers correct developmental
expression of transgenes in a position-independent and copy-number-dependent
manner [91]. As compared to a gene locus, a transgene without all its cis-regula-
tory elements has a heterogeneous chromatin organization and its expression is
position-dependent [92]. Transgenes of native genes with their 5‘ and 3‘ flanking
sequences like sheep p-lactoglobulin (BLG) may hnction in a position-inde-
pendent manner [93]. In contrast to LCRs, the BLG promoter did not hnction
independently and the expression of a BLG promoter/AAT (a1-antitrypsin)
transgene was position-dependent [94]. The insertion of matrix attachment
regions (MARs) [95-971, and the coinjection of transgenes with known high
transcriptional efficiency [98,99] improved transgene efficiency However, these
approaches are not universally applicable and may in fact suppress the expression
of some transgenes [ 100,1011. Coding, intragenic and 5‘ and 3‘ untranslated
regions (UTRs) all play roles in regulating expression. Generally, cDNA-based
transgenes are poorly expressed and genomic sequences or cDNAs with inserted
introns are preferred [ 102,1031. Expression from the large 186 kb gene of human
FVIII [lo41 was not possible earlier, but may be feasible with current techniques
[105,106]. Besides, two other genes are transcribed from the FVIII gene
[ 107,1081. FVIII coding sequences have regions that inhibit transcription [lo91
by blocking transcription elongation [ 1lo], or by silencing transcription [ 1111.
The FVIII cDNA contains an autonomously replicating consensus sequence
and an MAR-like sequence that represses heterologous gene expression [112].
Genomic sequences of heterologous genes may contain elements like enhancers
[ 113- 1151, MARs [ 1141, inhibitory sequences [ 1161, or cis-acting regulatory el-
ements that interfere with the specificity of a heterologous promoter/enhancer
and generate novel patterns of transgene expression [63,117]. Expression in ec-
 5

topic sites may ensue from such elements and/or the interaction of transgene
regulatory and coding sequences [ 118,1191. Endogenous genes and UTRs or
inserted heterologous sequences may play a role in the posttranscriptional regula-
tion of transgene RNA processing, tissue-specific splicing [ 120- 1221, RNA sta-
bility and translation eficiency [123,1241. For example, transcripts from FIX
cDNA or gene constructs were correctly spliced in the liver [51,53], but not
from a cDNA construct in the mammary gland [98,125].
In general, targeting the expression of human proteins to homologous tissues
using the regulatory elements of endogenous animal genes is more predictable.
Hemoglobin A (Hb) is a good example. The regulation of globin genes is well-
understood [91,126] and depends on the 01- and P-genes and the P-globin LCR.
Hb was produced in a tissue-specific manner in mouse [66,67] and pig erythro-
cytes [69,127]. Similarly, FIX [53] and AAT genes [52,54,128,129] containing
native 5' and 3' flanking regions were expressed in animals at endogenous gene
levels or higher, and retained the human pattern of tissue-specific expression.
With the development of new embryonic cell lines from nonpermissive genetic
backgrounds [ 1301, homologous gene replacement techniques [ 1311 and the clon-
ing of whole animals [ 1321, the production of human proteins instead of the host
counterparts will become more common. These technological advances may
one day result in TABs producing human polyclonal antibodies and experimenta-
tion is already underway [133-1371. We are still learning about the regulatory
elements of genes used in targeting heterologous proteins to specific animal tis-
sues. As hybrid genes can exhibit new characteristics, they have to be checked
empirically to determine if they work. The difficult in making the optimal trans-
gene is exemplified by the efforts of one group in expressing human serum albu-
min (HSA) [101,138-1451. As of today, more than 25 hybrid genes have been
tested in transgenic mice and/or cell culture, using three different promoters
and various combinations of coding, intronic and 3' flanking sequences. Trans-
gene control is still under study, and in my opinion, the level of expression is too
low for commercial production.
Proteins with potent biological activity or functions in diverse target tissues, like
human growth hormone [43,146,147] and erythropoietin [148,149], have had
deleterious effects on animals due to imprecise or deregulated transgene expres-
sion [148,149]. Korhonen et al. [150] successfully demonstrated a way to over-
come these problems by creating a BLG-erythropoietin fusion protein with low
in vivo biological activity that could be later cleaved to release the active protein
in vitro. Thus, in some cases it will be necessary to modifL the coding sequences
of transgenes to obtain healthy TABs, to hlly utilize the host cell's posttransla-
tional machinery [151], or to improve upon natural proteins [49].

Control elements of the mouse whey acidic protein gene

Regulatory sequences in the upstream, intragenic and downstream regions of

genes are being studied for their interactions with nuclear proteins in vitro and
6

in vivo. The involvement of these elements in gene regulation is being analyzed by

transcription in vitro, in transient assays and in transgenic animals. Defining the
regulatory elements for controlled transgene performance is a challenge and as
the author has been working on the mouse WAP (mWAP) gene, he will use it to
illustrate the problem. The WAP gene encodes the major whey protein present in
the milk of mice [152,153], rats [154], rabbits [ I S ] , camels [156], and was
recently found in porcine milk [157]. In mouse milk its concentration reaches 2
mg/ml and in rabbits 15 mg/ml. Its synthesis is nearly undetectable in the virgin
mammary gland, but increases during pregnancy to reach a maximum during
lactation [154,158,159]. The expression of WAP and other milk protein genes is
regulated by the synergistic action of the lactogenic hormones insulin, glucocor-
ticoids, and prolactin [ 1601. Glucocorticoids appear to control WAP and p-ca-
sein gene expression through distinct mechanisms that may entail both direct
and indirect pathways [ 159,161 - 1631. WAP expression is critically dependent on
cell-extracellular matrix interactions [ 164- 1681. WAP expression increases
sharply between days 15 and 17 of pregnancy in mice, while p-casein is induced
on day 10. The temporal pattern of mWAP gene expression during pregnancy
provided a reason to use mWAP gene regulatory sequences to target foreign pro-
teins to milk [42,169].
The author and his co-workers have used in vitro assays [170] to search for
regulatory sequences in the mWAP promoter [171], the rat u-lactalbumin (LAC)
promoter [ 1721, the human immunodeficiency virus enhancer [173] and the pro-
moterlenhancer of the human cytomegalovirus immediate early 1 gene [ 1741. In
the mWAP promoter, we found several sequences recognized by nuclear proteins
from lactating rat mammary glands and mammary epithelial cell lines including
the TGGCA motif which is a part of the consensus sequence TGGC/
A(N)SGCCAA for the nuclear factor 1 (NF1) binding site (Fig. 2)
[170,171,175]. We first noticed that rat mammary gland nuclear extracts con-
tained more binding activity to NF1 sites in the rat LAC promoter than extracts
from HeLa cells [172]. Binding sites at a purine-rich sequence
CCAAGAAGGAAGTG in the WAP promoter and a specific TTTAAA box are
conserved in the promoters of mouse, rat and rabbit WAP (Fig. 211). Some bind-
ing occurred between - 144 and - 1 1 1 in a conserved region present in the pro-
moters of four whey protein genes, with the consensus sequence
TGGCAGSCTCGGCST(G)YTCTCTCT(NTG)TGGCARA [ 1721. Similar
sequences were recognized in the mWAP (Fig. 21) and rat LAC [172] promoters
by nuclear proteins from the mammary glands of virgin, midpregnant and lactat-
ing rats. Proteins from nonmammary cells also bind to some of these sequences
and are members of a family of general transcription factors that recognize and
regulate other genes studied by us [ 173,174,176- 1781. This is supported by the
efficient transcription of the mWAP promoter in vitro in nuclear extracts from
mammary and nonmammary cells, the activation of the cytomegalovirus
immediate early 1 gene promoter by sequences upstream of the mWAPTTTAAA
box upon transfection into nonmammary cells [ 1791, and the low-level expression
 7

HLP91
Fig. 2. Regulatory elements in the 5' flanking region of the mouse WAP gene. I: DNasel protection
analysis of the - 354 to +24 SstI-KpnI fragment of the mWAP promoter was performed as described
[170,171]. A/G Maxam and Gilbert sequencing reaction (M), DNAsel digestion products in the ab-
sence (C), and presence of nuclear proteins from virgin (V), midpregnant (P) and lactating (L) rat
mammary glands. Protected regions are denoted by vertical bars, DNAsel hypersensitive sites by ar-
rows and nucleotide positions with respect to the cap site by numbers. A hypersensitive site character-
istic of Etsl binding is marked bya large arrow. Etsl: a transformation-specific protein produced by
the gene ets discovered in the E26 avian erythroblastosis virus. 11: Nuclear protein binding sites in
the mWAP promoter. Sites identified by exonuclease 111 digestion are marked by red boxes
[171,175], by DNAse I protection by red dots [171] and regions protected by GR by green bars
[ 18I]. The MAF/Ets I site is denoted by a blue bar [ 182,1831, an F1 I site (ACAAAG) by a black bar
[182], two CKINBF sites [I841 by orange bars and three putative STAT5 sites (185-1871 by yellow
bars. Hexanucleotide sequences corresponding to delayed secondary GR sites are highlighted in yel-
low and NFI sites in pale blue. GR: glucocorticoid receptor, MAF/Ets: mammary cell-activating fac-
tor, CKINBF: feline kidney CK cell factor/ negative regulatory element binding factor, STATS: signal
transduction and activator of transcription factor 5 . 111: Diagram of the 5' flanking region of mWAP
gene from mouse strains GR and C57BLl6 ((257) [I@]. The red line denotes the sequence between
- 1636 and +24 that is 99% conserved between the two strains. S: SuulllA, E: EcoR1, B: BuniHI,
K: Kpnl restriction enzyme cleavage sites.

of mWAP gene in nonmammary tissues [ 169,1801.

Transfection studies in HC11 mammary cells demonstrated the importance of
some of these binding sites in regulating mWAP promoter function. The tran-
8

scriptional factor mammary cell-activating factor (MAF) that recognizes the

sequence GPuPuGC/GAAG/T, binds to the mWAP promoter, is important for
hormone-independent function [182] and belongs to the Ets family of DNA-
binding proteins [ 1831. Analysis of 5' deletions of the mWAP promoter uncovered
a negative regulatory element between - 210 and - 195 [182]. Deletion of the
ACAAAG sequence between - 195 and - 165 (Fig. 211) decreased expression
by 80%. A deletion of one of the half-palindromic NF1 sites located between
- 165 and - 133 practically abolished expression. This indicates that the combi-
nation of factors binding to these sites is a key regulatory element in controlling
expression from the mWAP promoter. Interdigitated binding sites for NF1,
MAF/Ets and/or ACAAAG factors are present in the upstream region of whey
protein genes such as BLG [185], rat WAC rat, bovine and human LAC
[172,182].
The sequences between - 231 and - 71 of the mWAP promoter were found to
contain multiple glucocorticoid receptor (GR) binding sites (Fig. 211) [ 1811 com-
prising sequence motifs related to the delayed secondary glucocorticoid response
elements [189]. The GR-binding sites are in close proximity to or overlap with
binding sites for other factors.This suggests a cooperation between GR and other
transcription factors. In HC 1 1 cells, 0.45 kb of 5'-flanking sequences remain hor-
monally responsive to prolactin and dexamethasone induction, with a minimal
response region extending from - 165 to +24 [190]. However, the main mWAP
gene hormone response element(@was found in the region between - 1.1 and
-0.55 kb [191], in contrast to the - 1.8 and - 3.0 kb region ofrabbit WAP [192].
The sequence recognized by MAF contains the GGAA/T core motif charac-
teristic of the Ets transcription factor binding site. A hypersensitive site was
seen close to the TTCC sequence on the complementary strand of mWAP promo-
ter (Fig. 211) [171], a characteristic pattern caused by Etsl binding [193,194].
Recombinant Etsl bound to this site [ 1871. In transgenic mice, mWAP transgenes
with a normal Ets site are expressed on day 13 of pregnancy, with increases in
late pregnancy and lactation. Transgenes containing a mutation in the Ets site
were not expressed at midpregnancy, but were expressed during lactation. Dele-
tion of sequences between - 122 and - 9 1 removing the Ets site but leaving the
proximal NF1 sites intact did not affect expression during lactation [187]. A
transgene containing only 89 bp of the promoter but retaining the most proximal
NF1 site targeted expression of human growth hormone preferentially to the
mammary gland [119], suggesting the importance of N F l binding for mWAP
gene regulation. These sites are not conserved in the rat WAP promoter and
may explain the lack of expression of rat WAP transgenes containing 535 bp of
promoter [195]. In contrast, the introduction of mutations into a stretch of 16
bp overlapping the TTTAAA box of mWAP promoter did not change the tran-
scriptional activity of the WAP transgene during pregnancy and lactation (T.Bur-
don, R.J. Wall and L. Hennighausen, personal communication). It is therefore
possible that general transcription factors binding to a heterologous core promo-
ter sequence may make contact with transcriptional activators bound to other
 9

regulatory sequences in the mWAP promoter, changing the conformation of

DNA and thereby modulating transcription. We have proposed such a mecha-
nism for the interaction of the cytomegalovirus immediate early 1 gene promoter
with its transcriptional complex and enhancer DNA-binding protein [ 176,
reviewed in 1961.
The 2.5 kb upstream region controlled the expression of mWAP transgenes in
the mammary gland of mice [162] and pigs (Fig. 2111) [197]. The -949 bp
upstream region of the rat WAP gene controlled expression of a rat WAP trans-
gene in the mammary gland of mice [198] and elements present in the 3’ untrans-
lated region contributed to the level of expression [199]. Two regions of specific
DNase I-hypersensitivity located at approximately - 150 and - 800 were identi-
fied in the rat WAP 5’ flanking region [195]. The proximal site may act with tran-
scription complexes assembled on the TATA box, and with other nuclear factors
bound to sites identified in the mWAP promoter and conserved in rat WAP.
Similarly, we also detected a DNaseI-hypersensitive site in the proximal region
of rat LAC [172]. The region of the distal site between - 853 and - 720 bp is
essential for transgene expression and contains binding sites for NF1, GR [200]
and signal transduction and activator of transcription factor 5 (STATS)
[ 186,2011which was called milk protein binding factor [ 1851 or mammary gland
factor [202] in earlier reports. This region conferred glucocorticoid-inducibility
and changes in transgene expression correlated with the appearance of DNaseI
hypersensitive sites [200]. STAT5 is a latent transcription factor that becomes
activated by a tyrosine-specific protein kinase, Jak2, associated with the prolactin
receptor [203]. The activated STAT5 binds to DNA and is a central component
of the lactogenic hormone signalling pathway The GR can act as a transcrip-
tional coactivator for STAT5 and enhance transcription. STAT5 forms a complex
with GR which binds DNA independently of the glucocorticoid-response el-
ement [204]. Introduction of point mutations into one or both NF1-binding sites
abolished rat WAP transgene expression. Mutation of the STAT5-binding site
reduced transgene expression by approximately 90% per gene copy, but did not
alter tissue specificity [ 1861. Thus, the distal region of the rat WAP promoter con-
tains a cluster of transcription factor-binding sites which are highly conserved in
both mouse and rat WAP genes (Fig. 211) [186]. However, an mWAP minigene
with a deleted third intron containing only 973 bp 5’ flanking region exhibited
activity in only one out of 17 lines. Addition of MARS released this transgene
from severe position effects [97]. The endogenous mWAP gene sequences that
mediate this process are still unknown.
Many organs and cell types respond to pregnancy hormones, however, induc-
tion of WAP does not occur [ 1601 and in transfection experiments, the WAP pro-
moter mediates a mammary-specific cell response in the absence of lactogenic
hormones [ 1911. Additional regulatory mechanisms like enhancer and repressor
elements may play a role in tissue-specific expression. The author and his co-
workers identified an enhancer-like element between - 175 and - 25 using in
vitro transcription and in vivo transfection assays [ 1791. A negative regulatory
10

element located between -413 and -93 has been found by others (Fig. 211)
[ 184,2051. Negative regulatory element binding factor(s) (NBF) are present in
cells that do not express WAP and may restrict WAP expression to the mammary
gland. For mammary-specific expression of WAP and other whey protein genes,
the author favors the idea of the existence of unidentified mammary gland spe-
cific factor(s), or modified form(s) of this factor(s), and/or factors already identi-
fied in the regulation of milk protein genes. There may be forms of NF1 [206],
STAT5 [207,208] and Ets proteins [209] with specific splicing, posttranslational
modifications, or heterodimers which are preferentially expressed in the mam-
mary gland, that together with other factors contribute to tissue specificity. This
is based on the demonstration that -89 bp of mWAP 5' sequences were sufFi-
cient to allow expression during pregnancy and early lactation [119] and on the
binding of at least four proteins, whose fhctions are still unknown, to a region
between - 89 and +24 [171,175] (Fig. 2). N F l is a good example of a known
transcription factor with more than a dozen cloned N F l isoforms [206]. These
isoforms may be tissue-specific, as illustrated by the high levels of NFl/Redl
and low levels of N F l /X in hamster liver [210]. They may also be differentially
regulated by hormones, other factors and cell-cell contact [211]. NF1 serves as
a trans-acting factor in adenovirus replication [212] and in eukaryotic class I1
gene transcription. Additionally, NF1 acts as a silencer for genes encoding reti-
nol-binding protein [2 131, 3-hydroxy-3-methylglutaryl coenzyme A reductase
[210], growth hormone [214], mouse a2(I) collagen [215] and peripherin [216].
For other genes, NF1 acts as a transcriptional activator, including the a-globin
gene [217], human hepatitis B virus S gene [218], the myelin basic protein gene
[219] and the ctlb-adrenergic receptor gene [220]. Particular species of NFl
increase in level in the bovine mammary gland during lactation [2211. Two forms
of N F l from lactating sheep mammary gland with different affinities bind to
five sites in the minimal 5' regulatory region of the sheep BLG gene. The pres-
ence of a mammary-gland-specific form has been suggested [ 1851 as tissue speci-
ficity does not depend upon the three STAT5-binding sites [222].
Knowledge of the regulatory elements of genes helps in the design of more efi-
cient hybrid genes and opens up a way to increase or modulate the performance
of native regulatory elements. The mWAP promoter with silenced MAF/Etsl el-
ements may be practical for use with proteins that affect mammary gland differ-
entiation during early development and pregnancy. Insertion of a fragment of
the mouse mammary tumor virus long terminal repeat containing four hormone
response elements at - 330 in the - 524 to +1 flanking region of the rat p-casein
gene improved expression of a reporter gene in mice on average by 13-fold
[223]. The glucocorticoid-responsive units of tyrosine aminotransferase, a gene
expressed specifically in rat liver parenchyma, in association with the regulatory
sequences of the ubiquitously-expressed largest subunit of the RNA polymerase
I1 gene, showed the predicted composite pattern of liver-specific glucocorticoid-
responsiveness and ubiquitous expression in mice [224]. Repressor elements limit-
ing expression of milk protein genes in nonmammary tissues may allow the
 11

design of a vector active exclusively in mammary cells. Systems with transcrip-

tional activation switches that permit the quantitative control of transgene activity
in a tissue-specific manner are under development [225,226] and will open up
possibilities for novel types of inducible TABS.

