Molecular and Cellular Probes 28 (2014) 288e295

Contents lists available at ScienceDirect

Molecular and Cellular Probes

journal homepage: www.elsevier.com/locate/ymcpr

Development of real-time PCR assays for specific detection of hmsH,

hmsF, hmsR, and irp2 located within the 102-kb pgm locus of Yersinia
pestis
Charla E. Gaddy a, Pedro F. Cuevas a, Laurie J. Hartman a, c, Gerald B. Howe a,
Patricia L. Worsham b, Timothy D. Minogue a, *
a
Diagnostic Systems Division, US Army Medical Research Institute of Infectious Diseases, Fort Detrick, MD, USA
b
Bacteriology Division, US Army Medical Research Institute of Infectious Diseases, Fort Detrick, MD, USA
c
ClinicalRM, Inc., Hinckley, OH, USA

a r t i c l e i n f o a b s t r a c t

Article history: Virulent isolates of three pathogenic Yersinia species (Yersinia pestis, Yersinia pseudotuberculosis, and
Received 10 March 2014 Yersinia enterocolitica) harbor a 102-kb chromosomal region which encodes elements critical for viru-
Accepted 27 August 2014 lence. A 35-kb high pathogenicity island is contained in this region, is a known virulence determinant,
Available online 26 September 2014
contains irp1 and irp2 iron-regulating genes. An additional segment, the 68-kb high pathogenicity island,
contains genetic elements responsible for conferring the Y. pestis pigmentation phenotype on Congo red
Keywords:
agar at 28
C. Collectively, these contiguous segments are referred to as the pigmentation (pgm) locus, the
Yersinia pestis
absence of which results in strain attenuation and exemption from CDC Select Agent status. In this study,
Real-time PCR
CDC select agents
we developed a set of four real-time PCR assays to detect the presence or absence of multiple virulence
pgm locus genes located within this region. Specifically, we designed TaqMan® PCR assays to individually detect
High pathogenicity island (HPI) three hemin storage genes (hmsH, hmsF, and hmsR) which are genetic elements that confer the
pigmentation phenotype, as well as the iron-regulating status of 25 Y. pestis isolates (representing 23
different strains), thus establishing a molecular based assay capable of determining the pgm status of
candidate Y. pestis isolates. Included in the validation process, was a comparison of these real-time PCR
assays and newly developed conventional PCR assays targeting much larger areas of the 102-kb region
(including one assay spanning hmsR and hmsF, one spanning hmsH and hsmF, one targeting hmsF, and one
targeting irp2). There was high concordance between the conventional and real-time PCR assays for all
Y. pestis strains tested. The results from the comparative analysis document the specificity and sensitivity
of the real-time PCR assays and further solidify the ostensible benefits of real-time PCR over conventional
PCR.
Published by Elsevier Ltd.

1. Introduction rabbits, chipmunks, cats, etc.), inhalation of aerosolized droplets, or

Yersiniae are members of the Enterobacteriaceae family, a group
of Gram negative bacilli capable of causing varying degrees of
morbidity and mortality. There are currently 11 identified Yersinia
species, three of which (Yersinia pestis, Yersinia pseudotuberculosis,
and Yersinia enterocolitica) are known to cause human disease.
Y. pestis is the causative agent of bubonic, pneumonic, and septi-
cemic plague and is transmitted to humans and animals via bites
from flea reservoirs, infected rodents, and other small animals (ex.
* Corresponding author. USAMRIID, DSD, 1425 Porter Street, Fort Detrick, MD
21702, USA. Tel.: þ1 301 619 6352; fax: þ1 301 619 2492.
E-mail address: timothy.d.minogue.civ@mail.mil (T.D. Minogue).
by direct contact [1,2]. Naturally occurring transmission of Y. pestis
has been responsible for three pandemics resulting in millions of
deaths worldwide [3,4]. While the last pandemic began in excess of
150 years ago, animal to human transmission continues to pose a
significant health risk to individuals. This is especially true for those
located within plague endemic areas, such as those in sub-Saharan
Africa and Asia [5e7].
Accidental inoculation of Y. pestis resulting in laboratory-
acquired infections (LAIs) has been documented in both clinical
and research settings [8e10]. In the clinical laboratory, adherence
to conventional microbiological procedures for Biosafety Level 2
(BSL-2) environments minimizes the risk of transmission of most
infectious agents to laboratory personnel to include Y. pestis.

