Professional Documents
Culture Documents
Pluripotent Anti-Inflammatory Immunomodulatory Effects of Papaverine Against Cerebral Ischemic-Reperfusion Injury
Pluripotent Anti-Inflammatory Immunomodulatory Effects of Papaverine Against Cerebral Ischemic-Reperfusion Injury
FACULTATEA DE FARMACIE
PROGRAM DE STUDII FARMACIE
GRUPA 1
1. Introduction
Ischemic stroke is increasing in prevalence and has become the leading cause of morbidity and
mortality, but the therapeutic options are limited.1 Many studies have indicated that inflammation
plays a central role in all aspects of stroke, including initiation, propagation, and recovery.2 The
central target of inflammation is disruption of the blood-brain barrier (BBB) from the view of the
dynamic neurovascular unit (NVU),3 which functions to regulate communication between the
brain and cerebrovascular network, most notably in the context of coupling neuronal activity to
blood flow. In addition to involving the inflammatory response, cerebral ischemic injury is a
complex system of pathological processes, which include excitotoxicity and cell
death.4,5 Network pharmacology, which provides a straightforward method for identifying find
the connections between drugs and diseases, is a promising approach for uncovering the potential
pathways and biological processes in target network.6 To date, substantial achievements have
been made in determining the pathways and biological processes related to target drugs used in
treating cerebral ischemia via network pharmacology analysis.7
Papaverine (PV) is an opium alkaloid that has been used as a vasodilator agent for over 70 years
to treat cerebral and coronary artery vasospasm.8 This vasodilator can increase the intracellular
levels of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate
(cGMP) by inhibiting corresponding phosphodiesterases in smooth muscle.9 Additionally, it can
block calcium ion channels and inhibit the release of calcium. It can increase the mean
circulation time, improve the cerebral oxygenation,10, 11, 12 and significantly reduce blood-
brain barrier (BBB) disruption.13 In addition, recent reports have suggested that papaverine may
have a potential neuroprotective effect when used locally.14,15 However, some studies have
suggested that the use of papaverine leads to rapid increases in intracranial pressure16 and
transient neurological deficits17,18 by increasing reperfusion-induced vasodilation/hyperemia13, as
well as increases the risk of cerebral infarction19 and emboli due to precipitation.20,21 Baicalin
(BA) is an active natural compound extracted from the Chinese medicine Scutellaria
baicalensis with powerful anti-inflammatory effects, and it was proven to have a positive effect
in the treatment of cerebral ischemia via polypharmacological mechanisms related to immunity,
apoptosis, development, cytoskeletal remodeling, transduction and neurophysiology in our
previous studies.22, 23, 24 Therefore, in this study, we will first evaluate the effect of PV in
reducing the infarction volume of mice induced by focal cerebral ischemia-reperfusion and then
compare the differences in canonical pathways and biological processes between PV-treated
animals and BA-treated ones to uncover the potential pharmacological mechanism by which PV
can treat cerebral ischemia.
2.1. Animal model
Animal experiments were conducted in accordance with the Prevention of Cruelty to Animals
Act (1986) and the National Research Council's Guide for the Care and Use of Laboratory
Animals. The experimental protocol was approved by the Committee on the Ethics of Animal
Experiments of China Academy of Chinese Medical Sciences. Forty-two healthy 12-week-old
Adult mice (male, Kunming) weighing 38–48 g and aged 12 weeks were randomly assigned to
three groups (the PV-treated, BA-treated, vehicle-treated groups), with 14 mice in each group.
After being anesthetized with pentobarbital (4 mg/kg, i.p), the mice in the BA-treated and PV-
treated groups underwent 1.5 h of focal middle cerebral artery occlusion (MCAO) using an
intraluminal suture and 24 h of reperfusion. The mice in the vehicle-treated group underwent the
same surgical procedures, but a suture was not inserted into the external carotid artery (ECA).