Mouse WAP-plasma protein hybrid genes

Several constructs using the mWAP promoter, gene and 3' UTR were generated
to express human protein C (HPC) in the mammary gland (Fig. 3).
Results obtained were similar in part to the observations of others. When the
HPC cDNA was inserted into the first exon of the mWAP gene, the levels of
expression in mice were low (Table 1). Constructs containing only 1.6 kb of 3'
mWAP gene sequences performed unexpectedly well and the 4.1 kb mWAP pro-
moter improved them firther (Figs. 2111 and 3), similar to a construct containing
the entire HPC gene [229]. This was not limited to HPC, as human fibrinogen
(FIB) and AAT were expressed at mg/ml levels (Table l), and firin at
0.08-0.33 mg/ml levels [72]. The improved performance of the 4.1 vs. the 2.5
kb mWAP promoter proves that the region between - 4.1 and - 2.5 kb contains
previously unidentified regulatory elements enhancing expression, but does not
contain elements required for appropriate developmental regulation (Fig. 13IV)
[188]. Moreover, this region is not conserved between the GR and C57BL/6
mouse strains (Fig. 2111). The effectiveness of the 4.1 kb mWAP promoter in
expressing the AAT gene was surprising. AAT has been frequently expressed
using the regulatory sequences of other genes [52,94,128,230]. Our data show

DNA Construct
m W HFC 3 w
Remoter cONA Wpaa UTR
WAPPC1 k ---,'''-'' I
25kb l5kb 30kb 1 6kb

-
8 8
WAPPCJ
25kb l4kb 16kb

pHU27 C
4 1 kb 15kb l6kb
E, I, E, 3'HPCUTR
pHKM -
4 1 kb 13kb 04kb

4 E.
pHU38 ___I-+---Hb
4.1 kb
€9 4E.4
-- - - - - -4-w--
8.0 kb HPC gen.3
E7 E,
0.4 kb

Fig.3. Schematic representation of mWAP/HPC transgene constructs. WAPPCI [227] and WAPPC3
[228] have been described. pHL227 containing the 4.1 kb mWAP promoter, 1.55 kb KpnI fragment
of HPC cDNA and 1.6 kb 3' mWAP gene flanking sequences and pHL250 containing the 4.1 kb
mWAP promoter, HPC coding sequences with the 1.3 kb first intron and 3' UTR of HPC gene were
prepared (H. Lubon et al., unpublished observations). pHL238 was assembled as described [229].
mWAP gene 5' and 3' sequences are depicted with solid lines, the mWAP gene with a stipled box,
HPC exon sequences (E) with solid boxes and introns (I) with dashed lines. UTR: untranslated re-
gion, S: stop and start codons.
12

Table 1. Plasma proteins produced using the mouse WAP promoter.

Protein Species 2.5 kb WAP promoter 4.1 kb WAP promoter

Construct Expression Number Expression Number

(mgW of lines (mg/ml) of lines

t PAa Mouse 0.05 4 - -

LA-tPA Goat 0.003 1 - -

HSA ' Mouse 0.04-0.15 7 - -

HPC (WAPPCl)d Mouse 0.003-0.01 11 - -
HPC (WAPPC3)' Mouse 0.03-0.3 6 - -

HPC ( ~ H L 2 2 7 ) ~ Mouse - - 0.44-1.53 2

HPC ( ~ H L 2 3 8 ) ~ Mouse - - 0.1-0.9 6
HPC ( ~ H L 2 3 8 ) ~ Mouse - - 0.2- 1.6 4
HPC (WAPPCl)' Pig 0.1-1.0 3 - -
HPC (pHL238)i Pig - - 0.1-1.8 2
Fibrinogenk Mouse 0.01-0.05 6 0.1-0.6 3
Factor IX' Pig 0.2 1 - -

Factor VIIIm Mouse 0.03-0.18 pg/ml 1 - -

Factor VIII" Pig 0.001-0.003 1 - -
AAT gene' Mouse 1-5 2 5-10 2
< 0.1 or n.d. 3 50+ 3

"Pittius et al. [169]; bEbert et al. [39]; 'Ilan et al. [145]; dVelanderet al. [227]; 'Russell [228]; 'W Velan-
der and H. Lubon, unpublished observations; gDrohan et al. [229]; hBigenicmice for HPC and PACE
[303]; 'Velander et al. [264] and Van Cott et al. [335]; 'Van Cott et al. [335]; kButler et al. [279,282],
W Velander, personal communication; 'W Velander et al, personal communication; "H ' . Lubon,
R.K. Paleyanda and D.H. Scandella, unpublished observations; "Paleyanda et al. [235]; "Y. Echelard,
H. Meade and H. Lubon, unpublished observations. (Four founders transgenic for construct
pHL250 did not express rHPC.)

that the mWAP promoter performs almost 100% better than others in mice. This
may be another example of the interaction of regulatory sequences with heterolo-
gous gene sequences to confer improved performance on the hybrid gene, as
compared to endogenous genes and tissues.
In my opinion, for selected plasma proteins like HPC, FIX and FVIII, one can
use cDNAs to obtain the levels required for production, thus avoiding both
known and potential problems associated with genomic sequences. Especially as
I have learned that even the level of protein produced using cDNA transgenes
can stress the posttranslational machinery of mammary cells. Some mWAP/
cDNA constructs work better in pigs as compared to mice, similar to a mWAP
transgene [ 162,197,231-2331 indicating species-dependent expression (Table 1).
The author used this rather conservative approach to target FVIII expression to
the mouse mammary gland (Fig. 41,II) and we found (H. Lubon, R.K. Paleyanda
and D.H. Scandella, unpublished observations) that even the large 7.2 kb FVIII
cDNA was transcribed (Fig. 4111) and the protein secreted into milk (Fig. 4IV).
Although expression levels were low, biologically active FVIII was detected and
its levels increased in homozygous mice (Fig. 4V). These results are in contrast
to experiments with BLG/FIX and BLG/AAT cDNA constructs [234]. Similar
 13

I.

2.5 kb 5' WA6 7.2 kb h M l l &DNA 4.6 kb 3W P gene

p m r

MouaaLim IRMAAssay- APlTTAssay- APTTAssay-

Hetsmrvrrob HS(sr0~llote Hwnorv-
~~ ~

R.1 0.160 Uhnl 0.2 Uhnl 0.0 Uhnl

(33.8 ~rghnl) (40 Wml) (180 nglml)

Fig. 4. mWAP-directed expression of FVIII. I: Structure of mWAP/FVIII transgene. NotI, EcoRI,

KpnI, BamHI: restriction enzyme cleavage sites. 11: Slot blot detection of FVIII transgenic mice.
Three mWAP/FVIII transgenic founder mice were identified out of 14 and lines were established
from f2.1 and f3.1 that transmitted the transgene. CON: control mouse DNA, p225.11: mWAP/
FVIII plasmid DNA. 111: Detection of FVIII expression in the mammary gland. RT-PCR was car-
ried out on total RNA prepared from mouse 0.1.9.10 and PCR products were analyzed on a 2%
agarose gel. Primers specific for human FVIII (1) or random primers (2) for RT reaction, PCR of
RNA from f2.1.9.10 as a control for DNA contamination (3), RT-PCR of control mouse RNA
using FVIIL(4) or mWAP gene-specific (5) primers. PCR negative control (6) and DNA standards
in kb (M). Arrows indicate the 0.6 kb FVIII and 0.224 kb WAP PCR products. FVIII-specific pri-
mers #3604: GATCTGATTTAGTTGGCCCATC and #3204: GTAGACAGCTGTCCAGAG-
GAA, and WAP-specific primers #1265: ATCCATGTCTCCATGCCTTCTTCT and #1266:
T G T T G A C A G G A C C G G G T C C were used 1V Analysis of rFVlTT in mnurc milk Milk
whey proteins from control (CON) and f3.1.9 transgenic (TRG) mice, and plasma-derived FVIII
(FVIII) were resolved by 7.5% SDS-PAGE under reducing conditions after 5 min thrombin treat-
ment. Western blots were probed with a mixture of Mab 413 against the A2 domain of the heavy
chain and MAb 37 against the light chain of FVIII. The arrow indicates FVIII-specific polypep-
tides of about 90 KDa. V Quantitation of rFVIII in mouse milk. Immunoradiometric assay
(IRMA) was performed as described [236] using iodinated anti-FVIII Fab' fragments. One-stage
activated thromboplastin time ( A m ) assay was performed in FVIII-deficient plasma, as de-
scribed [237]. Normal pooled plasma was employed as a standard in both assays.
Fig. 5. Tissue-specific expression of WAP transgenes. I: Northern blot analysis of total RNA [ 1. 3, 5,
7) and mRNA (2, 4, 6. 8) from human liver. the mammary gland and kidney of WAP/HPC trans-
genic mouse 4.2.10.9 [ I881 and human liver HepG2 cells.To obtain signals of similar intensity, differ-
ent amounts of RNA were loaded in lanes 1 through 8; 3.7, 0.1 I , 0.004, 0.0001, 3.7, 0.096, 2.1 and
0.021 pg, respectively. Blots were hybridized with HPC cDNA probes as in [188].The arrow indicates
the mature rHPC transcript, RNA standards in kb are on the left. 11: Example of the sequence of
rHPC mRNA from the mammary gland. Total RNA from mouse 7.5.4.5 was used for reverse tran-
scription with oligo d(T)16.Oligos #3979 and #3584 were used for PCR and #3584 for cycle se-
quencing of the junctions of the first ( E l ) and second exons (Ez).Oligo #253 and #2269 were used
for PCR and #2269 for cycle sequencing of the junctions of the second and third exons ( E d The
DNA sequences of the junctions are presented on the right. The sequences of the oligos are,
#3979: GCCAGAATGTGGCAGCTCACAAGC: #3584: GAAGGCCAGTGTGTCATC; #253:
CGTGCCCACCAGGTGGTG; #2269: CTCCAAGGGCAAGACCAAGC. 111: Detection of
rHPC in transgenic pig urine. Immunoafinity chromatography using the 8861 MAb against the
heavy chain of HPC was employed to enrich rHPC from the urine of sow 110-3.Western blot of uri-
nary proteins from a control pig resolved by 10% SDS-PAGE under reducing conditions (CON),
rHPC (TRG) and HPC (HPC) were probed with a rabbit anti-HPC polyclonal antibody HC: heavy
chain, LC: light chain. I V Salivary gland-specific expression of rHPC. Slot blot analysis of RNA per-
formed as in [I881 revealed rHPC transcripts in the salivary gland (SG) of line 4.2.10 mice (Trg),
but not in control (Con). Other tissues examined include tongue (Ton), thymus (Thy), liver (Liv), kid-
ney (Kid). brain (Brn) and mammary gland (MG). 0.1 to 0.01-fold less RNA was analyzed from
mammary gland than from other tissues. Immunohistocheniistry of salivary gland sections using
the 8861 MAb further localized rHPC to the ductal epithelial cells. Magnification: 100 x .V Salivary
gland expression of a 4.1 kb WAP promoter/ 0-galactosidase transgene, as detected by X-Gal staining
(G. Robinson and L. Hennighausen, personal communication). Magnification: 100 x , 400 x .
 15

to WAP/HPC constructs, the WAP/FVIII cDNA construct was better expressed

in pigs [235], allowing further characterization of the protein.
It is not uncommon to find trace amounts of transcripts from transgenes of
native [238] or hybrid genes in nontarget tissues [239]. mWAP gene itself is nor-
mally expressed at low levels in other tissues [169,180]. The processing of pre-
mRNA from an mWAP/HPC transgene in the mammary gland and kidney dif-
fers from the human liver and HepG2 cells (Fig. 51). This could be due to tis-
sue-specific splicing events that alter the coding sequences in the mRNA, as
reported for BLG/FIX and BLG/HPC transgenes [ 125,1511. Thus, I prefer to
routinely determine the sequence of the transgene mRNA, or at least check the
exon/exon junctions (Fig. 511). Leaky expression of transgenes in other tissues
may not have an effect if no protein is synthesized. Transgene expression in the
kidney was connected with protein synthesis (H. Lubon and W. Velander, unpub-
lished observations). A sandwich ELISA performed on the urine of WAP/HPC
transgenic mice resulted in the detection of 64-76 ng/ml of rHPC. This was con-
firmed in pigs where rHPC expression levels were high enough to allow detection
by western blotting (Fig. 5111). In the author’s opinion, these “negative” results
illustrate that the urine of livestock animals can be used as another body fluid
for the production of blood and other human proteins. The promoters of genes
like uromodulin and uroplakins that are expressed in the kidney [240] and uri-
nary bladder [55], respectively, may target the secretion of recombinant proteins
to the urine (D. Kerr et al., personal communication). Many products of medical
use are routinely purified from urine, e.g., estrogenic compounds from pregnant
mare urine [241J and gonadotropins from the urine of women [242].
The detection of rHPC in the salivary gland confirmed that some proteins can
be targeted to this tissue as also shown by the use of salivary gland-specific pro-
moters [56]. mWAP gene regulatory elements directed expression of rHPC (Fig.
5IV), and the P-galactosidase reporter gene to these cells (Fig. 5V). Low-level
expression in the salivary gland was likewise reported for bovine K-casein direct-
ed by the goat P-casein promoter [243], for ovine BLG promoter driven AAT
transgenes [93] and for bovine asl-casein promoter driven lysozyme [244].

Exploring the protein modifying capacity of transgenic bioreactors

From the beginning the author believed that blood proteins could be produced in
TABS, but was concerned about the appropriate posttranslational modification
of proteins in homologous and heterologous tissues synthesized at an order of
magnitude higher than usual. This is one of the limiting factors in large-scale
production of recombinant protein and the assumption that the secretory cells
of intact animals could perform these functions better than mammalian cell sys-
tems was only partially true. Below I have summarised our work in this area
and added a discussion on other proteins.
16

II.

Fig.6. Human protein C structure and hnction. I: The 461 amino acid precursor with cleavage sites is
presented. The arrows indicate protein cleavage sites, the numbers denote amino acid residues. Gla:
y-carboxyglutamic acid, EGF: epidermal growth factor-like domain, OH: P-hydroxyaspartate,
CHO-oligosaccharides, AP: activation peptide, Ser, His, Asp: residues of the catalytic triad, PL:
phospholipid, T/TM: thrombin/thrombomodulin,PF4: platelet factor 4, a2-MAC: a2-macroglobulin,
PAI: plasminogen activator inhibitor. 11: Heterogeneity of rHPC purified from pig milk. Two-dimen-
sional gel electrophoresis of rHPC was performed by isoelectric focusing in the first and 15% SDS-
PAGE in the second dimension, as in [256]. The western blot was probed with a sheep polyclonal anti-
body to rHPC. SC: single chain, HC: heavy chain, LC: light chain.

Protein C - our model

We have studied this problem extensively using HPC (Fig. 61). HPC circulates in
plasma as a 62-kDa zymogen of a serine protease and activated HPC has potent
anticoagulant activity [245,246]. The 19 amino acid signal peptide directs trans-
location of the nascent polypeptide into the hepatocyte endoplasmic reticulum
(ER) and is cleaved by a signal peptidase. The 24 residue propeptide mediates
the binding of vitamin-K-dependent (VKD) y-glutamyl carboxylase, an integral
ER membrane protein [247]. The carboxylase utilizes reduced vitamin K, COZ
 17

and O2 to convert nine Glu residues to y-carboxyglutamic acid (Gla), following

the addition of the glycosyl core. The Gla domain is essential for Ca+*-mediated
activation of the zymogen, binding to phospholipids [248], thrombin-thrombo-
modulin [249], platelet factor 4 [250] and for plasminogen activator inhibitor
inactivation [2511. In its transit through the Golgi, complex carbohydrates are
added to four N-linked sites, the propeptide removed and an internal KR dipep-
tide cleaved to generate a light and a heavy chain held together by a disulfide
bond. HPC undergoes p-hydroxylation through the action of the aspartyl p-
hydroxylase at Asn residues in the epidermal growth factor-like (EGF) domain,
which also binds Ca+' [252]. All the above posttranslational modifications could
contribute to significant heterogeneity of the recombinant protein (Fig. 611). After
secretion, the activation peptide is proteolytically cleaved by thrombin to generate
activated HPC. The heavy chain contains the serine protease domain and is
implicated in multiple roles, such as mononuclear phagocyte response [253], c12-
macroglobulin binding [254], inactivation of plasminogen activator inhibitor
[2511 and inhibition of cytokine production by monocytes [255].
The five other plasmaVKD glycoproteins, prothrombin, factor VII, FIX, factor
X (FX), and protein S are synthesized with propeptides and contain 10-12 Gla
residues. FX and protein S contain P-hydroxyaspartate in their EGF domains.
FIX has five O-linked and two N-linked glycosylation sites. O-Fucosylation in
the EGF domain of FIX and N-fucosylation of HPC have been described
[257,258]. Moreover, FIX is phosphorylated at Ser'58 and sulfated at TyrlS5in
its activation peptide [259].
A complex protein, HPC, was a challenge for the TAB. The signal peptide was
removed in the mammary gland [229,260] similar to that of rHb [261], rAAT
[54,262] and rtPA [42,169,263] by host enzymes. Subsequently, we were the first
to report that the proteolytic processing of the rHPC propeptide was incomplete
in the mouse mammary gland [229]. Compared to HPC, 20-30% of rHPC
secreted into transgenic mouse [227,229] or pig [260,264] milk contained the pro-
peptide (Fig. 7). Amino acid sequencing revealed that 40-60% of pig rHPC
existed in the single-chain form (Fig. 7). We also observed that y-carboxylation
was inefficient in the mouse (Fig. 711) and more efficient in the pig, showing spe-
cies-specific differences in the ability of mammary epithelial cells to y-carbox-
ylate heterologous proteins (Fig. 7111). This may reflect differences in substrate-
specificity or enzyme levels between species. Despite this, about 20-30% of pig
rHPC was recovered in a biologically active form [264,265]. Thus, up to 0.38
mg/ml of active rHPC was produced in pig milk [264], compared to 0.3 mg/ml
in sheep milk [151], 0.02 mg/ml/106 cells/24 h in 293 cells [17] and 0.003 mg/
ml in mouse milk [227]. The fact that a portion of rHPC was hlly y-carboxylated
may be due to a property of the VKD-carboxylase which is not a distributive
but a processive enzyme [266].
In the liver of transgenic mice the rFIX propeptide was processed [51,53], but
rFIX produced in sheep milk possessed a different electrophoretic mobility
from plasma FIX [267]. Similarly, rFIX secreted by mouse trans-hybridoma cells
18

600 - Swine rHPC

E0 500 -
0

zf400 -
"300 -
I
SE 200 -
t 100 -

I1 100
90 - Mouse rHPC
4 80 -
-
-
0
70
3
ca 60 -
40 -
50
2"
EE
30 -
t 20 -
10
0 Ir. Im,
A NSFL EELRHSS L ERE
Light Chain Sequence
111
___

-t
I Swine rHPC Amino Acid Sequence 1%
Light chain " A N S F L y y L R H S S L y Ry 75
Propeptide - T P A P L D S V F S S S E R A H Q V 25
Heavy chain *'-D T E D Q E D Q V D P R L I D G K M 25
Additional Ktenninus
-65
Mouse rHPC Amino Acid Sequence %
Light chain "AN S F L E E L R H S S L E R E
Propeptide "T P A P L D S V F S S S E R A
Heaw chain ""D T E D Q E D Q V D P R L I D G loo

Fig. 7. Proteolytic processing and y-carboxylation of rHPC. Amino acid sequencing of rHPC purified
from pig (I) and mouse (11) milk was performed as described [260] and the processing of rHPC in
swine and mouse mammary gland was assessed by sequence comparison (111). PTH: phenylthiohy-
dantoin. As PTH-derivatives of Gla residues are not extracted during Edman degradation, this sug-
gested that the nine Glu residues were y-carboxylated in pig rHPC, but not in mouse rHPC.

had partial activity, although rAATwas active [82]. rFIX expressed in mouse liver
at a level 7 times higher than endogenous protein had electrophoretic mobility,
immunorecognition, Gla content and activity similar to that of plasma-derived
FIX [5 1,531. Indirect evidence suggested that y-carboxylation of rFIX may have
occurred in mouse [ 1251, pig (W. Velander, personal communication) and sheep
[267] mammary gland.
rHPC from pig milk was partially cleaved at positions - 1, 152 and 157
between dibasic KR residues [260], in addition to the expected N-termini at
 19

residues - 24, +1 and 158 (Fig. 7111). Enzymes similar to the N-arginine dibasic
convertase isolated from rat testes [268] may be responsible for this cleavage,
reflecting the accessibility of sites in foreign proteins to endogenous enzymes.
rtPA from mouse milk and long-acting tPA from goat milk existed mainly in
the two-chain form, unlike that from Bowes melanoma cells [169]. Mature pul-
monary surfactant proteins are generated by the removal of N- and C-terminal
propeptides. Surfactant protein-C expressed in the mouse mammary gland was
partially processed [269] and surfactant protein-B was completely unprocessed
[270]. The unexpected secretion of the proproteins implies that the mammary
epithelium does not contain the same enzymes as the pulmonary epithelium, or
that sites in these highly hydrophobic proteins are not accessible during transport
through the secretory pathway. Recombinant interferon-y (IFN) was secreted as
a heterogenous population of polypeptides C-terminally truncated at dibasic
amino acid sites [271]. While no full-length molecules were observed in CHO
cell-derived rIFN, with most of the peptides terminating between Gly12' and
Gln'33, mouse mammary gland derived rIFN terminated at GlyI2', LysI2' or
Arg'29, with some minor components ending at Gly13'. This might result from
initial cleavage by hrin at L~s'~*-Arg-Lys-Arg' 3 1 followed by other endopro-
teases and/or carboxypeptidases. Human IFN from peripheral blood lympho-
cytes has six different C-termini, G ~ Y ' Lys12', ~ ~ , Arg129, Lysl3', Ser132 and
Met134.As intact N- and C-termini are required for full bioactivity and residues
L y ~ ' ~ ' - A r g ' ~ ~ - Sare
e r ' crucial
~~ for receptor binding, rIFN will be less active.
The secretion of rHPC indirectly indicates the lack of C-terminal truncation, as
39 C-terminal residues have been shown to be essential for secretion [272].
rHPC and rFIX from transgenic animals were not assessed for P-hydroxyla-
tion, nor was recombinant human fibrinogen (FIB) studied for prolyl-hydroxyla-
tion of its BP chains. Prolyl- and lysyl-hydroxylation of human procollagen I
were found to be reduced in the mouse mammary gland (D. Toman, personal
communication). As hydroxylation regulates the temperature stability of the col-
lagen triple helix, the recombinant protein may behave differently. The only het-
erologous protein to be phosphorylated in mouse milk was bovine 0-casein. It
contained the same number of phosphoserines as the native protein [273] and
was incorporated into casein micelles. rFIX from CHO cells was less than 1%
phosphorylated compared to plasma FIX leading to reduced in vivo recovery
[259], but this modification in the transgenic product was not reported. Likewise,
data have still to be presented for the Ser-phosphorylation of the Aa chains of
rFIB.

