Willis Et Al., 2019

Enrichment and isolation of acid-tolerant sulfate-reducing microorganisms in the anoxic,
acidic hot spring sediments from Copahue volcano, Argentina
Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

Willis Graciana (1) *; Nancucheo Ivan (2); Hedrich Sabrina (3); Giaveno Alejandra (4); Donati Edgardo (1);
Johnson David Barrie (5)
(1) CINDEFI (CONICET-UNLP), Facultad de Ciencias Exactas, Universidad Nacional de La Plata. Calle
47 y 115, 1900 La Plata, Argentina. (2) Facultad de Ingeniería y Tecnología, Universidad San Sebastián,
Lientur 1457, Concepción 4080871, Chile. (3) Federal Institute for Geosciences and Natural Resources,
Resource Geochemistry, Stilleweg 2, 30655 Hannover, Germany. (4) PROBIEN (CONICET-UNCo),
Departamento de Química, Facultad de Ingeniería, Universidad Nacional del Comahue. Buenos Aires
1400, 8300 Neuquén, Argentina. (5) School of Natural Sciences, Bangor University, Deiniol Road, Bangor,
LL57 2UW, UK.
Keywords: acidophilic/acid-tolerant SRB, extremophiles, biosulfidogenesis, microbial sulfur cycle,
volcanic environments, Copahue-Caviahue.
One sentence summary: This study explores, for the first time, the anaerobic environments at Copahue
volcano focusing on the enrichment and isolation of acidophilic/acid-tolerant sulfate-reducing bacteria and
their characterization by 16S rRNA gene sequencing.
Running Title: Acidophilic sulfate-reducing bacteria at Copahue volcano
*Willis Graciana
willis.graciana@biotec.quimica.unlp.edu.ar
CINDEFI (CONICET-UNLP), Universidad Nacional de La Plata
Calle 47 y 115
La Plata, 1900, Buenos Aires, Argentina
Tel: +54 221 483 3794
Abstract

The geothermal Copahue-Caviahue (GCC) system (Argentina) is an extreme acidic environment,
dominated by the activity of the Copahue volcano. Environments characterized by low pH values, such as
volcanic areas, are of particular interest for the search of acidophilic microorganisms with application in
biotechnological processes. In this work, sulfate-reducing microorganisms were investigated in geothermal
acidic, anaerobic zones from GCC system. Sediment samples from Agua del Limón (AL1), Las Máquinas
(LMa2), Las Maquinitas (LMi) and Baño 9 (B9-2, B9-3) were found to be acidic (pH values 2.1 - 3.0) to
moderate acidic (5.1 - 5.2), containing small TOC values, and ferric iron precipitates. The organic electron
donor added to the enrichments was completely oxidized to CO2. Bacteria related to “Desulfobacillus
acidavidus” strain CL4 were found to be dominant (67 - 83% of the total number of clones) in the
enrichment cultures, and their presence was confirmed by their isolation on overlay plates. Other bacteria
were also detected with lower abundance (6 - 20% of the total number of clones), with representatives of
the genera Acidithiobacillus, Sulfobacillus, Alicyclobacillus and Athalassotoga/Mesoaciditoga. These
enrichments and isolates found at low pH confirm the presence of anaerobic activities in the acidic
sediments from the geothermal Copahue-Caviahue system.
Introduction
Sulfate-reducing prokaryotes (SRP) are mostly obligately anaerobic bacteria and archaea that are
widespread in anoxic environments. They gain energy from coupling electron transfer between various
donors (organic compounds, hydrogen or carbon monoxide) to sulfate, generating hydrogen sulfide
(Muyzer & Stams, 2008). The general reaction is stated in equations 1 and 2, where CH2O represents a
simple organic carbon source (Johnson, 2012):
(eq.1, at neutral/moderately alkaline pH)
(eq. 2, at low pH)

The sulfide (H2S and HS-) reacts with many transition metal ions, such as Cd, Cu, Fe, Ni, to form highly
insoluble sulfide phases (equation 3).

(eq. 3)
SRP include members of the four taxonomic groups: (i) the δ-proteobacteria subdivision, containing
diverse genera of Gram-negative, mesophilic sulfate-reducing bacteria (SRB); (ii) Gram-positive, spore-
forming SRB, that can resist higher temperatures than the mesophilic group (between 40-60 °C; Aüllo et
al., 2013); (iii) thermophilic SRB that inhabit high temperature environments, with an optimal growth
temperature between 65-70 °C; and (iv) thermophilic sulfate-reducing archaea that thrive at temperatures
above 80 °C, currently represented by the genus Archaeoglobus found only in marine hydrothermal
environments (Rabus et al., 2015).
For many years it was known that sulfidogenesis occurred in acidic environments even though the only
known SRP were, at the time, extremely intolerant of low pH (e.g. Tuttle et al., 1969). The first acidophilic
SRB isolated in pure culture and later described as a novel species was Desulfosporosinus acididurans
strain M1T, which was obtained from a geothermal site on the Caribbean island of Montserrat and was
shown to grow in pure culture within a pH range from pH 3.8 - 7.0 using glycerol as the electron donor
(Sen and Johnson, 1999; Sánchez-Andrea et al., 2015). This SRB is an “incomplete oxidiser” and
produces equimolar amounts of acetic acid when growing on glycerol as electron donor, though in co-
culture with the type strain of Acidocella aromatica (Jones et al., 2014) the acetic acid was oxidised to CO2
and the mixed culture was consequently able to grow at lower pH than pure cultures of D. acididuransT
(Kimura et al., 2006). Another acid-tolerant SRB Desulfosporosinus sp. strain GBSRB4.2, able to grow at
pH 4.8, was isolated by Senko et al. (2009) in sediments from a coal mine, which could reduce sulfate,
iron(III), manganese(IV) and uranium (VI). Also, Alazard et al. (2010) described a novel species,
Desulfosporosinus acidiphilus, isolated from an acidic mining effluent decantation pond sediment. This
species was demonstrated to be a moderately acidophile, with an optimum at pH 5.2. Rowe et al. (2007)
reported that SRB other than Desulfosporosinus species able to grow at low pH (Johnson et al., 2009)
were responsible for precipitation of copper sulfide (CuS) in an abandoned copper mine in south-west

Spain (Peptoccocaceae bacterium strain CL4). More recently Ňancucheo and Johnson (2012) described
novel consortia of acidophilic SRB (Peptoccocaceae strain CEB3 and D. acididuransT) and other
acidophiles, maintained in a sulfidogenic bioreactor that was operated at pH as low as 2.2, that were used
to remove transition metals (copper, nickel, cobalt and zinc) from synthetic acidic mine waters. On the
other hand, the first thermophilic acid-tolerant SRB was isolated by Mori et al. 2003 from a hot spring. This
isolate, described as Thermodesulfobium narugenseT, was found to be an autotroph with an optimum
growth pH between 5.5 – 6.0. Elsewhere, novel thermophilic and acid-tolerant SRB, Desulfothermobacter
acidiphilusT and Thermodesulfobium acidiphilumT, were isolated from terrestrial hot springs at Kamchatka
peninsula, and were reported to be autotrophic and use hydrogen as energy source (Frolov et al., 2018;
2017). Other thermophilic acid-tolerant SRB of the genus Thermodesulfobium (Thermodesulfobium sp.
strain 3baa) was recently isolated from sediments from an acidic mine pit lake in Germany (Ruffel et al.,
2018).
SRB are versatile in terms of growth conditions and they can develop in a range of different
environmental conditions (Muyzer & Stams, 2008). Extreme environments such as hot water pools, acidic
hot springs, hydrothermal systems in shallow and deep sea, and mining-impacted areas are a source of
sulfate reducers that can grow at elevated temperatures and low pH values. Many studies have focused
on the geochemistry and microbiology of these environments not only because of their ecological
implications, but also because indigenous microorganisms have potential application in many
biotechnological processes, such as bioprecipitation of transition metals from industrial and mine-impacted
wastewaters (Johnson, 2012; Ňancucheo and Johnson, 2012; Santos and Johnson, 2018; González et
al., 2019) and the use of microbial electrochemical systems (MESs, Pozo et al., 2017; Ni et al., 2018).
Many studies where acidophilic/acid-tolerant SRB were detected, using both culture-dependent and -
independent approaches, have been carried out with AMD streams, microbial mats, pit lakes (e.g. Rowe
et al., 2007; Falagán et al., 2014), acidic rivers (e.g. Sánchez-Andrea et al., 2011; 2013). Regarding
volcanic environments with extreme temperature and/or pH conditions, several hot spring from the

