Avian Pathology

ISSN: 0307-9457 (Print) 1465-3338 (Online) Journal homepage: https://www.tandfonline.com/loi/cavp20

Modelling Aspergillus fumigatus infections in racing

pigeons (Columba livia domestica)

L. A. Beernaert , F. Pasmans , F. Haesebrouck & A. Martel

To cite this article: L. A. Beernaert , F. Pasmans , F. Haesebrouck & A. Martel (2008) Modelling
Aspergillus�fumigatus infections in racing pigeons (Columba�livia�domestica), Avian Pathology,
37:5, 545-549, DOI: 10.1080/03079450802382280

To link to this article: https://doi.org/10.1080/03079450802382280

Published online: 16 Sep 2008.

Submit your article to this journal

Article views: 736

View related articles

Citing articles: 20 View citing articles

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=cavp20
Avian Pathology (October 2008) 37(5), 545
549

Modelling Aspergillus fumigatus infections in racing

pigeons (Columba livia domestica)
L. A. Beernaert*, F. Pasmans, F. Haesebrouck and A. Martel

Department of Pathology, Bacteriology and Avian Diseases, Faculty of Veterinary Medicine, Ghent University,
Salisburylaan 133, 9820 Merelbeke, Belgium

In vivo modelling of aspergillosis in birds allows the evaluation of control measures and the study of host

pathogen interactions. In this study the impact of the use of different inoculation routes and
immunosuppression on the course of an infection with Aspergillus fumigatus in racing pigeons (Columba
livia domestica) was examined. A. fumigatus conidia were inoculated in the thoracic air sac, lung or trachea
in immunocompetent or immunosuppressed pigeon squabs. Immunosuppression was induced by three
dexamethasone injections before inoculation. Mortality in the A. fumigatus-inoculated groups varied
between 1/4 and 4/4. The highest and more acute mortality was seen in immunocompetent pigeons
inoculated in the thoracic air sac and in pigeons inoculated in the thoracic air sac or lung after
immunosuppression. Pigeons inoculated in the lung or inoculated intratracheally after immunosuppression
developed an aspergillosis infection with a slower course of disease and more prominent clinical symptoms.
Using microsatellite length polymorphism, it was confirmed that all mycoses were caused by the inoculated
strain except for one isolate in a dexamethasone-treated pigeon. In conclusion, inoculation in the lung is
selected as the preferred model for chronic aspergillosis in pigeons, and inoculation in the thoracic air sac as
the preferred model for acute aspergillosis. The use of immunosuppressed birds seems to be contra-indicated
due to the risk of opportunistic infections.

Introduction

Avian aspergillosis is an infectious and non-contagious detection of strain-dependent differences of virulence.

disease caused by Aspergillus spp. These fungi are
ubiquitous and can be isolated from soil, air and
vegetation. The most commonly isolated species is
Aspergillus fumigatus but other Aspergillus spp., includ-
ing Aspergillus flavus, Aspergillus niger, Aspergillus
glaucus and Aspergillus nidulans, can also play a role
(Okoye & Okeke, 1986; Barton et al., 1992; Perelman &
Kuttin, 1992; de Wit et al., 1993; Oglesbee, 1997; Joseph,
2000). Mixed infections occasionally occur (Perelman &
Kuttin, 1992).
A. fumigatus is an opportunistic pathogen, causing
clinical infections at high infection pressure or in
immunosuppressed hosts. Phagocytic cells and normal
respiratory microbial clearance mechanisms are the first-
line defence against inhaled spores. Disease occurs when
this intrapulmonary defensive mechanism becomes in-
adequate and does not succeed in eliminating the
organism (Oglesbee, 1997).
In vivo models allowing reproducing aspergillosis in
birds are very useful for studying host
pathogen inter-
actions and evaluating the effect of different control
measures. Depending on the aims of such studies, a
more acute or a more chronic model is required. A
rather chronic infection model would be more suitable,
for example, in studies assessing the efficacy of anti-
mycotic treatment. The more acute model may allow the
Although experimental infections with A. fumigatus have
been carried out in quails, starlings, pigeons, turkeys and
chickens using different inoculation routes (intrave-
nously, intratracheally, in the abdominal/thoracic air
sac, intrapulmonary and using aerosol), there is an
absolute necessity to compare these routes in one bird
species in order to select the appropriate model (Chute
& O’Meara, 1958; Wright et al., 1960; Richard et al.,
1973, 1981; Richard & Thurston, 1983; Dyar et al.,
1984; Van Cutsem et al., 1989; Julian & Goryo, 1990;
Elmubarak & Fadlelmula, 1991; Peden & Rhoades,
1992; Perelman, 1993; Kunkle & Rimler, 1996; Kunkle
et al., 1999; Atasever & Gümüssoy, 2004; Gümüssoy
et al., 2004; Femenia et al., 2007). It was therefore the
aim of this study to select an acute and a ch-
ronic aspergillosis model in pigeons. For this purpose,
A. fumigatus conidia were inoculated in the thoracic air
sac, lung or trachea of immunocompetent or immuno-
suppressed pigeons.
Materials and Methods
Animals. In the first experiment, 18 clinically healthy adult racing
pigeons (Columba livia domestica) were divided into three groups of six
pigeons. In the second experiment, 35 clinically healthy, 4-week-old to
5-week-old pigeon squabs were divided into seven groups of four
pigeons and one group of seven pigeons. The animals were free from