Factor VIII

FVIII is synthesized as a 2351-amino acid precursor from which a 19-amino

acid signal peptide is cleaved (Fig. 81). In the secretory pathway, it undergoes gly-
cosylation at 25 potential sites, tyrosine sulfation and proteolytic cleavage. FVIII
is secreted as a metal ion complex of a 90-200 kDa heavy chain and an 80-
20

Fig.8. rFVIII from transgenic pig milk. I: Schematic representation of the complex processing of hu-
man FVIII. FVIIIa: activated FVIII, FVIIIi: inactivated FVIII, APC: activated HPC, Xa: activated
factor X.Al, A2, B: heavy chain domains; A3, C1, C2: light chain domains.Vertica1bars denote po-
tential glycosylation sites, arrows indicate thrombin cleavage sites and the numbers indicate amino
acids. 11: rFVIII enriched from the milk of transgenic pigs by immunoafinity chromatography was
analyzed by 8- 16% SDS-PAGE and western blotting with a sheep polyclonal antibody, as in [235].
A: Plasma-derived FVIII (H), proteins from control pig (C) and transgenic pig 177.2 (T) milk. B:
rFVIll from pis 178.1 milk (T)probed with CS MAb asainst the A l domain of FVTTl heavy chain
(HC). C: rFVIII (T) and human FVIII (H) probed with J16D-9 MAb against the FVIII light chain
(LC) after resolution by 8% SDS-PAGE. The arrow indicates FVIII LC, molecular weights in kDa
are on the left. 111: Thrombin digestion of rFVIII isolated from pig milk. rFVIII was analyzed by
8-16% SDS-PAGE before ( - ) and after (+) thrombin digestion. Twice the amount of protein was
used for digestion (+).Western blots were probed with MAb 8 against the A2 domain of FVIII HC
(1-3) or the sheep polyclonal antibody (4-6). Molecular weights in kDa are indicated on the left.
Al, A2, B: domains of heavy chain, T: thrombin.
I: Adapted with permission from: Kaufman RJ, Transf Med Rev 1992;6(4):235-246.
 21

kDa light chain [274]. rFVIII secreted into the milk of pigs [235] was processed
into the heavy and light chains (Fig. 811). Like plasma-derived FVIII, rFVIII
was heterogenous as expected from internal processing of the B domain [20].
Both the light and heavy chains of rFVIII were recovered after immunoafinity
chromatography using a heavy-chain-specific antibody, showing that rFVIII was
present as a metal-ion-linked heterodimer in milk. Additionally, rFVIII was
appropriately cleaved by thrombin (Fig. 8111) and had both cofactor and coagu-
lant activities, indicating correct assembly of the multidomain Al-A2-A3Cl C2
heterotrimer. As FVIII activation is sensitive to the sulfation of Tyr residues in
the heavy and light chains [275], this also suggests its sulfation in the mouse and
pig mammary gland. Human factor V, bovine FX, mouse IgA, IgG and IgM, as
well as FIB p- and y chains from several species also undergo Tyr-sulfation
[276]. Despite reports of an 85'% decrease in sulfation in rFIX from CHO cells
[259], this modification has not been studied in transgenic products as yet.

fig^ 9. mWAP-directed expression of fibrinogen. 1: Structure and activation of human fibrinogen. The
hexameric protein consisting of two a . p and y chains linked by disulfide bonds is cleaved by throm-
bin to release fibrinopeptides A and B (FPA. FPB) to generate fibrin. The binding sites for thrombin
(IIa), tissue plasminogen activator ([PA), Factor XI11 (FXIII) and ctz-protrase inhibitor (a2-PI) are in-
dicated in circles. 11: Western blot analysis of milk proteins after SDS-PAGE using a polyclonal anti-
body against fibrinogen for detection. Control mice (CON),WAPiFIB transgenic mice (TRG) and
plasma-derived fibrinogen (FIB) [279.282].
1: Adapted with permission from: Mosesson MW.Fibrin polymerization and its regulatory role in
hemostasis. J Lab Clin Med 1990;1 16( 1):S- 17.
22

Multimeric proteins: fibrinogen and hemoglobin

FIB is a 340-kDa hexameric protein composed of dimers of three polypeptide

chains designated Aa, BP and y (Fig. 91) of 610, 461 and 41 1 amino acids with
molecular weights of 66, 54, and 48.5 kDa, respectively [277]. The three chains
are synthesized in the liver from three individual mRNAs. The signal peptides
are cleaved, propeptides removed from the C-termini of Acr chains probably by
furin, polypeptides glycosylated, assembled and secreted into plasma as mature
molecules. In mature FIB, the six chains are assembled, then cross-linked by 29
inter- and intrachain disulfide bonds. During coagulation, thrombin removes
the N-terminal fibrinopeptides A and B from the cr and P-chains, converting
FIB to fibrin monomers which polymerize and form an insoluble clot. The BP
and y chains contain N-linked carbohydrates that can influence the rate of fibrin
polymerization, while the long y chain variant is Tyr-sulfated [278]. In plasma,
the 340-kDa form constitutes 70% of FIB, and C-terminal processing of the Acr
chains gives rise to 305 kDa (25%) and 270 kDa (5%) forms [278]. As fibrin clots
from degraded FIB are less stable, this needs to be studied in rFIB. rFIB was
expressed in the milk of transgenic mice (Fig. 911) [279] and sheep [280]. From
10 to 100% of the rFIB subunits were assembled into hexamers in the milk of
any given mouse line and assembly was dependent on the ratio of the individual
chains [281,2821. This variability may be connected with mosaic transgene
expression [283,284]. Colocalization of the three transgene products in the secre-
tory pathway may be another factor. Three out of four lines of sheep produced
rFIB, but the percentage of assembled material was not reported [280]. rFIB pu-
rified from milk was functional, but all subunits were not assembled into the
mature hexameric molecule [285]. In this case, the presence of unassembled indi-
vidual chains may be connected with the differential expression of multiple trans-
genes [281,2861, as observed during mammary gland development in HPC/
PACE bigenic mice. Perhaps, similar to other proteins, the processing of the pro-
peptides of rFIB is limited in the mammary gland and affects the assembly of
rFIB.
Human hemoglobin A (Hb), the oxygen transporter in erythrocytes, is a tetra-
meric protein composed of two a- and two P-globin chains, with globin subunits
covalently attached to a heme prosthetic group. Oxygen binds reversibly to iron
incorporated into the heme unit. rHb purified from the erythrocytes of trans-
genic swine was characterized in detail [68,69]. The protein was structurally and
functionally equivalent to Hb [261], showing that swine erythrocytes correctly
translated globin mRNAs, carried out cotranslational processing of chains, did
not introduce unwanted postranslational modifications and properly assembled
the functional tetramer. However, in every case an unbalanced expression of the
a- and P-chains favoring a-globin was observed.
Bovine follicle-stimulating hormone was an early example of the assembly of a
functional heterologous protein from two different subunits in TABS [286]. The
protein secreted to milk exhibited both biological- and receptor-binding activ-
 23

ities, confirming that appropriately glycosylated subunits had been assembled

into heterodimers, but free ct subunit was also detected in milk. Similarly, a tetra-
meric metalloprotein, extracellular superoxide dismutase (SOD), was assembled
from four subunits [287] into a 155-kDa protein in the milk of mice [288] and
rabbits [262] and had biological activity indistinguishable from that of human-
or cell-derived SOD.

Glycosylation

Oligosaccharide composition influences the biological activity, solubility, rate of

secretion, protease resistance, pharmacokinetics and immunogenicity of most
proteins [289]. As glycosylation is both cell- and species-dependent, studying
the glycosylation patterns of human proteins in transgenic animals is essential.
For example, the mammary form of glycosylation-dependent cell adhesion mol-
ecule l lacks the sulfated carbohydrates present in the endothelial form which
are required for interaction with leukocyte cell surface L-selectin and thus may
have different hnctions [290]. Likewise, the oligosaccharides of HPC inhibit
selectin-mediated cell adhesion and these carbohydrates may differ when plasma
proteins are produced in heterologous tissues [2911. The primary glycan struc-
tures of human, bovine, caprine, murine and porcine lactoferrin are specific to
the species [292]. Glycosylation of human lactoferrin from mouse milk also dif-
fers slightly from the natural protein [293].
rHPC from pig milk demonstrated increased electrophoretic mobility [264,265]
and species-specific heterogeneity upon two-dimensional electrophoresis when
compared to HPC (Figs. 611 and 101). The extensive heterogeneity of the single
chain could be explained by different y-carboxylation of the Gla domain. The
heterogeneity of the heavy chain is due to specific glycosylation in the mammary
gland and also differed from that of mouse rHPC, showing species-specific
modification of rHPC. In general, rHPC was more basic than HPC indicating a
lower degree of sialylation. Human kidney 293 cell-derived rHPC which had a
50% lower sialic acid content than HPC [258] was found to have 30-40% higher
specific activity. In addition, novel oligosaccharides terminating in GalNAcP 1,4-
(Fucct 1,3)GlcNAc(31-R were detected which may contribute to the higher activity.
Most of the heterogeneity of HPC and mouse rHPC was due to glycosylation, as
shown by deglycosylation with N-glycosidase F (H. Lubon and R.K. Paleyanda,
unpublished observations), with minor forms due to differences in proteolytic
processing. The various forms indicate either differential accessibility of glycosy-
lation sites to enzymes, a different composition or ratio of glycosylases in mam-
mary'epithelial cells compared to the liver, or both. Analysis of sugar composi-
tion of pig rHPC revealed a high level of hcosylation and the presence of N-
acetylgalactosamine, a sugar absent in HPC, although the total carbohydrate con-
tent was similar to plasma-derived HPC (W. Velander and H. Lubon, unpub-
lished observations).
tPA, AATand antithrombin I11 (ATIII) are plasma glycoproteins that do not
24

Fig. 10. Overcoming mammary gland limitations in rHPC processing. I: Two-dimensional gel elec-
trophoresis of transgenic whey proteins and HPC, and western blot analysis using the 8861 MAb di-
rected against the HPC heavy chain, as in [304]. 11: Expression of posttranslational modification en-
zymes in mouse tissues. Slot blot of total RNA from the liver and mammary gland (MG) of CD-1
mice were probed with 32P-labeledcDNAs of human furin and PACE4, bovine y-carboxylase, chick-
en propyl hydroxylase-a and -p and rat N-arginine dibasic (NRD) convertase. 111: Northern blot of
total RNA from the mammary gland of a line C5.2 HPC/PACE bigenic mouse [303] was probed with
32P-labeled HPC and PACE cDNAs. Molecular weights in kb are on the left. I V Milk proteins from
control, line 6.4 HPC transgenic and line C5.2 HPC/PACE bigenic mice were resolved by 8-16%
SDS-PAGE.Western blots were probed with the 8861 MAb as in [303].The dot denotes the milk pro-
tein detected by the secondary antibodies. SC: single chain, HC: heavy chain.
 25

undergo other complex posttranslational modifications. tPA is a protease of 527

amino acids that regulates hemostasis by converting plasminogen into proteolyti-
cally active plasmin which cleaves fibrin, thus promoting the lysis of blood clots.
Interestingly, long-acting tPA from goat’s milk also contained N-acetylgalactosa-
mine which was absent in the C127 mouse fibroblast cell-derived protein. AAT
is a serine protease inhibitor of 394 amino acids that inactivates factor XIa, plas-
min and neutrophil elastase among others. Glycosylation of AAT is not required
for activity, but is crucial to maintain its half-life in vivo [294]. rAAT produced
in mouse and rabbit blood exhibited the expected molecular weight [52,54], but
AAT from sheep milk had a different electrophoretic profile [295]. Isoelectric
focusing showed 15-20 bands with PI values ranging from 4.46 to 4.88, while
AAT resolved between pH 4.42 and 4.67 [262], possibly due to decreased sialyla-
tion and/or the deletion of five N-terminal amino acids in 10% of the protein.
No compositional analysis was presented for rAAT from transgenic sheep. High-
er levels of a1,6 core fucosylation of bi- and triantennary structures were
detected at AsnS3in mouse rAAT than in AAT At Asn247predominantly fucosy-
lated biantennary glycans were present in rAATunlike the complex sialylated gly-
cans of AAT [294].
ATIII is a single-chain polypeptide of 432 amino acids which is a major inhibi-
tor of thrombin, FXa, FIXa and other serine proteases. In the goat mammary
gland, addition of oligomannose to specific Asn residues of rATIII was observed
[296] which could increase clearance of the protein by the mannose receptor. As
shown by lectin binding, rSOD from mouse milk contained no terminal galac-
tose, and terminal sialic acid residues were attached to galactose by a2,3 or a2,6
glycosylic bonds, whereas this configuration was absent in SOD [288]. Although
plasma clearance after intravenous injection of rSOD into rabbits was slightly
faster than of SOD from other sources, binding to the endothelium and release
after heparin injection were similar. Detailed studies of rIFN from mouse milk
showed considerable site-specific variation in glycosylation, with complex sialy-
lated and core-hcosylated glycans at one N-linked site and mainly oligomannose
at the second, unlike CHO cell rIFN which contained no mannose [296]. Both
sites were completely occupied in contrast to rIFN secreted by CHO or SF9 cells,
indicating increased accessibility of the second site in mammary epithelial cells.
N-acetylgalactosamine, N-glycolylneuraminic acid and Gala 1,3Gal (Gal group)
residues were not detected in contrast to proteins from mouse cell lines. N-gly-
cans at Asn25are critical for protease resistance, hence susceptibility to proteases
will depend on the host cell used for production [271]. The data presented also
suggest that the mouse mammary gland may be deficient in the ER al,2-manno-
sidase I and N-acetylglucosamine transferases, and that the Golgi a-mannosi-
dase I1 enzyme levels may be low [296].
The lack of the Gala1,3Gal moiety usually found on the cell surfaces and
secreted proteins of New World monkeys, rodents, pigs, sheep and cows [289], in
rIFN [296] and rAAT is encouraging. About 1% of human serum antibodies are
directed against this epitope which may elicit an immune response. Host cell
26

type, nutrient and/or enzyme limitations are known to influence processing and
site occupancy in glycoproteins [289,297], but the capabilities of the mammary
gland for specific proteins have to be better defined. The concern about the Gal
group in transgenic products may be premature. Investigation with baboons
showed that the recoveries and half-lives of FVIII and rFVIII containing the
Gal group produced by baby hamster kidney cells were the same in the presence
of anti-Gal antibodies [298]. Porcine FVIII contains a large amount of the Gal
group and has been used to treat patients [299]. The absence of alterations in the
half-life of circulating porcine FVIII suggest that the anti-Gal antibodies may
not interact with the porcine proteins, possibly due to the interference of von
Willebrand factor which associates with FVIII. Factor VIII may be a special
case, therefore only clinical trials with each transgenic protein will provide a de-
finitive answer.
The only O-glycosylated protein studied in the mouse mammary gland [300]
was human bile-salt-stimulated lipase. The lipase showed altered migration
upon SDS-PAGE, lower mass and no interaction with specific lectins, suggesting
an almost complete lack of O-glycosylation, without detriment to lipase activity,
stability at low pH and sensitivity to high temperatures.

Transgenic animal bioreactors of the next century

Analysis of a variety of foreign proteins produced in TABs demonstrated that

folding and disulfide bond formation were generally like those of the natural pro-
teins. Signal peptide cleavage and N-linked glycosylation generally occurred at
the expected sites. Other posttranslational modifications like y-carboxylation,
propeptide cleavage, hydroxylation and assembly of multimeric proteins may be
partial and depend on the level of expression, the protein, the cell-type and ani-
mal species.
Differences in the processing of heterologous proteins in TABs could be due to
several reasons: altered folding and conformation of precursors in the secretory
pathway, lack of recognition of foreign proteins by endogenous enzymes, lack of
appropriate enzymes in the host animal cells or insufficient amounts of enzyme.
The author’s own study of rHPC suggested that the cellular protease and y-car-
boxylase machinery may have become saturated when rHPC was synthesized in
large amounts, leading to a reduction in the amount of biologically active protein.
This was tested (H. Lubon and R. Drews, unpublished observations) by screen-
ing the mammary gland of mice for the presence of some endogenous enzymes
(Fig. 1011). The mammary gland expressed less hrin or PACE (paired amino
acid cleaving enzyme), PACE4, N-arginine dibasic convertase and y-carboxylase
than the liver. Differences in prolyl hydroxylase-cx and -p levels were less appar-
ent, probably because highly hydroxylated proteins like collagen are synthesized
mainly in fibroblasts.
Therefore, a WAP/PACE [301,302] construct was coinjected with the WAP/
HPC construct to generate bigenic animals [303]. The transgenes were cointe-
 27

grated and coexpressed in the mammary gland (Fig. 10111). Human h r i n tran-
scripts were expressed at 100-fold higher levels than endogenous mouse hrin.
The presence of human hrin resulted in an almost complete conversion of the
single-chain rHPC precursor to the mature two-chain form (Fig. lOIV), showing
for the first time that exogenous enzymes in transgenic animals can improve the
processing of heterologous proteins, overcoming the inefficient processing
machinery of host cells. This idea can be extended to generate multitransgenic
animals expressing proteins of interest along with enzymes that perform post-
translational modifications like y-carboxylation, glycosylation, hydroxylation,
sulfation, phosphorylation, and/or with other components of the secretory path-
way like the chaperones that control the proper folding of polypeptides and the
assembly of subunits. With an excess of specific substrate they should not affect
the health of the animals as we have shown.
The recent engineering of the glycosylation pathways of endogenous proteins in
animals hrther supports this opinion. Humans and higher primates do not pos-
sess a functional al,3-galactosyltransferase (al,3-GT; EC 2.4.1.51) gene and
contain natural antibodies to the Gala 1,3-Gal epitopes. Instead, they express an
a1,2-fUcosyltransferase (a1,2-FT; EC 2.4.1.69) that is responsible for the synthe-
sis of the blood group H-antigen, Fuca1,2GalP 1,3(4)-R. However, both these
enzymes use the same acceptor substrate, N-acetyllactosamine. Mouse milk gly-
cans were remodelled by expressing a mWAP/human a 1,2-FT cDNA transgene
[305]. Milk contained large quantities of 2’-hcosyllactose, about 33-50% of all
sugars, and a major modified glycoprotein containing the H-antigen. Normal
mouse milk is deficient in these hcosylated oligosaccharides, suggesting that the
Golgi apparatus of the lactating mammary gland could adapt its uptake of
GDP-Fuc, the donor sugar nucleotide for a1,2-FT. Moreover, soluble forms of
the active enzyme were detected in milk. Likewise, h r i n was active both inside
the cell and upon secretion into milk [72]. This opens up another avenue for the
production of endogenous intracellular enzymes, for analysis and in vitro proces-
sing of proteins.
Similar approaches have been used to modifjr porcine organs for xenotrans-
plantation. Pigs transgenic for a1,2-FT expressed the H-antigen in peripheral
blood mononuclear cells and were more resistant to challenge with human sera,
presenting a new way to suppress hyperacute rejection [306]. The production of
the H-antigen in endothelial cells of multiple organs of mice and pigs by a1,2-
FT expression dramatically decreased the Gal epitope leading to protection from
complement-mediated lysis [307]. I believe the hture will bring more animals
with increasingly modified metabolic pathways that will improve the perfor-
mance of TABS.

