Relation between Genetic Markers of Drug

Resistance and Susceptibility Profile of

Clinical Neisseria gonorrhoeae Strains
Elena N. Ilina, Vladimir A. Vereshchagin, Alexandra D.
Borovskaya, Maja V. Malakhova, Sergei V. Sidorenko, Nazar
C. Al-Khafaji, Anna A. Kubanova and Vadim M. Govorun
Antimicrob. Agents Chemother. 2008, 52(6):2175. DOI:
10.1128/AAC.01420-07.
Published Ahead of Print 31 March 2008.

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

Updated information and services can be found at:
http://aac.asm.org/content/52/6/2175

These include:
REFERENCES This article cites 30 articles, 20 of which can be accessed free
at: http://aac.asm.org/content/52/6/2175#ref-list-1

CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new
articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml

To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2008, p. 2175–2182 Vol. 52, No. 6
0066-4804/08/$08.00⫹0 doi:10.1128/AAC.01420-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Relation between Genetic Markers of Drug Resistance and Susceptibility

Profile of Clinical Neisseria gonorrhoeae Strains䌤
Elena N. Ilina,1* Vladimir A. Vereshchagin,1 Alexandra D. Borovskaya,1 Maja V. Malakhova,1
Sergei V. Sidorenko,2,3 Nazar C. Al-Khafaji,2 Anna A. Kubanova,2 and Vadim M. Govorun1
Research Institute of Physico-Chemical Medicine, Moscow, Russian Federation1; Central Research Institute of Dermatology and
Venerology, Moscow, Russian Federation2; and National Research Centre for Antibiotics, Moscow, Russian Federation3
Received 2 November 2007/Returned for modification 15 January 2008/Accepted 20 March 2008

The main goal of this work is to clarify the predictive value of known genetic markers of Neisseria
gonorrhoeae resistance to penicillin, tetracycline, and fluoroquinolones. The correlation between the
presence of certain genetic markers and susceptibility of N. gonorrhoeae isolates to penicillin, tetracycline,

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

and fluoroquinolones has been analyzed by means of statistical methods. Susceptibility testing with
penicillin, tetracycline, and fluoroquinolones was performed by the agar dilution method. N. gonorrhoeae
genomic DNA was isolated. The presence of blaTEM-1 and tet(M) genes was analyzed by PCR. A novel
method of polymorphism discovery based on a minisequencing reaction followed by matrix-assisted laser
desorption ionization–time-of-flight mass spectrometry was applied for the analysis of chromosomal N.
gonorrhoeae genes involved in antimicrobial resistance development. Clinical N. gonorrhoeae isolates (n ⴝ
464) were collected. Susceptibility levels to penicillin, tetracycline, and fluoroquinolones were found to be
25.9%, 35.9%, and 54.1%, respectively. Among the 19 N. gonorrhoeae isolates with penicillin MICs of >4
␮g/ml, the blaTEM-1 gene was detected in 12. The Tet(M) determinant was found in 4 of 12 N. gonorrhoeae
isolates with tetracycline MICs of >16 ␮g/ml. The chromosomal genetic markers of penicillin and
tetracycline resistance were detected especially in isolates with penicillin MICs of 0.25 to 2.0 ␮g/ml and
tetracycline MICs of 0.5 to 4 ␮g/ml. Mutations in GyrA and ParC were found in 208 of 211 quinolone-
resistant N. gonorrhoeae isolates. This work is the first representative molecular research of the N.
gonorrhoeae population in Russia. Information about the prevalence of antibiotic resistance mechanisms
and the positive predictive value of certain genetic determinants is given. The positive predictive values of
the analyzed genetic markers were found to be different for fluoroquinolones (90.3%), penicillin (91.1%),
and tetracycline (81.9%).