Throughout the entire surgical procedure, the mice were maintained at a temperature of 37 °C
with normal blood pressure, glucose levels and blood gas levels.
2.2. Drug administration
The Chinese herbal drugs BA and PV were validated using fingerprint chromatographic
methodologies. In the experiment, 42 mice were randomized into three groups: the vehicle (0.9%
NaCl), BA-treated (5 mg/ml), and PV-treated (4 mg/ml) groups.7,22,23 After 1.5 h of focal cerebral
ischemia, BA (5 mg/ml) and PV (4 mg/ml) were dissolved in 0.9% sodium chloride, and both
compounds were injected into the tail vein of mice in the BA-treated and PV-treated groups at a
dose of 2 ml/kg body weight. Mice in the vehicle-treated group were injected through the tail
vein with 0.9% NaCl (2 ml/kg body weight) at the same time point.
The infarct volume was measured in nine mice from each of the BA-treated, PV-treated and
vehicle-treated groups. The 2,3,5-triphenyltetrazolium blue staining method was used to estimate
the cerebral infarct size.25 The individuals who measured the infarct volume were unaware of the
treatment conditions. The infarct area was calculated using a pathological image analysis system
(Topica), and the ratio of the infarct volume to the total volume of the section was calculated. To
compare the average infarct volume between different groups, one-way analysis of variance was
used. The null hypothesis was rejected at 0.05.
2.4. RNA isolation
The left hippocampi of 5 randomly selected mice from each of the BA-treated, PV-treated, and
vehicle-treated groups were homogenized with TRIzol reagent (Invitrogen, USA) to extract total
RNA. A previously published method was used for RNA extraction and microarray data
analysis.6 The RNA samples were purified and concentrated using an RNeasy MicroKit (Qiagen,
Valencia, CA, USA). This process was described in detail in previous studies.6,26,27
2.5. Microarray
Gene expression profiling was conducted using a mouse brain array (Boao Capital, Beijing,
China), a microarray chip containing 16,463 oligoclones (Incyte Genomics, Santa Clara, CA,
USA). Each clone was repeated on each chip so that there were four technical iterations of each
clone. The intensity value of each clone was determined by averaging the four intensities after
spline smoothing. Each clone was verified by DNA sequencing. RNA from the vehicle-treated
group was labeled with Cy3 and pooled, and the rest of the RNA was labeled with Cy5.
Hybridization, washing and scanning of the microarrays were performed according to standard
protocols.
All differentially expressed genes were uploaded to GeneGo MetaCore™ in the ArrayTrack
system. The likelihood of a significant association between the gene and a canonical pathway or
biological process was measured using P-values and calculated by Fisher's exact test. The level
of statistical significance was set at P < 0.05. Canonical pathways and biological processes with
a P < 0.05 and a fold change >1.5 were selected and analyzed.
Another eight mice from each group were decapitated after anesthesia with Pelltobarbitalum
Natricum (40 mg/kg). Total RNA was extracted from the left brains of the mice using TRIzol
(Invitrogen) and reverse transcribed into cDNA using a reverse transcription system kit (Takara,
Shanghai, China) according to the manufacturer's protocol. qRT-PCR was performed on an ABI
7500 Real-Time PCR System (Applied Biosystems, Foster City, USA) using the SYBR Green
PCR Kit to determine mRNA expression levels. The relative expression of G-CSF (primers:
CACTATGGTCAGGACGAGAGG and CTCACTTGCTCCAGGGACTTA) and p38MAPK
(primers: TGCTCGTTTTGGACTCAGATAAGA and ATCATAGGTCAGGCTCTTCCACTC)
was analyzed using the comparative CT method for relative quantitation and the 2-ΔΔCt method
by normalizing to β-actin expression, and relative expression is presented as the percent change
compared to matched controls. The results are expressed as the mean ± standard deviation.
Differences between two groups were assessed using Student's t test, and one-way analysis of
variance (ANOVA) was used to assess differences between multiple groups; P < 0.05 was
considered to indicate statistical significance.