The other side@) of the bioreactor

Ideally, once a heterologous protein is synthesized it should be well processed, be

secreted in the target destination, have the expected activity and not harm the
28

animal. However, when a transgene product is expressed in tissues other than the
tissue of origin, it may affect the tissue and exhibit as yet unknown functions.
Depending on its cell and tissue localization, the protein may exert local and/or
systemic effects [149,308]. I believe that it will be possible to engineer the “per-
fect transgene”, but changing the intrinsic properties of cells and organs will be
more dificult. LAC has been found in the sera of pregnant and lactating women
[309], cows [3 10-3 121, and pregnant goats [3 131. P-lactoglobulin was detected
in the serum of cows [312] and WAP in the serum of lactating rabbits [155].
Low-level secretion of transgene products through the basal membrane of mam-
mary epithelial cells [314] cannot be excluded. The presence of rAAT [262,315]
and other proteins [148,316] in the bloodstream of transgenic animals is not sur-
prising. Similarly, proteins expressed in erythrocytes may be released in bone, as
seen with human growth hormone [ 1471. Thus, understanding the phenotype of
the animal is important for developing the optimal bioreactor.
As mentioned before, HPC, FVIII, FIX, FX and FIB have to be proteolytically
cleaved at one or more internal peptide bonds before they can demonstrate bio-
logical activity rHPC expression in the mammary gland and secretion into milk
and urine did not affect the health of the mice and pigs. This could be because
rHPC was produced in the zymogen form and not as an active protease. Immu-
nohistochemical staining of rHPC in the mammary gland showed that it was
present within the alveolar epithelial cells, as well as in the alveolar and ductal
lumina of HPC and HPC/PACE mice (Fig. 11). It was notable that excessive
baso-lateral secretion of protein had not occurred. Closer examination of trans-
genic tissues showed subtle changes only at midlactation consisting of less dis-
tended alveoli, larger epithelial cells with centrally positioned nuclei and smaller

Fig. 11. Immunohistochemical localization of rHPC in the mammary gland. Mammary glands were
taken from control mice (A,D), HPC transgenic (B,E) and HPC/PACE bigenic mice (C,F) on day
10 of lactation. Sections were stained with hematoxylin and eosin (H & E) (A-C). Tissues were also
probed with a sheep polyclonal antibody to rHPC, developed with DAB substrate (D-F) and coun-
terstained with hematoxylin as in [ 1881. Magnification: 400 x .
 29

I.

11.

Fig. 12. Morphology of HPC and HPC/PACE mouse mammary glands. I: H & E staining of mam-
mary tissue sections from HPC transgenic mice from lines 5.2, 6.4, 7.2, 7.5, 4.2 (B-F) and a non-
transgenic mouse (A). 11: H & E staining of mammary tissue from HPC/PACE bigenic mice from
lines C1.2, C2.2, C4.1, C5.2 (B-E), control (A) and HPClPACEM bigenic mice (F).The mouse lines
are described in [229,303], tissues were taken on day 10 of lactation. Magnification: 100 x .

noncoalescent cytoplasmic vesicles containing rHPC in addition to the larger

secretory vacuoles, when compared to control mouse tissue. Signs of necrosis or
neoplasia were not present. Thus, rHPC did not impair mammary gland develop-
ment and differentiation during pregnancy and lactation and all lines of rHPC
mice could nurse their offspring.
The author examined the morphology of the mammary gland from five lines of
HPC transgenic mice and five lines of HPC/PACE bigenic mice and observed a
pattern similar to that of control (Fig. 12).
This means that the incomplete proteolytic processing of rHPC was probably
not responsible for the observed changes. The author also studied the composi-
30

Fig. 13. Protein composition of transgenic mouse milk. Milk proteins from I: Four lines of HPC/
PACE; and 11: three lines of HPC mice were compared with those from four control mice, by 10%
SDS-PAGE and silver staining, as in [229]. 111: Milk proteins from control, HPC/PACE, HPC and
HPC/PACEM mutant PACE mice were resolved by 14% SDS-PAGE and western blot detection per-
formed with a rabbit anti-WAP antibody [197]. I V Northern blot analysis of total RNA from the
mammary glands of pregnant (P) and lactating (L) HPC/PACE mice from line C5.2 [303] was per-
formed to detect rHPC and PACE transgene, mWAP and 18s rRNA endogenous gene transcripts,
using the 32P-labeledcDNAs of HPC, PACE, mWAP and 18s rRNA.

tion of proteins in the milk of transgenic animals and observed a different elec-
trophoretic pattern in the higher molecular weight proteins, as compared to con-
trol (Fig. 131).
Further experiments showed (H. Lubon, R.K. Paleyanda and R. Drews,
unpublished observations) that this may be connected with the expression of
rHPC in the mammary gland, as milk proteins from single transgenic mice
showed a similar pattern (Fig 1311). As the synthesis of WAP is sensitive to sig-
nals for the differentiation of the mammary epithelium [ 164,1661 and the synthe-
sis of foreign proteins in mice can be at the expense of endogenous milk proteins
[317,318], the relative amount of WAP was determined (Fig. 13111). Indeed,
WAP decreased approximately 50% in the milk from HPC/PACE mice com-
pared to milk from control, HPC and HPUPACEM mice. Following this obser-
 31

I.

11.

III.

Fig. 14. Analysis of mice homozygous for HPC transgene. IA: Southern blots for the estimation of
homozygosity. BumHI-digested DNA was hybridized with a probe consisting of the first intron of
HPC gene. The arrows indicate DNA samples of potential homozygotes containing two alleles of
the transgene. Molecular weights in kb are on the left. IB: PCR detection of a 502 bp HPC-specific
band in DNA from a litter obtained by mating a potential homozygote with a control mouse. Primers
used were 5'CAGTCACTlTGCCTGACACCGGTAC and 3' GCCAGTGTGCATTTGAGTAGG-
GA, as described [319]. 11: Northern blot analysis for the presence and level of transgene and endog-
enous milk protein transcripts. Total RNA from mammary glands of homozygous line 6.4H mice
and control mice taken during the virgin (V), pregnant (P) and lactating (L) states were probed with
32P-Iabeled cDNAs of mouse p-casein, WAP, a-lactalbumin and 18s rRNA. 111: Histology of the
mammary gland of HPC and HPCIPACE homozygous mice. H & E staining of mammary gland sec-
tions from HPC line 4.2H mice (1,111) and HPCIPACE line C1.2H mice (I1,IV) on day 1-2 of lacta-
tion. Magnification: A and B, 100 x ; C and D, 400 x .
32

vation, the developmental regulation of both transgenes was studied (Fig. 13IV).
Both mWAP/HPC and mWAP/PACE trangenes were induced earlier in preg-
nancy than the endogenous WAP gene, and the temporal regulation pattern dif-
fered.
It was decided to generate homozygous animals for HPC and HPCIPACE to
increase the expression of rHPC, as observed with rFVIII mice (Fig. 4V) and
by others [244,316]. Progeny generated by mating two hemizygous mice from
the same line were screened first for the presence of the transgene, then homo-
zygosity was assessed by Southern blot analysis of DNA (Fig. 14IA). DNA from
mice with two alleles of the transgene exhibited a stronger signal. Potentially
homozygous mice were crossed with control animals and the parent deemed
homozygous if all its progeny were transgenic (Fig. 14IB). Unexpectedly, mice
from the first HPC homozygous line could not nurse their pups in the first two
lactations. Analysis of transgene and endogenous milk protein gene expression
at different stages of development showed reduced transcription of WAP and 01-
lactalbumin genes (Fig. 1411). The same pattern was observed in another line of
homozygous animals (H. Lubon and C. Palmer, unpublished observations).These
changes in milk gene expression were connected with impaired mammary gland
development (Fig. 14IIA, IIIC). Similarly, the development and differentiation
of the mammary gland was affected in three lines of homozygous bigenic mice
(Fig. 14IIIB,D) (H. Lubon and R. Drews, unpublished observations).
There are several possible explanations for these findings. The author prefers to
connect this with hitherto unknown functions of HPC in addition to its well-
defined roles in the coagulation cascade. It has been shown that activated HPC
mediates anti-inflammatory effects possibly by inhibiting selectin-mediated cell
adhesion [2911 and prevents vascular injury by inhibiting tumor necrosis factor
production [255]. This is a reasonable assumption, as several proteins involved
in the coagulation cascade have additional biological activities. For example,
thrombin, HPC and protein S bind to certain cellular receptors [320-3221.
Thrombin is a potent mitogen [320], stimulates mesenchymal cells and plays a
role in embryonic development [323]. Factor X, Xa and protein S are potent
mitogens for aortic smooth muscle cells [324]. Protein S secreted by osteoblasts
may play a role in bone mass and turnover [325], while its role in neural tumor
cells [326] is unknown.
Other instances of the disruption of mammary function occurred with the
expression of isologous or heterologous milk proteins. For example, the milchlos
phenotype has been described in mice and pigs transgenic for mWAP gene
[231,232]. In certain tissue contexts WAP can function as an epithelial growth
regulator [327] and affect mammary development. However, the effect of expres-
sion of HPC on the lobulo-alveolar development of the gland and milk protein
gene expression is distinct from that of WAP.
Another explanation cannot as yet be excluded. Changing the composition of
milk by expressing heterologous proteins or additional milk proteins and by
“knocking-out”endogenous genes [328-3303 may alter the traficking of proteins
 33

in the secretory pathway and indirectly affect mammary development. Bovine K-

casein secreted in mouse milk reduced micelle size producing a stronger curd
[243]. Lactation ceased upon bovine p-casein secretion in transgenic mice [3311.
The predominantly unprocessed hydrophobic surfactapt protein-C inhibited lac-
tation in a high-expressing founder [269], although surfactant protein-B which
was completely unprocessed in milk did not have an effect on lactation [270].
Secretion of a C-terminal deletion variant of surfactant protein-B at high levels
again led to the inhibition of lobulo-alveolar development, growth retardation
and cannibalism [332], suggesting that processed hydrophobic surfactant proteins
may affect mammary hnction. Excess of long-acting tPA resulted in protein
insolubility in milk and nodularity of the gland [333]. Thus, the structure and
physicochemical properties of particular proteins may directly influence mam-
mary function or indirectly by changing milk composition.

The end product

A transgenic founder is comparable to a mammalian cell engineered for the pro-

duction of a recombinant protein. Here the similarity ends, as one has to build a
production plant to grow large numbers of cells. Transgene transmission has
been demonstrated in rabbits [54,334], pigs [43,335], sheep [336], goats [333]
and cows (F. Pieper, personal communication). Sequential lactations yielded
similar levels of AAT in the milk of sheep [336], long-acting tPA in the milk of
goats [333] and HPC in the milk of pigs [335] and phenotypic stability was shown
in G1 and G2 animals. Transgenic livestock need a well-organized farm with
additional precautions based on good agricultural practices. The economic ben-
efits of this are obvious in the collection of raw material and capital investment.
Unlike in sterile cell culture systems, proteins from transgenic animals are
exposed to animal pathogens present in tissues or body fluids [337]. Depending
on the protein of choice, various animals like rabbits, pigs, sheep, goats and
cows may be utilized. For proteins required in low volumes, such as FIX and
FVIII, rabbits or pigs may be considered. For proteins required in ton volumes,
traditional dairy animals like sheep, goats and cows will be needed (Table 2).
The cost of 1 1 of milk will be higher for rabbits and lower for cows. Only sheep
and goats have been used so far for the clinical production of plasma proteins
and at production levels of 10 g/l, the estimated raw product cost in milk is US
$2-20/g for a 100 kg/year product.
Purification of the raw material is required and will add to the cost of the end
product. It has long been expected that foreign proteins expressed in the body
fluids of transgenic animals would be produced more cost-effectively Immunoaf-
finity chromatography commonly used in the isolation of plasma proteins and
for rapid characterization [229,235,264,338] will be avoided in the production
process to prevent introducing mouse immunoglobulin into the product (see
Fig. 15). The low concentration of pig protein C in pig blood means that only
trace amounts of pig protein C and other VKD proteins will be present in normal
34

Tuble 2. Blood protein production in transgenic animals.

Plasma Annual Levels in Level of trans- Animal Reference
protein requirement - human plasma genic protein species
world (mgW (mg/ml)
Albumin 400- 500 tons 35-53 10.0 Mouse 11391
35.0 Mouse Meadea
u ,-Antitrypsin 4000-8000 kg 1.4-3.2 12.5 Mouse WI
60.0 Sheep 12951
Antithrombin 111 70 kg 0.17-0.39 10.0 Mouse Meadea
7.0 Goat
Hemoglobin 35,000 kgb 32.0 Pig
tPAILAtPA' 100-200 kg 3.0 Goat
Factor VIII 0.4-0.5 kg 0.0001 0.0027 Pig
Factor IX 6-8 kg 0.005 0.06 Mouse
0.005 Sheep
0.2 Pig
Factor X 0.01 0.7 Mouse
Protein C 30-300 kg 0.004 1.6 Mouse
2.0 Pig
0.3 Sheep
Fibrinogen 600- 1200 kg 2.0-4.0 0.5 Mouse
2.0 Mouse
10.0 Sheep

aH. Meade, personal communication; bAssuming that rHb will supply 5% of the world demand for
blood and red cells; 'LA-tPA, longer-acting tissue plasminogen activator; dWVelander et al., personal
communication.

milk. This was true for rHPC produced in pig milk. Traces of animal VKD-pro-
teins in normal milk allowed the use of the specific biochemical properties of
this protein for purification. For example, the binding of y-carboxylated proteins
to barium citrate and pseudo-affinity chromatography in the presence of calcium
(Fig. 15) [265].
Species-specific differences in amino acid sequence and mammary-specific
glycosylation patterns also need to be considered. The large amount of rHPC in
milk allowed the removal of unprocessed or under-carboxylated protein during
purification so that the final product had a biological activity at least equal to
that of HPC, with some fractions being hyperactive [260]. One may decide to pu-
ri@ these hyperactive fractions and thus decrease the dose of recombinant pro-
tein administered to patients. The similarity of purified rHPC to HPC was
assessed by using specific antibodies, amino acid sequencing, kinetic studies of
zymogen interaction with natural activators [339], thermal stability and domain-
domain interactions using scanning microcalorimetry and spectroflurometry
[340], functional amidolytic, anticoagulant and inhibition assays [339]. These
studies indicated structural and hnctional similarity of rHPC. Recent announce-
ments of the acceptance by the regulatory agencies of rAAT and rATIII indicate
that clinically adequate proteins may be produced. Whether this will be true of
 35

Pig Milking 4 ~ r r i u m / ~ i t mprecipitation

te
0.012M N.Ur. 0 . W LU, , 30 Plln
7.000 XO. 15 nh
Centrifugation
3.omXQ.25 nh.hrlEs

17% PEGlPBS Pmipitation

7.0M)Xp.25mk
(BLG.SA.UC)
Buffer Exchange
0.OW Tfb. 0 . W EDTh PH 7.4
Solubillution
Imia
I DUE-Sephrrore Chromatography I
OMSOOlUC.CI..Mk.l

I Buffer Exchrngo
o.m rm. I)rl N e b . m 7.0 I
.L
12% PEG/lM NrCl precipitrtion
7.000xp. I mh
.I. aumnmtmt
Solvent-DetergentVlrel Inrctlvation
tu mw,iuIx-iw. OM4%
I I
Fig. 15. Scheme of purification of rHPC from pig milk. PEG: polyethylene glycol, PBS: phosphate-
buffered saline,TNBP: tri-(n-butyl) phosphate,TX-100: Triton X-100, O/N:overnight, BLG: p-lacto-
globulin, SA: serum albumin, LAC: a-lactalbumin.

every protein remains to be assessed as these two proteins are rather small, are
only glycosylated and are expressed at high levels in milk (Table 2). The purifica-
tion of rFVIII from milk could be more challenging as this large and complex
protein interacts with other milk components (H. Lubon et al., unpublished
observations) and has free cysteines [341]. Even today its purification from plas-
ma is not a trivial or inexpensive matter. On the other hand, porcine FVIII has
been used in hemophilia A therapy [299] so traces of pig proteins in recombinant
products may be acceptable. The purification of HSA could be more challenging,
as animal albumin is present in milk at higher concentrations than other plasma
proteins. HSA is a globular, highly anionic, nonglycosylated protein of 65-67
kDa which is extremely compact owing to its 17 disulfide bridges. The lack of
posttranslational modification implies that purification procedures have to be
based on the differences in the amino acid composition of the animal and human
proteins. It is the most abundant serum protein, being present at 35-53 mg/ml
concentration and is used in the clinic in large quantities to maintain blood
volume and plasma osmotic pressure in acute conditions like burns, sugery and
trauma. Thus, rHSA even if produced in transgenic cows may be more expensive
than plasma-derived albumin. For rHb produced in pig erythrocytes, ion-
exchange chromatography was efficient in separating it from pig and pig/human
hybrid Hb [26 11. Transgenic plasma proteins will immediately have the advantage
of safety over plasma-derived products due to the lack of human pathogens. Pro-
duction methods have of course to take every precaution to avoid the transmittal
of animal pathogens [337].
36

The amount of collected blood will no longer be the limiting factor in produc-
tion, as the size of the transgenic animal herd can be increased on demand by
breeding, or more rapidly by cloning [ 1321 if this technology becomes acceptable.
Chemically modified hemoglobin may be produced in large quantities [342], as
may variants or mutant forms of proteins with different indications, e.g., HPC
[343], AAT [344], FIX, FVIII [345] or Hb [346] mutants. Larger genes as for
FVIII and entire genetic loci, such as those of immunoglobulins or hemoglobin,
may be expressed using the yeast artificial chromosome technology [106], P1
cloning systems [ 1351 or by the extrachromosomal homologous recombination
of overlapping DNA fragments [ 1051. The unlimited availability of safer, cheaper
blood proteins will lead to the increased use of FVIII and FIX in prophylaxis,
and allow the storage of large amounts of rHb products for emergency use at
times of blood shortage. Applications for blood proteins will increase, for exam-
ple, AAT in emphysema, liver disease, cystic fibrosis and psoriasis. The use of
fibrin sealant in plastic and cosmetic surgery and fibrin sealant supplemented
by antibiotics, growth factors and anticancer agents will grow [348,349]. Oral,
topical and local routes of administration of these products will become more
common.
Given all the limitations in transgenic technology, the understanding of regula-
tory sequences used for targeting proteins and emerging issues in the posttransla-
tional processing of proteins, progress in the production of plasma proteins is
continuing (Table 2 and tables in reference [50]). In the short history of transgenic
animals, plasma proteins produced by TABS were the first to be administered to
humans. If the ongoing clinical trials prove to be successful and the first trans-
genic product is licensed, this may soon become another method of human blood
protein production. However, it is unlikely that whole blood, blood cells, plasma
and plasma-derivatives will be completely replaced by recombinant proteins.
Advances have been made in the viral inactivation of blood products [350] and
scientific discoveries similar to that of the finding of blood groups [2] may tomor-
row make human blood products as safe as recombinant ones.
Are we the first to use proteins from milk in humans? No indeed, milk as a
blood substitute was popular for several years in the USA from as early as 1873
[ 13. All we have done is to modifj this idea using more sophisticated technologies.

Acknowledgements

The author would like to thank Dr L. Hennighausen for the mouse p-casein
cDNA, a-lactalbumin cDNA and a mouse WAP antibody; Dr D. Scandella for
human FVIII cDNA, antibodies to Factor VIII and help with FVIII assays; Dr
C. Fulcher for antibodies C5 and J16D-9 to FVIII; Drs R.J. Kaufman and A.
Rehemtulla for the human PACE/hrin, PACEM, PACE4 and bovine y-carboxy-
lase cDNAs; Dr W.J.M van de Ven for monoclonal antibodies to furin; Dr W.
Garten for soluble furin from CV1 cells; Dr W - Y Kao for the chicken prolyl-
hydroxylase cDNAs; and Drs P.Cohen and A. Prat for the rat N-arginine dibasic
 37

convertase cDNA. I thank all colleagues for sharing their unpublished results
and all the members of the transgenic animal programs at the American Red
Cross and Virginia Polytechnic and State University for their long-term friendly
cooperation. Finally, I am gratehl to Drs WN. Drohan and L. Hoyer for their
continued support.