Gonorrhea remains one of the major sexually transmitted
diseases in Russia; in 2005, the disease rate was 90 cases per
100,000 people. Although the incidence of gonorrhea de-
creased slightly during recent years, the situation remains
alarming due to the spread of multiresistant strains which are
resistant to at least penicillin, tetracycline, and fluoroquinolo-
nes (31). However, replacement in routine practice of culture
and susceptibility testing by nucleic acid amplification tech-
niques reduces the amount of information on antimicrobial
susceptibility patterns and highlights the need for the develop-
ment of molecular tools for the detection of antibacterial re-
sistance in Neisseria gonorrhoeae.
Beta-lactams, fluoroquinolones, and spectinomycin are rec-
ommended for the treatment of gonorrhea by national and
international guidelines (17), and tetracyclines are also used in
countries with limited resources. The genetic mechanisms of N.
gonorrhoeae resistance to antibacterials are complicated and
not definitely elucidated. However, acquisition of some genes
and a number of mutations in structural genes and regulatory
regions are considered to be involved unambiguously in resis-
tance development.
Resistance to penicillin can be mediated by the production of
* Corresponding author. Mailing address: Institute of Physico-Chemi-
cal Medicine, Malaya Pirogovskaya St., 1a, 119992 Moscow, Russia.
Phone: 7-495-2450471. Fax: 7-495-2467721. E-mail: ilinaEN@gmail.com.
䌤
Published ahead of print on 31 March 2008.
TEM-1 beta-lactamase, encoded by the plasmid-borne blaTEM-1
gene, or by mutations in a number of chromosomal genes (2,
21, 22, 25). It has been proposed that resistance due to chro-
mosomal mutations is a result of a complicated interplay be-
tween reduced affinities of modified penicillin-binding proteins
(encoded by the penA and ponA genes) to penicillin, activation
of the MtrC-MtrD-MtrE efflux pump (by mutation in the pro-
moter region of the mtrR gene), and reduction in the perme-
ation of the outer membrane porin PorB1b (encoded by
porB1b) (i.e., by penB mutations) (4, 9, 10, 19, 23). It is likely
that mutations in the pilQ gene, encoding a protein of the
secretin family, are also involved in the development of resis-
tance to penicillin (32).
Resistance to tetracycline is also mediated by different
mechanisms, including high-level resistance due to acquisition
of the tet(M) gene, encoding a ribosome-protecting protein
(18), and low-level resistance due to a combination of target
modification (mutation in the rpsJ gene, encoding ribosomal
protein S10), derepressed efflux (mtrR gene), and reduced per-
meation (porB1b gene) (9, 10, 11, 19). Involvement of the last
two mechanisms in the development of resistance to both pen-
icillin and tetracyclines can explain the high frequency of as-
sociated resistance to these antibacterials in clinical isolates of
chromosomally resistant N. gonorrhoeae.
Mechanisms of fluoroquinolone resistance in N. gonorrhoeae
are not as complicated as those of resistance to beta-lactams
and involve mutations in gyrA and parC genes (5, 28). Re-

2175
2176 ILINA ET AL. ANTIMICROB. AGENTS CHEMOTHER.

TABLE 1. List of primers for N. gonorrhoeae gene fragment amplification

Gene locus Primer name Sequence (5⬘–3⬘)b Amplicon length (bp) Reference
a c
por (part I) M13F-Por01 GTCACGACGTTGTAAAACGACGGCCAGTCTG 500–600 30
ACTTTGGCAGCCCTT
M13R-Por08 CACACAGGAAACAGCTATGACCGTATTGTGC 500–600c 30
GAAGAAGC
por (part II)a M13F-Por11 GTCACGACGTTGTAAAACGACGGCCAGTCTG 500–600c 30
TCCGTACGCTACG
M13R-Por14 CACACAGGAAACAGCTATGACCAGATTAGA 500–600c 30
ATTTGTGGCGC
blaTEM-1 B1f TACTCAATCGGTAATTGGCT 340 (Asian and African types) This article
or 142 (Toronto type)
D2r GCCCAAAAAAGGGACGAAAG 340 (Asian and African types) This article
or 142 (Toronto type)
B3f CGTATATCTAGTTGAGGCAC 340 (Asian and African types) This article
or 142 (Toronto type)
D4r GTGCCTCAACTAGATATACG 340 (Asian and African types) This article

