ENGLISH Actividad Bilingüismo Tercer Corte BIOLOGÍA 1,1

You might also like

Download as docx, pdf, or txt
Download as docx, pdf, or txt
You are on page 1of 3

UNIVERSIDAD MANUELA BELTRÁN

Resolución 4974 del 29 de Diciembre de 2004 Min. Educación


NIT: 860.517.647-5

TALLER

NOMBRE DE LA ASIGNATURA: Biología


CORTE 3
TEMA: Genética Molecular

Objectives:
● Identify the processes by which the DNA strand replicates, transcribes and
translates to establish protein synthesis.
● Recognize the importance of enzymes in the processes of replication,
transcription and translation.

Description of the activity:

1. Complete the table below. Write the correct letter A – F for each box.

An enzyme that adds new ribonucleotides to the 3′ end


A. Replication of the growing strand.  C
A set of instructions that specifies which amino acids will
B. Transcription be used to build a protein.  F
An enzyme that adds new nucleotides to the 3′ end of
C. Translation the growing strand by using a RNA primer to get started.  D
D. DNA A mechanism that converts a RNA sequence into the
polymerase amino acid sequence of a polypeptide.  E
A mechanism that creates a new DNA strand in a
E. RNA sequence determined by complementary base pairing
polymerase with the bases on the template strand.  A
A mechanism that copies the information of a DNA
sequence (the gene) into corresponding information in
F. Genetic code an RNA sequence. B

1. Select the correct answer for the following questions:

Bogotá D.C. – Campus Universitario: Av. Circunvalar No. 60 - 00 – Tel.: 546 06 00 / 56 / 58 – Fax: 546 06 38
Sede Bucaramanga: Cra. 27 No. 33 - 106 – Tel.: (7) 634 34 40 – 657 06 07 / 632 26 50
Dirección Internet: www.umb.edu.co
UNIVERSIDAD MANUELA BELTRÁN
Resolución 4974 del 29 de Diciembre de 2004 Min. Educación
NIT: 860.517.647-5

2. Which of the following is NOT a base of DNA nucleotides?

a. Adenine b. Guanina c. Uracil d. Tymine e. Cytosine

3. What are the mating rules for DNA bases?

a. A - G, T - C b. A - C, T - G c. A - U, C - G d. A - T, G - C

4. The replication pattern in the DNA is:

a. Conservative
b. Semi-conservative
c. Dispersive

5. Solve the following exercises:

a. Perform the REPLICATION process on the following DNA strand:

3'TACGCATAGGATACCAATCGATCAGTTACCGAGCCTCCTACGGACTACTACTAG 5'

b. TRANSCRIBE the following strand of DNA to mRNA:

3'TACGCATAGGATACCAATCGATCAGTTACCGAGCCTCCTACGGACTACTACTAG5'
3
´UACGCAUAGGAUACCAAUCGAUCAGUUACCGAGCCUCCUACGGACUACUACUA
G5´

c. With the help of the table of the Genetic Code, TRANSLATE the obtained
mRNA strand.
TyrAlaStopAspThyArgSerValThrGluGluThrAspTyrTyrStop

Bogotá D.C. – Campus Universitario: Av. Circunvalar No. 60 - 00 – Tel.: 546 06 00 / 56 / 58 – Fax: 546 06 38
Sede Bucaramanga: Cra. 27 No. 33 - 106 – Tel.: (7) 634 34 40 – 657 06 07 / 632 26 50
Dirección Internet: www.umb.edu.co
UNIVERSIDAD MANUELA BELTRÁN
Resolución 4974 del 29 de Diciembre de 2004 Min. Educación
NIT: 860.517.647-5

Bogotá D.C. – Campus Universitario: Av. Circunvalar No. 60 - 00 – Tel.: 546 06 00 / 56 / 58 – Fax: 546 06 38
Sede Bucaramanga: Cra. 27 No. 33 - 106 – Tel.: (7) 634 34 40 – 657 06 07 / 632 26 50
Dirección Internet: www.umb.edu.co

You might also like