Kamchatka peninsula (Russia) and from the Yellowstone National Park were widely characterized in terms
of microbial ecology (e.g. Johnson et al., 2001; 2003; Fishbain et al., 2003; Meyer-Dombard et al., 2005;
Burgess et al., 2012; Chernyh et al., 2015; Mardanov et al., 2018) and isolation of acidophilic/acid-tolerant
SRB (Frolov et al., 2016; 2017; 2018).Other studies related to volcanic areas were conducted at the Tans-
Mexican volcanic belt (Souza Brito et al., 2014; Medrano-Santillana et al., 2017; Prieto-Barajas et al.,
2018), Narugo hot spring in Japan (Mori et al., 2003) and geothermal water from a gold mine in Japan
(Hirayama et al., 2005) among others.
The geothermal Copahue-Caviahue (GCC) system is a volcanic extreme environment located in the
north west of Neuquén province, Argentina (Figure 1). Copahue volcano (37°51′S, 71°10.2′ W), 2977
m.a.s.l., is an andesitic stratovolcano with a small acidic crater lake. Its activity dominates the
biogeochemistry of the environment, which is characterized by wide ranges of temperature and pH (< 1 to
8) and the presence of heavy metals (Chiacchiarini et al., 2010). This volcanic area has been subject to
studies of geology, geochemistry, volcanism and hydrotherapy over the last decades (Varekamp, 2004;
Pedrozo, 2008; Agusto et al., 2013; Chiodini et al., 2015; Roulleau et al., 2016). Most investigations on
ecology, biodiversity and microbiology in this geothermal environment are relatively recent. Some of these
have been focused on the isolation and characterization of the aerobic, acidophilic iron- and sulfur-
oxidizing microorganisms (e.g. Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans) due to their
potential applications in biomining processes (Lavalle et al., 2005; Chiacchiarini et al., 2010; Giaveno et
al., 2013; Urbieta et al., 2014; 2015; Castro & Donati, 2016). However, few studies have been previously
carried out with anaerobic sediments from Copahue volcano and these have tended to be restricted to
water and sediments from the Rio Agrio and the recipient lake Caviahue (Wendt-Potthoff & Koschorreck,
2002; Koschorreck et al., 2003) and neutrophilic SRP (Chiacchiarinni et al., 2010), even though most of
the geothermal ponds have extremely low pH values.

The general aim of this study was to demonstrate the presence of SRB with the ability to grow at low
pH values. The current study focused on the enrichment, isolation and identification by 16S rRNA

sequencing of SRB from the anaerobic zones of Copahue-Caviahue areas.
Materials and Methods
Site description and sampling
Three sampling points were chosen for this study, representing different geothermal fields within the
Copahue system (indicated by arrows in Fig. 1): Las Máquinas, Las Maquinitas and Copahue village. Las
Máquinas (LMa) presents a temperature ~ 40 ±2 °C and pH ~3 and was selected for its physicochemical
conditions but also for being the site less affected by infrastructure and anthropogenic activities. Las
Maquinitas (LMi) is the smallest thermal spring at Copahue system and has elevated temperatures around
92 ±2 °C in the thermal ponds. Some visible sulfur deposits were observed in the coldest walls of the
ponds. In recent years, this area has suffered several human impacts as its sediments are used for health
treatments. Copahue village is the biggest thermal spring at Copahue system and has been greatly
affected by infrastructure works during the construction of the village. The area comprises the therapeutic
thermal complex, the section called Baño 9 (B9) and Agua del Limon (AL), among other thermal springs.
The area is of interest due to its wide range of pH (2 - 7) and temperature (15 - 90 °C), and CO2 and H2S
emanate from several ponds and hot springs within it (Varekamp, 2004; Pedrozo, 2008; Chiacchiarini et
al., 2010; Chiodini et al., 2015).
At these sites, sediment samples were collected from five different acidic hot springs (Table 1), AL1,
LMa2, LMi, B9-2 and B9-3, referred to in the geothermal location described above. In general, the water
layer in the hot springs was approximately 10 cm deep and sediments below were collected in sterile
polypropylene bottles to avoid evaporation and the entry of oxygen. Samples were kept at 4 °C until
processing on return to the laboratory. Water samples were also collected and filtered through 0.22 µm
(pore size) cellulose acetate membrane filters (Millipore) to determine sulfate and metal concentrations.
Enrichment and isolation
To obtain active sulfidogenic consortia at acidic pH conditions, five sediment samples from Copahue
volcano were inoculated into specific liquid medium. The growth medium was prepared and sparged with
nitrogen to displace oxygen, autoclaved at 121 °C for 20 minutes and dispensed into sterile 50 mL flasks.
Sediment samples were added to the flasks (approximately in a 1:3 ratio), which were then sealed.
Cultures were incubated at 30 °C for 30 days using the AnaeroGen system (Oxoid, UK) to create an
anaerobic environment. The growth medium contained: 3 mM glycerol (as electron donor), 0.1 g/L yeast
extract, 4 mM ZnSO4, 100 µM FeSO4, 5 mM K2SO4, basal salts and trace elements (Ñancucheo et al.,
2016), and was adjusted to pH 3.0. FeSO4 and ZnSO4 were added from 1M stock solutions prepared from
the heptahydrate salts. Sulfate reducing activity was determined by measuring differences in
concentrations of glycerol, sulfate and acetic acid at the beginning and after one month of incubation. The
formation of off-white precipitates (ZnS), changes to pH and microscopic confirmation of the presence of
microorganisms were also used as indicators of SRB activity.
Isolation of acidophilic SRB from the enrichment cultures was performed by streaking liquid samples
from enrichments onto the overlay medium described by Ñancucheo et al. (2016) and incubated
anaerobically (AnaeroGen system) at 30 °C. Colonies were purified by repeated single colony isolation.
Cells were resuspended in 0.05 M NaOH and 0.25 % SDS at 90°C for 20 minutes and 16S rRNA genes
amplified and sequenced. Colonies were inoculated into 3 mL liquid medium and analysed for glycerol and
sulfate consumption and acetate production.
Chemical analysis
At each sampling point, redox potential (E‟) and pH values were measured in situ using a
multiparameter Hanna HI 8424 meter coupled to a HI 1043 pH electrode and a combination redox
potential electrode with an integral Ag/AgCl reference. Dissolved oxygen (DO) concentrations in the water
in contact with sediments was determined using a JPB-607A portable DO analyser (Hinotek, China), and
sulfide was measured with a Hach DR-850 equipment using the methylene blue technique-equivalent to
USEPA method 376.2 or Standard Method 4500-S2- D (Greenberg, 1985). Total Organic Carbon (TOC),

heavy metals and water content in sediments were determined in duplicate. Water content was
determined by weight loss at 105 °C when drying 1 g of sample. TOC was determined by oxidation of 6 g
of sediment with potassium dichromate in acidic conditions according to the Walkley-Black procedure
(Schumacher, 2002). Heavy metals were measured according to the USEPA method 3050 B, using
approximately 2 g of wet sediment. The amount of transition metals in sediments, expressed in milligram
of metal per grams of dry sample, was calculated then using the water content determine for each sample.
For all analytical measurements, samples were filtered through 0.22 μm (pore size) cellulose acetate
membranes. Sulfate was determined by turbidimetry using a Beckman DU 640 spectrophotometer
(Fullerton, CA, USA) at 450 nm (Greenberg et al., 1985). Glycerol was determined by an enzymatic
colorimetric method using a commercial kit (TG color, Wiener Lab) following the manufacturer‟s
instructions. Concentrations of acetic acid were measured by high performance liquid chromatography
(Waters 1525) equipped with a Diode Array Detector (Waters 2996) at 210 nm and a PRP-X300 column
(Hamilton) at room temperature. Sulfuric acid (0.5 mM) was used as mobile phase (2.0 mL/min).
Concentration of transitions metals (in both acid digestion and water samples) were measured using an
atomic absorption spectrophotometer (Shimadzu AA-6650, Shimadzu Corporation, Kyoto, Japan).
Microscopic observations
Bacterial morphology in enrichment cultures was investigated by using an optical microscope with
phase contrast. Fluorescence in situ hybridisation (FISH) was performed for rapid identification of cultures
at domain level. For this, 1 mL of each enrichment culture was centrifuged at 2,000 – 3,000 rpm to remove
metal sulfides. Fixation of samples was performed as described by Urbieta et al., 2015 and hybridizations
as described by Amann, 1995 with CY3-labelled probes for the Bacteria domain EUB338 (5‟
GCTGCCTCCCGTAGGAGT 3‟, Amann et al., 1990) and Archaea domain (5‟
GTGCTCCCCCGCCAATTCCT 3‟, Stahl and Amann, 1991). Pure cultures of Desulfovibrio vulgaris DSM
644 and Acidianus copahuensis DSM 29038 were used as positive controls for Bacteria and Archaea,
respectively. Samples were observed with an epifluorescence microscope (Leica 2500) and images were