http://dx.doi.org/10.1016/j.mcp.2014.08.004
0890-8508/Published by Elsevier Ltd.
 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295
However, due to high aerosol transmissibility and low infectious
dose required for inhalation exposure (100e500 organisms), the
probability of LAIs increases dramatically when manipulating
Y. pestis even under these conditions [11]. To mitigate this hazard,
the Centers for Disease Control and Prevention (CDC) recommend
BSL-3 containment and safety precautions for Y. pestis work [12].
Y. pestis is a Health and Human Services (HHS) and CDC Select
Agent. As such, it is subject to the rules and regulations of the CDC
Select Agent Program restricting agent possession, use, and transfer
[13]. Two exceptions are noted: attenuated Y. pestis strains that do
not contain the 102-kb chromosomal segment referred to as the
pgm locus or those that lack the low calcium response (Lcr) viru-
lence plasmid [14]. Y. pestis strains meeting these criteria are not
considered select agents. CDC Select Agent Exclusion Rules and
Regulations dictate the use of PCR and/or Southern blot analysis to
demonstrate the absence of the pgm locus or the Lcr virulence
plasmid when determining the exempt status of any given Y. pestis
strain.
The Y. pestis pgm locus is a 102-kb chromosomal DNA segment
responsible for its pigmented phenotype when grown on Congo red
agar (CRA) at 28
C [15]. Deletion of the pgm locus results in loss of
the pigmentation phenotype, strain attenuation, and loss of the
ability of the Y. pestis to cause disease via peripheral routes of
infection in the absence of extraneously injected iron [15e18]. The
pgm locus consists of two proximal regions: a ~68-kb region
referred to as the ‘pigmentation segment’ and a ~35-kb high
pathogenicity island (HPI). The pigmentation segment contains the
hemin storage (hms) locus. This encompasses the hmsHFRS operon
which contains genes that encode hmsH, hmsF, hmsR, and hmsS
proteins, all of which facilitate hemin storage in vivo and the
binding of Congo red in vitro resulting in the pigmented phenotype
[15,19e24]. The HPI is proximal to the pigmentation segment and
contains genetic elements, such as the yersiniabactin (Ybt) locus,
psn, irp1, and irp2, all of which transcribe products that facilitate
siderophore-dependent iron acquisition and sequestration, a pro-
cess critical for Y. pestis virulence [15,16,21,23,25e30]. Genetic
Fig. 1. Genetic organization of the Y. pestis 102-kb pgm locus. A. Schematic representation displaying major genes located within the 102-kb pgm locus including hmsH, hmsF, hmsR,
and irp2. B. Schematic representation displaying location of nucleic acid sequence targeted by conventional and real-time PCR primers. Dark gray bars located above the targeted
genes represent real-time PCR amplification products. Light gray bars located below the targeted genes represent conventional PCR amplification products. RT, real-time PCR; Con,
conventional PCR.
289
elements located within the HPI encode proteins, including YbtE,
YbtS, YbtT, YbtU, HMWP1, and HMWP2, which are required for
yersiniabactin biosynthesis, the siderophore required for iron
acquisition in virulent Y. pestis infections [25,31e35]. HMWP1 and
HMWP2 are transcribed from irp1 and irp2, respectively, and both
proteins are required for mouse virulence by most routes of
infection [36e38].
Spontaneous deletion of the pgm locus en bloc or various sized
deletions within both the pigmentation segment and the HPI has
been previously described in Y. pestis mutants [16]. The finding of
segmental deletion of some pgm-associated sequences facilitates
the need to target multiple sites within this locus to confirm the
presence or absence of the pgm locus in its entirety.
In accordance with CDC rules and regulations that dictate the
entirety of the pgm locus be absent for exemption, we previously
adopted and used a set of conventional PCR assays developed by
Jenkins et al. as an integral part of our strategy to determine the
pgm status of Y. pestis isolates in our laboratory [39]. However,
because of the issues inherent to the use of conventional PCR (i.e.
post-PCR analysis, low band resolution, and gel-to-gel variability),
we sought to develop real-time PCR assays that indicated the full
pgm status of Y. pestis isolates. Here, we report the development
and optimization of 4 real-time TaqMan® PCR assays that target
hmsH, hmsF, and hmsR, located within the pigmentation segment,
and irp2, located within the HPI (Fig. 1). The collective presence or
absence of these targets allows for rapid determination of the pgm
status of candidate Y. pestis isolates with high confidence.
2. Materials and methods
2.1. Sample acquisition and nucleic acid preparation
All Yersinia isolates were obtained from the Critical Reagents
Program (Frederick, MD) or the Unified Culture Collection (UCC)
maintained at the United States Army Medical Research Institute of
Infectious Diseases (USAMRIID, Ft. Detrick, MD). All isolates were
290 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295
subsequently sub-cultured on Sheep Blood Agar plates (Remel,
Lenexa, KS) at 28
C for 24 h. Following incubation, nucleic acid
preparations were made by either diluting isolated colonies in PBS
and boiling at 95e100
C for 5 min followed by dilution in
TriseEDTA (TE) buffer (1:100) or by extraction and purification
using QIAamp® DNA Mini Kit or the BioRobot EZ1System (Qiagen,
Valencia, CA). Nucleic acid quantification was performed using the
Nanodrop Spectrophotometer (Thermo Scientific, Wilmington, DE),