*To whom correspondence should be addressed. Tel: 32 9 264 74 42. Fax: 32 9 264 74 90. E-mail: lies.beernaert@ugent.be
Received 16 April 2008
ISSN 0307-9457 (print)/ISSN 1465-3338 (online)/08/50545-05 # 2008 Houghton Trust Ltd
DOI: 10.1080/03079450802382280
546 L. A. Beernaert et al.
Salmonella spp. and endoparasites. During the experiment each bird
was housed individually at 20 to 228C and 31% to 55% relative humidity
with a 12-h photoperiod. The birds received a commercial pigeon diet
ad libitum and had free access to fresh drinking water.
All experiments were performed with the permission of the Ethical
Committee of the Faculty of Veterinary Medicine, Merelbeke, Ghent
University, Belgium (EC 2006/099).
Experimental inoculum. The A. fumigatus strain used in this study was
isolated from a racing pigeon, which was losing weight for 4 weeks and
was presented with severe dyspnea. Five-day-old cultures of this strain
on Sabouraud dextrose agar (CM0041; Oxoid Ltd, Basingstoke, UK)
were washed with 5 ml of 0.01% Tween 80 in Hank’s balanced salt
solution (HBSS) to harvest A. fumigatus conidia. The conidia were
washed three times in 0.01% Tween 80 in HBSS (3200 x g, 10 min at
48C) and the suspension was adjusted to a concentration of 106 or 108
A. fumigatus conidia/ml in HBSS by haemacytometer count.
Experimental design. The first experiment was carried out in order to
determine an appropriate infection dose. Three groups of six pigeons
were inoculated intratracheally either with 0.2 ml of a 106 or 108
A. fumigatus conidia/ml suspension in HBSS or with 0.2 ml HBSS. The
second experiment was carried out in order to examine the impact of
the use of different inoculation routes and immunosuppression on the
course of an infection with A. fumigatus. Seven groups of four pigeons
were inoculated either with 0.2 ml of a 108 A. fumigatus conidia/ml
suspension in HBSS (Groups 4, 5, 6, 7 and 8) or with 0.2 ml HBSS
(Control Groups 1 and 2) using one of the following inoculation routes:
intratracheal (Group 8), inoculation in the right thoracic air sac
(Groups 1, 4 and 6) and inoculation in the apical part of the right
lung (Groups 2, 5 and 7). The pigeons of three groups received three
dexamethasone injections (2 mg/kg intramuscularly every 48 h) before
inoculation with A. fumigatus (Groups 6, 7 and 8). One group of
pigeons (n7) only received three dexamethasone injections (Control
Group 3).
The animals were observed at least twice daily. The presence of
ruffled feathers, dyspnea, sneezing and stridor were scored blindly. Out
of ethical considerations, pigeons with severe dyspnea (open beak
breathing) or extreme weakness were euthanized. This was noted as
‘‘mortality’’. In the first experiment at 22 days post inoculation (p.i.)
and in the second experiment at 7 days p.i., all remaining pigeons were
euthanized by an intravenous injection of 0.2 ml T61 (Intervet,
Mechelen, Belgium) in the vena basilica. At necropsy, macroscopic
lesions were described and samples were collected for mycological and
bacteriological examination.
Weight. All pigeons were weighted at the time of the first dexametha-
sone injection, at the time of inoculation and at necropsy. Statistical
analysis was performed using a two-sample t test (Microsoft Office
Excel).
Clinical score. Every day, a score for tail hopping and abdominal
breathing was given to each pigeon. These scores ranged from 0 to 1
(0 absent, 0.2 barely visible, 0.4 mild, 0.6 moderate, 0.8 pro-
nounced, 1highly pronounced). The sum of those two scores forms
the dyspnea score for a certain pigeon on a certain day. The presence or
absence of ruffled feathers, as a general sign of sickness, was also noted
daily for each pigeon.
Mycological and bacteriological examination. In the first experiment
samples of the trachea, lungs and air sacs, and in the second experiment
samples of the trachea, lungs, air sacs, heart, pericardium, liver, kidney,
brain, pectoral muscle and abdominal fluid, were inoculated on
Sabouraud dextrose agar plates and incubated at 378C at aerobic
conditions to isolate A. fumigatus. Growth of A. fumigatus was assessed
2 days after plate inoculation. Bacteriological examination was
performed on the livers of all pigeons using standard microbiological
isolation techniques.
Microsatellite length polymorphism. Microsatellite length polymorphism
(MLP) was used to confirm that mycoses during this study originated
from the inoculated strain.
DNA was extracted by the following technique. For each isolate, a
piece of mycelium was cut out from the agar plate. After melting the
agar, the mycelium was crushed manually in order to release DNA from
the cells. After centrifugation (16 100 x g, 2.5 min), the supernatant was
used for polymerase chain reaction.
Primers were selected for the amplification of microsatellites A, B, C
and D (Table 1). One primer per set was labelled with the fluorescent
dye 6-carboxyfluorescein for detection with an automated DNA
sequencer. The PCR amplification was performed in a 20-ml volume
containing 1.5 mM MgCl2, 100 mM dNTPs, 0.1 mM for each primer,
0.025 U/ml Taq DNA polymerase and 2 ml supernatant. Amplification
was performed in an Eppendorf† Mastercycler ep system, with
denaturation for 5 min at 948C, 35 time cycles of 30 sec at 948C,
30 sec at 598C, and 30 sec at 728C, and a final extension step at 728C for
30 min. Two microlitres of the PCR product was mixed with 12 ml
deionized formamide and 0.3 ml rox 500LIZ. This mixture was
denaturated at 958C during 2 min and incubated on ice for 0.5 h. The
samples were further analysed by capillary electrophoresis (ABI 3100;
Applied Biosystems). A reference strain (CBS 143.89; Centraal Bureau
voor Schimmelculturen, Utrecht, the Netherlands) was included in all
analyses as an internal control.
Results
Clinical signs. Immunocompetent pigeons inoculated
intratracheally showed no clinical signs in the first
experiment.
In the second experiment, a significant difference
(PB0.01) between the average weight of immunosup-
pressed and immunocompetent pigeons was observed on
the day of inoculation. After inoculation, weight loss was
detected in the groups inoculated with A. fumigatus
except for Group 6 (dexamethasone treated, inoculated
with A. fumigatus in the air sac) (Table 2). Dyspnea was
only seen in A. fumigatus-inoculated pigeons, most
apparent in Group 5 (inoculated in the lung) and Group
8 (dexamethasone treated, inoculated in the trachea).
Dyspnea was almost absent in Group 6 (dexamethasone
treated, inoculated with A. fumigatus in the air sac) and
Group 7 (dexamethasone treated, inoculated with A.
fumigatus in the lung) (Table 3). Sneezing was seen in one
pigeon in Group 4 (inoculated in the thoracic air sac) on
the fourth day p.i. and in one pigeon in Group 5
(inoculated in the lung) on the fourth and sixth days
p.i. Stridor was noticed in the latter from the fifth day
p.i. onward and in one pigeon in Group 8 (dexametha-
sone treated, inoculated in trachea) on the fifth day p.i.
Mortality. In the first experiment, no mortality was
observed in any group. In the second experiment, no
mortality was observed in the negative control groups,
except for two out of seven pigeons in Group 3
(dexamethasone treated, not inoculated), which died
due to a Streptococcus gallolyticus septicaemia. Mortality
Table 1. Primer sequences for multiplication of microsatellites
A, B, C and D (Bart-Delabesse et al., 1998)
Microsatellite Primer sequences (5? to 3?)
A GCCTACGATGACCGAAATGA
CTGTTTTGAGAAGCGGATGG
B TTGCCATCGCTTGTCATAGA
GCAGGTGGTTCAATAGGACAG
C CGAAGCTCTCCCCTGCAAATC
GATGCCGCTGGTGGTGTTGT
D AGGGATACGGCTACGGACAA
AAAGCGTCTGTCAGCGTGTCT
 A. fumigatus infections in racing pigeons 547