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

or 142 (Toronto type)
tet(M) Tet1 ATCCTTTCTGGGCTTCCATTG 436 This article
Tet2 CCGAGCAGGGATTTCTCCAC 436 This article
penA penA-f CGTGATTGCGAAGGCATTGG 379 This article
penA-r GTGCGTCAGTGCGGTATAGG 379 This article
ponA PonA1-f GAGAAAATGGGGGAGGACCG 206 This article
PonA1-r GGCTGCCGCATTGCCTGAAC 206 This article
rpsJ RPS-for GTGCTGTTGTAAAAGGCCCG 186 This article
RPS-rev CGGCCGGCAAATCCAGCTTC 186 This article
gyrA GyrAFEx GACGGCCTAAAGCCGGTGCA 431 5
GyrAREx ATGTTGGTCGCCATACCGAC 431 5
parC ParCFEx GTTTCAGACGGCCAAAAGCCC 300 28
ParCREx GGAACAACAGCAATTCCGCAAT 300 28
mtrR MtrAF GCCAATCAACAGGCATTCTTA 401 16
MtrAR GTTGGAACAACGCGTCAAAC 401 16
a
The por gene was amplified as two overlapping parts (parts I and II).
b
The M13F and M13R sequences are underlined.
c
Amplified fragments are different for PIA and PIB serovars of N. gonorrhoeae.

duction of cell permeation and efflux activation can partic-
ipate in the increase of fluoroquinolone MICs for N. gonor-
rhoeae, but the significance of these mechanisms is not
obvious (6, 15).
The aims of this study were to reveal the correlation between
the presence of known resistance determinants and the levels
of susceptibility of clinical N. gonorrhoeae isolates to penicillin,
tetracycline, and fluoroquinolones and to evaluate the useful-
ness of detection of these determinants for clinical resistance
prediction.
Standard PCR combined with matrix-assisted laser desorp-
tion ionization–time-of-flight (MALDI-TOF) mass spectrom-
etry-based minisequencing or a sequencing procedure was
used for the detection of single-nucleotide polymorphisms
(SNPs) associated with antimicrobial resistance. This method
is based on enzymatic extension of an oligonucleotide primer
annealing close to a polymorphic site, using a deoxynucleoside
triphosphate-dideoxynucleoside triphosphate (dNTP-ddNTP)
mixture. The SNPs in the analyzed genes were detected by
measurement of the molecular weights of reaction products.
This technique is as accurate as direct sequencing for SNP
identification but is far simpler and less expensive. Previously,
this method was applied successfully for hepatitis C virus geno-
typing (13).
(Parts of this work were presented at the 46th Interscience
Conference on Antimicrobial Agents and Chemotherapy, San
Francisco, CA, 14 to 17 September 2006.)
MATERIALS AND METHODS
Bacterial isolates and susceptibility testing. N. gonorrhoeae isolates from pa-
tients with uncomplicated gonorrhea were collected in the laboratories of clinics
for sexually transmitted diseases in different regions of Russia during the period
2004–2005. Isolates were sent frozen on dry ice to the central laboratory (Central
Research Institute of Dermatology and Venereology). In the central laboratory,
isolates were retrieved from cryobeads on GC agar plates and subcultured once
before susceptibility testing. Identification was confirmed using a crystal Hae-
mophilus/Neisseria test (BBL). Susceptibility testing with penicillin G, tetracy-
cline, and ciprofloxacin (all from Sigma) was performed by the agar dilution
method, using GC agar (bioMerieux, France) supplemented with PolyViteX
(bioMerieux, France). N. gonorrhoeae strain ATCC 49226 was used as a
control. Current CLSI interpretive criteria were used to define antimicrobial
resistance (3).
Genotypic characterization. Total genomic DNAs from N. gonorrhoeae iso-
lates were obtained according to the method of Boom et al. (1). If necessary, the
prepared DNA samples were stored at a temperature of ⫺20°C.
(i) Conventional PCR for detection of blaTEM-1 and tet(M) genes. Genomic
DNA was used as a template, and the oligonucleotide primers are described in
Table 1. Amplification was carried out in a 10-␮l reaction mixture containing 66
mM Tris-HCl, pH 9.0, 16.6 mM (NH4)2SO4, 2.5 mM MgCl2, a 0.2 mM concen-
tration of each dNTP, 5 pmol of each primer, and 1 unit of Taq polymerase
(Fermentas, Lithuania) under the following conditions: 94°C for 20 s, 60°C for
20 s, and 72°C for 15 s for 35 cycles. A programmed Tetrad DNA Engine
thermocycler (MJ Research, Inc.) was used. The amplification products were
analyzed by means of electrophoresis on a 2% agarose gel.
(ii) Nucleotide polymorphisms in the penA, ponA, rpsJ, gyrA, and mtrR genes
and the mtrR gene promoter were detected by minisequencing reactions. PCR
was performed as described above, using the sets of primers listed in Table 1.
Some primers were previously recommended (5, 16, 28, 30), and the others were
newly designed using Oligo_6.31 software (Molecular Biology Insights Inc.) and
VOL. 52, 2008 NEISSERIA GONORRHOEAE RESISTANCE MARKERS 2177