and the samples were further diluted with TE to the desired con-
centration prior to use. Culture and extraction of all virulent strains
of Y. pestis were performed under Biosafety Level 3 (BSL-3) condi-
tions. USAMRIID DNA panels containing nucleic acids from various
non-Yersinia microorganisms were used to test real-time PCR cross-
reactivity. Purified nucleic acids were diluted in TE to appropriate
working concentrations.
2.2. Conventional PCR assays
For these experiments we developed conventional PCR assays
targeting four genes (hmsR, hmsF, hmsH, and irp2) located within
the 102-kb pgm locus. The Y. pestis 102-kb region (GenBank
Accession AL031866) and GeneScript bioinformatics tools (www.
genescript.com) were used for primer design. Specificity of
designed primers was verified in silico against the GenBank
database using BLAST (http://blast.ncbi.nlm.nih.gov/). Those with
a high degree of specificity were selected for further evaluation
and purchased from Life Technologies (Grand Island, NY). PCR
assays were performed using 10X PCR buffer with 10 mM MgCl2,
10X dNTPS (BioFire Diagnostics, Salt Lake City, UT), 0.8 U of
Platinum Taq® DNA Polymerase (Life Technologies),0.5 mM for-
ward and reverse primers, and 1 pg template DNA [Y. pestis CO92
(pgmþ)] per reaction. Amplification was carried out on the Bio-
Rad MJ-Mini Thermo Cycler (Life Science Research, Hercules,
CA) using the following thermocycling conditions in a 50 ml re-
action volume: 94
C for 2 min; 30 cycles of 94
C for 1 min, 50
C
for 2 min, 72
C for 1 min; and 72
C for 2 min. These thermal
cycling conditions were used for all subsequent tests using
conventional PCR assays.
Target specificity was determined by agarose gel based anal-
ysis. Generated amplicons were subjected to gel electrophoresis
(2% w/v agarose) followed by ethidium bromide gel staining and
visualization using the Alpha Innotech Imager Gel Documenta-
tion System (Protein Simple, Santa Clara, California). Primer sets
yielding the highest amount of specific amplification product in
the absence of non-specific extraneous products were down-
selected for follow-on experiments. Appropriately sized bands
were excised and purified using the Qiaquick Gel Extraction Kit
(Qiagen). Purified fragments were subjected to Sanger
sequencing for target specificity confirmation. Sequence and
other information about the down-selected primers can be found
in Table 1.
Table 1
Data for conventional and real-time PCR primers and probes.
Assay type Gene target Forward primer (50 e30 )
Conventional PCR hmsF CCACGGTCTTTCACTTTGCG
hmsR CAACACAACCCACGGGG
hmsH GGAAGTAAACCTGGCGAATG
irp2 CACTGCGCGTCGTTCAG
Real-time PCR hmsF AATGCGCGGTATATTCATCA
hmsR CAATCAATGTCGAACGGGTA
hmsH CTGATGACGGACCAATAACG
irp2 AGCAATGCGCAATACTGTTC
a
All real-time probes are labeled with 6-carboxyfluorescein (FAM) at the 50 terminus 6-carboxy-N,N,N0 ,N0 -tetramethyrhodamine (TAMRA)at the 30 terminus.
2.3. Real-time PCR assays
Initial real-time PCR primers and probes were designed and
selected as described above.
Empirical evaluation to down-select final primer/probe sets was
performed using Platinum® Taq DNA Polymerase technology on the
R.A.P.I.D.® System (Idaho Technology, Salt Lake City, UT) or the
LightCycler® 2.0 (Roche Applied Science, Indianapolis, ID) using the
following cycling conditions in a 20 ml reaction volume: 95
C for
2 min; 45 cycles of 95
C for 1 s and 60
C for 20 s; and 40
C for 30 s.
These thermal cycling conditions were used for all subsequent real-
time PCR assays. Primer pairs down-selected for use in follow-up
experiments were those with the highest efficiency of amplifica-
tion [i.e. lowest quantification cycle (Cq) value], highest endpoint
fluorescence, and yielded the highest amount of specific amplifi-
cation product in the absence of non-specific, extraneous products
as determined by gel based analysis as described above.
Probe concentrations were determined by diluting probes so
that fluorescence background was 10e30 fluorescent units. MgCl2
and primer concentrations were then optimized sequentially.
MgCl2 was optimized in 1 mM increments from 3 mM to 7 mM.
Down-selected primers were optimized in 0.1 mM increments from
0.5 mM to 1.0 mM. The combinations that exhibited the earliest Cq
values and generated the highest endpoint fluorescence were
chosen as the optimal conditions for each assay. Final optimized
assay conditions are as follows: hmsF (primers e 0.7 mM each, probe
e 0.1 mM, MgCl2 e 5 mM), hmsH (primers e 0.6 mM each, probe e
0.1 mM, MgCl2 e 4 mM), hmsR (primers e 0.6 mM each, probe e
0.1 mM, MgCl2 e 4 mM), and irp2 (primers e 1.0 mM each, probe e
1.0 mM, MgCl2 e 0.15 mM). Sequence and other information for
down-selected primers and probes can be found in Table 1.
2.4. Real-time PCR sensitivity and specificity
Assay linearity was determined by standard curve analysis using
total DNA extracted from Y. pestis Antigua (GenBank accession
number CP000308) [40]. Ten-fold and two-fold dilutions of
genomic DNA from 100 pg down to 1 fg concentrations were pre-
pared and run in triplicate. The LightCycler® Data Analysis (LCDA)
software version 3.5.3 was used to generate standard curves based
on the resulting Cq values. Linearity was determined by calculating
the efficacy and efficiency of the assays based on the slope of the
standard curve. Preliminary limit of detection (LOD) was deter-
mined as the lowest dilution by which a product was detected with
the standard curve (3/3 replicates). To confirm LOD, two separate
PCR runs consisting of 30 replicates for each primer/probe set were