Dedication

I dedicate this paper to little Agnieszka hoping that the hture will be better for
all because of medicines produced by this new technology.

References

1. Oberman HA. The history of blood transfusion. In: Petz LD, Swisher SN (eds) Clinical Practice
of Blood Transfusion. New York: Churchill Livingstone, 1981;9-28.
2. Landsteiner K. Ueber Agglutinationserscheinung normalen menschlichen Blutes. Wien Klin
Wochenschr 1901;14:1132-1134.
3. Kendrick D. Blood program in World War 11. Office of the Surgeon General, Department of the
Army, Washington, DC, 1964;136.
4. Cohn EJ. The separation of blood into fractions of therapeutic value. Ann Int Med 1947;
26:341-352.
5. Drohan WN, Hoyer LW Plasma protein products. In: Anderson KC, Ness PM (eds) Scientific
Basis of Transfusion Medicine. Implications for Clinical Practice. Philadelphia: WB. Saunders
Company, 1994;381-402.
6. Rossi EC, Simon TL, Moss GS, Could SA. Principles of Transfusion Medicine. Baltimore: Wil-
liams and Wilkins, 1996.
7. Stagnaro T Future of plasma derived products. J Am Blood Res Assoc (summer edition)
1992;46-49.
8. Robert P.The worldwide market for plasma fractions, present and future. J Am Blood Res Assoc
(summer edition) 1994;38-41.
9. Cuthbertson B, Reid KG, Foster PR. Viral contamination of human plasma and procedures for
preventing virus transmission by plasma products. In: Harris JR (ed) Blood Separation and
Plasma Fractionation. New York: Wiley-Liss, 1991;385-435.
10. Dodd RY. Adverse consequences of blood transfusion: Quantitative risk estimates. In: Nance S
(ed) Blood Supply: Risks, Perceptions and Prospects for the Future. Bethesda, MD: American
Association of Blood Banks, 1994;1-24.
1 1. Dodd RY Viral contamination of blood components and approaches for reduction of infectivity
Immunol Invest 1995;24:25-48.
12. Ehmann WC, Eyster ME, Aledort LM, Goedert JJ. Causes of death in haemophilia. Nature
1995;378:124.
13. Blum EVelligan M, Lin N, Matin A. DnaK-mediated alterations in human growth hormone
protein inclusion bodies. Bio/Technology 1992;10:301-304.
14. Buckholz RG. Yeast systems for the expression of heterologous gene products. Curr Opin Bio-
techno1 1993;4:538-542.
15. Datar RV, Cartwright T, Rosen CG. Process economics of animal cell and bacterial fermenta-
tions: a case study analysis of tissue plasminogen activator. Bio/Technology 1993;11:349-357.
16. Jones CE. Prospects for a recombinant albumin. J Am Blood Res Assoc 1996;4:108- 1 10.
17. Grinnell BW,Walls JD, Berg DT, Boston J, McClure DB,Yan SB. Expression, characterization,
and processing of recombinant human protein C from adenovirus-transformed cell lines. In:
38

Hershberger CL, Queener SW, Hegeman G (eds) Genetics and Molecular Biology of Industrial
Microorganisms. Washington, D.C.: American Society of Microbiology, 1989;226-237.
18. Yan SB, Razzano P, ChaoYB,Walls JD, Berg DT, McClure DB, Grinnell BW. Characterization
and novel purification of recombinant human protein C from three mammalian cell lines. Bio/
Technology 1990;8:655-661.
19. Berkner KK. Expression of recombinant vitamin K-dependent proteins in mammalian cells.
Meth Enzymol 1993;222:450-477.
20. Kaufman RJ, Wasley LC, Dorner AJ. Synthesis, processing, and secretion of recombinant
human factor VIII expressed in mammalian cells. J Biol Chem 1988;263:6352-6362.
21. Morfini M, Longo G, Messori A, Lee M, White G, Mannucci P. Pharmacokinetic properties of
recombinant factor VIII compared with a monoclonally purified concentrate (Hemofil M). The
Recombinate Study Group. Thromb Haemost 1992;68:433-435.
22. White GCD, McMillan CW, Kingdon HS, Shoemaker CB. Use of recombinant antihemophilic
factor in the treatment of two patients with classic hemophilia. N Engl J Med 1989;320:
166- 170.
23. White G, Lusher J, Shapiro A,Tubridy K, Courter S. Recombinant factor IX in the treatment of
previously-treated patients. Blood 1996;88:327.
24. Hedner U, Glazer S, Falch J. Recombinant activated factor VII in the treatment of bleeding epi-
sodes in patients with inherited and acquired bleeding disorders. Trans Med Rev 1993;7:78-83.
25. VanAken WG. The potential impact of recombinant factor VIII on hemophilia care and the
demand for blood and blood products. Trans Med Rev 1997;11:6- 14.
26. Brinster RL, Palmiter RD. Induction of foreign genes in animals. Trends Biochem Sci
1982;7:438-440.
27. Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME, Rosenfeld MG, Birnberg NC, Evans
RM. Dramatic growth of mice that develop from eggs microinjected with metallothionein-
growth hormone fusion genes. Nature 1982;300:611-615.
28. Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH. Genetic transformation of
mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci USA 1980;77:
7380-7384.
29. Constantini F, Lacy, E. Introduction of a rabbit P-globin gene into the mouse germ line. Nature
198 1;294:92-94.
30. Gordon JW, Ruddle FH. Integration and stable germ line transmission of genes injected into
mouse pronuclei. Science 198 1 ;214:1244- 1246.
31. Harbers K, Jahner D, Jaenisch R. Microinjection of cloned retroviral genomes into mouse
zygotes: Integration and expression in the animal. Nature I98 1;293:540-542.
32. Wagner EF, Stewart TA, Mintz B. The human P-globin gene and a functional viral thymidine
kinase gene in developing mice. Proc Natl Acad Sci USA 1981;78:5016-5020.
33. Wagner TE, Hoppe PC, Jollick JD, Scholl DR, Hodinka RL, Gault JB. Microinjection of a rab-
bit P-globin gene into zygotes and its subsequent expression in adult mice and their offspring.
Proc Natl Acad Sci USA 1981;78:6376-6380.
34. Brinster RL, ChenY, Trumbauer M, Senear AW,Warren R, Palmiter RD. Somatic expression of
herpes thymidine kinase in mice following injection of a fusion gene into eggs. Cell 1981;27:
223-23 1.
35. Brinster RL, Ritchie KA, Hammer RE, OBrien R, Arp B, Storb U. Expression of a micro-
injected immunoglobulin in the spleen of transgenic mice. Nature 1983;306:332-336.
36. Swift GH, Hammer RE, MacDonald RJ, Brinster RL. Tissue-specific expression of the rat pan-
creatic elastase I gene in transgenic mice. Cell 1984;38:639-646.
37. Hammer RE, Purse1 VG, Rexroad CE,Wall RJ, Bolt DJ, Ebert KM, Palmiter RD, Brinster RL.
Production of transgenic rabbits, sheep and pigs by microinjection. Nature 1985;315:680-683.
38. Brem G, Brenig B, Goodman HM, Selden RC, Graf F, Kruff B, Springmann K, Hondele J,
Meyer J,Winnacker EL, KrauDlich H. Production of transgenic mice, rabbits and pigs by micro-
injection into pronuclei. Zuchthygiene 1985;20:251-252.
 39

39. Ebert KM, Selgrath JP, DiTullio P, Denman J, Smith TE, Memon MA, Schindler JE, Monas-
tersky GM,Vitale JA, Gordon K. Transgenic production of a variant of human tissue-type plas-
minogen activator in the milk: Generation of transgenic goats and analysis of expression. Bio/
Technology 1991;9:835-838.
40. Krimpenfort P,Rademakers A, Eyestone W, van der Schans A, van den Broek SPK, Kootwijk
E, Platenburg G, Pieper F, Strijker R, de Boer H. Generation of transgenic dairy cattle using
‘in vitro’embryo production. Bio/Technology 1991;9:844-847.
41. Krimpenfort P. The production of human lactoferrin in the milk of transgenic animals. Cancer
Detect Prev 1993;17:301-305.
42. Gordon KI, Lee E,Vitale JA, Smith AE,Westphal H, Hennighausen L. Production of human tis-
sue plasminogen activator in transgenic mouse milk. Bio/Technology 1987;5:1183- 1187.
43. Purse1 VG, Pinkert CA, Miller KF, Bolt DJ, Campbell RG, Palmiter RD, Brinster RL, Hammer
RE. Genetic engineering of livestock. Science 1989;244:1281- 1287.
44. Hennighausen L. The mammary gland as a bioreactor: Production of foreign proteins in milk.
Protein Expr Purif 1990;1:3-8.
45. Janne J, Hyttinen JM, Peura T, Tolvanen M, Alhonen L, Halmekyto M. Transgenic animals as
bioproducers of therapeutic proteins. Ann Med 1992;24:273-280.
46. Logan JS. Transgenic animals: beyond ‘funny milk‘. Curr Opin Biotechnol 1993;4:591-595.
47. Houdebine LM. Production of pharmaceutical proteins from transgenic animals. J Biotechnol
1994;34:269-287.
48. Maga EA, Anderson GB, Murray JD. The effect of mammary gland expression of human lyso-
zyme on the properties of milk from transgenic mice. J Dairy Sci 1995;78:2645-2652.
49. Colman A. Production of proteins in the milk of transgenic livestock: Problems, solutions, and
successes. Am J Clin Nutr 1996;63:6398-6458.
50. Lubon H, Paleyanda RK, Velander WH, Drohan WN. Blood proteins from transgenic animal
bioreactors. Trans Med Rev 1996;10:131- 143.
51. Choo KH, Raphael K, McAdam W, Peterson MG. Expression of active human blood clotting
factor IX in transgenic mice: use of a cDNA with complete mRNA sequence. Nucl Acids Res
1987;15:872-885.
52. Kelsey GD, Povey S, Bygrave AE, Lovell-Badge RH. Species- and tissue-specific expression of
human al-antitrypsin in transgenic mice. Genes Devel 1987;1:161-171.
53. Jallat S, Perraud F, Dalemans W, Balland A, Dieterle A, FaureT, Meulien P, Pavirani A. Charac-
terization of recombinant human factor IX expressed in transgenic mice and in derived trans-
immortalized hepatic cell lines. EMBO J 1990;9:3295-3301.
54. Massoud M, Bischoff R, Dalemans W, Pointu H, Attal J, Schultz H, Clesse D, Stinnakre MG,
Pavirani A, Houdebine LM. Expression of active recombinant human alpha 1-antitrypsin in
transgenic rabbits. J Biotechnol 1991;18:193-203.
55. Lin JH, Zhao H, Sun TT.A tissue-specific promoter that can drive a foreign gene to express in
the suprabasal urothelial cells of transgenic mice. Proc Natl Acad Sci USA 1995;92:679-683.
56. Midkkelsen TR, Brandt J, Larsen HJ, Larsen BB, Poulsen K, Ingerslev J, Din N, Hjorth JF? Tis-
sue-specific expression in the salivary glands of transgenic mice. Nucl Acids Res 1992;20:
2249-2255.
57. Rancourt DE, Peters ID, Walker VK, Davies PL. Wolfish antifreeze protein from transgenic
Drosophila. BiolTechnology 1990;8:453-457.
58. Peters ID, Rancourt DE, Davies PL, Walker VK. Isolation and characterization of an antifreeze
protein precursor from transgenic Drosophila: evidence for partial processing. Biochim Biophys
Acta 1993;1171:247-254.
59. Hall J, Ali S, Surani MA, Hazlewood GP, Clark AJ, Simons JP, Hirst BH, Gilbert HJ. Manipu-
lation of the repertoire of digestive enzymes secreted into the gastrointestinal tract of transgenic
mice. Bio/Technology 1993;11:376-379.
60. Bry L, Falk PG, Gordon JI. Genetic engineering of carbohydrate biosynthetic pathways in trans-
genic mice demonstrates cell cycle-associated regulation of glycoconjugate production in small
40

intestinal epithelial cells. Proc Natl Acad Sci USA 1996;93:1161- 1166.
61. Damak S, Jay NP, Barrel1 GK, Bullock DW. Targeting gene expression to the wool follicle in
transgenic sheep. Bio/Technology 1996;14:181- 184.
62. Nony P, Prudhomme JC, Couble P. Regulation of the P25 gene transcription in the silk gland of
Bombyx Biol Cell 1995;84:43-52.
63. Slack JL, Liska DJ, Bornstein P. An upstream regulatory region mediates high-level, tissue-spe-
cific expression of the human al(1) collagen gene in transgenic mice. Molec Cell Biol 1991;
1112066-2074.
64. DSouza RN, Niederreither K, de Crombrugghe, B. Osteoblast-specific expression of the u2(I)
collagen promoter in transgenic mice: correlation with the distribution of TGF-P 1. J Bone
Miner Res 1993;8:1127-1136.
65. Tsumaki N, KimuraT, Matsui Y, Nakata K, Ochi T Separable cis-regulatory elements that con-
tribute to tissue- and site-specific a2(XI) collagen gene expression in the embryonic mouse car-
tilage. J Cell Biol 1996;134:1573-1582.
66. Behringer RR, RyanTM, Reilly MP, AsakuraT, Palmiter RD, Brinster RL,TownesTM. Synthe-
sis of functional human hemoglobin in transgenic mice. Science 1989;245:971-973.
67. Hanscombe 0,Vidal M, Kaeda J, Luzzatto L, Greaves DR, Grosveld F. High-level erythroid-
specific expression of the human P-globin gene in transgenic mice and the production of human
hemoglobin in murine erythrocytes. Genes Devel 1989;3:1572- 1581.
68. Sharma A, Khoury-Christianson AM,White SP, Dhanjal NK, Huang W, Paulhiac C, Friedman
EF, Manjula BN, Kumar R. High-efficiency synthesis of human a-endorphin and magainin in
the erythrocytes of transgenic mice: a production system for therapeutic peptides. Proc Natl
Acad Sci USA 1994;91:9337-9341.
69. Swanson ME, Martin MJKOD, Hoover K, Lago W, Huntress V, Parsons CT, Pinkert CA, Pilder
S, Logan JS. Production of functional human hemoglobin in transgenic swine. Bio/Technology
1992;10:557-559.
70. Serra D, Fillat C, Matas R, Bosch F, Hegardt FG. Tissue-specific expression and dietary regula-
tion of chimeric mitochondria1 3-hydroxy-3-methylglutarylcoenzyme A synthase/human
growth hormone gene in transgenic mice. J Biol Chem 1996;271:7529-7534.
71. Haigh J, McVeigh J, Greer P. The fps/fes tyrosine kinase is expressed in myeloid, vascular
endothelial, epithelial, and neuronal cells and is localized in the trans-golgi network. Cell
Growth Differ 1996;7:931-944.
72. Paleyanda RK, Drews R, Lee TK, Lubo: H. Secretion of human hrin into mouse milk. J Biol
Chem 1997;272:15270-15274.
73. DiTullio P,Cheng SH, Marshall J, Gregory RJ, Ebert KM, Meade HM, Smith AE. Production
of cystic fibrosis transmembrane conductance regulator in the milk of transgenic mice. Bio/
Technology 1992;10174-77.
74. Green LL, Hardy MC, Maynard-Currie CE,Tsuda H, Louie DM, Mendez MJ, Abderrahim H,
Noguchi M, Smith DH, ZengY, David NE, Sasai H, Garza D, Brenner DG, Hales J E McGuin-
ness RP, Capon DJ, Klapholz S, Jakobovits A. Antigen-specific human monoclonal antibodies
from mice engineered with human Ig heavy and light chain YACs. Nature Genet 1994;7:13-21.
75. Maga EA, Murray JD. Mammary gland expression of transgenes and the potential for altering
the properties of milk. Bio/Technology 1995;13:1452- 1457.
76. Damak S, Su H-Y, Jay NP, Bullock DW. Improved wool production in transgenic sheep expres-
sing insulin-like growth factor 1. Bio/Technology 1996;14:185- 188.
77. Platenburg GJ, Kootwijk EP, Kooiman PM, Woloshuk SL, Nuijens JH, Krimpenfort PJ, Pieper
FR, de Boer HA, Striker R. Expression of human lactoferrin in milk of transgenic mice.Trans-
genic Res 1994;3:99-108.
78. Rosochacki SJ, Smirnov A, Kozikova L, Sadowska J, Jefimov A, Zwierzchowski L. Transfer of
human growth-related genes into rabbits. Anim Sci Papers Reports 1992;9:81-90.
79. Bawden CS, Sivaprasad AYVerma PJ, Walker SK, Rogers GE. Expression of bacterial cysteine
biosynthesis genes in transgenic mice and sheep: toward a new in vivo amino acid biosynthesis
 41

pathway and improved wool growth. Transgenic Res 1995;4:87- 104.

80. Yarus S, Rosen JM, Cole AM, Diamond G. Production of active bovine tracheal antimicrobial
peptide in milk of transgenic mice. Proc Natl Acad Sci USA 1996;93:14118-14121.
81. Bulera SJ, Haas MJ, Sattler CA, Li Y, Pitot HC. Cell lines with heterogeneous phenotypes result
from a single isolation of albumin-SV40 T-antigen transgenic rat hepatocytes. Hepatology
1997;25:1192- 1203.
82. Pavirani A, SkernT, Le Meur M, LutzY, Lathe R, Crystal RG, Fuchs J-P, Gerlinger P, Courtney
M. Recombinant proteins of therapeutic interest expressed by lymphoid cell lines derived from
transgenic mice. Bio/Technology 1989;7:1049-1054.
83. Perraud F, Dalemans W, Ali-Hadji D, Pavirani A. Novel cell lines derived from transgenic mice
expressing recombinant human proteins. Transgenic hepatoma-derived lines. Cytotechnology
1992;9:69-75.
84. Langford GA, Cozzi E,Yannoutsos N, Lancaster R, Elsome K, Chen P, White DJG. Production
of pigs transgenic for human regulators of complement activation using YAC technology. Trans-
plant Proc 1996;28:862-863.
85. Fodor WL,William GL, Matis LA, Madri JA, Rollins SA, Knight JW, Velander W, Squint0 SI?
Expression of a functional human complement inhibitor in a transgenic pig as a model for the
prevention of xenogeneic hyperacute organ rejection. Proc Natl Acad Sci USA 1994;91:
11153-1 1157.
86. Diamond LE, McCurry KR, Martin MJ, McClellan SB, Oldham ER, Platt JL, Logan JS. Char-
acterization of transgenic pigs expressing hnctionally active human CD59 on cardiac endothe-
hum. Transplantation 1996;61:1241- 1249.
87. Schmoeckel M, Nollert G, Shahmohammadi M, Young VK, Knig W, White DJ, Hammer C,
Reichart B. Human decay accelerating factor successfully protects pig hearts from hyperacute
rejection by human blood. Transplant Proc 1996;28:768-769.
88. Wilson C, Bellen HJ, Gehring WJ. Position effects on eukaryotic gene expression. Ann Rev Cell
Biol 1990;6:679-714.
89. Palmiter RD, Brinster RL. Germ-line transformation of mice. Ann Rev Genet 1986;20:
465-499.
90. Dillon N, Grosveld F. Chromatin domains as potential units of eukaryotic gene function. Curr
Opin Genet Devel 1994;4:260-264.
91. Grosveld R, van Assendelft BG, Greaves DR, Kolias G. Position-independent high-level expres-
sion of the human P-globin gene in transgenic mice. Cell 1987;51:975-985.
92. Huber MC, Kruger G, Bonifer C. Genomic position effects lead to an inefficient reorganization
of nucleosomes in the 5’-regulatory region of the chicken lysozyme locus in transgenic mice.
Nucl Acids Res 1996;24:1443--1452.
93. Whitelaw CBA, Harris H, McClenaghan M, Simons JP, Clark AJ. Position-independent expres-
sion of the ovine P-lactoglobulin gene in transgenic mice. Biochem J 1992;286:31-39.
94. Archibald AL, McClenaghan M, Hornsey V, Simons JP, Clark AJ. High level expression of bio-
logically active human a I-antitrypsin in the milk of transgenic mice. Proc Natl Acad Sci USA
1990;87:5178-5182.
95. McKnight RA, Shamay A, Sankaran L, Wall RJ, Hennighausen L. Matrix-attachment regions
can impart position-independent regulation of a tissue-specific gene in transgenic mice. Proc
Natl Acad Sci USA 1992;89:6943-6947.
96. Bonifer C, Yannoutsos N, Kruger G, Grosveld F, Sippel AE. Dissection of the locus control
function located on the chicken lysozyme gene domain in transgenic mice. Nucl Acids Res
1994;22:4202-4210.
97. McKnight RA, Spencer M,Wall RJ, Hennighausen L. Severe position effects imposed on a lkb
mouse whey acidic protein gene promoter are overcome by heterologous matrix attachment
regions. Molec Reprod Devel 1996;44:179- 184.
98. Clark AJ, Cowper A, Wallace R, Wright G, Simons JP. Rescuing transgene expression by co-
integration. Bio/Technology 1992;10:1450- 1454.
42