TABLE 2. Internal primers used in minisequencing reactions for antimicrobial resistance-associated SNP discovery
Predicted molecular mass
Predicted molecular mass (Da) of (Da) of primer extension
Gene Detected Molecular Composition of dNTP
Primer sequence (5⬘–3⬘) primer extension reaction product for reaction product for
locus marker mass (Da) and ddNTP mix
wild type (reaction conditions) mutant type (reaction
conditions)

penA Asp345a GGGGTAAACATGG 5,933 dT, ddC 6,206 (primer ⫹ ddC) 6,510 dDDD (primer ⫹
GTATCG dT ⫹ ddC)
ponA Leu4213Pro GGTTCAAGAGCCG 5,227 dT, dG, ddC 6,133 (primer ⫹ dT ⫹ dG ⫹ ddC) 5,500 (primer ⫹ ddC)
TTGC
gyrA Ser913Phe ATACCACCCCCACG 6,020 dT, dA, ddC 6,293 (primer ⫹ ddC) 6,597 (primer ⫹ dT ⫹
GCGATT ddC)
Ser913Tyr ATACCACCCCCACG 6,020 dT, dA, ddC 6,293 (primer ⫹ ddC) 6,606 (primer ⫹ dA ⫹
GCGATT ddC)
Asp953Gly CGCCATACGGACGA 5,870 dT, ddC, ddG 6,447 (primer ⫹ dT ⫹ ddC) 6,143 (primer ⫹ ddC)
TGGTG
Asp953Ala CGCCATACGGACGA 5,870 dT, ddC, ddG 6,447 (primer ⫹ dT ⫹ ddC) 6,183 (primer ⫹ ddG)
TGGTG

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

Asp953Asn CGCCATACGGACGA 5,870 dT, ddC, ddG 6,447 (primer ⫹ dT ⫹ ddC) 6,791 (primer ⫹ dT ⫹
TGGTG dT ⫹ ddG)
mtrR ⫺35delA ACATACACGATTGC 6,110 dA, dC, ddT, ddG 7,676 (primer ⫹ 5dA ⫹ ddG) 7,363 (primer ⫹ 4dA ⫹
ACGGAT ddG)
⫺10insTT ATTGCACGGATAAA 5,607 dA, dC, ddT, ddG 7,492 (primer ⫹ 6dA ⫹ ddG) 8,101 (primer ⫹ 8dA ⫹
AAGTC ddG)
Gly453Asp TGAAATGCCAATAG 6,175 dA, dC, ddT, ddG 6,770 (primer ⫹ dC ⫹ dC ⫹ ddG) 6,463 (primer ⫹ ddT)
AGCGCG
rpsJ Val573Met ACATTTTCCGTTCTC 5,979 dA, dT, ddG 6,292 (primer ⫹ ddG) 6,910 (primer ⫹ dA ⫹
CGCAC dT ⫹ ddG)