run using two different real-time PCR thermal cycler instruments,
by two different operators. LOD confirmation was determined as a
minimum of 58/60 positive reactions (Greater than 95% confidence
that there will be a 90% success rate of the assay at that LOD) for
each assay at the specified concentrations. Inclusivity was deter-
mined at assay LOD. Exclusivity was determined using 100 pg of
Reverse primer (50 e30 ) Probe (50 e30 )a Size (bp)
GAGTTACTGACTGATGATG 1103
CCGCCCTGTGCTGTCTTC 870
GCAAAGTGAAAGACCGTG 940
GATCTCCGCAGAACAGG 315
CCAGCATGGTTATCAACTCG CATGACCCTAGATCCTGGTGTGGC 78
TATCGATGGTGATGCCTTGT TACCGGTCACCGCGCCAGTA 124
GAATTTATTGACCCGTTGGG TACCAACGCGCACGCATTGA 96
ACTGCGCTTTAACTGGGATT ACCTGCCCGGCAGGAAACAG 83
 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295
genomic DNA or 5 ml of boiled nucleic acid preparations obtained
from various microorganisms.
3. Results
3.1. Real-time PCR assay linearity and LOD
Primer pairs, probes, and assay conditions were determined and
optimized as described in the Methods. Evaluation of linearity and
LOD determination are essential components of analytical method
validation. Linearity is defined as ability of an assay to detect target
analytes proportional to its concentration in a sample and is a key
parameter in determining the test accuracy. The linearity of each
real-time PCR assay was assessed to determine the amplification
efficacy and efficiency of each real-time primer/probe set. Quanti-
tative standard curve analysis resulted in functional linearity for all
four real-time PCR assays with each down-selected real-time
primer/probe set demonstrating acceptable linearity (across the
concentration range tested (Fig. 2). LOD is defined as the lowest
amount of target detectable in a given sample within an acceptable
confidence limit. Based on the dilution set used, these experiments
resulted in a preliminary LOD of 100 fg for each of the four real-time
PCR primer/probe sets. Subsequent analysis confirmed the LOD for
all assays as 100 fg, equivalent to 20 Y. pestis Antigua genome copies
per reaction. Average Cq values for hmsH, hmsF, hmsR, and irp2
derived from LOD confirmation analyses were 34.24 (SD ± 0.62),
33.40 (SD ± 0.57), 34.72 (SD ± 0.75), and 37.65 (SD ± 1.25),
respectively.
3.2. Inclusivity for real-time PCR assays
Inclusivity, defined as the ability of an assay to detect targeted
strains of the specified organism, is a critical parameter for evalu-
ating assay utility. Inclusivity was evaluated using genomic DNA
extracted from 16 different Y. pestis strains containing the full pgm
locus (pgmþ) to include a pgm þ KIM5 strain derived from
pgm þ KIM6 [41]. Pgm status of assayed Y. pestis isolates was
originally determined via multiple means including: observation of
colony pigmentation on Congo red agar, Southern blot analysis,
Fig. 2. Standard curve analysis for hsmH, hmsF, hmsR, and irp2 real-time PCR assays. Total DNA was extracted from Y. pestis Antigua and serially diluted to 100 pg, 50 pg, 10 pg, 5 pg,
1 pg, 500 fg, and 100 fg. Each sample was run in triplicate using the four real-time PCR primer/probe sets. Cq values for replicates were averaged, and standard curves and R-values
were generated using Microsoft Excel 2010.
291
nucleotide sequencing, and/or detection of multiple pgm targets
using conventional PCR assays previously established by Jenkins
et al. [39]. Given the non-pigmented phenotype is not exclusive to
en bloc deletion of the entire 102-kb pgm locus nor absence of the
entire 68-kb segment, observation of non-pigmented colonies on
Congo red agar was not used exclusively to classify any Y. pestis
isolate as pgm-prior to these experiments [16]. All four primer/
probe sets yielded positive results for all pgm þ Y. pestis strains
assayed (Table 2).
To compare the performance of our real-time PCR assays to
conventional PCR, we determined the presence of hmsF, hmsR,
hmsH, and irp2 using four newly designed conventional PCR assay
primer sets. We found near 100% concordance [hmsH (25/25), hmsF
(24/25), hmsR (25/25), irp2 (25/25)] between the real-time PCR and
conventional PCR assays for all pgm þ Y. pestis strains assayed
(Table 2). These data confirm the previously determined pgm status
in candidate Y. pestis isolates using non-PCR technologies and es-
tablishes the validity of our newly developed real-time PCR assays
to detect the presence of the intact pgm locus.
3.3. Specificity of real-time PCR assays
Exclusivity, defined as the lack of cross-reactivity with near
neighbors, closely related strains, or potential environmental co-
habitants, is also a critical parameter for evaluating assay utility.
In these experiments, we used genomic DNA extracted from nine
different Y. pestis strains previously characterized as lacking the
entire pgm locus (pgm). Included in these tests was an attenu-
ated pgm- Y. pestis CO92 mutant derived from the Y. pestis
pgm þ wild type strain [42]. Exclusivity tests with our newly
developed real-time PCR assays confirmed the lack of the pgm
locus in all strains tested (Table 2). A comparison of the real-time
and conventional PCR assays resulted in several (8/9) discrep-
ancies. The discordant results were systemic, only found when
assaying for hmsR, and appeared to be false positives generated
when using the conventional PCR assay. Given that individually all
real-time PCR assays were in agreement with one another and in
agreement with three of the four conventional PCR assay results,
these data establish the validity of our real-time PCR assays to
292 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295