99. Clark AJ, Archibald AL, McClenaghan M, Simons JP, Wallace R, Whitelaw CBA. Enhancing
the efficiency of transgene expression. Phil Trans R SOCLond B 1993;339:225-232.
100. Attal J, Cajero-Juarez M, Petitclerc D, Theron M-C. The effect of matrix attached regions
(MAR) and specialized chromatin structure (SCS) on the expression of gene constructs in cul-
tured cells and in transgenic mice. Molec Biol Rep 1996;22:37-46.
101. Barash I, Ilan N, Kari R, Hurwitz DR, Shani M. Co-integration of P-lactoglobulin/human se-
rum albumin hybrid genes with the entire P-lactoglobulin gene or the matrix attachment region
element: repression of human serum albumin and P-lactoglobulin expression in the mammary
gland and dual regulation of the transgenes. Molec Reprod Devel 1996;45:421-430.
102. Brinster RL, Allen JM, Behringer RR, Gelinas RE, Palmiter RD. Introns increase transcrip-
tional efficiency in transgenic mice. Proc Natl Acad Sci USA 1988;85:836-840.
103. Palmiter RD, Sandgren EP, Avarbock MR, Allen DD, Brinster RL. Heterologous introns can
enhance expression of transgenes in mice. Proc Natl Acad Sci USA 1991;88:478-482.
104. Gitschier J,Wood WI, GoralkaTM,Wion KL, Chen EY, Eaton DH,Vehar GA, Capon DJ, Lawn
RM. Characterization of the human factor VIII gene. Nature 1984;312:326-330.
105. Pieper FR, de Wit IC, Pronk AC, Kooiman PM, Strijker R, Krimpenfort PJ, Nuyens JH, de
Boer HA. Efficient generation of functional transgenes by homologous recombination in murine
zygotes. Nucl Acids Res 1992;20:1259- 1264.
106. Lamb BT, Gearhart JD. YAC transgenics and the study of genetics and human disease. Curr
Opin Genet Devel 1995;5:342-348.
107. Levinson B, Kenwrick S, Lakich D, Hammonds JG, Gitschier J. A transcribed gene in an intron
of the human factor VIII gene. Genomics 1990;7:1- 11.
108. Levinson B, Kenwrick S, Camel P, Fisher K, Gitschier J. Evidence for a third transcript from the
human factor VIII gene. Genomics 1992;14:585-589.
109. Lynch CM, Israel DI, Kaufman RJ, Miller AD. Sequences in the coding region of clotting factor
VIII act as dominant inhibitors of RNA accumulation and protein production. Hum Gene
Ther 1993;4:259-272.
110. Koeberl DD, Halbert CL, Krumm A, Miller AD. Sequences within the coding regions of clot-
ting factor VIII and CFTR block transcriptional elongation. Hum Gene Ther 1995;6:469-479.
111. Hoeben RC, Fallaux FJ, Cramer SJ, van den Wollenberg DJ, van Ormondt H, Briet E, van der
Eb AJ. Expression of the blood-clotting factor-VIII cDNA is repressed by a transcriptional si
lencer located in its coding region. Blood 1995;85:2447-2454.
112. Fallaux FJ, Hoeben RC, Crammer SJ, van den Wollenberg DJM, Briet E, van Ormondt H, van
der Eb AJ. The human clotting factor VIII cDNA contains an autonomously replicating
sequence consensus- and matrix attachment region-like sequence that binds a nuclear factor,
represses heterologous gene expression, and mediates the transcriptional effects of sodium buty-
rate. Molec Cell Biol 1996;16:4264-4272.
1 13. Xu M, Hammer RE, Blasquez VC, Jones SL, Garrard WT Immunoglobulin K gene expression
after stable integration. 11. Role of the intronic MAR and enhancer in transgenic mice. J Biol
Chem 1989;264:21190-21195.
I 14. Forrester WC, van Genderen C, Jenuwein T, Grosschedl R. Dependence of enhancer-mediated
transcription of the immunoglobulin p gene on nuclear matrix attachment regions. Science
1994;265:1221-1225.
115. Sabourin JC, Kern AS, Gregori C, Porteu A, Cywiner C, Chatelet FP, Kahn A, Pichard AL. An
intronic enhancer essential for tissue-specific expression of the aldolase B transgenes. J Biol
Chem 1996;271:3469-3473.
116. Sherwood AL, Bottenus RE, Martzen MR, Bornstein P. Structural and functional analysis of
the first intron of the human a2(I) collagen-encoding gene. Gene 1990;89:239-244.
117. Begemann M, Tan SS, Cunningham BA, Edelman GM. Expression of chicken liver cell adhe-
sion molecule fusion genes in transgenic mice. Proc Natl Acad Sci USA 1990;87:9042-9046.
118. Russo AF, Crenshaw EB, Lira SA, Simmons DM, Swanson LW, Rosenfeld MG. Neuronal
expression of chimeric genes in transgenic mice. Neuron 1988;1:311-320.
 43

119. Giinzburg WH, Salmons B, Zimmermann B, Miiller M, Erne V, Brem G. A mammary-specific

promoter directs expression of growth hormone not only to the mammary gland, but also to
Bergman glia cells in transgenic mice. Molec Endocrinol l991;5: 123- 133.
120. Magendzo K, Shirvan A, Cultraro C, Srivastava M, Pollard HB, Burns AL. Alternative splicing
of human synexin mRNA in brain, cadiac, and skeletal muscle alters the unique N-terminal
domain. J Biol Chem 1991;266:3228-3232.
121. Hadsell DL, Greenberg NM, Fligger JM, Baumrucker CR, Rosen JM. Targeted expression of
des (1-3) human insulin-like growth factor I (IGF-I) in transgenic mice influences mammary
gland development and IGF-binding protein expression. Endocrinology 1996;137:32 1-330.
122. Edwalds-Gilbert G,Veraldi KL, Milcarek C. Alternative poly(A) site selection in complex tran-
scription units: means to an end? Nucl Acids Res 1997;25:2547-2561.
123. Falcone D, Andrews DW Both the 5’ untranslated region and the sequences surrounding the
start site contribute to efficient initiation of translation in vitro. Molec Cell Biol 199l;ll:
2656-2664.
124. Tanguay RL, Gallie DR. Translational efficiency is regulated by the length of the 3’ untranslated
region. Molec Cell Biol 1996;16:146- 156.
125. Yull F, Harold G, Wallace R. Cowper A, Percy J, Cottingham I, Clark A. Fixing human factor
IX (fIX): correction of a cryptic RNA splice enables the production of biologically active fIX
in the mammary gland of transgenic mice. Proc Natl Acad Sci USA 1995;92:10899-10903.
126. Engel JD. Developmental regulation of human P-globin gene transcription: a switch of loyalties?
Trends Genet 1993;9:304-309.
127. Sharma A, Matin MJ, Okabe JF,Truglio RA, Dhanjal NK, Logan JS, Kumar R. An isologous
promoter permits high level expression of human hemoglobin in transgenic swine. Bio/Technol-
Ogy 1994;12~55 -59.
128. Sifers RN, Carlson JA, Clift SM, DeMayo FJ, Bullock DW, Woo SL. Tissue specific expression
of the human a-I-antitrypsin gene in transgenic mice. Nucl Acids Res 1987;15:1459- 1475.
129. Dente L, Ruther U,Tripodi M,Wagner EF, Cortese R. Expression of human ul-acid glycopro-
tein genes in cultured cells and in transgenic mice. Genes Devel 1988;2:259-266.
130. McWhir J, Schnieke AE, Ansell R,Wallace H, Colman A, Scott AR, Kind AJ. Selective ablation
of differentiated cells permits isolation of embryonic stem cell lines from murine embryos with
a non-permissive genetic background. Nature Genet 1996;14:223-226.
131. Stacey A, Schnieke A, McWhir J, Cooper J, Colman A, Melton DW Use ofdouble-replacement
gene targeting to replace the murine a-lactalbumin gene with its human counterpart in embry-
onic stem cells and mice. Molec Cell Biol 1994;14:1009--1016.
132. Campbell KHS, McWhir J, Ritchie WA,Wilmut I. Sheep cloned by nuclear transfer from a cul-
tured cell line. Nature 1996;380:64-66.
133. Taylor LD, Carmack CE, Schramm SR, Mashayekh R, Higgins KM, Kuo CC, Woodhouse C,
Kay RM, Lonberg N. A transgenic mouse that expresses a diversity of human sequence heavy
and light chain immunoglobulins. Nucl Acids Res 1992;20:6287-6295.
134. Lonberg N, Taylor LD, Harding FA, Trounstine M, Higgins KM, Schramm SR, Kuo CC,
Mashayekh R,Wymore K, McCabe JG, Munoz-O’Regan D, ODonnell SL, Lapachet ESG, Ben-
goechea T, Fishwild DM, Carmack CE, Kay RM, Huszar D. Antigen-specific human antibodies
from mice comprising four distinct genetic modifications. Nature 1994;368:856-859.
135. Wagner SD, Gross G, Cook GP, Davies SL, Neuberger MS. Antibody expression from the core
region of the human IgH locus reconstructed in transgenic mice using bacteriophage P1 clones.
Genomics 1996;35:405-414.
136. Zou X, Xian J, Davies NP, Popov AV, Bruggemann M. Dominant expression of a 1.3 Mb human
Igr locus replacing mouse light chain production. FASEB J 1996;lO:1227- 1232.
137. Mendez MJ, Green LL, Corvalan JR, Jia XC, Maynard-Currie CE,Yang XD, Gallo ML, Louie
DM, Lee DV, Erickson KL, Luna J, Roy CM, Abderrahim H, Kirschenbaum F, Noguchi M,
Smith DH, Fukushima A, Hales JF, Finer MH, Davis CG, Zsebo KM, Jakobovits A. Functional
transplant of megabase human immunoglobulin loci recapitulates human antibody response in
44

mice. Nature Genet 1997;15:146- 156.

138. Shani M, Barash I, Nathan M, Ricca G, Searfoss GH, Dekel I, Faerman A, Givol D, Hurwitz
DR. Expression of human serum albumin in the milk of transgenic mice. Transgenic Res
19923:195-208.
139. Hurwitz DR, Nathan M, Barash I, Ilan N, Shani M. Specific combinations of human serum
albumin introns direct high level expression of albumin in transfected COS cells and in the
milk of transgenic mice. Transgenic Res 1994;3:365-375.
140. Barash I, Faerman A, Baruch A, Nathan M, Hurwitz DR, Shani M. Synthesis and secretion of
human serum albumin by mammary gland explants of virgin and lactating transgenic mice.
Transgenic Res 1993;2:266-276.
141. Barash I, Faerman A, RatovitsbT, Puzis R, Nathan M, Hurwitz DR, Shani M. Ectopic expres-
sion of P-lactoglobulin/human serum albumin hsion genes in transgenic mice: Hormonal regu-
lation and in situ localization. Transgenic Res 1994;3:141-151.
142. Barash I, Nathan M, Kari R, Ilan N, Shani M, Hurwitz DR. Elements within the P-lactoglobu-
lin gene inhibit expression of human serum albumin cDNA and minigenes in transfected cells
but rescue their expression in the mammary gland of transgenic mice. Nucl Acids Res
1996;24:602-6 10.
143. Baruch A, Shani M, Hurwitz DR, Barash I. Developmental regulation of the ovine P-lactoglo-
bulinlhuman serum albumin transgene is distinct from that of the P-lactoglobulin and the endo-
genous p-casein genes in the mammary gland of transgenic mice. Devel Genet 1995;16:
241 -252.
144. Ilan N, Barash I, Faerman A, Shani M. Dual regulation of j3-lactoglobulin/human serum albu-
min gene expression by the extracellular matrix in mammary cells from transgenic mice. Exp
Cell Res 1996;224:28-38.
145. Ilan N, Barash I, Raikhinstein M, Faerman A, Shani M. p-Lactoglobulin/human serum albu-
min hsion genes do not respond accurately to signals from the extracellular matrix in mam-
mary epithelial cells from transgenic mice. Exp Cell Res 1996;228:146- 159.
146. Devinoy E, Thepot D, Stinnakre M-G, Fontaine M-L, Grabowski H, Puissant C, Pavirani A,
Houdebine L-M. High level production of human growth hormone in the milk of transgenic
mice: The upstream region of the rabbit whey acidic protein (WAP) gene targets transgene
expression to the mammary gland. Transgenic Res 1994;3:79-89.
147. Saban J, Schneider GB, Bolt D, King D. Erythroid-specific expression of human growth hor-
mone affects bone morphology in transgenic mice. Bone 1996;18:47-52.
148. Suk K, Jung D-Y, Kang S-K, Kang S-W, Seo EJ, Kang HA,Yu M-H, Seo J-S. Human erythro-
poietin-induced polycythemia in transgenic mice. Molec Cell 1995;5:634-640.
149. Massoud M, Attal J, Thepot D, Pointu H, Sytinnakre MG, Theron MC, Lopez C, Houdebine
LM. The deleterious effects of human erythropoietin gene driven by the rabbit whey acidic pro-
tein gene promoter in transgenic rabbits. Reprod Nutr Devel 1996;36:555-563.
150. Korhonen V-P, Tolvanen M, Hyttinen J-M, Uusi-Oukari M, Sinervirta R, Alhonen L, Jauhiai-
nen M, Janne OA, Janne J. Expression of bovine P-lactoglobulin/human erythropoietin hsion
protein in the milk of transgenic mice and rabbits. Eur J Biochem 1997;245:482-489.
151. Colman A. Production of vitamin K-dependent proteins in the milk of transgenic mammals,
Exploiting transgenic technology for commercial development, IBC Meeting, San Diego,
1995;l-4.
152. Hennighausen LG, Sippel AE. Comparative sequence analysis of the mRNAs coding for mouse
and rat whey proteins. Nucl Acids Res 1982;10:3733-3743.
153. Hennighausen LG, Sippel AE. Characterization and cloning of the mRNAs specific for the lac-
tating mouse mammary gland. Eur J Biochem 1982;125:131-141.
154. Hobbs AA, Richards DA, Kessler DJ, Rosen JM. Complex hormonal regulation of rat casein
gene expression. J Biol Chem 1982;257:3598-3605.
155. Grabowski H, Le Bars D, C h h e N, Attal J, Malienou-N’Gassa R, Puissant C, Houdebine LM.
Rabbit whey acidic protein concentration in milk, serum, mammary gland extract, and culture
 45

medium. J Dairy Sci 1991;74:4143-4150.

156. Berg OU, von Bahr-Lindstom H, Zaidi ZH, Jornvall H. A camel milk whey protein rich in half-
cysteine. Primary structure, assessment of variations, internal repeat patterns, and relationships
with neurophysin and other active polypeptides. Eur J Biochem 1986;159:195-201.
157. Simpson KJ, Bird P, Shaw D, Nichols K. Isolation, characterization and hormone-dependent
expression of the porcine whey acidic protein. Biochem SOCTransact 1996;24:367S.
158. Devinoy E, Hubert C, Jolivet G, Thepot D, Clergue N, Desaleux M, Dion M, Servely JL, Hou-
debine LM. Recent data on the structure of rabbit milk protein genes and on the mechanism
of the hormonal control of their expression. Reprod Nutr Devel 1988;28:1145-1164.
159. Pittius CW, Sankaran L, Topper Y, Hennighausen L. Comparison of the regulation of the whey
acidic protein gene with that of a hybrid gene containing the whey acidic protein gene promoter
in transgenic mice. Molec Endocrinol 1988;2:1027- 1032.
160. Topper YJ, Freeman CS. Multiple hormone interactions in the developmental biology of the
mammary gland. Physiol Rev 1980;60:1049-1 106.
161. Doppler W, Hock W, Hofer P, Groner B, Ball RK. Prolactin and glucocorticoid hormones con-
trol transcription of the p-casein gene by kinetically distinct mechanisms. Molec Endocrinol
1990;4:912-919.
162. Burdon T, Sankaran L, Wall RJ, Spencer M, Hennighausen L. Expression of a whey acidic pro-
tein transgene during mammary development: evidence for different mechanisms of regulation
during pregnancy and lactation. J Biol Chem 1991;266:6909-6914.
163. Puissant C, Houdebine L-M. Cortisol induces rapid accumulation of whey acid protein mRNA
but not of a,,- and p-casein mRNA in rabbit mammary explants. Cell Biol Int Rep 1991;15:
121- 129.
164. Chen L-H, Bissell MJ. A novel regulatory mechanism for whey acidic protein gene expreession.
Cell Regul 1989;1:45-54.
165. Lin CQ, Dempsey PJ, Coffey RJ, Bissell MJ. Extracellular matrix regulates whey acidic protein
gene expression by suppression of TGF-a in mouse mammary epithelial cells: studies in culture
and in transgenic mice. J Cell Biol 1995;129:1115-1126.
166. Roskelley CD, Srebrow A, Bissell MJ. A hierarchy of ECM-mediated signalling regulates tissue-
specific gene expression. Curr Opin Cell Biol 1995;7:736-747.
167. Streuli CH, Edwards GM, Delcommenne M, Whitelaw CBA, Burdon TG, Schindler C, Watson
CJ. Stat5 as a target for regulation by extracellular matrix. J Biol Chem 1995;270:21639-21644.
168. Streuli CH, Schmidhauser C, Bailey N, Yurchenko P, Skubitz APN, Roskelley C, Bissell MJ.
Laminin mediates tissue-specific gene expression in mammary epithelia. J Cell Biol 1995;129:
59 1-603.
169. Pittius CW, Hennighausen L, Lee E,Westphal H, Nicols E,Vitale J, Gordon K. A milk protein
gene promoter directs the expression of human tissue plasminogen activator cDNA to the mam-
mary gland in transgenic mice. Proc Natl Acad Sci USA 1988;85:5874-5878.
170,Hennighausen L, Lubon H. Interaction of protein with DNA in vitro. Meth Enzymol
1987;152:721-735.
171. Lubon H, Hennighausen L. Nuclear proteins from lactating mammary glands bind to the pro-
moter of a milk gene. Nucl Acids Res 1987;15:2103-2122.
172. Lubon H, Hennighausen L. Conserved region of the rat a-lactalbumin promoter is a target for
protein binding in vitro. Biochem J 1988;256:391-396.
173. Lubon H, Ghazal P, Nelson JA, Hennighausen L. Cell-specific activity of the human immuno-
deficiency virus enhancer repeat in vitro. AIDS Res Hum Retroviruses 1988;4:381-391.
174. Ghazal P, Lubon H, Fleckenstein B, Hennighausen L. Binding of transcription factors and
creating of a large nucleoprotein complex on the human cytomegalovirus enhancer. Proc Natl
Acad Sci USA 1987;84:3658-3662.
175. Lubon H, Hennighausen L. The murine whey acidic protein gene promoter is recognized by
nuclear factors from mammary epithelial cells. Molec Genet (Life Sci Adv) 1987;6:205-209.
176. Ghazal P, Lubon H, Hennighausen L. Multiple sequence specific transcription factors modulate
46

cytomegalovirus enhancer activity in vitro. Molec Cell Biol 1988;8:1809- 181 1 .