3. Results
3.2. The canonical pathways activated in the PV-treated group compared with the vehicle-
treated group
3.3. The top 10 biological processes activated in the PV-treated group compared with the
vehicle-treated group
The top 10 biological processes activated in the PV-treated group compared with the vehicle-
treated group were mainly related to multiple immunomodulatory processes of neurovascular
inflammation, including neuropeptide signaling pathways, Th17-derived cytokines, the
regulation of angiogenesis, cell adhesion related to leukocyte chemotaxis, antigen presentation,
cell adhesion related to synaptic contact, and inflammation related to amphoterin signaling
(Fig. 1c). In particular, the top biological process was “signal transduction_neuropeptide
signaling pathways”, which showed that many neuroimmunoregulatory peptides, such as alpha-
MSH, beta-MSH, and gamma-MSH, DA-alphaMSH, were inhibited (Fig. 2).
Fig. 2. The top biological process activated in the PV-treated group compared with the
vehicle-treated group-signal transduction_neuropeptide signaling pathways. The circles in
the figure indicate the target nodes of papaverine. Red circles indicate upregulation, and blue
circles indicate downregulation.
3.4. The canonical pathways activated in the PV-treated group compared with the BA-
treated group
There were 17 pathways that were unique to the PV-treated group compared to the BA-treated
group (P < 0.05) (Supplementary Table 2). Ten (58.82%) of the 17 pathways were related to the
immune response, with 4 (23.53%) of these pathways being cytokine-mediated signaling
pathways (Fig. 3a). Moreover, the 10 canonical pathways with the lowest p-values were mainly
related to the immune response (50%) (Fig. 3b), especially cytokine production and cytokine-
mediated signaling pathways, including cytokine production by Th17 cells in the CF, immune
response_IL-17 signaling pathways (Fig. 4) and immune response_IL-27 signaling pathway. As
shown in Fig. 4, IL-6, IL-23, granulocyte-macrophage colony stimulating factor (GM-CSF),
granulocyte colony stimulating factor (G-CSF), receptor activator of nuclear factor-kB ligand
(RANKL), p38 MAPK and nuclear factor-kB (NF-κB), which are cytokines in the IL-17
signaling pathway that are important for inflammation, were all activated.
Fig. 3. The canonical pathways and biological processes activated by papaverine compared
with BA. (a) The 17 pathway-related cellular processes activated in the PV-treated group
compared with the BA-treated group. (b) The top 10 pathways activated in the PV-treated group
compared with the BA-treated group (P < 0.05). (c) The top 10 biological processes activated in
the PV-treated group compared with the BA-treated group (P < 0.05).
3.5. The top 10 biological processes activated in the PV-treated group compared with the
BA-treated group
The top 10 targeted pathways of biological processes activated in the PV-treated group compared
with the BA-treated group, as in the PV-treated group compared with the vehicle-treated group,
were also mainly related to multiple immunomodulatory processes of neurovascular
inflammation, such as the regulation of signal transduction factors like neuroimmunoregulatory
peptides, Th17-derived cytokines, the regulation of angiogenesis, the activation of the WNT
signaling pathway and the IL-10-mediated anti-inflammatory response (Fig. 3c). The top
biological process was also the “signal transduction_neuropeptide signaling pathways”
(Supplementary Figure 1), and many neuroimmunoregulatory peptides of the MSH family were
also inhibited.
P38MAPK and G-CSF mRNA expression was consistently altered in individual samples from
the sham, vehicle-treated, BA-treated and PV-treated groups (Fig. 5). There was a statistically
significant difference between the vehicle-treated group and the sham group (P < 0.05). The BA-
treated group and the PV-treated group showed statistically significant differences compared
with the vehicle-treated group (P < 0.05). There was a trend but no significant difference
between the BA-treated group and the PV-treated group.
Fig. 5. Validation by the mRNA expression levels of G-CSF and P38MAPK using real-time
RT-PCR. ∗P < 0.05.