Table 2
Comparative results for conventional and real-time PCR assays for Yersinia pestis strains.

UCC ID Strain Expected pgm status hmsH hmsF hmsR irp2 Determined pgm statusc

Conv RT Conv RT Conv RT Conv RT

Inclusivity YERS080 Angola þ þ þ þ þ þ þ þ þ þ

YERS016 Antigua þ þ þ þ þ þ þ þ þ þ
YERS023 CO92 þ þ þ þ þ þ þ þ þ þ
YERS073 Dodson þ þ þ þ þ þ þ þ þ þ
YERS100 El Dorado þ þ þ  þ þ þ þ þ þ
YERS022 Java 9 þ þ þ þ þ þ þ þ þ þ
YERS082a KIM5(pDC1Ap)þ þ þ þ þ þ þ þ þ þ þ
YERS061 KIM10v þ þ þ þ þ þ þ þ þ þ
YERS018 PBM19 þ þ þ þ þ þ þ þ þ þ
YERS019 Pestoides B þ þ þ þ þ þ þ þ þ þ
YERS020 Pestoides F þ þ þ þ þ þ þ þ þ þ
YERS079 Pestoides G þ þ þ þ þ þ þ þ þ þ
YERS075 SAKA þ þ þ þ þ þ þ þ þ þ
YERS074 Shasta þ þ þ þ þ þ þ þ þ þ
YERS077 752296 þ þ þ þ þ þ þ þ þ þ
YERS076 753382 þ þ þ þ þ þ þ þ þ þ
Exclusivity YERS078 A1122  ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS071 Cadman ¡ ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS059b CO92 (pgm) ¡  ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS081 EV76D ¡ ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS021 Harbin35  ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS052 KIM5 ¡ ¡ ¡ ¡ ¡ þ   ¡ ¡
YERS017 Nairobi ¡ ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡
YERS083 Nicholisk 41 ¡ ¡ ¡ ¡  ¡ ¡ ¡ ¡ ¡
YERS072 762955 ¡ ¡ ¡ ¡ ¡ þ  ¡ ¡ ¡

Highlighted cells indicate discordant results between conventional and real-time PCR results.
UCC, Unified Culture Collection; Conv, conventional PCR; RT, real-time PCR; þ, detection; ¡, non-detection.
a
pgm þ Y. pestis KIM5 mutant generated from pgm þ Y. pestis KIM6.
b
pgm - Y. pestis CO92 mutant that lacks the entire pgm locus.
c
pgm status determined using real-time PCR results only.

signify the absence of the pgm locus in its entirety in candidate
Y. pestis isolates.
In addition to pgm- Y. pestis strains, we also incorporated into
our exclusivity testing a number of near neighbor Yersinia species
including multiple strains of Y. pseudotuberculosis, Yersinia aldovae,
Y. enterocolitica, Yersinia frederiksenii, Yersinia kristensenii, Yersinia
intermedia, Yersinia rohdei, and Yersinia ruckeri (strains identifica-
tion can be found in Supplementary Table 1). Previous studies
established the presence of elements associated with the pgm locus
in multiple pathogenic Yersinia species as well as other pathogenic
Enterobacteriaceae [16,43e46]. As such, we expected to find the
presence of pgm genetic elements in some of these isolates.
Accordingly, 26 of the 39 near neighbor isolates tested yielded
positive results for the presence of one or more of the four pgm
locus targets assayed when using our real-time PCR assays
(Table 3). The intact pgm locus was demonstrated in 12 of the 39
isolates assayed. In contrast to the determined pgm status of
assayed Y. pestis strains, these analyses revealed the partial pres-
ence of the pgm locus (i.e. one to three positive targets) in 14 of 39
isolates assayed. Comparative analysis between real-time and
conventional PCR assays resulted in a high degree of discordance,
especially for the hmsH and hmsF gene targets for Y. enterocolitica
(Table 3). For the majority of the discordant results (26 of 30),
conventional PCR resulted in positive detection while the real-time
PCR assays resulted in no detection (Table 4).
Lastly, each real-time PCR and conventional PCR assay was
tested for cross-reactivity against a wide range of non-Yersinia to
include: additional threat organisms, nearest genetic neighbors to
threat organisms, organisms sharing an environmental niche with
a threat organism and thus likely to be found in environmental
samples, organisms sharing a clinical niche with a threat organism
(particularly respiratory pathogens, opportunists, and typical res-
piratory flora), and organisms observed repeatedly in clinical and
environmental samples. No cross-reactivity was noted across all

Table 3
Comparative results for conventional and real-time PCR assays for Yesinia pestis near neighbors.

Organism (n) hmsH hmsF hmsR irp2

Agree Disagree Agree Disagree Agree Disagree Agree Disagree

Y. aldovae (1) 0 1
Y. enterocolitica (8) 1 7
Y. frederiksenii (5) 5 0
Y. intermedia (1) 0 1
Y. kristensenii (3) 2 1
Y. pseudotuberculosis (18) 1 17
Y. rohdei (1) 1 0
Y. ruckeri (2) 1 1
Total (39) 11 28
0 1 1 0 0 1
3 5 8 0 8 0
5 0 4 1 4 1
1 0 1 0 1 0
3 0 2 1 3 0
16 2 15 3 18 0
1 0 1 0 1 0
1 1 2 0 2 0
30 9 34 5 37 2

(n) represents the number of strains assayed for each species. ‘Agree’ denotes the number of strains within that species where both conventional and real-time PCR assays
were in agreement. ‘Disagree’ denotes the number of strains within that species where the conventional and real-time PCR assays for a particular target did not agree.
 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295 293

Table 4
Conventional and real-time PCR assay results for Yersinia pestis near neighbors.