taken using a Leica DFC 300 FX camera and its corresponding software (Leica Microscopy Systems Ltd.,
Heerbrugg, Switzerland).
16S gene analysis
DNA was extracted from each of the sulfidogenic cultures using the Ultra–CleanTM Soil DNA Isolation
Kit (MoBio Laboratories, USA) according to the manufacturer‟s instruction. The starting material was
prepared by filtering 5.0 mL of each culture through 0.22 um cellulose acetate membranes and the filters
used for DNA extraction. The 16S rRNA genes were amplified by PCR as previously described (Okibe et
al., 2003) using the universal bacterial primers 27F-CM (5‟ AGAGTTTGATCMTGGCTCAG 3‟) and 1387R
(5 ‟GGGCGGWGTGTACAAGGC 3‟) and archaeal primers A-21F (5‟ TTCCGGTTGATCCYGCCGGA 3‟)
and 915R (5‟ GTGCTCCCCCGCCAATTCCT 3‟). The PCR products were checked by electrophoresis on
1% agarose gel.
16S rRNA gene clone libraries were constructed to analyse the microbial composition of the
sulfidogenic consortia. Positive PCR products from each enrichment culture (pooled from three
independent reactions) were purified using the Ultra Clean® PCR Clean-Up Kit (MOBIO Laboratories) and
ligated using the pGEM-T Easy Vector System (Promega, USA). Before cloning DNA concentration of
PCR products was determined using the NanoDrop 2000 (Thermo Fisher Scientific). The resulting ligation
products were transformed into Escherichia coli strain DH5α according to the manufacturer‟s instructions.
For each library, 32 white colonies were randomly picked and selected for the correct insert size by colony
PCR with vector primers, resulting in 30 clones with the correct insert size per sample. The plasmid from
each of these clones was purified using the Concert Rapid miniprep system (Life Technologies) and DNA
inserts were subjected to restriction fragment length polymorphism analysis (RFLP) analysis, using the
restriction enzymes MspI and CfoI to determine the number of different 16S rRNA genes that had been
cloned. The RFLP analysis revealed five restriction pattern groups, and 14 clones were sequenced in
total. Plasmids of at least one or two representative clones for each RFLP pattern were sequenced using
the primers SP6 and T7 from the p-GEM-T Easy Vector System. The sequencing reactions were

performed by Macrogen Inc. (Seoul, Korea). Sequences were assembled with preGap and Gap 4 software
from Staden Package (Bonfield et al., 1995) and plasmid sequences were manually removed using the
NCBI VecScreen tool. All sequences were checked for chimeras using the online analysis Bellerophon
(Huber et al., 2004). The taxonomic identification of the sequences was performed using the public
databases SILVA, EzBioCloud and GenBank (Altschul et al., 1997; Yoon et al., 2017; Quast et al., 2013).
MEGA 6 was used to establish the phylogenetic affiliations of the 16S rRNA gene sequences from SRB
isolates (Tamura et al., 2013). A consensus tree was generated, and bootstrap analysis was performed.
Results
Characteristics and physicochemical analysis of Copahue hot springs
The main physicochemical characteristics of sediment and water samples, and concentrations of
transition metals in water samples, are shown in Table 1. Total soluble Cu, Pb, Ni and Cr were measured
in water in contact with sediments, but their concentrations were below the detection limits (0.02; 0.5;
0.05; 0.06 mg/L, respectively) of atomic absorption spectrophotometry. The samples were found to be
acidic (AL1 and LMa2) to moderately acidic (LMi, B9-2 and B9-3) suggesting that the microbial
communities present might be resistant or tolerant to acidic conditions. Temperatures varied from
mesophilic (LMa2 and AL1 samples) to moderately thermophilic and hyperthermophilic conditions (B9-2,
B9-3 and LMi samples). DO measurements revealed anoxic environments and a highly reducing
conditions indicated by negative redox potentials. All samples contained relatively high sulfate and low
dissolved sulfide concentrations in the water in contact with sediments. Furthermore, TOC results showed
low values of organic matter (in general lower than 2%) compared to those reported for other volcanic
environments with similar characteristics (Lantican et al., 2011). Iron was the only metal present in both
water and sediments in relatively high concentrations (16 - 40 mg/g dry sample).
Sulfate reduction at acidic pH in enrichments from Copahue
Sulfate-reducing activity was detected in cultures at low pH in all sediments from Copahue volcano, as
indicated by the formation of ZnS precipitates, detection of H2S odour and consumption of sulfate (26% in
AL1 culture, and 33% in LMi culture) and glycerol (94 - 99%). The latter were stoichiometric with no
accumulation of acetate production (Table 2) suggesting that glycerol was completely oxidized to CO2.
According to equation 5 the stoichiometry between glycerol oxidised (to CO2) and sulfate reduced is
1:1.75, which correlates with the results shown in Table 2.
(eq 5)
Microscopic observations showed that enrichment cultures consisted mostly of rod-shaped and spore-
forming bacteria with ellipsoidal spores causing the swelling of the cells, as common features of the
enrichment cultures. Other bacterial morphologies, including smaller bacilli, were also detected in smaller
numbers in all cultures, indicating the existence of mixed populations. FISH analysis revealed that in all
enrichment cultures all cells stained with DAPI showed positive hybridisation with the Bacteria-specific
probe. In contrast, no hybridisation was detected when the Archaea-specific probe was used, indicating
that enrichment cultures where dominated by Bacteria (see Supplementary Material Figure S1). Other
cultures showed similar hybridisation efficiency.
Phylogenetic identification of clones from Copahue sulfidogenic enrichment cultures
None of the enrichment cultures showed positive results when Archaea-specific primers were used,
which correlates with negative Archaea FISH hybridisation. On the other hand, positive amplification with
Bacteria-specific primers was achieved with DNA extracted from enrichment cultures. The distribution and
percentage of taxonomic units of each clone library were also calculated (Fig. 2). The 16S rRNA gene
sequences from all sulfidogenic cultures were classified into three different phyla: Firmicutes (Bacilli and
Clostridia classes); Thermotogae (Thermotogae class) and Proteobacteria (Gammaproteobacteria class).
Although the method (cloning/sequencing) used to describe the bacterial structure and composition

provides lower diversity coverage compared to high-throughput sequencing (HTS) methods, it was
possible to identify the sulfate-reducing microorganisms in the enrichment cultures and other bacteria
present in minor numbers. Moreover, cloning/sequencing approach generates longer sequences than the
HTS‟s short reads, thereby providing a more robust phylogenetic affiliation (Medrano-Santillana et al.,
2017). Biomolecular analysis of the enrichment cultures showed that members of genera reported as
spore-forming sulfate reducers were found as the dominant bacteria in all enrichment cultures.
Sequences distantly related to the genus Desulfitobacterium dominated the low pH enrichment cultures
AL1(83%), LMa2 (73%), LMi (67%), B9-3 (63%) and B9-2 (80%) (Figure 2). The closest relative (98%
sequence identity) was Peptoccocaceae bacterium strain CL4 (EF061086, “Desulfobacillus acidavidus”
strain CL4) (Table 3). “Desulfobacillus acidavidus” was described as a mesophilic, strictly anaerobic,
spore-forming bacterium able to metabolize glycerol completely to CO2 coupled to sulfate reduction
(Johnson et al., 2009). This metabolism was observed in all enrichment cultures from Copahue sediments
(Table 2).
The other clones with lower abundance (6-20%) in enrichment cultures at low pH were affiliated to
Alicyclobacillus, Sulfobacillus, Acidithiobacillus (At.) and Athalassotoga/Mesoaciditoga, the latter with low
sequence identity. Members of these genera have been identified in natural acidic environments and
those associated with mining activities and are involved in the biogeochemical cycling of iron and sulfur.
Some differences in their distribution among the enrichment cultures were observed. Sequences related to
Acidithiobacillus and Athalassotoga/Mesoaciditoga (7 - 13%) were only present in cultures originating from
samples AL1 and LMa2, the ponds with moderate temperature similar to the optimal growth temperatures
of these genera. In contrast, in enrichment cultures of higher temperature ponds, B9-2, B9-3 and LMi,
acidophilic, thermophilic bacteria related to Sulfobacillus and Alicyclobacillus were detected between 13-
23%. The Acidithiobacillus genus was represented by three distinct species At. ferriduransT, At. ferriphilus
T
and At. ferrooxidans T. These bacteria are facultatively anaerobic, mesophilic, chemolitho-autotrophic
sulfur/iron-oxidisers (some species and strains also oxidise hydrogen) that have been isolated from acidic