sequences of N. gonorrhoeae strain FA1090 (GenBank accession no. NC_
002946).
Dephosphorylation of the 5⬘-end phosphate groups of dNTPs in the post-
amplification reaction mixture was done by incubation with 0.5 U of shrimp alkaline
phosphatase (Fermentas, Lithuania) for 20 min at 37°C, followed by inactivation
of the enzyme by heating for 10 min at 85°C.
Minisequencing reactions were carried out with the amplicons of all genes of
interest, obtained by conventional PCR with original internal primers designed
for each particular SNP (Table 2) in such a way that, after annealing, their 3⬘
ends were close to polymorphic sites. In the presence of certain dNTPs and
ddNTPs in the reaction mixture, these primers were extended in accordance with
the nucleotide sequence of the complementary chain. Hence, the reaction prod-
ucts were different for wild (native) and mutant types. The SNPs were detected
by measurement of the molecular masses of the reaction products by means of
MALDI-TOF mass spectrometry and comparison to the theoretical molecular
masses.
The common scheme for using a MALDI-TOF mass spectrometry-based
primer extension reaction for SNP scanning is shown in Fig. 1.
Thermocyclic primer extension reactions were carried out in 20-␮l reaction
mixtures containing 66 mM Tris-HCl, pH 9.0, 16.6 mM (NH4)2SO4, 2.5 mM
MgCl2, a 0.2 mM concentration of each dNTP and ddNTP, 10 pmol of each
respective internal primer (Table 2), and 2 units of TermiPol DNA polymerase
(Solis Biodyne, Estonia) according to the following profile: 94°C for 20 s, 58°C
for 20 s, and 72°C for 15 s for 70 cycles.
The minisequencing reaction products were purified using a SpectroCLEAN
kit (Sequenom USA) according to the manufacturer’s instructions.
A sample aliquot (0.2 to 1 ␮l) was spotted onto the matrix, which was prelim-
inarily dried on AnchorChip (Bruker Daltonics, Germany) 400-␮m targets. The
matrix employed was a saturated solution of 3-hydroxypicolinic acid (Fluka,
Germany) in a 1:1 acetonitrile-water mixture (Merck, Germany) mixed with 0.4
M dibasic ammonium citrate (Fluka, Germany) at 9:1 (vol/vol) ratio. All solvents
were of a quality suitable for mass spectrometry. Mass spectra were collected on
a Reflex IV MALDI-TOF mass spectrometer (Bruker Daltonics, Germany) that
was operated in the positive linear mode. A 337-nm nitrogen laser with a 9-Hz
pulse frequency was used. Mass spectrometer parameters were optimized for the
range of m/z values from 1,000 to 10,000, using a peptide standard set for
calibration. Each mass spectrum was collected with 30 laser pulses at constant
laser power and a constant threshold value in order to enhance the resolution.
(iii) Sequencing procedure for analysis of porB1 and parC gene changes. PCRs
were performed with the corresponding primer sets (Table 1) under the same
conditions as those described above. DNA sequence analysis was performed by
the modified Sanger method, using an ABI Prism BigDye Terminator cycle
sequencing ready reaction kit and an ABI Prism 3100 genetic analyzer (Applied
Biosystems; Hitachi, Japan) according to the manufacturer’s instructions.
Analysis of the nucleotide sequence as well as of deduced amino acid se-
quences was performed using Vector NTI Advance v. 9.0 software (Infomarks
Inc.).
Por typing of N. gonorrhoeae isolates. N. gonorrhoeae typing based on analysis
of por gene variability was done as described previously (8, 14, 24, 30). The por
type of a particular isolate was determined by identification of the obtained
nucleotide sequences of the porB1 genes in the EMBL (European Molecular
Biology Laboratory) and NCBI (National Center for Biotechnology Informa-
tion) databases.
Statistical analysis. Associations between genetic factors and susceptibility
categories were examined by using chi-square (␹2) and Cramer (V) tests. All
statistical calculations were two-tailed and were conducted with the significance
set at P values of ⬍0.05. Statistical analyses were performed with STATISTICA
6.0 software.
RESULTS
Four hundred sixty-four isolates were included in the study.
Por typing revealed genetic heterogeneity among the isolates
studied. Four hundred twelve (88.8%) isolates belonged to the
PIB serovar, and the most prevalent serotypes were PIB2,
PIB3, and PIB22, detected in 170 (36.6%), 122 (26.3%), and 41
(8.8%) isolates, respectively. The remaining PIB serovar iso-
lates (80 [17.2%]) belonged to seven different serotypes. The
PIA serovar was found in 52 (11.2%) isolates, with the PIA6
serotype being predominant, as it was found in 37 (8%) iso-
lates.
Genotypes and penicillin susceptibility. Among isolates in-
cluded in the study, 120 (25.9%) were susceptible to penicillin,
289 (62.2%) had intermediate susceptibility, and 55 (11.9%)
were resistant. The penicillin MIC distribution for isolates with
different genotypes is shown in Table 3. The wild type (no
mutations in target genes and no blaTEM-1 gene) was detected
2178 ILINA ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