UCC ID Organism hmsH hmsF hmsR irp2 Determined pgm statusa

Conv RT Conv RT Conv RT Conv RT

YERS098 Yersinia aldovae þ  þ    þ  

YERS093 Yersinia enterocolitica þ þ þ þ þ þ þ þ þ
YERS001 Yersinia enterocolitica þ  þ    þ þ partial
YERS004 Yersinia enterocolitica þ  þ    þ þ partial
YERS015 Yersinia enterocolitica þ  þ    þ þ partial
YERS039 Yersinia enterocolitica þ  þ    þ þ partial
YERS094 Yersinia enterocolitica þ  þ    þ þ partial
YERS014 Yersinia enterocolitica þ        
YERS095 Yersinia enterocolitica þ        
YERS005 Yersinia frederiksenii       þ  
YERS027 Yersinia frederiksenii         
YERS028 Yersinia frederiksenii         
YERS029 Yersinia frederiksenii         
YERS097 Yersinia frederiksenii þ    þ    
YERS099 Yersinia intermedia þ        
YERS096 Yersinia kristensenii þ þ þ þ þ þ þ þ þ
YERS002 Yersinia kristensenii þ    þ    
YERS006 Yersinia kristensenii þ        
YERS009 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS033 Yersinia pseudotuberculosis þ þ þ þ  þ þ þ þ
YERS035 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS036 Yersinia pseudotuberculosis þ þ þ þ  þ þ þ þ
YERS085 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS086 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS088 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS089 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS091 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS092 Yersinia pseudotuberculosis þ þ þ þ þ þ þ þ þ
YERS007 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS031 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS032 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS034 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS038 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS087 Yersinia pseudotuberculosis þ þ  þ  þ   partial
YERS090 Yersinia pseudotuberculosis þ þ þ þ þ þ   partial
YERS030 Yersinia pseudotuberculosis þ  þ      
YERS062 Yersinia rohdei         
YERS012 Yersinia ruckeri         
YERS013 Yersinia ruckeri þ  þ      

UCC, Unified Culture Collection; þ, detected; , not detected; Conv, conventional PCR; RT, real-time PCR. Highlighted cells show disconcordant results.
a
Determined pgm status determined using real-time PCR results only.