environments with moderate temperature values, such as mine-impacted waters and geothermal sites
(Falagán and Johnson, 2016; Hedrich and Johnson, 2013; Kelly & Wood, 2000). Other sequences in AL1
and LMa2 enrichment cultures were found to be distantly related to anaerobic, moderately thermophilic
fermentative bacteria Mesoaciditoga lauensisT and Athalassotoga saccharophilaT (Itoh et al., 2016;
Reysenbach et al., 2013). The closest cultivated relatives of the sequences retrieved from cultures LMi,
B9-2 and B9-3 samples were found in a gold-recovery plant (DQ124681), lead-zinc ore (AF137502) and
geothermal sites (AY007662, AY371274, AF450135). The sequences had a high similarity to Sulfobacillus
thermotolerans Kr1, Alicyclobacillus tolerans K1 and unidentified strains that have been tentatively
assigned to the genus Alicyclobacillus (Johnson et al., 2001; 2003, Yahya et al., 2008). Sulfobacillus and
Alicyclobacillus are also facultatively anaerobic, acidophilic iron/sulfur oxidizing bacteria, but with the
ability to grow at higher temperatures than species of Acidithiobacillus genus (20 - 60°C and 20-55°C,
respectively) (Bogdanova et al., 2006; Karavaiko et al., 2005).
In view of their metabolic features and the fact that they are present in low relative abundance, the
latter groups of microorganisms would seemingly not be contributing to the sulfidogenic activity of the
enrichment cultures (Figure 2). However, their presence might be attributable to their ability to grow and
resist facultative/anaerobic conditions and the fact that they might be present in the original sample.
Bacteria related to Acidithiobacillus, Sulfobacillus and Alicyclobacillus genera have been previously
detected at geothermal Copahue area (Chicacchiarini et al., 2010; Lavalle et al., 2005; Urbieta et al.,
2014). Also, members of Sulfobacillus and Alicyclobacillus form endospores, which can survive in
environments with low oxygen conditions (Bogdanova et al., 2006; Karavaiko et al., 2005). To confirm the
viability of these bacteria, a 10 mL aliquot of each enrichment culture was incubated under aerobic
conditions (at 30 °C and 45° C) using sulfur and iron as energy source (Johnson 1995). A decrease in pH
was observed, confirming sulfur oxidation. The 16S rRNA gene sequences retrieved from these cultures,
using the same methodology described for anaerobic enrichments, showed similar sequences to the ones
previously described (see Supplementary Material Table 1). On the other hand, in cultures from samples

AL1 and LMa2 some sequences (6 -13.3%, Figure 2) were only remotely related to the recently described
Athalassotoga/Mesoaciditoga genera. The only two species described for these genera were found to be
moderately thermophilic (30 - 60 ºC), acid-tolerant, heterotrophic and anaerobic bacteria, able to use
sulfur compounds as electron acceptor and metabolize a variety of complex organic compounds as
carbon and energy sources (Itoh et al., 2017; Reysenbach et al., 2013). In addition, species related to the
Thermotogae phylum were not detected in previous studies from Copahue volcano but are widespread in
many anaerobic environments such as hydrothermal vents, marine sediments and terrestrial hot springs,
among others (Souza Brito et al., 2014; Tobler and Benning, 2011), and therefore they might also be
present in the original sediments samples. The low sequence similarity to this taxon suggests the
presence of a novel genus in our samples.
Isolation and phylogenetic identification of sulfidogenic bacteria
Several isolates were recovered from enrichment cultures of all samples on overlay plates at 30 ºC:
LMa2_E2; LMi_H1; B93_E2; B92_C3; AL1_C1. These grew as ZnS-encrusted colonies on overlay plates
and were Gram-positive, spore-forming, rod-shaped bacteria. All isolates oxidised glycerol completely to
CO2 at the expense of sulfate reduction, as no acetate was detected after cultivation on liquid medium at
pH 3.0. All isolates were closely related to Peptoccoaceae bacterium strain CL4 (EF061086,
“Desulfobacillus acidavidus”; 99% 16S rRNA gene sequence similarity) (Figure 3). These results support
those found in enrichment cultures with culture-independent techniques, where Peptoccoaceae bacterium
strain CL4 was implicated to be the main bacterium to be responsible for sulfate reduction.
Discussion
It is generally assumed, that exposure to low pH leads to the establishment of a tolerant and resistant
microbial population. However, very few acidophilic SRP have been described despite of the facts that
sulfate is usually present in elevated concentrations in extremely acidic environments. A previous study
performed in sediments at the naturally acidified (pH 1.8) glacial lake Caviahue at the geothermal
Copahue system (Fig. 1) found high sulfate consumption and sulfide production at low pH values,

predicting that microbial sulfate reduction occurs in this ecosystem (Koschorreck et al., 2003). However,
until now no studies focused on the isolation of acidophilic/acid-tolerant SRPs. Indeed, the sulfidogenic
enrichment cultures and, most important, pure cultures of SRBs obtained in this study revealed the
existence of viable SRB in several anaerobic sediments from Copahue volcano and based on activity data
are likely to be adapted to acidic conditions. This indicates that the sulfidogenic metabolic process was not
adversely affected nor inhibited by the initial low pH.
Previous studies reported the enrichment and isolation of acidophilic/acid-tolerant SRB from acidic
environments. Rowe et al., 2007 found Peptococcaceae bacterium strain CL4 (EF061086) in acidic
sediments from an abandoned copper sulfide mine, which was physiologically characterized by Johnson
et al., 2009. This isolate was distantly related to Desulfitobacterium aromaticivoransT and
Desulfosporosinus acidophilusT therefore was proposed as a new genus and specie: “Desulfobacillus
acidavidus”. Later, Sanchez- Andrea et al., 2013 reported the isolation of a sulfate-reducing bacterium
(isolate I-i) in Tinto River natural acid rock drainage. This isolate clustered into a group without close
representatives and the closest sequence belongs to the clone HQ730640 retrieved in a former study of
Tinto River sediments (Sanchez-Andrea et al., 2011). Moreover, strain CEB3 isolated by Nancucheo &
Johnson, 2012 from an acidic sulfidogenic bioreactor treating mine water (pH 2.4) was also classified into
Peptococcaceae family. From the latter, it can be suggested that all these isolates, including the ones
obtained in this study, could form a distinct taxon of acidophilic/acid tolerant SRB positioned between
Desulfosporosinus and Desulfitobacterium genera. The sequences and isolates retrieved from our study
have the same 16S rRNA sequence similarity with cultivated species of Desulfitobacterium than those
found in the studies mentioned above, therefore falling into the same taxon (Table 2 and Figure 3).
Moreover, BLAST analysis performed with 16SrRNA sequences from SRB isolates from this study shows
that they have 97% sequence similarity with clone HQ730640. To our knowledge, this study is the first
report of this acidophilic/acid-tolerant group of SRB in an acidic volcanic environment. Other studies
performed in acidic pools of the volcanic area of Kamchatka Peninsula regarding microbial ecology or