FIG. 1. Scheme of minisequencing reaction followed by MALDI-TOF mass spectrometry analysis. An amplified fragment of N. gonorrhoeae
genomic DNA is used as a template. An internal oligonucleotide primer is selected close to the polymorphic site (the variable nucleotides are
shown in bold). The annealing primer is extended by TermiPol DNA polymerase (Solis Biodyne, Estonia) at one or two nucleotides, in accordance
with the nucleotide sequence of the polymorphic site. As a rule, a mixture of deoxynucleotides and dideoxynucleotides is used. The dideoxynucle-
otide which terminates primer elongation is indicated by an asterisk. The annealing primer and its extended products are shown in boxes.
Subsequent MALDI-TOF mass spectrometry analysis of reaction products allows us to detect the diversity between the nonextended primer and
products of the minisequencing reaction, which are different for the wild type (a) and the mutant (b).

in 54 (11.6%) isolates and was significantly associated with
clinical susceptibility (␹2 ⫽ 134.3; P ⬍ 0.001).
Eleven different combinations of determinants involved in
the development of resistance to penicillin were detected. As a
single resistance determinant, an Asp345a insertion in penA
(penAmut) was found in 51 (9.4%) isolates, and the distribution
of penicillin MICs for these isolates was found to be bimodal.
Analysis of the PorB1b protein (PenB locus) revealed that
225 (48.5%) isolates possessed two different combinations of
amino acid substitutions at positions 120 and 121, which have
been regarded as critical in mediating resistance to penicillin
and tetracycline (9, 19). The combination of a Gly1203Lis
mutation with an Ala1213Asp mutation was found in 115
isolates, and a Gly1203Asp mutation with an Ala1213Asn
mutation was found in 74 isolates. Because all of these muta-
tions led to the same effect in the following analysis, we did not
discriminate them in individual isolates and considered them
together as penB mutants (penBmut).
Within the mtrR region, the following changes were de-
tected: amino acid substitution Gly453Asp in the MtrR pro-
tein (72 isolates) and nucleotide mutation ⫺35delA in the
gene’s promoter (170 isolates). It should be noticed that
among the isolates, 19 carried both mutations simultaneously.
Taking into account that both mutations led to overexpression
of the MtrC-MtrD-MtrE efflux pump (23, 29) and that a cu-
mulative effect had not been shown, we considered them to-
gether to be mtrR mutants (mtrRmut).
Three genotypes (penAmut penBmut, penAmut mtrRmut, and
penAmut penBmut mtrRmut) were detected in 7, 15, and 6 iso-
lates, respectively. An obvious trend toward higher MICs for
isolates with these genotypes than those for wild-type isolates
was observed, but the correlation with clinical nonsusceptibility
was not significant (P ⬎ 0.05). The genotypes with isolated
mutations in mtrR and penB were observed in one and two
isolates, respectively, with a penicillin MIC of 0.015 ␮g/ml.
Four genotypes (ponAmut penAmut, ponAmut penAmut
mtrRmut, ponAmut penAmut penBmut, and ponAmut penAmut
penBmut mtrRmut) were more prevalent and were detected in 39
(8.4%), 62 (13.4%), 76 (16.4%), and 133 (28.7%) isolates,
respectively. All of these genotypes were significantly associ-
ated with clinical nonsusceptibility (␹2 ⫽ 281.7; P ⬍ 0.001).
The highest penicillin MICs were observed for 18 (3.9%) beta-
VOL. 52, 2008 NEISSERIA GONORRHOEAE RESISTANCE MARKERS 2179