Table 2. Average total weight loss as a percentage of the initial muscle was noticed. The pathological findings of the
weight in pigeons, either inoculated with A. fumigatus or sham A. fumigatus-inoculated pigeons are summarized in
inoculated, at 7 days p.i. (or at euthanasia) Table 5. Necropsy showed lesions suggestive of asper-
gillosis in all A. fumigatus-inoculated pigeon groups.
Group Weight loss
The most pronounced lesions were noticed in the
(%)
respiratory tract and visceral organs. Air sac lesions
HBSS in right thoracic air sac (n4) 1.3a included the presence of granulomatous foci and
HBSS in right lung (n4) 3.6a clouding. Lung lesions included the presence of gran-
Dexamethasone (n7) 1.4 ulomatous and haemorrhagic foci. Lesions on the
A. fumigatus in right thoracic air sac (n4) 8.1 pericard included the presence of granulomatous foci
A. fumigatus in right lung (n4) 6.6 and a content of yellow fluid. Liver lesions included
A. fumigatus in right thoracic air sac after 0.011a granulomatous foci and congestion. A pale aspect of
dexamethasone injections (n4)
the kidneys, a large granulomatous focus in the brain
A. fumigatus in right lung after dexamethasone 8.9
injections (n4)
and the presence of a pale aspect and granulomatous
A. fumigatus in trachea after dexamethasone 12.4 foci on the pectoral muscles were also noticed occa-
injections (n4) sionally.