isolation of SRB have found sequences or acidophilic SRB isolates related with Thermodesulfobium,
Thermodesulfovibrio, Desulfobaba and Desulfothermobacter genera (Burgess et al., 2012; Frolov et al.,
2016; 2017; 2018), which are phylogenetically very distant from our SRB.
Some of the ponds from Copahue volcano, where acidophilic/acid-tolerant SRB were isolated in this
study, present low pH values (Agua del Limón pH 2.1 and Las Máquinas pH 3.0) and low organic matter
content. All the acidophilic sulfate reducing strains described above were also isolated from natural
environments or engineered systems at low pH and low organic matter content: 2.65 – 2.75 for strain CL4,
3.2 for isolate I-I and 2.4 for strain CEB3. Among the closest cultivated relatives from our isolates,
Peptococcaceae bacterium CL4 is more acidophilic (capable of growing in pure culture in pH 3.0 liquid
media, Johnson et al., 2009) than Desulfosporosinus acididuransT (optimum pH 5.5, Sanchez- Andrea et
al., 2015). Although not fully characterized Peptococcaceae bacterium CEB3 appears to be more
thermotolerant rather than mesophilic SRB and was found to be dominant in a bioreactor operating at
40°C and pH 4.0 (Santos & Johnson, 2018). Therefore, one of the reasons that Copahue Peptococcaceae
bacterium -isolates could thrive in Copahue ponds rather than for example Desulfosporosinus
acididuransT, is because of their capability to grow at higher temperatures and lower pH values.
Bioremediation of acidic, metal-contaminated waters using acidophilic SRPs is attractive due to the
possibility to avoid a neutralization step to contact the acidic mine water with neutrophilic SRPs. Since D.
acididuransT is an incomplete oxidizer of glycerol, condition not desirable in a bioremediation context as
less electrons are available for sulfate reduction and acetic acid generated increases the chemical
demand of water discharged from the process. Therefore, the fact of obtaining acidophilic SRPs (related to
Peptoccoaceae bacterium strain CL4) from different global locations and with the ability to oxidize
completely glycerol is crucial and expand the sources to find acidophilic SRPs. On the other hand, the use
of SRPs in MESs to treat mine-impacted waters at low pH and generate energy has not been widely
investigated. Recently, Pozo et al. (2016; 2017) described the removal of sulfate from acid mine drainage
using neutrophilic SRPs in a bioelectrochemical cell with a previous neutralization step. The tolerance to

acidic conditions of the SRPs from Copahue volcano obtained in this work, make them candidates for
implementing a MES where operational costs of neutralization steps will be avoided.
The presence of Peptococcaceae bacterium CL4- related species in high temperature ponds could be
associated with their ability to form endospores. However, the existence of other acidophilic SRP able to
grow at extreme temperatures is not excluded, since the enrichment cultures and isolation in this study
were set up at 30°C while most samples had higher in situ temperatures. Also, the use of glycerol as the
only electron donor could have been limited the range of SRP able to grow autotrophically. For example,
Frishbain et al. 2003 enriched SRB from Yellowstone hot springs using acetate and/or H2 as electron
donors. Bacteria detected includes Desulfobacula, Desulfotomaculum and Desulfomicrobium genera, who
are known to be neutrophilic rather than acidophilic/acid – tolerant bacteria (Rabus et al., 2015).
Moderately thermophilic, chemolitho-autotrophic and acidophilic/acid-tolerant SRMs of the genera
Thermodesulfobium and Desulfothermobacter have recently been isolated and detected in acidic thermal
springs and mud pools (Frolov et al., 2017 Frolov et al., 2018; Souza Brito et al., 2014).
In the study performed by Urbieta et al. (2014) a preliminary geomicrobiological model of sulfur
metabolism operating in the upper zones of Copahue hot springs was outlined. Acidophilic, sulfur-
oxidizing bacteria of the genus Acidithiobacillus and Thiomonas and archaea related to Sulfolobus and
Acidianus copahuensisT were postulated to have key roles in aerobic sulfur and carbon cycles. Based on
results obtained by culture-dependent approaches and the related metabolisms described, sulfate-
reducers and other anaerobic bacteria reported in this study also contribute to these cycles via their
anaerobic sulfur and carbon metabolisms. Elemental sulfur and other reduced sulfur compounds (S2O32-
and SO32-), which are present in considerable amounts in Copahue hot springs due to continuous volcanic
activity and microbial sulfur oxidation (Chiacchiarini et al., 2010), could serve as electron acceptors under
anaerobic conditions for many of the microbial species in the environment. Sulfate reduction might be
carried out by SRB such as “Desulfobacillus”, due to their presence and isolation from acidic pH cultures
originating from sediments. On the other hand, other obligate anaerobes able to reduce elemental sulfur

(but not sulfate) have also been detected: Athalassotoga/Mesoaciditoga-related species may reduce
elemental sulfur under anoxic conditions. These bacteria can also ferment or respire complex organic
matter, generating a pool of intermediates that can be act as substrates for the metabolism of SRB (Itoh et
al., 2016; Reysenbach et al., 2013). Furthermore, chemolithotrophic bacteria related to Acidithiobacillus,
Sulfobacillus and Alicyclobacillus may act as primary producers contributing to the carbon cycle and
oxidizing elemental sulfur or sulfide under both aerobic and anaerobic conditions competing with
thermophilic archaea (Urbieta et al., 2014).
Conclusions
Several studies have been carried out at the geothermal Caviahue-Copahue system in Patagonia,
Argentina, but relatively few explored its anaerobic zones. As demonstrated in this study, this extreme
environment has great potential for isolation of anaerobic microorganisms, particularly sulfate-reducing
bacteria. The results indicate that sulfidogenic bacteria can thrive under acidic conditions found in hot
spring sediments from Las Máquinas, Las Maquinitas and Agua del Limón and Baño 9. Other anaerobic
or facultative anaerobic microorganisms were also detected in enrichment cultures. Considering that some
of these sequences were distantly related to cultivated species, we consider Copahue volcano hot spring
sediments to be a potential source of novel anaerobic species, which require further isolation and
characterization. The sulfate-reducing bacteria SRB isolated in the present study have potential
applications in bioremediation processes, especially those related with the treatment of mine-impacted
waters and energy generation in Microbial Electrochemical Systems (MESs). This study is the first report
of the microbial exploration of the anaerobic zones of Caviahue-Copahue geothermal system and gives
more insights in the field of SRPs thriving this type of environments.

Data availability
Sequencing data have been submitted to GenBank: The 16S rRNA gene sequences determined for the
isolates are deposited under accession numbers: KT952395, KT952393, MK733921, MK733922,
MK733923.The 16S rRNA gene sequences determined in the clone libraries are deposited under
accession numbers: MK450143-MK450156 and MN453463-MN453469 (Supplementary Material).
Funding
This work was supported by the Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT),
Argentinian Government [Grant Numbers PICT 2012 0623, PICT 2013 0630 and PICT 2015 0463] and
Consejo Nacional de Investigación Científica y Técnica (CONICET), Argentinian Government.
Acknowledgments
Willis G, Giaveno A and Donati E want to specially thank to EPROTEN and Dirección de Áreas
Naturales Protegidas of Neuquén province for the authorization and collaboration in accessing to the
sampling sites. Willis G. wants to specially thank to Inti Gadda, Federico Giagante and Camila Castro for
their contribution in processing the images.
Competing interest
The authors declare no competing financial interests
References
Agusto M, Tassi F, Caselli AT, et al. Gas geochemistry of the magmatic-hydrothermal fluid reservoir in
the Copahue-Caviahue Volcanic Complex (Argentina). J Volcanol Geoth Res 2013; 257: 44-56.
Alazard D, Joseph M, Battaglia-Brunet F, et al. Desulfosporosinus acidiphilus sp. nov.: a moderately
acidophilic sulfate-reducing bacterium isolated from acid mining drainage sediments. Extremophiles 2010;
14: 305-312.
Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Res 1997; 25: 3389-3402.