4. Discussion
Our study indicated that PV may be effective in reducing the ischemic infarct volume and
therefore might have potential for treating cerebral ischemia in clinical practice. We found that
compared with those activated in the vehicle-treated and BA-treated groups, the canonical
pathways and biological processes activated in the PV-group were both mainly related to the
immune response, especially related to inflammation, which has been reported to play a key role
in cerebral ischemia and ischemia-reperfusion injury.28,29 For example, one canonical pathway
identified to be significantly activated in the PV-treated group compared with the vehicle-treated
and BA-treated groups was the IL-17 signaling pathway, which is related to the immune
response; this is a complicated pathway associated with the induction of proinflammatory
molecule and chemokine production, the recruitment of neutrophils, and the promotion of T
lymphocyte function (Fig. 4).30,31 Our findings are consistent with previous studies showing that
PV has anti-inflammatory effects in preventing vasospasm and anti-inflammatory actions.32,33
In recent years, a number of studies have suggested that postischemic reperfusion injury is
associated with a distinct pattern of immune cell responses and extracellular signaling
molecules.34, 35, 36, 37 It has been reported that T cells are recruited to postischemic brain
tissue through the blood-brain barrier, causing inflammation and nerve damage. T cells release
neurotoxic cytokines to aggravate nerve damage, for example, TH7 cells secrete IL-17.2 Our
study showed that the main pathways and biological processes associated with the effect of
papaverine were all related to the immune response, especially the modulation of neurovascular
inflammation. For example, PV regulated both Th17-derived cytokine production and the IL-17
signaling pathway by acting on cytokines such as G-CSF, p38MAPK, IL-6 and RANKL. Studies
have found that IL-17 activates G-CSF secretion by peripheral cells and terminates
mitochondrial outer membrane permeability and caspase 9 activation, thereby prolonging
neutrophil survival.38 Granulocyte colony-stimulating factor (G-CSF) is an endogenous growth
factor that exhibits multiple neuroprotective mechanisms against stroke. For example, protecting
endoplasmic reticulum homeostasis promotes the weakening of apoptotic protein expression and
the enhancement of anti-apoptotic protein expression.39 Weise et al performed experiments
showing that high concentrations of G-CSF can reduce monocyte infiltration after
stroke.40 Related studies show that p38 MAPK and G-CSF play important roles in the cerebral
ischemia. Inhibition of p38 MAPK can reduce cerebral infarction volume and neurological
deficits after cerebral infarction.41 Studies have found that p38MAPK is a key MAPK involved in
the production of transmission media including TNF-α and COX-2, and the p38MAPK signal
plays a critical role in regulating cellular processes, especially inflammation.42 G-CSF is an
endogenous growth factor that shows multiple neuroprotective mechanisms against stroke.43 G-
CSF plays a key role in controlling the immune response and leads to anti-inflammatory
cytokines, preventing excessive activation of monocytes and lymphocytes by reducing the
release of pro-inflammatory mediators.44 In addition, the receptor-activated nuclear factor-kB
(NF-κB) ligand (RANKL)/RANK signaling pathway has been found to attenuate inflammatory
responses through TOLL-like receptor signaling pathways in microglia, and the activation of the
(RANKL)/RANK signaling pathway has neuroprotective effects and can reduce the expression
of inflammatory cytokines.45 In our study, we found that the expression of G-CSF and RANK
was upregulated after treatment with PV compared with BA; thus, the neuroprotective effect of
PV may be different from that of BA.
5. Conclusion
In this study, we performed a comparative analysis to determine the difference in the
pharmacological mechanism of PV compared with BA in the treatment of cerebral ischemia-
reperfusion injury. By comparing the effects of and the canonical pathways and biological
processes activated by PV compared with vehicle and BA, we found that PV reduced the infarct
size in ischemic cerebral infarction; the findings suggested that PV might act as an efficacious
pluripotent anti-inflammatory agent against cerebral ischemic-reperfusion injury by targeting
multiple immunomodulatory processes of neurovascular inflammation.