a
Negative weight loss valueweight gain.
in the A. fumigatus-inoculated groups varied between 1/4
and 4/4, the lowest mortality occurring in Groups 5 and 8
(inoculated in the lung; and dexamethasone treated,
inoculated in the trachea), and 100% mortality occurring
in Groups 4, 6 and 7 (inoculated in the air sac;
dexamethasone treated, inoculated in the air sac; and
dexamethasone treated, inoculated in the lung). Mortal-
ity was more acute in Groups 4, 6 and 7 (inoculated in the
air sac; dexamethasone treated, inoculated in the air sac;
and dexamethasone treated, inoculated in the lung), than
in Groups 5 and 8 (inoculated in the lung; and
dexamethasone treated, inoculated in trachea) (Table 4).
Pathological findings. Immunocompetent pigeons inocu-
lated intratracheally showed no macroscopic lesions at
necropsy.
In the second experiment, no lesions were observed
in the control groups with the exception of two out of
seven pigeons in Group 3 (dexamethasone treated, not
inoculated) that died of S. gallolyticus septicaemia. In
these pigeons, a pale aspect of the liver and pectoral
Mycological findings. In the first experiment, A. fumiga-
tus could not be isolated from trachea, lungs and air sacs
of any of the pigeons.
In the second experiment, A. fumigatus was isolated
from different organs of all inoculated pigeons and could
not be isolated from organs of non-A. fumigatus-
inoculated pigeons (Table 5).
Microsatellite length polymorphism. All isolated strains
had the same MLP characteristics as the inoculated
strain (A123B102C167D112), except for one strain
(A127B161C165D78). This strain was isolated from pale
kidneys of one pigeon in Group 7 (dexamethasone
treated, inoculated in the apical part of the right lung).
The strain isolated from the trachea of the same pigeon
had the same MLP characteristics as the inoculated
strain.
Discussion
Immunocompetent adult pigeons inoculated intratrache-
ally showed no clinical signs, mortality or lesions at
necropsy. A. fumigatus could not be isolated from the

Table 3. Average daily clinical scores for dyspnea and the presence or absence of ruffled feathers per day in pigeons, either inoculated
with A. fumigatus or sham inoculated