177. Ghazal P, Lubon H, Hennighausen L. Specific interaction between transcription factors and the
promoter-regulatory region of the human cytomegalovirus major immediate-early gene. J Virol
1988;62:1076-1079.
178. Lubon H, Ghazal P, Hennighausen L, Reynolds-Kohler C, Luckshin C, Nelson JA. Cell-specific
activity of the modulator region in the human cytomegalovirus major immediate early gene.
Molec Cell Biol 1989;9:1342- 1345.
179. Lubon H, Pittius CW, Hennighausen L. In vitro transcription of the mouse whey acidic protein
promoter is affected by upstream sequences. FEBS Lett 1989;251:173- 176.
180. Wen J, Kawamata Y, Tojo H, Tanaka S, Tachi C. Expression of whey acidic protein (WAP) genes
in tissues other than the mammary gland in normal and transgenic mice expressing mWAP/
hGH fusion gene. Molec Reprod Devel 1995;41:399-406.
181. Welte T, Philipp S, Cairns C, Gustafsson JA, Doppler W. Glucocorticoid receptor binding sites
in the promoter region of milk protein genes. J Steroid Biochem Mol Biol 1993;47:75-81.
182. Mink S, Hartig E, Jennewein P, Doppler W, Cat0 AC. A mammary cell-specific enhancer in
mouse mammary tumor virus DNA is composed of multiple regulatory elements including
binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.
Molec Cell Biol 1992;12:4906-4918.
183. Welte T, Garimorth K, Philipp S, Jennewein P, Huck C, Cat0 AC, Doppler W. Involvement of
Ets-related proteins in hormone-independent mammary cell-specific gene expression. Eur J
Biochem 1994;223:997- 1006.
184. Kolb AF, Gunzburg WH, Albang R, Brem G, Erfle V, Salmons B. Negative regulatory element
in the mammary specific whey acidic protein promoter. J Cell Biochem 1994;56:245-261.
185. Watson CJ, Gordon KE, Robertson M, Clark AJ. Interaction of DNA-binding proteins with a
milk protein gene promoter in vitro: identification of a mammary gland-specific factor. Nucl
Acids Res 1991 ; 19:6603-6610.
186. Li S, Rosen JM. Nuclear factor I and mammary gland factor (STAT5) play a critical role in regu-
lating rat whey acidic protein gene expression in transgenic mice. Molec Cell Biol 1995;15:
2063-2070.
187. McKnight RA, Spencer M, Dittmer J, Brady JN, Wall RJ, Hennighausen L. An Ets site in the
whey acidic protein gene promoter mediates transcriptional activation in the mammary gland
of pregnant mice but is dispensable during lactation. Molec Endocrinol 1995;9:717-724.
188. Paleyanda RK, Zhang DW, Hennighausen L, McKnight R, Drohan WN, Lubon H. Regulation
of human protein C gene expression by the mouse WAP promoter. Transgenic Res 1994;3:
335-343.
189. Chan GC, Hess P, Meenakshi T, Carlstedt-Duke J, Gustafsson JA, Payvar F. Delayed secondary
glucocorticoid response elements. Unusual nucleotide motifs specify glucocorticoid receptor
binding to transcribed regions of a2,-globulin DNA. J Biol Chem 1991;266:22634-22644.
190. Jennewein P. Funktionelle Analyse des WAP Gen Promotors. Universitat Innsbruck, 1992.
191. Doppler W, Villunger A, Jennewein P, Brduscha K, Groner B, Ball RK. Lactogenic hormone
and cell type-specific control of the whey acidic protein gene promoter in transfected mouse
cells. Molec Endocrinol 1991;5:1624-1632.
192. Devinoy E, Maliknou-N’Gassa R, Thepot D, Puissant C, Houdebine LM. Hormone responsive
elements within the upstream sequences of the rabbit whey acidic protein (WAP) gene direct
chloramphenicol acetyl transferase (CAT) reporter gene expression in transfected rabbit mam-
mary cells. Molec Cell Endocrinol 1991;81:185--193.
193. Nye JA, Petersen JM, Gunther CV, Jonsen MD, Graves BJ. Interaction of murine ets-1 with
GGA-binding sites establishes the ETS domain as a new DNA-binding motif. Genes Devel
1992;6:975-990.
194. Dittmer J, Gegonne A, Gitlin SD, Ghysdael J, Brady JN. Regulation of parathyroid hormone-
related protein (PTHrP) gene expression. Spl binds through an inverted CACCC motif and
regulates promoter activity in cooperation with Etsl. J Biol Chem 1994;269:21428-21434.
 47

195. Li S, Rosen JM. Distal regulatory elements required for rat whey acidic protein gene expression
in transgenic mice. J Biol Chem 1994;269:14235-14243.
196. Goodrich JA, Cutler G, Tjian R. Contacts in context: Promoter specificity and macromolecular
interactions in transcription. Cell 1996;84:825-830.
197. Wall RJ, Purse1 VG, Shamay A, McKnight RA, Pittius CW, Hennighausen L. High-level syn-
thesis of a heterologous milk protein in the mammary glands of transgenic swine. Proc Natl
Acad Sci USA 1991;88:1696--1700.
198. Bayna EM, Rosen JM. Tissue-specific, high level expression of the rat whey acidic protein gene
in transgenic mice. Nucl Acids Res 1990;18:2977-2985.
199. DaleTC, Krnacik MJ, Schmidhauser C,Yang C-Q, Bissell MJ, Rosen JM. High-level expression
of the rat whey acidic protein gene is mediated by elements in the promoter and 3’ untranslated
region. Molec Cell Biol 1992;12:905-914.
200. Li S, Rosen JM. Glucocorticoid regulation of rat whey acidic protein gene expression involves
hormone-induced alterations of chromatin structure in the distal promoter region. Molec Endo-
crinol l994;8: 1328- 1335.
201. Wakao H, Gouilleux F, Groner B. Mammary gland factor (MGF) is a novel member of the
cytokine regulated transcription factor gene family and confers the prolactin response. EMBO
J l994;l3:2182-2191.
202. Schmitt-Ney M, Doppler W, Ball RK, Groner B. 0-Casein gene promoter activity is regulated by
the hormone-mediated relief of transcriptional repression and a mammary-gland-specific
nuclear factor. Molec Cell Biol 1991;11:3745-3755.
203. Hennighausen L, Robinson GW, Wagner K-U, Liu X. Prolactin signaling in mammary gland
development. J Biol Chem 1997;272:7567-7569.
204. Stocklin E, Wissler M, Gouilleux F, Groner B. Functional interactions between Stat5 and the
glucocorticoid receptor. Nature 1996;383:726-728.
205. Kolb AF, Albang R, Brem G, ErfleV, Gunzburg WH, Salmons B. Characterization of a protein
that binds a negative regulatory element in the mammary-specific whey acidic protein promoter.
Biochem Biophys Res Commun 1995;217:1045--1052.
206. Kruse U, Sippel AE. The genes for transcription factor Nuclear Factor I give rise to correspond-
ing splice variants between vertebrate species. J Mol Biol 1994;238:860-865.
207. Gouilleux F, Wakao H, Mundt M, Groner B. Prolactin induces phosphorylation of Tyr694 of
Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 1994;
13:4361-4369.
208. Liu X,Robinson GW, Hennighausen L. Activation of Stat5a and Stat5b by tyrosine phosphory-
lation is tightly linked to mammary gland differentiation. Molec Endocrinol 1996;lO:
1496- 1506.
209. Wasylyk B, Hahn SL, Giovane A. The Ets family of transcription factors. Eur J Biochem
1993;211:7-18.
210. Gil G, Smith JR, Goldstein JL, Slaughter CA, Orth K, Brown MS, OsborneTE Multiple genes
encode nuclear factor I-like proteins that bind to the promoter for 3-hydroxy-3-methylglutaryl-
coenzyme A reductase. Proc Natl Acad Sci USA 1988;85:8963-8967.
21 1. Hartig E, Nierlich B, Mink S, Neb1 G, Cat0 ACB. Regulation of expression of mouse mammary
tumor virus through sequences located in the hormone response element: Involvement of cell-
cell contact and a negative regulatory factor. J Virol 1993;67:813-821.
212. Gounari F, De Francesco R, Schmitt J, van der Vliet P, Cortese R, Stunnenberg H. Amino-
terminal domain of NFI binds to DNA as a dimer and activates adenovirus DNA replication.
EMBO J 1990;9:559-566.
2 13. Colantuoni V, Pirozzi A, Blance C, Cortese, R. Negative control of liver-specific gene expres-
sion: cloned human retinol-binding protein gene is repressed in HeLa cells. EMBO J
1987;6:631-636.
214. Roy RJ, Guerin SL. The 30-kDa rat liver transcription factor nuclear factor 1 binds the rat
growth-hormone proximal silencer. Eur J Biochem 1994;219:799-806.
48

215. Rossi P, Karsenty G, Roberts AB, Roche NS, Sporn MB, de Crombrugghe B. A nuclear factor 1
binding site mediates the transcriptional activation of a type I collagen promoter by transform-
ing growth factor-p. Cell 1988;52:405-414.
216. A d a m AD, Choate DM,Thompson MA. NFI-L is the DNA-binding component of the protein
complex at the peripherin negative regulatory element. J Biol Chem 1995;270:6975-6983.
217. Jones KA, Kadonaga JT, Rosenfeld PJ, Kelly TJ, Tjian R. A cellular DNA-binding protein that
activates eukaryotic transcription and DNA replication. Cell 1987;48:79-89.
218. Shad Y, Ben-Levy R, De-Medina T High affinity binding site for nuclear factor I next to the
hepatits B virus S gene promoter. EMBO J 1986;5
219. InoueT,TamuraT, Furuichi T, Mikoshiba K. Isolat mentary DNAs encoding a cer-
ebellum-enriched nuclear factor I family that activates transcription from the mouse myelin
basic protein promoter. J Biol Chem 1990;265:19065- 19070.
220. Gao B, Jiang L, Kunos G. Transcriptional regulation of C({b adrenergic receptors (albAR) by
nuclear factor 1 (NFl): a decline in the concentration of NFI correlates with the downregula-
tion of albAR gene expression in regenerating h e r . Molec Cell Biol 1996;16:5997-6008.
221. Ivanov VN, Kabishev S, Gorodetsky S, Gribanovsky V, Williams RO. Activation of the transcrip-
tion factors NFI and NFKB in bovine mammary gland during lactation. Molec Biol (Moscow)
1990;24:1605- 1615.
222. Burdon TG, Maitland KA, Clark AJ, Wallace R, Watson CJ. Regulation of the sheep p-lacto-
globulin gene by lactogenic hormones is mediated by a transcription factor that binds an inter-
feron-y activation site-related element. Molec Endocrinol 1994;8:1528-1536.
223. Greenberg NM, Reding TV, D u e T, Rosen JM. A heterologous hormone response element
enhances expression of rat p-casein promoter-driven chloramphenicol acetyltransferase hsion
genes in the mammary gland of transgenic mice. Molec Endocrinol 1991;5:1504-1512.
224. Sassi H, Fromont-Racine M, Grange T, Pictet R. Tissue specificity of a glucocorticoid-depend-
ent enhancer in transgenic mice. Proc Natl Acad Sci USA 1995;92:7197-7201.
225. Hennighausen L,Wall RJ,Tillmann U, Li M, Furth PA. Conditional gene expression in secretory
tissues and skin of transgenic mice using the MMW-LTR and the tetracycline responsive sys-
tem. J Cell Biochem 1995;59:463-472.
226. Kistner A, Gossen M, Zimmermann F, Jerecic J, Ullmer C, Lubbert H, Bujard H. Doxycycline-
mediated quantitative and tissue-specific control of gene expression in transgenic mice. Proc
Natl Acad Sci USA 1996;93:10933-10938.
227. Velander WH, Page RL, Morcol T, Russell CG, Canseco R,Young JM, Drohan WN, Gwazdaus-
kas FC,WilkinsTD, Johnson JL. Production of biologically active protein C in the milk of trans-
genic mice. Ann NY Acad Sci 1992;665:391-403.
228. Russell CG. Improvement of expression of recombinant human protein C in the milk of trans-
genic animals using a novel transgene construct, PhD Thesis. Virginia Polytechnic Institute
and State University, Blacksburg,Virginia, 1993.
229. Drohan WN, Zhang DW, Paleyanda RK, Chang R,Wroble M,Velander W, Lubon H. Inefficient
processing of human protein C in the mouse mammary gland. Transgenic Res 1994;3:355-364.
230. Riither U, Tripodi M, Cortese R, Wagner EF. The human a-I-antitrypsin gene is efficiently
expressed from two tissue-specific promotors in transgenic mice. Nucl Acids Res l987;15:
75 19-7529.
23 I . Burdon T, Wall R, Shamay A, Smith GH, Hennighausen L. Over-expression of an endogenous
milk protein gene in transgenic mice is associated with impaired mammary gland alveolar
development and a milchlos phenotype. Mech Devel I99 1;36:67-74.
232. Shamay A, Pursel VG, Wilkinson E, Wall RJ, Hennighausen L. Expression of the whey acidic
protein in transgenic pigs impairs mammary development. Transgenic Res 1992;I :124- 132.
233. Shamay A, Solinas S, Pursel VG, McKnight RA,Alexander L, Beattie CHL, Wall RJ. Produc-
tion of the mouse whey acidic protein in transgenic pigs during lactation. J Anim Sci
1992;69:4552-4562.
234. Whitelaw CBA, Archibald AL, Harris S, McClenaghan M, Simons JP, Clark AJ. Targeting
 49

expression to the mammary gland: Intronic sequences can enhance the efficiency of gene
expression in transgenic mice. Transgenic Res 1991;1:3-13.
235. Paleyanda RK,Velander WH, LeeTK, Scandella DH, Gwazdauskas FC, Knight JW, Hoyer LW,
Drohan WN, Lubon H. Transgenic pig produce functional human factor VIII in milk. Nature
Biotechnol 1997;15:971 -975.
236. Lazarchick J, Hoyer LW. Immunoradiometric measurement of the factor VIII procoagulant
antigen. J Clin Invest 1978;62:1048-1052.
237. Over J. Methodology of the one-stage assay of Factor VIII (VII1:C). Scand. J Haematol Suppl
1984;41:I 3-24.
238. Farini E, Whitelaw CBA. Ectopic expression of P-lactoglobulin transgenes. Molec Gen Genet
1995;246:734-738.
239. Ninomiya T, Hirabayashi M, Sagaro J, Yuki A. Functions of milk protein gene 5’ flanking
regions on human growth hormone gene. Molec Reprod Devel 1994;37:276-283.
240. Pennica D, Kohr WJ, Kuang WJ, Glaister D, Aggarwal BB, Chen EY, Goeddel DV. Identification
of human uromodulin as the Tamm-Horsfall urinary glycoprotein. Science 1987;236:83-88.
241. Williams LS. Canada’s huge pregnant-mare-urine industry faces growing pressure from animal-
rights lobby. Can Med Assoc J 1994;151:1009-1012.
242. Giudice E, Crisci C, Eshkol A, Papoian R. Composition of commercial gonadotrophin prepara-
tions extracted from human post-menopausal urine: characterization of non-gonadotrophin
proteins. Hum Reprod 1994;9:2291-2299.
243. Gutierrez-Adan A, Maga EA, Meade H, Shoemaker C E Medrano JF, Anderson GB, Murray
JD. Alterations of the physical characteristics of milk from transgenic mice producing bovine
r-casein. J Dairy Sci 1996;79:791-799.
244. Maga EA, Anderson GB, Huang MC, Murray JD. Expression of human lysozyme mRNA in
the mammary gland of transgenic mice. Transgenic Res 1994;3:36-42.
245. Foster DC, Yoshitake S, Davie EW. The nucleotide sequence of the gene for human protein C.
Proc Natl Acad Sci USA 1985;82:4673-4677.
246. Esmon CT. The roles of protein C and thrombomodulin in the regulation of blood coagulation. J
Biol Chem 1989;264:743-746.
247. Furie B, Furie BC. Molecular basis of vitamin K-dependent y-carboxylation. Blood 1990;75:
1753- 1762.
248. Bombeli T, Mueller M, Haeberli A. Anticoagulant properties of the vascular endothelium.
Thromb Haemost 1997;77:408-423.
249. Olsen PH, Esmon NL, Esmon CT, LaueTM. Ca2+dependence of the interactions between pro-
tein C, thrombin, and the elastase fragment of thrombomodulin. Analysis by ultracentrifugation.
Biochemistry 1992;31:746-754.
250. Slungaard A, DeckerTD, Dandelet LA, Key NS. Platelet factor 4 binds to Gla domain-contain-
ing clotting factors in human plasma and alters their activities: A potential new natural antico-
agulant mechanism. Thromb Haemost 1997;(Suppl.):416.
25 1. DAngelo A, Lockhart MS, DAngelo SV, Taylor FB Jr. Protein S is a cofactor for activated pro-
tein C neutralization of an inhibitor of plasminogen activation released from platelets. Blood
1987;69:231-237.
252. Ohlin AK, Stenflo J. Calcium-dependent interaction between the epidermal growth factor pre-
cursor-like region of human protein C and a monoclonal antibody J Biol Chem 1987;262:
13798- 13804.
253. Grey ST, Tsuchida A, Hau H, Orthner CL, Salem HH, Hancock WW. Selective inhibitory effect
of the anticoagulant activated protein C on the responses of human mononuclear phagocytes
to LPS, IFN-y, or phorbol ester. J Immunol 1994;153:3664-3672.
254. Hoogendoorn H, Toh CH, Nesheim ME, Giles AR. a2-Macroglobulin binds and inhibits acti-
vated protein C. Blood 1991;78:2283-2290.
255. Murakami K, Okajima K, Uchiba M, Johno M, Nakagaki T, Okabe H,Takatsuki K. Activated
protein C prevents LPS-induced pulmonary vascular injury by inhibiting cytokine production.
 Am J Physiol - Lung Cell Mol Physiol 1997;16:L197-L202.
256. Cole KD, Lee TK, Lubon H. Aqueous two-phase partition of milk proteins: application to
human protein C secreted in pig milk. Appl Biochem Biotechnol 1997;67:97-112.
257. Harris RJ, Spellman MW 0-linked fucose and other post-translational modifications unique to
EGF modules. Glycobiology 1993;3:219-224.
258. Yan SB, Chao YB, van Halbeek H. Novel Asn-linked oligosaccharides terminating in GalNAc
p( 1-)4)[Fuc u( I-)3)]GlcNAc p( 142) are present in recombinant human protein C expressed in
human kidney 293 cells. Glycobiology 1993;3:597-608.
259. White G C 11, Beebe A, Nielsen B. Recombinant factor 1X.Thromb Haemost 1997;78:261-265.
260. Lee TK, Drohan WN, Lubon H. Proteolytic processing of human protein C in swine mammary
gland. J Biochem 1995;118:81-87.
261. Rao MJ, Schneider K, Chait BT, Chao TL, Keller H, Anderson S, Manjula BN, Kumar R,
Acharya AS. Recombinant hemoglobin A produced in transgenic swine: structural equivalence
with human hemoglobin A. Artif Cells Blood Substit Immobil Biotechnol 1994;22:695-700.
262. Carver A,Wright G, Cottom D, Cooper J, Dalrymple M,Temperley S, Udell M, Reeves D, Percy
J, Scott A, Barrass D, GibsonY, Jeffrey Y, Samuel C, Colman A, Garner I. Expression of human
u 1-antitrypsin in transgenic sheep. Cytotechnology 1992;9:77-84.
263. Denman J, Hayes M, ODay C, Edmunds T, Bartlett C, Hirani S, Ebert KM, Gordon K,
McPherson JM. Transgenic expression of a variant of human tissue-type plasminogen activator
in goat milk: purification and characterization of the recombinant enzyme. Bio/Technology
1991;9:839-843.
264. Velander WH, Johnson JL, Page RL, Russell CG, Subramanian A, Wilkins TD, Gwazdauskas
FC, Pittius C, Drohan WN. High-level expression of a heterologous protein in the milk of trans-
genic swine using the cDNA encoding human protein C. Proc Natl Acad Sci USA 1992;89:
12003- 12007.
265. Drohan WN,WilkinsTD, Latimer E, Zhou D,VelanderW, LeeTK, Lubon H. A scalable method
for the purification of recombinant human protein C from the milk of transgenic swine. In:
Galindo E, Ramirez OT (eds) Advances in Bioprocess Engineering. Dordrecht: Kluwer Aca-
demic Publishers, 1994;501-507.
266. Morris DP, Stevens RD, Wright DJ, Stafford DW Processive post-translational modification.
Vitamin K-dependent carboxylation of a peptide substrate. J Biol Chem 1995;270: 30491 -
30498.
267.Clark AJ, Bessos H, Bishop JO, Brown P, Harris S, Lathe R, McClenaghan M, Prowse C,
Simons JP, Whitelaw CBA, Wilmut 1. Expression of human anti-hemophilic factor IX in the
milk of transgenic sheep. BioiTechnology 1989;7:487-492.
268. Pierotti AR, Prat A, Chesneau V, Gaudoux F, Leseney AM, Foulon T, Cohen P. N-Arginine
dibasic convertase, a metalloendopeptidase as a prototype of a class of processing enzymes.
Proc Natl Acad Sci USA 1994;91:6078-6082.
269. Wei Y, Yarus S, Greenberg NM, Whitsett J, Rosen JM. Production of human surfactant protein
C in milk of transgenic mice. Transgenic Res 1995:4:232-240.
270. Yarus S, Greenberg NM, Wei Y, Whitsett JA, Weaver TE, Rosen JM. Secretion of unprocessed
human surfactant protein B in milk of transgenic mice. Transgenic Res 1997;6:51-57.
271. James DC, Goldman MH, Hoare M, Jenkins N, Oliver RWA, Green BN, Freedman RB. Post-
translational processing of recombinant human interferon-y in animal expression systems. Pro-
tein Sci 1996;5:331-340.
272. Katsumi A, Yamazaki T. Sugiura I, Kojima T. Senda T. Miyata T. Tsukamoto H, Umeyama H,
Saito H. The carboxyl-terminal region of protein C is essential for its secretion. Thromb Hae-
most 1997;(Suppl.):415.
273. Hitchin E. Stevenson EM, Clark AJ, McClenaghan M, Leaver J. Bovine p-casein expressed in
transgenic mouse milk is phosphorylated and incorporated into micelles. Prot Expr Purif
1996:7:247-252.
274. Kaufman RJ. Expression and structure-hnction properties of recombinant factor VIII. Transfus
 51

Med Rev 1992;6:235-246.