TABLE 3. Distribution of penicillin MICs for N. gonorrhoeae isolates with different genotypes
No. (%) of isolates by
No. of isolates with MIC (␮g/ml)
Genotypea
No. (%) of susceptibility levelb P valuec
isolates
0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 S I R

wt 54 (11.6) 29 16 4 4 1 49 (90.7) 5 (9.3) 0 ⬍0.001

penAmut 51 (9.4) 19 1 4 13 4 6 2 25 (49.0) 24 (47.1) 2 (3.9) ⬎0.05
mtrRmut 1 (0.2) 1 1 (100) 0 0
penBmut 2 (0.4) 2 2 (100) 0 0
penAmut penBmut 7 (1.5) 2 1 4 2 (28.6) 5 (71.4) 0 ⬎0.05
penAmut mtrRmut 15 (3.2) 2 4 4 2 3 1 1 5 (33.3) 9 (60.0) 1 (6.7) ⬎0.05
penAmut penBmut mtrRmut 6 (1.3) 1 2 2 1 1 3 (50.0) 3 (50.0) 0 ⬎0.05

penAmut ponAmut 39 (8.4) 2 2 2 13 4 9 5 2 6 (15.4) 31 (79.5) 2 (5.1) ⬍0.001

penAmut ponAmut mtrRmut 62 (13.4) 4 2 7 7 21 17 4 1 6 (9.7) 51 (82.3) 5 (8.0) ⬍0.001
penAmut penBmut ponAmut 76 (16.4) 2 3 1 11 9 17 27 6 1 6 (7.9) 63 (82.8) 7 (9.2) ⬍0.001
penAmut penBmut ponAmut 133 (28.7) 6 5 4 11 9 33 40 18 4 1 15 (11.3) 95 (71.4) 23 (17.3) ⬍0.001
mtrRmut

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

blaTEM-1pres 18 (3.9) 3 3 2 4 6 0 3 (16.7) 15 (83.3) ⬍0.001
Total 464 66 29 25 63 36 92 98 36 7 6 6 120 (25.9) 289 (62.2) 55 (11.9)
a
Pattern of known genetic markers selected for analysis of antimicrobial resistance to penicillin. wt, wild-type (native) sequence in loci associated with resistance to
penicillin; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter; blaTEM-1pres, combination of blaTEM-1 gene presence with any variants
of other genetic loci.
b
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria 关3兴 for certain antibiotics). Nonsusceptible categories
are shown in bold.
c
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher’s exact test was used).

lactamase-positive isolates, but in 8 of them the MICs varied
from 1.0 to 4.0 ␮g/ml, while usually the production of beta-
lactamases is associated with values of ⱖ8.0 ␮g/ml. The rela-
tionship between the analyzed groups (genotype, as a complex
of known genetic markers, and phenotype) was confirmed by
the Cramer factor, which was found to be 0.64 for penicillin
resistance.
Genotypes and tetracycline susceptibility. One hundred
sixty-seven (35.9%) isolates were susceptible to tetracycline,
121 (26.0%) had intermediate susceptibility, and 176 (38.1%)
were resistant. The tetracycline MIC distribution for isolates
with different genotypes is shown in Table 4. The wild type [no
mutations in genes involved in development of resistance and
no tet(M) gene] was detected in 91 (19.6%) isolates and was
significantly associated with clinical susceptibility (␹2 ⫽ 116.7;
P ⬍ 0.001).
Seven different combinations of determinants involved in
the development of resistance to tetracycline were observed.
Isolated mutations in mtrR and penB genes in the absence of
other known determinants involved in the development of
resistance to tetracyclines were rare: three isolates with each
genotype were detected. The isolated mutation Val573Met in
the rpsJ gene (rpsJmut) was found in 59 (12.7%) isolates. In
comparison to wild-type isolates, an obvious shift toward
higher MIC values was observed for isolates harboring muta-
tions in the rpsJ gene, but the association was not statistically
significant.
Three genotypes (rpsJmut mtrRmut, rpsJmutpenBmut, and rpsJmut