Day p.i. Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 Group 7 Group 8

Dyspnea score
1 0 0 0 0 0 0 0 0
2 0 0 0 0 0
a 0 0
3 0 0 0 1 0.48
a 0.2 0.5
4 0 0 0 0.1 0.25
a
a 0.4
5 0 0 0 0.3 0.4
a
a 0.7
6 0 0 0
a 0.2
a
a 0.4
7 0 0 0
a 0.27
a
a 0.67
Fraction of pigeons with ruffled feathers
1 0/4 0/4 0/7 1/4 1/4 1/4 2/4 0
2 0/4 0/4 2/7 3/4 1/4
a 3/4 2/4
3 0/4 0/4 0/5 1/2 0/4
a 1/1 2/4
4 0/4 0/4 0/5 1/2 2/4
a
a 3/4
5 0/4 0/4 0/5 1/2 1/3
a
a 3/4
6 0/4 0/4 0/5
a 0/3
a
a 1/3
7 0/4 0/4 0/5
a 1/3
a
a 1/3

Group 1, HBSS in right thoracic air sac; Group 2, HBSS in right lung; Group 3, dexamethasone; Group 4, A. fumigatus in right
thoracic air sac; Group 5, A. fumigatus in right lung; Group 6, A. fumigatus in right thoracic air sac after dexamethasone injections;
Group 7, A. fumigatus in right lung after dexamethasone injections; Group 8, A. fumigatus in trachea after dexamethasone injections.
a
All pigeons died.
548 L. A. Beernaert et al.

Table 4. Daily mortality in pigeons, either inoculated with A. fumigatus or sham inoculated

Day p.i. Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 Group 7 Group 8

1
2 2 4 2
3 2 1
4 1 1
5 1 1 1
6
7
Total 0 0 2/7 4/4 1/4 4/4 4/4 1/4

Group 1, HBSS in right thoracic air sac; Group 2, HBSS in right lung; Group 3, dexamethasone; Group 4, A. fumigatus in right
thoracic air sac; Group 5, A. fumigatus in right lung; Group 6, A. fumigatus in right thoracic air sac after dexamethasone injections;
Group 7, A. fumigatus in right lung after dexamethasone injections; Group 8, A. fumigatus in trachea after dexamethasone injections.

tracheas or other organs of these animals. Apparently,
the pigeons were capable of clearing the infection even at
very high infection doses. This finding suggests that
clinically healthy pigeons are not prone to develop
aspergillosis. This low susceptibility might be species
dependent (Chaudhary & Sadana, 1988; Femenia et al.,
2007) and age dependent (O’Meara & Chute, 1959;
Femenia et al., 2007). Therefore, pigeon squabs (4 to 5
weeks old) were used in the second experiment.
In the second experiment, A. fumigatus-inoculated
pigeons developed mycosis. Because of the risk of
contamination by airborne conidia, especially in the
dexamethasone-pretreated groups, we used MLP analy-
sis to ensure that the mycosis was caused by the
inoculated strain. Hereby, it was confirmed that all
isolated A. fumigatus strains had the same MLP
characteristics as the inoculated strain except for one
isolate of a dexamethasone-treated pigeon. Probably due
to the dexamethasone injections, environmental, air-
borne A. fumigatus conidia caused a co-infection. This
finding emphasizes the role of immunosuppression in
the development of avian aspergillosis. Clinical symp-
toms were present in all inoculated pigeons. However,
the most obvious symptoms were noticed in pigeons
inoculated in the lung or inoculated intratracheally after
immunosuppression. This coincides with delayed mor-
tality in animals from both groups. Hence, the more
severe symptoms can probably be merely attributed to
the slower course of infection. Both experimental de-
signs can thus be used as a model for chronic aspergil-
losis. Due to the more acute mortality in pigeons
inoculated in the thoracic air sac and in pigeons
inoculated in the thoracic air sac or lung after immu-
nosuppression, these designs are more suitable as a
model for acute aspergillosis. In this experiment mor-
tality was observed from the second day and within 5
days p.i. In the models for acute aspergillosis four out of
four pigeons died within 5 days p.i., while in the models
for chronic aspergillosis only one out of four pigeons
died on the fifth day p.i. These findings are in contrast
with A. fumigatus experimental infections in other avian
species. In turkeys inoculated with A. fumigatus spores in
the thoracic air sac, no mortality was seen in the first 4
days p.i.; while quails and starlings inoculated with A.
fumigatus spores intratracheally demonstrated mortality
as soon as 2 to 3 days p.i. (Peden & Rhoades, 1992;
Kunkle & Rimler, 1996; Atasever & Gümüssoy, 2004;
Gümüssoy et al., 2004; Femenia et al., 2007). On the
other hand, pigeons inoculated with A. fumigatus spores
intravenously showed similar results as the models for