275. Michnick DA, Pittman DD,Wise RJ, Kaufman RJ. Identification of individual tyrosine sulfation
sites within factor VIII required for optimal activity and efficient thrombin cleavage. J Biol
Chem 1994;269:20095-20 102.
276. Niehrs C, Beisswanger R, Huttner WB. Protein tyrosine sulfation, 1993 - an update. Chem Biol
Interact 1994;92:257-271.
277. Nieuwenhuizen W. Biochemistry and measurement of fibrinogen. Eur Heart J 1995;16:6- 10.
278. Henschen AH. Human fibrinogen - structural variants and functional sites. Thromb Haemost
1993;70:42-47.
279. Butler S, Vancott K, Gwazdauskas F, Lubon H, Drohan W, Velander W The production of
recombinant fibrinogen in the milk of transgenic animals. Thromb Haemost 1997;(Suppl.):372.
280. Cottingham I, McKee C, McCreath G, Lasser G, Bishop P. Fully recombinant sealant using
human fibrinogen from transgenic sheep. Thromb Haemost 1997;(Suppl):372.
281. Prunkard D, Cottingham I, Garner I, Bruce S, Dalrymple M, Lasser G, Bishop P, Foster D.
High-level expression of recombinant human fibrinogen in the milk of transgenic mice. Nature
Biotechnol 1996;14:867-871.
282. Butler SP, van Cott K, Subrumanian A, Gwazduaskas FC, Velander WH. Current progress in
the production of recombinant human fibrinogen in the milk of transgenic animals. Thromb
Haemost 1997;78:537-542.
283. Faerman A, Barash I, Puzis R, Nathan M, Hurwitz DR, Shani M. Dramatic heterogeneity of
transgene expression in the mammary gland of lactating mice: a model system to study the syn-
thetic activity of mammary epithelial cells. J Histochem Qtochem 1995;43:461-470.
284. Dobie KW, Lee M, Fantes JA, Graham E, Clark AJ, Springbett A, Lathe R, McClenaghan M.
Variegated transgene expression in mouse mammary gland is determined by the transgene inte-
gration locus. Proc Natl Acad Sci USA 1996;93:6659-6664.
285. Prunkard D, Cottingham I, Garner I, Lasser G, Bishop P, Foster D. Expression of recombinant
human fibrinogen in the milk of transgenic sheep. Thromb Haemost 1997;(SuppI):40.
286. Greenberg NM, Anderson JW, Hsueh AJW, Nishimori K, Reeves JJ, deAvila DM, Ward DN,
Rosen JM. Expression of biologically active heterodimeric bovine follicle-stimulating hormone
in milkof transgenic mice. Proc Natl Acad Sci USA 1991;88:8327-8331.
287. Stromqvist M, Houdebine L, Anderson JO, Edlund A, Johansson T, Viglietta C, Puissant C,
Hansson L. Recombinant human extracellular superoxide dismutase produced in milk of trans-
genic rabbits. Transgenic Res 1997;6:271-278.
288. Hansson L, Edluns M, Edluns A, Johansson T, Marklund SL, Fromm S, Stromqvist M, Tornell
J. Expression and characterization of biologically active human extracellular superoxide dismu-
tase in milk of transgenic mice. J Biol Chem 1994;269:5358-5363.
289. Goochee CF, Gramer MJ, Andersen DC, Bahr JB, Rasmussen JR. The oligosaccharides of gly-
coproteins: Bioprocess factors affecting oligosaccharide structure and their effect on glycopro-
tein properties. Bio/Technology 1991;9:1348-1355.
290. Dowbenko D, Kikuta A, Fennie C, Gillett N, Lasky LA. Glycosylation-dependent cell adhesion
molecule 1 (GlyCAM 1) much is expressed by lactating mammary gland epithelial cells and is
present in milk. J Clin Invest 1993;92:952-960.
291. Grinnell BW, Hermann RB,Yan SB. Human protein C inhibits selectin-mediated cell adhesion:
Role of unique hcosylated oligosaccharide. Glycobiology 1994;4:221-225.
292. Spik G, Coddeville B, Mazurier J, Bourne Y, Cambillaut C, Montreuil J. Primary and three-
dimensional structure of lactotransferrin (lactoferrin) glycans. Adv Exp Med Biol 1994;357:
21-32.
293. Nuijens JH, van Berkel PH, Geerts ME, Hartevelt PP, de Boer HA, van Veen HA, Pieper FR.
Characterization of recombinant human lactoferrin secreted in milk of transgenic mice. J Biol
Chem 1997;272:8802-8807.
294. Kemp PA, Jenkins N, Clark AJ, Freedman RB. The glycosylation of human recombinant alpha-
I-antitrypsin expressed in transgenic mice. Biochem SOCTransact 1996;24:339S.
52

295. Wright G, Carver A, Cottom D, Reeves D, Scott A, Simons P,Wilmut I, Garner I, Colman A.
High level expression of active human alpha- I-antitrypsin in the milk of transgenic sheep.
Bio/Technology 1991;9:830-834.
296. James DC, Freedman RB, Hoare M, Ogonah OW, Rooney BC, Larionov OA, Dobrovolsky VN,
Lagutin OV, Jenkins N. N-Glycosylation of recombinant human interferon-y produced in differ-
ent animal expression systems. Bio/Technology 1995;13:592-596.
297. Jenkins N, Curling EMA. Glycosylation of recombinant proteins: Problems and prospects.
Enzyme Microb Techno1 1994;16:354-364.
298. Hironaka T, Furukawa K, Esmon PC, Fournel MA, Sawada S, Kato M, Minaga T, Kobata A.
Comparative study of the sugar chains of factor VIII purified from human plasma and from
the culture media of recombinant baby hamster kidney cells. J Biol Chem 1992;267:8012-8020.
299. Hay CR, Bolton-Maggs P. Porcine factor VIIIC in the management of patients with factor VIII
inhibitors. Transfus Med Rev 1991;5:293-299.
300. Stromqvist MJT, Edlund M, Edlund A, Johansson T, Lindgren K, Lundberg L, Hansson L.
Recombinant human bile salt-stimulated lipase: An example of defective 0-glycosylation of a
protein produced in milk of transgenic mice. Transgenic Res 1996;5:475-485.
30 1. Barr PJ. Mammalian subtilisins: The long-sought dibasic processing endoproteases. Cell 1991;
66:l-3.
302. van de Ven WJM, Roebroek AJM, van Duijnhoven HLP. Structure and fbnction of eukaryotic
proprotein processing enzymes of the subtilisin family of serine proteases. Crit Rev Oncog
1993;4:115-136.
303. Drews R, Paleyanda RK, Lee TK, Chang RR, Rehemtulla A, Kaufman RJ, Drohan WN,
Lubon H. Proteolytic maturation of protein C upon engineering the mouse mammary gland to
express furin. Proc Natl Acad Sci USA 1995;92:10462- 10466.
304. Paleyanda RK, Velander WH, Lee TK, Drews R, Gwazdauskas FC, Knight JW, Drohan WN,
Lubon H. Human plasma proteins from transgenic animal bioreactors. In: Fuller G, McKeon
TA, Bills DD (eds) Agriculture Materials as a Renewable Resources: Nonfood and Industrial
Appliations. Washington, D.C.: American Chemical Society, 1996;205-215.
305. Prieto PA, Mukerji P, Kelder B, Erney R, Gonzalez D,Yun JS, Smith DF, Moremen KW, Nardel-
li C, Pierce M, Li Y, Chen X, Wagner TE, Cummings RD, Kopchick JJ. Remodeling of mouse
milk glycoconjugates by transgenic expression of a human glycosyltransferase. J Biol Chem
1995;49:29515-295 19.
306. Koike C, Hayashi S,Yokoyama 1,Yamakawa H, Negita M,Takagi H. Converting a-Gal epitope
of pig into H antigen. Transplant Proc 1996;28:553.
307. Sharma A, Okabe J, Birch,'F McClellan SB, Martin MJ, Platt JL, Logan JS. Reduction in the
level of Gal(u1,3)Gal in transgenic mice and pigs by the expression of an u( 1,2)fucosyltransfer-
ase. Proc Natl Acad Sci USA 1996;93:7190-7195.
308. Ikeda A, Matsuyama S, Nishihara M, Tojo H, Takahashi M. Changes in endogenous growth hor-
mone secretion and onset of puberty in transgenic rats expressing human growth hormone
gene. Endocr J 1994;41:523-529.
309. Martin RH, Glass MR, Chapman C, Wilson GD, Woods KL. Human a-lactalbumin and hor-
monal factors in pregnancy and lactation. Clin Endocrinol (Oxf) 1980;13:223-230.
3 10. Akers RM, McFadden TB, Beal WE, Guidry AJ, Farrell HM. Radioimmunoassay for measure-
ment of bovine u-lactalbumin in serum, milk and tissue culture media. J Dairy Res 1986;
53:419-429.
31 1. McFadden TB, Akers RM, Kazmer GW. u-Lactalbumin in bovine serum: relationships with
udder development and function. J Dairy Sci 1987;70:259-264.
312. Mao FC, Bremel RD, Dentine MR. Serum concentrations of the milk proteins a-lactalbumin
and P-lactoglobulin in pregnancy and lactation: correlations with milk and fat yields in dairy
cattle. J Dairy Sci 1991;74:2952-2958.
313. Forsyth IA, Byatt JC, Iley S. Hormone concentrations, mammary development and milk yield in
goats given long-term bromocriptine treatment in pregnancy. J Endocrinol 1985;104:77-85.
 53

314. Devinoy E, Stinnakre MG, Lavialle EThepot D, Ollivier-Bousquet M. Intracellular routing and
release of caseins and growth hormone produced into milk from transgenic mice. Exp Cell
Res 1995;221:272-280.
315. Bischoff R, Degryse E, Perraud F, Dalemans W, Ali-Hadji D, Thkpot D, Devinoy E, Houdebine
LM, Pavirani A. A 17.6 kbp region located upstream of the rabbit WAP gene directs high level
expression of a functional human protein variant in transgenic mouse milk. FEBS Lett
1992;305:265-268.
316. ReddyVB,Vitale J,Wei C, Montoya-Zavala M, Stice SL, Balise J, Rob1 JM. Expression of human
growth hormone in the milk of transgenic mice. Anim Biotechnol 1991;2:15--29.
3 17. Wilde CJ, Clark AJ, Kerr MA, Knight CH, McClenaghan M, Simons JP. Mammary develop-
ment and milk secretion in transgenic mice expressing the sheep P-lactoglobulin gene. Biochem
J 1992;284:717-720.
318. McClenaghan M, Springbett A, Wallace RM, Wilde CJ, Clark AJ. Secretory proteins compete
for production in the mammary gland of transgenic mice. Biochem J 1995;310:637-641.
319. Drews R, Drohan WN, Lubon H. Transgene detection in the mouse tail digests. BioTechniques
1994;17~866-867.
320. Coughlin SR. Thrombin receptor structure and hnction. Thromb Haemost 1993;70:184- 187.
32 I . Fukudome K, Esmon CT. Molecular cloning and expression of murine and bovine endothelial
cell protein Clactivated protein C receptor (EPCR). The structural and hnctional conservation
in human, bovine, and murine EPCR. J Biol Chem 1995;270:5571-5577.
322. Stitt TN, Conn G, Gore M, Lai C, Bruno J, Radziejewski C, Mattsson K, Fisher J, Gies DR,
Jones PF, Masiakowski P, Ryan TE, Tobkes NJ, Chen DH, DiStefano PS, Long GL, Basilico C,
Goldfarb MP, Lemke G, Glass DJ, Yancopoulos GD. The anticoagulation factor protein S and
its relative, Gas6, are ligands for the Tyro 3/Axl family of receptor tyrosine kinases. Cell
1995;80:661-670.
323. Connolly AJ, Ishihara H, Kahn ML, Farese RV Jr, Coughlin SR. Role of the thrombin receptor
in development and evidence for a second receptor. Nature 1996;381:516-519.
324. Gasic GP, Arenas CP, GasicTB, Gasic G.J. Coagulation factors X, Xa, and protein S as potent
mitogens of cultured aortic smooth muscle cells. Proc Natl Acad Sci USA 1992;89:2317-23-20.
325. Maillard C, Berruyer M, Serre CM, Dechavanne M, Delmas PD. Protein-S, a vitamin K-
dependent protein, is a bone matrix component synthesized and secreted by osteoblasts. Endo-
crinology 1992;130:1599- 1604.
326. Phillips DJ, Greengdrd JS, Fernandez JA, Ribeiro M, Evatt BL, Griffin JH, Hooper WC. Pro-
tein s, an antithrombotic factor, is synthesized and released by neural tumor cells. J Neurochem
1993;61:344-347.
327. Hennighausen L, Mcknight R, Burdon T, Baik M, Wall R, Smith GH. Whey acidic protein
extrinsically expressed from the mouse mammary tumor virus long terminal repeat results in
hyperplasia of the coagulation gland epithelium and impaired mammary development. Cell
Growth Differ 1994:5:607-613.
328. Kumar S, Clarke AR. Hooper ML, Horne DS, Law AJ, Leaver J, Springbett A, Stevenson E,
Simons JP. Milk composition and lactation of 0-casein-deficient mice. Proc Natl Acad Sci
USA 1994;91:6138-6142.
329. Stinnakre MG,Vilotte JL, Soulier S, Mercier JC. Creation and phenotypic analysis of a-lactalbu-
min-deficient mice. Proc Natl Acad Sci USA 1994;91:6544-6548.
330. L'Huillier PJ. Soulier S, Stinnakre M-G, Lepourry L, Davis SR, Mercier J-C,Vilotte J-L. Effi-
cient and specific ribozyme-mediated reduction of bovine a-lactalbumin expression in double
transgenic mice. Proc Natl Acad Sci USA 1996;93:6698-6703.
33 1. Bleck G, Jimenez-Flores R, Bremel R. Anomalous milk properties of transgenic mice expres-
sing bovine beta-casein under control of the bovine alpha-lactalbumin 5' flanking region. FAS-
EB J 1993;7:A812.
332. Yarus S, Weaver TE, Rosen JM. The carboxy-teminal domain of human surfactant protein B is
not required for secretion in milk of transgenic mice. Front Biosci 1997;2:Al -AS.
54

333. Ebert KM, DiTullio P, Barry CA, Schindler JE, Ayres SL, SmithTE, Pellerin LJ, Meade HM,
Denman J, Roberts B. Induction of human tissue plasminogen activator in the mammary gland
of transgenic goats. Bio/Technology 1994;12:699-702.
334. Brem G. Inheritance and tissue-specific expression of transgenes in rabbits and pigs. Molec
Reprod Devel 1993;36:242-244.
335. Van Cott KE, Lubon H, Russell CG, Butler SP: Gwazdauskas FC, Knight J, Drohan NW, Velan-
der WH. Phenotypic and genotypic stability of multiple lines of transgenic pigs expressing
recombinant protein C. Transgenic Res 1997;6:203-212.
336. Carver AS, Dalrymple Ma,Wright G, Cottom DS, Reeves DB, GibsonYH, Keenan JL, Barass
JD, Scott AR, Colman A, Garner I. Transgenic livestock as bioreactors: Stable expression of
human alpha-I-antitrypsin by a flock of sheep. Bio/Technology 1993;11:1263--1269.
337. Ziomek CA. Minimization of viral contamination in human pharmaceuticals produced in the
milk of transgenic goats. In: Brown F, Lubiniecki AS (eds) Viral Safety and Evaluation of Viral
Clearance From Biopharmaceutical Products. Basel: Karger, 1996;265-268.
338. Van Cott KE, Williams BL, Gwazdauskas F, Lee TK, Lubon H, Drohan WN, Velander WH.
Affinity purification of biologically active and inactive forms of recombinant human protein C
produced in the porcine mammary gland. J Mol Recognit 1997;9:407-414.
339. Lee TK, Bangalore N, Velander W, Drohan WN, Lubon H. Activation of recombinant human
protein C. Thromb Res 1996;82:225-234.
340. Medved LV, Orthner CL, Lubon H, Lee TK, Drohan WN, Ingham KC. Thermal stability and
domain-domain interactions in natural and recombinant protein C. J Biol Chem 1995;270:
13652-13659.
341. McMullen BA, Fujikawa K, Davie EW, Hedner U, Ezban M. Locations of disulfide bonds and
free cysteines in the heavy and light chains of recombinant human factor VIII (antihemophilic
factor A). Protein Sci 1995;4:740-746.
342. Bakker JC, Bleeker WK. Blood substitutes based on modified hemoglobin. Vox Sang 1994;67:
139-142.
343. Richardson MA, Gerlitz B, Grinnell BW. Enhancing protein C interaction with thrombin results
in a clot-activated anticoagulant. Nature 1992;360:261-264.
344. Luisetti M, Travis J. Bioengineering: cz I-proteinase inhibitor site-specific mutagenesis. The pros-
pect for improving the inhibitor. Chest 1996;110:2788-283S.
345. Berntorp E. Second generation, B-domain deleted recombinant factor VIII. Thromb Haemost
1997;78:256-260.
346. ODonnell JK, Birch P: Parsons CT, White SP, Okabe J, Martin MJ, Adams C, Sundarapandiyan
K, Manjula BN, Acharyas AS, Logan JS, Kumar R. Influence of the chemical nature of side
chain at p 108 of hemoglobin A on the modulation of the oxygen afinity by chloride ions. Low
oxygen afinity variants of human hemoglobin expressed in transgenic pigs: Hemoglobins Pres-
byterian and Yoshizuka. J Biol Chem 1994;269:27692-27699.
347. Colman A, Garner I. The transgenic mammary gland as a bioreactor: Expectations and realiza-
tions. Miami Bio/Technology Short Reports, Advances in Gene Technology 1995;6:107.
348. Martinowitz U, Spotnitz WD. Fibrin tissue adhesives. Thromb Haemost 1997;78:661-666.
349. Jackson MR, MacPhee MJ, Drohan WN, Alving BM. Fibrin sealant: current and potential clini-
cal applications. Blood Coagul Fibrinolysis 1996;7:737-746.
350. Suomela H. Inactivation of viruses in blood and plasma products. Transhs Med Rev 1993;7:
42-57.