nucleic acids tested using real-time or conventional PCR assays. A
full list of microorganism DNAs included in the cross-reactivity
analysis can be found in Supplementary Table 2.
4. Discussion
CDC regulations dictate confirmation of the pgm status using
PCR or Southern blot analysis to determine the Select Agent
exemption status of candidate Y. pestis isolates. The aim of this
study was to develop assays that can be collectively used for this
purpose. To that end, we report the development and validation of
four novel real-time PCR assays designed to detect multiple gene
targets located throughout the span of the pgm locus of Y. pestis.
Given the potential for various single-nucleotide polymorphisms
(SNPs) and partial deletions in some pgm þ strains, the inclusion
of multiple assays targeting regions located in both the pigmen-
tation and HPI segments of the pgm locus ensured maximum
confidence in our determination [16,47,48]. For these experiments,
we equate the detection of: (1) all four targets (hmsH, hmsF, hmsR,
and irp2) to the presence of an intact pgm locus (pgmþ), (2) non-
detection of all assayed targets to complete deletion of the pgm
locus (pgm), and (3) detection of less than four targets to the
partial presence of the pgm locus. Using these criteria, we
confirmed the presence of the intact pgm locus in all our
previously established pgm þ strains using the real-time PCR
primers/probe sets.
We found that the HPI segment was 100% associated with the
presence of the pigmentation segment in all isolates assayed. These
findings are consistent with en bloc deletion of the pgm locus, as
previously demonstrated in multiple studies [16,47,49]. This col-
lective presence or absence of both segments was not found in the
other Yersinia species assayed, where in contrast, the presence of
one segment in the absence of the other was high. This was
particularly seen to be systematic for Y. pseudotuberculosis and
Y. enterocolitica, a finding that is consistent with studies demon-
strating the deletion of the HPI segment without the concurrent
deletion of the pigmentation segment [16,17,47]. These findings
solidify the need for inclusion of multiple targets spanning across
the entire pgm locus to determine the pgm status of candidate
Y. pestis isolates.
A high incidence of discordance was noted when targeting hmsR
in pgm- Y. pestis strains. Of the nine strains assayed, discordant
results were seen in eight. In these instances, the conventional PCR
assay resulted in a positive call while the real-time PCR result
indicated its absence. In addition, a discordant result was noted
when assaying for hmsF in pgm þ Y. pestis (YERS100). Given (1) the
previously confirmed pgm status of these isolates using other mo-
lecular methods and (2) the otherwise complete concordance
294 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295
between conventional and real-time PCR assays for additional pgm
targets assayed, we surmise the conventional PCR results in these
instances are erroneous. We speculate the false positive results are
due to non-specific binding or mispriming of conventional primer
pairs resulting in amplicons with sizes similar to the correctly
amplified product, or, in the case of false negatives, a result of non-
binding or decreased primer binding due to nucleotide differences
in primers and target sequence at or near the 30 end.
In conclusion, our data indicate the use of these real-time PCR
assays is applicable for rapid and accurate determination of the
CDC Select Agent status of candidate Y. pestis strains based on the
presence or absence of multiple genomic targets located in the
Y. pestis 102-kb pgm locus. In addition, these assays could be used
to characterize nominally exempt Y. pestis strains before usage
outside of BSL-3 containment as well as to rapidly identify spon-
taneous deletion of the Y. pestis pgm locus in subcultured isolates
previously characterized as pgmþ. Lastly, in conjunction with
other molecular methods such as sequencing, these assays could
be used with culture collections to further characterize various
Yersinia isolates.
Acknowledgments
This work was supported with funds from Defense Threat
Reduction Agency (#CB3641) JSTO-CBD project
CBM.DIAG.02.10.RD.004. The opinions, interpretations, conclusions,
and recommendations are those of the authors and are not neces-
sarily endorsed by the U.S. Army.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.mcp.2014.08.004.
References
[1] Craven RB, Maupin GO, Beard ML, Quan TJ, Barnes AM. Reported cases of
human plague infections in the United States, 1970e1991. J Med Entomol
1993;30(4):758e61.
[2] Butler T. Plague into the 21st century. Clin Infect Dis 2009;49(5):736e42.
[3] Perry RD, Fetherston JD. Yersinia pestis-etiologic agent of plague. Clin Micro-
biol Rev 1997;10(1):35e66.
[4] Achtman M, Zurth K, Morelli G, Torrea G, Guiyoule A, Carniel E. Yersinia pestis,
the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis.
Proc Natl Acad Sci U S A 1999;96(24):14043e8.
[5] Anisimov AP, Lindler LE, Pier GB. Intraspecific diversity of Yersinia pestis. Clin
Microbiol Rev 2004;17(2):434e64.
[6] Neerinckx S, Bertherat E, Leirs H. Human plague occurrences in Africa: an
overview from 1877 to 2008. Trans R Soc Trop Med Hyg 2010;104(2):97e103.
[7] World Health Organization. Human plague in 2002 and 2003. Wkly Epidemiol
Rec 2004:301e6.
[8] Burmeister RW, Tigertt WD, Overholt EL. Laboratory-acquired pneumonic
plague. Report of a case and review of previous cases. Ann Intern Med
1962;56:789e800.
[9] Centers for Disease Control and Prevention. Fatal laboratory-acquired infec-
tion with an attenuated Yersinia pestis StraineChicago, Illinois, 2009. MMWR
Morb Mortal Wkly Rep 2011;60(7):201e5.
[10] Pike RM. Laboratory-associated infections: summary and analysis of 3921
cases. Health Lab Sci 1976;13(2):105e14.
[11] Franz DR, Jahrling PB, Friedlander AM, McClain DJ, Hoover DL, Bryne WR, et al.
Clinical recognition and management of patients exposed to biological war-
fare agents. JAMA 1997;278(5):399e411.
[12] US Department of Health and Human Services. Biosafety in microbiological
and biomedical laboratories. 5th ed. 2009 Available at: http://www.cdc.gov/
biosafety/publications/bmbl5 [accessed 27.03.13].
[13] Centers for Disease Control and Prevention. Possession, use, and transfer of
select agents and toxins; biennial review; final rule. Fed Regist 2012.
[14] US Department of Health and Human Services. National Select Agent Registry:
select agents exclusions. US Department of Agriculture; 2010.
[15] Burrows TW, Jackson S. The virulence-enhancing effect of iron on non-
pigmented mutants of virulent strains of Pasteurella pestis. Br J Exp Pathol
1956;37(6):577e83.
[16] Buchrieser C, Prentice M, Carniel E. The 102-kilobase unstable region of Yer-