Amann RI, Binder B.J., Olson R.J., et al. Combination of 16S rRNA-targeted oligonucleotide probes
with flowcytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990; 56:1919-1925.
Amann RI. In situ identification of microorganisms by whole cell hybridization with rRNA-targeted nuclei
acid probes. In: Akkermans ADL, van Elsas JD, de Bruijn FJ (eds.). Molecular Microbial Ecology Manual,
Dordrecht, Netherlands: Kluwer Academic Publishers, 1995, 1-15.
Aüllo T, Ranchou-Peyruse A, Ollivier B, et al. Desulfotomaculum spp. and related gram-positive sulfate
reducing bacteria in deep subsurface environments. Front Microbiol 2013; 4: 1-12.
Bogdanova TI, Tsaplina IA, Kondrat‟eva TF, et al. Sulfobacillus thermotolerans sp. nov., a
thermotolerant, chemolithotrophic bacterium. Int J Syst Evol Microbiol 2006; 56: 1039-1042.
Bonfield JK, Smith KF, Staden R. A new DNA sequence assembly program. Nucleic Acids Res. 1995;
23: 4992-4999.
Burgess EA, Unrine JM, Mills GL, et al. Comparative geochemical and microbiological characterization
of two thermal pools in the Uzon Caldera, Kamchatka, Russia. Microbiol Ecol 2012; 63: 471-489.
Castro C, Donati E. Effect of different energy sources on the adhesion and bioleaching of a
chalcopyrite concentrate by the extremophilic archaeon Acidianus copahuensis. Hydrometallurgy 2016;
162: 49-56.
Chernyh NA, Mardanov AV, Gumerov VM, et al. Microbial life in Bourlyashchy, the hottest thermal pool
of Uzon Caldera, Kamchatka. Extremophiles 2015; 19: 1157-1171.
Chiacchiarini P, Lavalle L, Giaveno A, et al. First assessment of acidophilic microorganisms from
geothermal Copahue-Caviahue system. Hydrometallurgy 2010; 104: 334-341.

Chiodini G, Cardellini C, Lamberti MC, et al. Carbon dioxide diffuse emission and thermal energy
release from hydrothermal systems at Copahue-Caviahue volcanic complex (Argentina). J Volcanol Geoth

Res 2015; 304: 294-303.
Falagán C, Johnson DB. Acidithiobacillus ferriphilus sp. nov.: a facultatively anaerobic iron- and sulfur-
metabolising extreme acidophile. Int J Syst Evol Microbiol 2016; 66: 206-211.
Falagán C, Sánchez-España J, Johnson DB New insights into the biogeochemistry of extremely acidic
environments revealed by a combined cultivation-based and culture-independent study of two stratified pit
lakes. FEMS Microbiol Ecol 2014; 87: 231-243.
Fishbain S, Dillon JG, Gough HL, et al. Linkage of high rates of sulfate reduction in Yellowstone hot
springs to unique types in the dissimilatory sulfate respiration pathway. Appl Environ Microbiol 2003 69(6):
3663-3667.
Frololov EN, Merkel AY, Pimenov NV, et al. Sulfate reduction and inorganic carbon assimilation in
acidic thermal springs of Kamchatka Peninsula. Microbiology 2016; 85: 471-480.
Frolov EN, Kublanov IV, Toshchakov SV, et al. Thermodesulfobium acidiphilum sp. nov., a
thermoacidophilic, sulfate-reducing, chemoautotrophic bacterium from a thermal site. Int J Syst Evol
Microbiol 2017; 67: 1482-1485.
Frolov EN, Zayulina KS, Kopitsyn DS, et al. Desulfothermobacter acidiphilus gen. nov., sp. nov., a
thermoacidophilic sulfate-reducing bacterium isolated from a terrestrial hot spring. Int J Syst Evol Microbiol
2018; 68(3): 871-875.
Giaveno A, Urbieta MS, Ulloa JR, et al. Physiologic versatility and growth flexibility as the main
characteristics of a novel thermoacidophilic Acidianus strain isolated from Copahue Geothermal area in
Argentina. Microb Ecol 2013; 65: 336-346.

González D, Liu Y, Villa Gomez D, et al. Performance of a sulfidogenic bioreactor inoculated with
indigenous acidic communities for treating an extremely acidic mine water. Min Eng 2019; 131: 370-375.

Greenberg AE, Trussell RR, Clesceri LS (eds). Standard Methods for the Examination of Water and
Wastewater. Washington: APHA-AWWA-WPCF, 1985.
Hedrich S, Johnson DB. Acidithiobacillus ferridurans sp. nov., an acidophilic iron-, sulfur- and
hydrogen- metabolizing chemolithorophic gamma proteobacterium. Intl J Syst Evol Microbiol 2013; 63:
4018-4025.
Hirayama H, Takai EK, Inagaki F, et al. Bacterial community shift along a subsurface geothermal water
stream in Japanese gold mine. Extremophiles 2005; 9:169-184.
Huber T, Faulkner G, Hugenholtz P. Bellerophon; a program to detect chimeric sequences in multiple
sequence alignments. Bioinformatics 2004; 20: 2317-2319.
Itoh T, Onishi M, Kato S, et al. Athalassotoga saccharophila gen. nov., sp. nov., isolated from an acidic
terrestrial hot spring, and proposal of Mesoaciditogales ord. nov. and Mesoaciditogaceae fam. nov. in the
phylum Thermotogae. Int J Syst Evol Microbiol 2016; 66: 1045-1051.
Johnson DB, Body DA, Bridge TAM, et al. Biodiversity of acidophilic, moderate thermophiles isolated
from two sites in Yellowstone National Park, and their roles in the dissimilatory oxido-reduction of iron. In:
Thermophiles: Biodiversity, Ecology and Evolution. Reysenbach AL, Voytek A (eds). New York: Kluwer
Academic/Plenum Publishers, 23-39, 2001.
Johnson DB, Jameson E, Rowe OF, et al. Sulfidogenesis at low pH by acidophilic bacteria and its
potential for the selective recovery of transition metals from mine waters. Adv Mat Res 2009; 71-73: 693-
696.
Johnson DB, Okibe N, Roberto FF. et al. Novel thermoacidophilic bacteria isolated from geothermal
sites in Yellowstone National Park: physiological and phylogenetic characteristics. Arch Microbiol 2003;

180: 60-68.
Johnson DB. Reductive dissolution of minerals and selective recovery of metals using iron- and sulfate-
reducing acidophiles. Hydrometallurgy 2012; 127-128: 172-177.
Johnson DB. Selective solid media for isolating and enumerating acidophilic bacteria. J Microbiol Meth
1995; 23: 205-218.
Jones RM, Hedrich S, Johnson DB. Acidocella aromatica sp. nov.: an acidophilic heterotrophic
alphaproteobacterium with unusual phenotypic traits. Extremophiles 2013; 17: 841-850.
Karavaiko G.I., Bogdanova T.I., Tourova T.P., et al. Reclassification of „Sulfobacillus
thermosulfidooxidans subsp. thermotolerans‟ strain K1 as Alicyclobacillus tolerans sp. nov. and
Sulfobacillus disulfidooxidans Dufresne et al. 1996 as Alicyclobacillus disulfidooxidans comb. nov., and
emended description of the genus Alicyclobacillus. Int J Syst Evol Micr 2005; 55: 941-947.
Kelly D.P., Wood A.P. Reclassification of some species of Thiobacillus to the newly designated genera
Acidithiobacillus gen. nov., Halothiobacillus gen. nov. and Thermithiobacillus gen. nov. Int J Syst Evol
Microbiol 2000; 50: 511-516.
Kimura S, Hallberg KB, and Johnson DB. Sulfidogenesis in low pH (3.8 – 4.2) media by a mixed
population of acidophilic bacteria. Biodegradation 2006; 17: 57-65.
Koschorreck M, Wendt-Potthoff K, Geller W. Microbial sulfate reduction at low pH in sediments of an
acidic lake in Argentina. Environ Sci Technol 2003; 37: 1159-1162.
Lantican NB, Diaz MGQ, Cantera JJL, et al. Microbial community of a volcanic mudspring in the
Philippines as revealed by 16S rDNA sequence analysis and fluoresce in situ hybridization. World J
Microb Biot 2001; 27: 859-867.

Lavalle L, Chiacchiarini P, Pogliani C, et al. Isolation and characterization of acidophilic bacteria from
Patagonia, Argentina. Process Biochem 2005; 40: 1095-1099.