Funding
Acknowledgements
All authors participated in the study design, interpretation of the results and analysis of the data
and reviewed the manuscript.
References
S. Shekhar, M.W. Cunningham, M.R. Pabbidi, S. Wang, G.W. Booz, F. FanTargeting vascular
inflammation in ischemic stroke: recent developments on novel immunomodulatory
approaches
3
C. IadecolaThe neurovascular unit coming of age: a journey through neurovascular
coupling in health and disease
Neuron, 96 (2017), pp. 17-42, 10.1016/j.neuron.2017.07.030
CrossRefGoogle Scholar
10
J.M. Milburn, C.J. Moran, D.T. Cross, M.N. Diringer, T.K. Pilgram, R.G. Dacey Jr.Effect of
intraarterial papaverine on cerebral circulation time
11
J.M. Milburn, C.J. Moran, D.T. Cross, M.N. Diringer, T.K. Pilgram, R.G. Dacey Jr.Increase in
diameters of vasospastic intracranial arteries by intraarterial papaverine administration
J Neurosurg, 88 (1998), pp. 38-42, 10.3171/jns.1998.88.1.0038
12
J. Fandino, Y. Kaku, B. Schuknecht, A. Valavanis, Y. YonekawaImprovement of cerebral
oxygenation patterns and metabolic validation of superselective intraarterial infusion of
papaverine for the treatment of cerebral vasospasm
J Neurosurg, 89 (1) (1998), pp. 93-100, 10.3171/jns.1998.89.1.0093
13
14
The 37th annual meeting of the Western thoracic surgical association, Colorado springs (2011)
Google Scholar
15
Google Scholar
16
W. McAuliffe, M. Townsend, J.M. Eskridge, D.W. Newell, M.S. Grady, H.R. WinnIntracranial
pressure changes induced during papaverine infusion for treatment of vasospasm
J Neurosurg, 83 (1995), pp. 430-434, 10.3171/jns.1995.83.3.0430
17
L.E. Hendrix, J.E. Dion, M.E. Jensen, C.D. Phillips, S.A. NewmanPapaverine-induced
mydriasis
18
S. Reddy, D.R. Goldman, A. Kaines, J.P. Hubschman, D. SarrafIntracisternal irrigation of
papaverine leading to choroidal infarction
20
M. Sawada, N. Hashimoto, T. Tsukahara, S. Nishi, Y. Kaku, S. YoshimuraEffectiveness of
intra-arterially infused papaverine solutions of various concentrations for the treatment of
cerebral vasospasm
21
R.S. Polin, C.A. Hansen, P. German, J.B. Chadduck, N.F. KassellIntra-arterially administered
papaverine for the treatment of symptomatic cerebral vasospasm
Neurosurgery, 42 (1998), pp. 1256-1264
22
23
25
26
27
J Neuroinflammation, 10 (2013), p. 95, 10.1186/1742-2094-10-95
28
Google Scholar
29
666.e1
30
31
Blood, 120 (18) (2012), pp. 3793-3802, 10.1182/blood-2012-02-412726
32
33
Google Scholar
34
35
D. Petrovic-Djergovic, S.N. Goonewardena, D.J. PinskyInflammatory disequilibrium in
stroke
36
37
J Neuroinflammation, 8 (2011), p. 106, 10.1186/1742-2094-8-106
38
J Immunol, 197 (6) (2016), pp. 2400-2408, 10.4049/jimmunol.1600138
39
J.M. Menzie-Suderam, P. Mohammad-Gharibani, J. Modi, et al.Granulocyte-colony
stimulating factor protects against endoplasmic reticulum stress in an experimental model
of stroke
40
41
42
Google Scholar
43
44
45
Google Scholar
Bibliografie
https://www.sciencedirect.com/science/article/pii/S1347861320300724