sinia pestis comprises a high-pathogenicity island linked to a pigmentation
segment which undergoes internal rearrangement. J Bacteriol 1998;180(9):
2321e9.
[17] Fetherston JD, Schuetze P, Perry RD. Loss of the pigmentation phenotype in
Yersinia pestis is due to the spontaneous deletion of 102 kb of chromosomal
DNA which is flanked by a repetitive element. Mol Microbiol 1992;6(18):
2693e704.
[18] Une T, Brubaker RR. In vivo comparison of avirulent Vwa- and Pgm- or Pstr
phenotypes of Yersiniae. Infect Immun 1984;43(3):895e900.
[19] Hinnebusch BJ, Perry RD, Schwan TG. Role of the Yersinia pestis hemin storage
(hms) locus in the transmission of plague by fleas. Science 1996;273(5273):
367e70.
[20] Lillard Jr JW, Fetherston JD, Pedersen L, Pendrak ML, Perry RD. Sequence and
genetic analysis of the hemin storage (hms) system of Yersinia pestis. Gene
1997;193(1):13e21.
[21] Pendrak ML, Perry RD. Characterization of a hemin-storage locus of Yersinia
pestis. Biol Met 1991;4(1):41e7.
[22] Pendrak ML, Perry RD. Proteins essential for expression of the hms+ pheno-
type of Yersinia pestis. Mol Microbiol 1993;8(5):857e64.
[23] Perry RD, Pendrak ML, Schuetze P. Identification and cloning of a hemin
storage locus involved in the pigmentation phenotype of Yersinia pestis. J
Bacteriol 1990;172(10):5929e37.
[24] Surgalla MJ, Beesley ED. Congo red-agar plating medium for detecting
pigmentation in Pasteurella pestis. Appl Microbiol 1969;18(5):834e7.
[25] Bearden SW, Fetherston JD, Perry RD. Genetic organization of the yersinia-
bactin biosynthetic region and construction of avirulent mutants in Yersinia
pestis. Infect Immun 1997;65(5):1659e68.
[26] Bearden SW, Perry RD. The yfe system of Yersinia pestis transports iron and
manganese and is required for full virulence of plague. Mol Microbiol
1999;32(2):403e14.
[27] Carniel E, Mazigh D, Mollaret HH. Expression of iron-regulated proteins in
Yersinia species and their relation to virulence. Infect Immun 1987;55(1):
277e80.
[28] Fetherston JD, Kirillina O, Bobrov AG, Paulley JT, Perry RD. The yersiniabactin
transport system is critical for the pathogenesis of bubonic and pneumonic
plague. Infect Immun 2010;78(5):2045e52.
[29] Fetherston JD, Lillard Jr JW, Perry RD. Analysis of the pesticin receptor from
Yersinia pestis: role in iron-deficient growth and possible regulation by its
siderophore. J Bacteriol 1995;177(7):1824e33.
[30] Perry RD, Fetherston JD. Yersiniabactin iron uptake: mechanisms and role in
Yersinia pestis pathogenesis. Microbes Infect 2011;13(10):808e17.
[31] Bobrov AG, Geoffroy VA, Perry RD. Yersiniabactin production requires the
thioesterase domain of HMWP2 and YbtD, a putative phosphopantetheinylate
transferase. Infect Immun 2002;70(8):4204e14.
[32] Gehring AM, DeMoll E, Fetherston JD, Mori I, Mayhew GF, Blattner FR, et al.
Iron acquisition in plague: modular logic in enzymatic biogenesis of yersi-
niabactin by Yersinia pestis. Chem Biol 1998;5(10):573e86.
[33] Gehring AM, Mori I, Perry RD, Walsh CT. The nonribosomal peptide synthetase
HMWP2 forms a thiazoline ring during biogenesis of yersiniabactin, an iron-
chelating virulence factor of Yersinia pestis. Biochemistry 1998;37(33):
11637e50.
[34] Geoffroy VA, Fetherston JD, Perry RD. Yersinia pestis YbtU and YbtT are
involved in synthesis of the siderophore yersiniabactin but have different
effects on regulation. Infect Immun 2000;68(8):4452e61.
[35] Perry RD, Balbo PB, Jones HA, Fetherston JD, DeMoll E. Yersiniabactin from
Yersinia pestis: biochemical characterization of the siderophore and its role in
iron transport and regulation. Microbiology 1999;145(Pt 5):1181e90.
[36] Carniel E, Guiyoule A, Guilvout I, Mercereau-Puijalon O. Molecular cloning,
iron-regulation and mutagenesis of the irp2 gene encoding HMWP2, a protein
specific for the highly pathogenic Yersinia. Mol Microbiol 1992;6(3):379e88.
[37] de Almeida AM, Guiyoule A, Guilvout I, Iteman I, Baranton G, Carniel E.
Chromosomal irp2 gene in Yersinia: distribution, expression, deletion and
impact on virulence. Microb Pathog 1993;14(1):9e21.
[38] Heesemann J, Hantke K, Vocke T, Saken E, Rakin A, Stojiljkovic I, et al. Viru-
lence of Yersinia enterocolitica is closely associated with siderophore pro-
duction, expression of an iron-repressible outer membrane polypeptide of
65,000 Da and pesticin sensitivity. Mol Microbiol 1993;8(2):397e408.
[39] Jenkins AL, Worsham PL, Welkos SL. A strategy to verify the absence of the
pgm locus in Yersinia pestis strain candidates for select agent exemption. J
Microbiol Methods 2009;77(3):316e9.
[40] Chain PS, Hu P, Malfatti SA, Radnedge L, Larimer F, Vergez LM, et al. Complete
genome sequence of Yersinia pestis strains Antiqua and Nepal516: evidence of
gene reduction in an emerging pathogen. J Bacteriol 2006;188(12):4453e63.
[41] Gong S, Bearden SW, Geoffroy VA, Fetherston JD, Perry RD. Characterization of
the Yersinia pestis Yfu ABC inorganic iron transport system. Infect Immun
2001;69(5):2829e37.
[42] Welkos S, Pitt ML, Martinez M, Friedlander A, Vogel P, Tammariello R.
Determination of the virulence of the pigmentation-deficient and pigmenta-
tion-/plasminogen activator-deficient strains of Yersinia pestis in non-human
primate and mouse models of pneumonic plague. Vaccine 2002;20(17e18):
2206e14.
[43] Bach S, de Almeida A, Carniel E. The Yersinia high-pathogenicity island is
present in different members of the family Enterobacteriaceae. FEMS Micro-
biol Lett 2000;183(2):289e94.
[44] Carniel E. The Yersinia high-pathogenicity island: an iron-uptake island. Mi-
crobes Infect 2001;3(7):561e9.
 C.E. Gaddy et al. / Molecular and Cellular Probes 28 (2014) 288e295
[45] Rakin A, Heesemann J. Virulence-associated fyuA/irp2 gene cluster of Yersinia
enterocolitica biotype 1B carries a novel insertion sequence IS1328. FEMS
Microbiol Lett 1995;129(2e3):287e92.
[46] Schubert S, Rakin A, Karch H, Carniel E, Heesemann J. Prevalence of the “high-
pathogenicity island” of Yersinia species among Escherichia coli strains that are
pathogenic to humans. Infect Immun 1998;66(2):480e5.
[47] Buchrieser C, Rusniok C, Frangeul L, Couve E, Billault A, Kunst F, et al. The 102-
kilobase pgm locus of Yersinia pestis: sequence analysis and comparison of
selected regions among different Yersinia pestis and Yersinia pseudotubercu-
losis strains. Infect Immun 1999;67(9):4851e61.
295
[48] Iteman I, Guiyoule A, de Almeida AM, Guilvout I, Baranton G, Carniel E.
Relationship between loss of pigmentation and deletion of the chromosomal
iron-regulated irp2 gene in Yersinia pestis: evidence for separate but related
events. Infect Immun 1993;61(6):2717e22.
[49] Fetherston JD, Perry RD. The pigmentation locus of Yersinia pestis
KIM6+ is flanked by an insertion sequence and includes the structural
genes for pesticin sensitivity and HMWP2. Mol Microbiol 1994;13(4):
697e708.