Table 5. Pathological and mycological findings in pigeons inoculated with A. fumigatus

Organ Number of animals showing lesions (L) and number of animals from which A. fumigatus was isolated (I)a

Group 4 Group 5 Group 6 Group 7 Group 8

L I L I L I L I L I

Trachea swab 0 0 0 0 0 1 0 2 3 1
Left abdominal air sac 4 0 2 0 1 0 2 1 4 1
Right abdominal air sac 4 2 1 1 1 4 2 1 2 0
Left thoracic air sac 4 3 2 0 2 1 2 1 4 0
Right thoracic air sac 4 2 2 1 4 3 2 1 4 0
Left lung 2 3 1 2 2 4 0 3 4 1
Right lung 2 3 4 1 2 4 4 4 4 1
Pericard 4 2 1 1 3 2 2 1 0 0
Heart 0 1 0 0 0 1 0 0 0 1
Liver 4 4 1 1 4 4 3 3 1 0
Spleen 4
b 4 b
0
b 1
b 0
b
Kidney 2 0 0 0 3 3 1 1 0 0
Brain 1 1 0 0 0 0 0 0 0 0
Ascites 4 2 1 0 1 1 0
b 0
b
Pectoral muscle 2 1 1 1 4 2 3 0 1 0

a
Each group consisted of four animals. Group 4, A. fumigatus in right thoracic air sac; Group 5, A. fumigatus in right lung; Group 6,
A. fumigatus in right thoracic air sac after dexamethasone injections; Group 7, A. fumigatus in right lung after dexamethasone
injections; Group 8, A. fumigatus in trachea after dexamethasone injections. bNot determined.