Mardanov AV, Gumerov VM, Beletsky AV, et al. Microbial diversity in acidic thermal pools in the Uzon
Caldera, Kamchatka. Antonie van Leeuwenhoek 2018; 111: 35.
Medrano-Santillana M, Souza-Brito EM, Duran R, et al. Bacterial diversity in fumaroles environments of
the Paricutín volcano, Michoacán (México). Extremophiles 2017; 21: 499-511.
Meyer-Dombard DR, Shock EL, Amend JP. Archaeal and bacterial communities in geochemically
diverse hot spring of Yellowstone National Park, USA. Geobiology 2005; 3: 211-227.
Mori K, Kim H, Kakegawa T, et al. A novel lineage of sulfate-reducing microorganisms:
Thermodesulfobiaceae fam. nov., Thermodesulfobium narugense, gen. nov., sp. nov., a new thermophilic
isolate from a hot spring. Extremophiles 2003; 7: 283-290.
Muyzer G, Stams AJM. The ecology and biotechnology of sulphate-reducing bacteria. Nat Rev
Microbiol 2008; 6: 441-454.
Nancucheo I, Johnson DB. Selective removal of transition metals from acidic mine waters by novel
consortia of acidophilic sulfidogenic bacteria. Microb Biotechnol 2012; 5: 34-44.
Nancucheo I, Rowe OF, Hedrich S, et al. Solid and liquid media for isolating and cultivating acidophilic
and acid-tolerant sulfate-reducing bacteria. FEMS Microbiol Lett 2016, DOI: 10.1093/femsle/fnw083.
Ni G, Harnawan P, Seidel L, et al. Haloalkalophilic microorganisms assists sulfide removal in a
microbial electrolysis cell. J Hazard Mat 2018; 363: 197-204.
Okibe N, Gericke M., Hallberg KB, et al. Enumeration and characterization of acidophilic
microorganisms isolated from a pilot plant stirred tank bioleaching operation. Appl Environ Microbiol 2003;
69: 1936-1943
Pedrozo FL, Temporetti PF, Beamud G, et al. Volcanic nutrient inputs and topic state of Lake
Caviahue, Patagonia, Argentina. J Volcanol Geoth Res 2008; 178: 205-212.

Pozo G, Jourdin L, Lu Y, et al. Cathodic biofilm activates electrode surface and achieves efficient
autotrophic sulfate reduction. Electrochim Acta 2016; 213: 66-74.
Pozo G, Pongy S, Keller J, Freguia LP, et al. A novel bioelectrochemical system for chemical-free
permanent treatment of acid mine drainage. Water Research 2017; 126(1): 411-420.
Prieto-Barajas CM, Alcaraz LD, Valencia-Cantero E, et al. Life in hot spring microbial mats located in
the Trans-Mexican Volcanic Belt: A 16S/18S rRNA gene and metagenomic analysis. Geomicrobiol J 2018;
35: 704-712.
Quast C, Pruesse E, Yilmaz P, et al (2013). The SILVA ribosomal RNA gene database project:
improved data processing and web-based tools. Nucl. Acids Res 2013; 41 (D1): D590-D596.
Rabus R, Venceslau SS, Wöhlbrand L, et al. A post-genomic view of the ecophysiology, catabolism
and biotechnological relevance of sulphate-reducing prokaryotes. In: Poole RK (ed.). Advances in
Microbial Physiology, Amsterdam, The Netherlands: Elsevier, 2015, 66: 55-321.
Reysenbach AL, Liu Y, Lindgren AR, et al. Mesoaciditoga lauensis gen. nov., sp. nov., a moderately
thermoacidophilic member of the order Thermotogales from a deep-sea hydrothermal vent. Int J Syst Evol
Microbiol 2013; 63: 4724-4729.
Roulleau E, Tardani D, Sano Y, et al. New insights from noble gas and stable isotopes of
geothermal/hydrothermal fluids at Caviahue-Copahue Volcanic Complex: Boiling steam separation and
water-rock interactions at shallow depth. J Volcanol Geoth Res 2016; 328: 70-83.
Rowe OF, Sanchez-España J, Hallberg KB, et al. Microbial communities and geochemical dynamics in
an extremely acidic, metal-rich stream at an abandoned sulfide mine (Huelva, Spain) underpinned by two
functional primary production systems. Environ Microbiol 2007; 9: 1761-1771.

Rüffel V, Maar M, Dammbrück MN, et al. Thermodesulfobium sp. strain 3baa, an acidophilic sulfate
reducing bacterium forming biofilms triggered by mineral precipitation. Environ Microbiol 2018; 20: 3717-

3731.
Sánchez-Andrea I, Rodriguez N, Amils R, et al. Microbial diversity in anaerobic sediments at Rio Tinto,
a naturally acidic environment with high heavy metal content. Appl Environ Microb 2011; 77: 6085-6093.
Sánchez-Andrea I, Stams AJM, Amils R, et al. Enrichment and isolation of acidophilic sulfate-reducing
bacteria from Tinto River sediments. Environ Microbiol Rep 2013; 5: 672-678.
Sánchez-Andrea I, Stams AJM, Hedrich S, et al. Desulfosporosinus acididurans sp. nov.: an acidophilic
sulfate-reducing bacterium isolated from acidic sediments. Extremophiles 2015; 19: 39-47.
Santos AL, Johnson DB. Design and application of a low pH upflow biofilm sulfidogenic bioreactor for
recovering transition metals from synthetic waste water at Brazilian copper mine. Front Microbiol 2018; 9:
1-11.
Schumacher B. Methods for the determination of Total Organic Carbon in soils and sediments. In: Soils
and Sediments. Washington DC: U.S. Environmental Protection Agency, 2002.
Sen AM, Johnson DB. Acidophilic sulphate-reducing bacteria: candidates for bioremediation of acid
mine drainage. In: Amils R and Ballester A. (eds). Biohydrometallurgy and the Environment Toward the
Mining of the 21st Century. Process Metallurgy 9A. Amsterdam: Elsevier, 1999, 709-718.
Senko JM, Zhang G, Mc Donough JT, et al. Metal reduction at low pH by a Desulfosporosinus species:
implications for the biological treatment of acid mine drainage. Geomicrobiol J 2009; 26: 71-82.
Souza Brito EM, Villegas-Negrete N, Sotelo-González IA, et al. Microbial diversity in Los Azufres
geothermal field. Extremophiles 2014; 18: 385-398.

Stahl DA, Amann R. (1991). Development and application of nucleic acid probes. In: Stackebrandt E.,
Goodfellow M. (eds.). Nucleic Acid Techniques in Bacterial Systematics. Chichester: John Wiley & Sons

Ltd., 1991, 205-248.
Tamura K, Stecher G, Peterson D, et al. MEGA6: Molecular Evolutionary Genetics Analysis version
6.0. Mol Biol Evol 2013; 30: 2725-2729.
Tobler DJ, Benning LG. Bacterial diversity in five Icelandic geothermal waters: temperature and sinter
growth rate effects. Extremophiles 2011; 15: 473-485.
Tuttle JH, Dugan PR, Randles CI. Microbial dissimilatory sulfur cycle in acid mine water. J Bacteriol
1969; 97: 594-602.
Urbieta MS, Gonzalez-Toril E, Giaveno MA, et al. Archaeal and bacterial diversity in five different
hydrothermal ponds in the Copahue region in Argentina. Syst Appl Microbiol 2014; 37: 429-441.
Urbieta MS, Gozález-Toril E, Aguilera Bazan A, et al. Comparison of the microbial communities of hot
springs waters and the microbial biofilms in the acidic geothermal area of Copahue (Neuquén, Argentina).
Extremophiles 2015; 19: 437-450.
Varekamp JC. Copahue volcano: a modern terrestrial analog for the opportunity landing site. Eos 2004;
85: 401-407.
Wendt-Potthoff K, Koschorreck M. Functional groups and activities of bacteria in a highly acidic
volcanic mountain stream and lake in Patagonia, Argentina. Microb Ecol 2002; 43: 92-106.
Yahya A, Hallberg KB, Johnson DB. Iron and carbon metabolism by a mineral-oxidizing
Alicyclobacillus-like bacterium. Arch Microbiol 2008; 189: 305-312.
Yoon SH, Ha SM, Kwon S, et al. Introducing EzBioCloud: A taxonomically united database of 16S
rRNA and whole genome assemblies. Int J Syst Evol Microbiol 2017; 67:1613-1617.
Figure 1. Locations of the geothermal fields within the Copahue geothermal system and sampling points
(indicated with black arrows): Las Máquinas (LMa), Las Maquinitas (LMi), Baño 9 (B9-2 and B9-3) and
Agua del Limón (AL). Other sample points indicated in the map, belonging to the Rio Agrio, were not
included in this study (Chiacchiarini et al., 2010).