acute aspergillosis in this study (Van Cutsem et al., 1989;
Elmubarak & Fadlelmula, 1991). Discrepancy with
literature can be caused by species-dependent suscept-
ibility for A. fumigatus infections and/or variability of
pathogenicity of the A. fumigatus isolates used in the
different studies (Peden & Rhoades, 1992). Lesions
suggestive of aspergillosis were present in all A. fumiga-
tus-inoculated pigeons. In this study, as well as in general
(apart from the used inoculation route and avian
species), acute mortality is consistent with disseminated
mycosis while reduced and delayed mortality is consis-
tent with mycotic lesions restricted to the respiratory
tract (Chaudary & Sadana, 1988; Peden & Rhoades,
1992; Kunkle & Rimler, 1996; Atasever & Gümüssoy,
2004; Gümüssoy et al., 2004; Femenia et al., 2007).
Dexamethasone treatment clearly enhanced the risk of
opportunistic infections, such
as streptococcosis or interference with environmental
A. fumigatus strains. The use of immunocompetent
pigeons thus seems preferable in aspergillosis models.
Based on our results, we propose inoculation of
A. fumigatus in the apical part of the right lung using
immunocompetent pigeon squabs as the preferred
chronic aspergillosis model. Inoculating A. fumigatus in
the right thoracic air sac of immunocompetent pigeon
squabs appears to be the best model for acute aspergil-
losis.
Acknowledgements
The present work was supported by the Institute for the
Promotion of Innovation by Science and Technology in
Flanders (IWT Vlaanderen), Brussels, Belgium.
References
Atasever, A. & Gümüssoy, K.S. (2004). Pathological, clinical and
mycological findings in experimental aspergillosis infections of
starlings. Journal of Veterinary Medicine A, 51, 19
22.
Bart-Delabesse, E., Humbert, J.-F., Delabesse, E. & Bretagne, S. (1998).
Microsatellite markers for typing Aspergillus fumigatus isolates.
Journal of Clinical Microbiology, 36, 2413
2418.
Barton, J.T., Daft, B.M., Read, D.H., Kinde, H. & Bickford, A.A.
(1992). Tracheal aspergillosis in 61/2-week-old chickens caused by
Aspergillus flavus. Avian Diseases, 36, 1081
1085.
Chaudhary, S.K. & Sadana, S.R. (1988). Experimental aspergillosis in
Japanese quails (Coturnix coturnix japonica), clinical signs and
haematological changes. Mycopathologia, 102, 179
184.
Chute, H.L. & O’Meara, D.C. (1958). Experimental fungous infections
in chickens. Avian Diseases, 2, 154
166.
de Wit, J.J., van Cutsem, J., Schoenmaker, G.J.W., Braunius, W.W. & van
den Bergh, J.P.A.M. (1993). Een ernstige Aspergillus flavus-infectie bij
slachtkuikens en het effect van desinfectie met enilconazole: een case
study. Tijdschrift voor diergeneeskunde, 118, 511
513.
A. fumigatus infections in racing pigeons 549
Dyar, P.M., Fletcher, O.J. & Page, R.K. (1984). Aspergillosis in turkeys
associated with use of contaminated litter. Avian Diseases, 28,
250
255.
Elmubarak, A.K. & Fadlelmula, A. (1991). Pathogenesis of Aspergillus
fumigatus infection in pigeons in the Sudan. Revue d’Elevage et de
Medicine Vétérinaire des Pays Tropicaux, 44, 26
28.
Femenia, F., Fontaine, J., Lair-Fulleringer, S., Berkova, N., Huet, D.,
Towanou, N., Rakotovao, F., Granet, O.-I., Le Loc’h, G., Arné, P. &
Guillot, J. (2007). Clinical, mycological and pathological findings in
turkeys experimentally infected by Aspergillus fumigatus. Avian
Pathology, 36, 213
219.
Gümüssoy, K.S., Uyanik, F., Atasever, A. & Cam, Y. (2004). Experi-
mental Aspergillus fumigatus infection in quails and results of
treatment with itraconazole. Journal of Veterinary Medicine B, 51,
34
38.
Joseph, V. (2000). Aspergillosis in raptors. Seminars in Avian and Exotic
Pet Medicine, 9(2), 66
74.
Julian, R.J. & Goryo, M. (1990). Pulmonary aspergillosis causing right
ventricular failure and ascites in meat-type chickens. Avian Pathology,
19, 643
654.
Kunkle, R.A. & Rimler, R.B. (1996). Pathology of acute aspergillosis in
turkeys. Avian Diseases, 40, 875
886.
Kunkle, R.A., Rimler, R.B. & Steadham, E.M. (1999). Absence of
protection against challenge with Aspergillus fumigatus by adoptive
transfer of splenocytes from convalescent turkeys. Avian Diseases, 43,
678
684.
Oglesbee, B.L. (1997). Mycotic diseases. In R.B. Altman (Ed.), Avian
Medicine and Surgery, 1st edn (pp. 323
361). Philadelphia: W.B.
Saunders Company.
Okoye, J.O.A. & Okeke, C.N. (1986). Pathogenicity of an isolate of
Aspergillus flavus in chickens. Avian Pathology, 15, 259
270.
O’Meara, D.C. & Chute, H.L. (1959). Aspergillosis experimentally
produced in hatching chicks. Avian Diseases, 3, 404
406.
Peden, W.M. & Rhoades, K.R. (1992). Pathogenicity differences of
multiple isolates of Aspergillus fumigatus in turkeys. Avian Diseases,
36, 537
542.
Perelman, B. (1993). Evaluation of azole anti-mycotic agents using an
experimental model of aspergillosis in turkey poults. In Proceedings
of the European Conference on Avian Medicine and Surgery (p. 120).
Utrecht, The Netherlands.
Perelman, B. & Kuttin, E.S. (1992). Aspergillosis in ostriches. Avian
Pathology, 21, 159
163.
Richard, J.L. & Thurston, J.R. (1983). Rapid hematogenous dissemina-
tion of Aspergillus fumigatus and A. flavus spores in turkey poults
following aerosol exposure. Avian Diseases, 27, 1025
1033.
Richard, J.L., Pier, A.C., Cysewski, S.J. & Graham, C.K. (1973). Effect
of aflatoxin and aspergillosis on turkey poults. Avian Diseases, 17,
111
121.
Richard, J.L., Cutlip, R.C., Thurston, J.R. & Songer, J. (1981).
Response of turkey poults to aerosolized spores of Aspergillus
fumigatus and aflatoxigenic and nonaflatoxigenic strains of Aspergil-
lus flavus. Avian Diseases, 25, 53
67.
Van Cutsem, J., Van Gerven, F. & Janssen, P.A.J. (1989). Oral and
parenteral therapy with saperconazole (R 66905) of invasive asper-
gillosis in normal and immunocompromised animals. Antimicrobial
Agents and Chemotherapy, 33, 2063
2068.
Wright, M.L., Anderson, G.W. & Epps, N.A. (1960). Hatchery
sanitation as a control measure for aspergillosis in fowl. Avian
Diseases, 4, 369
379.