Figure 2. Relative abundance of 16S rRNA genes from enrichment cultures originated from Agua del
Limón (AL1), Las Máquinas (LMa2), Las Maquinitas (LMi) and Baño 9 (B9-2, B9-3) hot spring sediments.
Light grey bars correspond to Sulfobacillus clones; dark grey bars correspond to Peptococcaceae
bacterium CL4 clones and lined bars corresponds to Alicyclobacillus clones. The affiliation is based on
EZBioCloud database.
Figure 3. Phylogenetic affiliations of the complete 16S rRNA gene sequences (1421 bp) of five
sulfidogenic isolates. The consensus phylogenetic tree was generated using MEGA with different sets of
ﬁlters, which showed stable branching. Maximum Likelihood was used as the statistical method and five
hundred bootstrap replicates were performed. The bar indicates a 10% estimated sequence divergence,
and Bacillus methanolicus strain NCIMB 13113 was used to root the tree. The sequences from the
isolates are indicated in boldface type and light grey colour. Designations after the organism names or
identiﬁers are GenBank accession numbers.

Table 1. Physicochemical parameters of Copahue samples determined in situ, dissolved iron

concentration (mM) and in sediments (mg/g of dry sample).
Fe
Sedime
2-
Sulfid Hum nt
Sam Locatio E’ SO4 DO TOC Water
Site pH T [°C] e a b
idity (mg/g
ple n [mV] (mM) (%) (mM)
(mM) (%) dry
sample)
37°49‟0.
B9 20‟‟S
5.1 57 -131 16.87 ND ND 0.8 63 16.8 0.26
(2) 71°5‟50.
Baño 41‟‟W
9 37°49‟0.
B9 87‟‟S
5.1 67 -290 15.10 ND ND 1.0 42 40.0 0.23
(3) 71°5‟50.
46‟‟W
37°49‟0.
Las
9‟‟S 0.6
Máqui LMi 5.2 90 -126 31.35 0.020 0.7 47 26.3 2.14
71°5‟12‟‟ 0
nitas
W
37°50‟2.
Las
LMa 61‟‟S
Máqui 3.0 38 -70 15.31 0.028 1.0 0.8 69 22.1 0.31
2 71°5‟3.2
nas
0‟‟W
37°49‟0.
Agua
13‟‟S 0.3
del AL1 2.1 41 -200 27.39 0.011 2.2 53 25.3 0.25
71°5‟36. 0
Limón
18‟‟W
ND: not determined
a
DO: Dissolved Oxygen
b
TOC: Total Organic Carbon (determined in 0.1 g of sediment corrected with humidity)
Table 2. Stoichiometry of glycerol oxidised and sulfate reduced in low pH enrichments cultures. Acetic
acid was not detected in any of the experiments.
Enrichment Glycerol Sulfate ZnS/ H2S

culture oxidised (mM) reduced (mM) generation
AL1 2.3 4.2 +
B9-2 2.5 4.4 +
B9-3 2.2 3.9 +
LMa2 2.2 3.7 +
LMi 2.4 4.2 +
Table 3. Phylogenetic affiliation of sequences from low pH enrichment clones, based on EZBioCloud

database.
Accession Top-hit strain; accession no.; % Phylogenetic assignment

Clone
no. similarity (EzBioCloud) Class, family, genus
AL1ac_a1 MK450144
B9-3ac_a8 MK450147 Peptoccocaceae bacterium CL4 Bacteria, Firmicutes, Clostridia,
LMa2ac_a17 MK450146 (“Desulfobacillus acidavidus”); Clostridiales, Peptoccocaceae,
B9-2ac_a2 MK450143 EF061086; 98% Desulfitobacterium
LMiac_a12 MK450145
B9-2ac_b3 MK450148 T
Alicyclobacillus tolerans strain K1 ; Bacteria, Firmicutes, Bacilli, Bacillales,
B9-3ac_b10 MK450149
AF137502; 99.4% Alicyclobacillaceae, Alicyclobacillus
LMiac_b5 MK450150
T
LMiac_c14 MK450151 Sulfobacillus thermotolerans strain Kr1 ; Bacteria, Firmicutes, Clostridia,
B9-3ac_c11 MK450152 DQ124681; 98.1% Clostridiales, Family XVII, Sulfobacillus
Acidithiobacillus (At.) ferriphilus strain
T
M20 ; KR905751; 99%
T
AL1ac_d6 MK450153 At. ferridurans strain ATCC 33020 ;
AJ278719; 98.9% Bacteria, Proteobacteria,
Gammaproteobacteria, Acidithiobacillales,
T
At. ferridurans strain ATCC 33020 ; Acidithiobacillaceae, Acidithiobacillus
KR905751; 99.9%
LMa2ac_e4 MK450154 T
At. ferriphilus strain M20 ; AJ278719;
99.1%
AL1ac_f9 MK450155 T Bacteria; Thermotogae; Thermotogae_c;
Athalassotoga saccharophila NAS-01 ;
MK450156 Mesoaciditogales; Mesoaciditogaceae;
LMa2ac_f16 AB898788; 94.9%
Athalassotoga
(T)
Type strain

Willis Et Al., 2019

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Willis Et Al., 2019

Uploaded by

Copyright:

Available Formats

Enrichment and isolation of acid-tolerant sulfate-reducing microorganisms in the anoxic,

acidic hot spring sediments from Copahue volcano, Argentina

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

Johnson David Barrie (5)

Resource Geochemistry, Stilleweg 2, 30655 Hannover, Germany. (4) PROBIEN (CONICET-UNCo),

LL57 2UW, UK.

Keywords: acidophilic/acid-tolerant SRB, extremophiles, biosulfidogenesis, microbial sulfur cycle,

volcanic environments, Copahue-Caviahue.

their characterization by 16S rRNA gene sequencing.

Running Title: Acidophilic sulfate-reducing bacteria at Copahue volcano

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

biotechnological processes. In this work, sulfate-reducing microorganisms were investigated in geothermal

the genera Acidithiobacillus, Sulfobacillus, Alicyclobacillus and Athalassotoga/Mesoaciditoga. These

sediments from the geothermal Copahue-Caviahue system.

simple organic carbon source (Johnson, 2012):

(eq.1, at neutral/moderately alkaline pH)

(eq. 2, at low pH)

insoluble sulfide phases (equation 3).

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

environments (Rabus et al., 2015).

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

isolate, described as Thermodesulfobium narugenseT, was found to be an autotroph with an optimum

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

(Hirayama et al., 2005) among others.

oxidizing microorganisms (e.g. Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans) due to their

the geothermal ponds have extremely low pH values.

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

Materials and Methods

Site description and sampling

al., 2010; Chiodini et al., 2015).

microorganisms were also used as indicators of SRB activity.

sulfate consumption and acetate production.

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

membranes. Sulfate was determined by turbidimetry using a Beckman DU 640 spectrophotometer

atomic absorption spectrophotometer (Shimadzu AA-6650, Shimadzu Corporation, Kyoto, Japan).

GCTGCCTCCCGTAGGAGT 3‟, Amann et al., 1990) and Archaea domain (5‟

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

16S gene analysis

(5 ‟GGGCGGWGTGTACAAGGC 3‟) and archaeal primers A-21F (5‟ TTCCGGTTGATCCYGCCGGA 3‟)

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

Characteristics and physicochemical analysis of Copahue hot springs

1:1.75, which correlates with the results shown in Table 2.

cultures showed similar hybridisation efficiency.

Phylogenetic identification of clones from Copahue sulfidogenic enrichment cultures

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

respectively) (Bogdanova et al., 2006; Karavaiko et al., 2005).

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

presence of a novel genus in our samples.

Isolation and phylogenetic identification of sulfidogenic bacteria

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

adversely affected nor inhibited by the initial low pH.

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

acididuransT is an incomplete oxidizer of glycerol, condition not desirable in a bioremediation context as

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

implementing a MES where operational costs of neutralization steps will be avoided.

Moderately thermophilic, chemolitho-autotrophic and acidophilic/acid-tolerant SRMs of the genera

Downloaded from https://academic.oup.com/femsec/advance-article-abstract/doi/10.1093/femsec/fiz175/5610214 by Goteborgs Universitet user on 02 November 2019

thermophilic archaea (Urbieta et al., 2014).

more insights in the field of SRPs thriving this type of environments.

accession numbers: MK450143-MK450156 and MN453463-MN453469 (Supplementary Material).

Consejo Nacional de Investigación Científica y Técnica (CONICET), Argentinian Government.

their contribution in processing the images.