TABLE 4. Distribution of tetracycline MICs for N. gonorrhoeae isolates with different genotypes
No. (%) of isolates by
No. of isolates with MIC (␮g/ml)
Genotypea
No. (%) of susceptibility levelb P valuec
isolates
0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 S I R

wt 91 (19.6) 38 12 9 17 11 3 1 76 (83.5) 15 (16.5) 0 ⬍0.001

mtrRmut 3 (0.6) 1 1 1 3 (100.0) 0 0
penBmut 3 (0.6) 2 1 2 (66.7) 1 (33.3) 0 ⬎0.05
rpsJmut 59 (12.7) 9 3 1 5 13 17 9 2 18 (30.5) 30 (50.8) 11 (18.7) ⬍0.05

rpsJmut mtrRmut 78 (16.8) 10 4 4 3 8 13 22 11 1 2 21 (26.9) 21 (26.9) 36 (46.2) ⬍0.01

rpsJmut penBmut 87 (18.8) 9 5 1 3 8 14 13 27 7 18 (20.7) 22 (25.3) 47 (54.0) ⬍0.01
rpsJmut penBmut 139 (30.0) 16 6 1 6 11 21 24 33 15 6 29 (20.9) 32 (23.0) 78 (56.1) ⬍0.01
mtrRmut
tet(M)pres 4 (0.9) 2 2 0 0 4 (100.0) ⬍0.01
Total 464 85 31 16 35 51 68 70 73 23 10 2 167 (40.0) 119 (25.6) 178 (38.4)
a
Pattern of known genetic markers selected for analysis of antimicrobial resistance to tetracycline. wt, wild-type (native) sequence in loci associated with resistance
to tetracycline; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter; tet(M)pres, combination of tet(M) determinant presence with any
variants of other genetic loci.
b
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria 关3兴 for certain antibiotics). Nonsusceptible categories
are shown in bold.
c
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher’s exact test was used).
2180 ILINA ET AL. ANTIMICROB. AGENTS CHEMOTHER.

TABLE 5. Distribution of ciprofloxacin MICs for N. gonorrhoeae isolates with different genotypes
No. (%) of isolates by
No. of isolates with MIC (␮g/ml)
Genotypea
No. (%) susceptibility levelb P valuec
of isolates
0.002 0.004 0.008 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 S I R

wt 150 (32.2) 76 42 21 6 4 1 149 (99.3) 1 (0.7) 0 ⬍0.001

mtrRmut 85 (18.3) 40 12 16 10 4 1 1 1 82 (96.5) 0 3 (3.5) ⬍0.001

gyrAmut 17 (3.7) 2 1 2 4 6 1 1 2 (11.8) 1 (5.9) 14 (82.3) ⬍0.001

parCmut 4 (0.1) 1 1 2 1 (25.0) 0 3 (72.0) ⬎0.05

gyrAmut mtrRmut 6 (1.3) 2 1 2 1 2 (33.3) 0 4 (66.7) ⬎0.05

parCmut mtrRmut 13 (2.8) 1 1 2 2 1 4 2 1 2 (15.4) 0 11 (84.6) ⬍0.001

gyrAmut parCmut 70 (15.1) 1 6 3 28 16 11 5 1 (1.4) 0 69 (98.6) ⬍0.001
gyrAmut parCmut 119 (25.6) 5 1 1 4 1 3 12 10 20 29 21 11 12 (10.1) 0 107 (89.9) ⬍0.001
mtrRmut
Total 464 128 55 38 21 9 0 1 1 0 9 25 24 52 50 35 16 251 (54.1) 2 (0.4) 211 (45.5)
a
Pattern of known genetic markers selected for analysis of antimicrobial resistance to fluoroquinolones. wt, wild-type (native) sequence in loci associated with

Downloaded from http://aac.asm.org/ on August 5, 2013 by guest

resistance to fluoroquinolones; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter.
b
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria 关3兴 for certain antibiotics). Nonsusceptible categories
are shown in bold.
c
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher’s exact test was used).

penBmut mtrRmut) were more prevalent and were detected in 78 DISCUSSION

(16.8%), 87 (18.8%), and 139 (30%) isolates, respectively. All
of these genotypes were significantly associated with clinical
nonsusceptibility (␹2 ⫽ 163.1; P ⬍ 0.001). The association
between the analyzed groups (genotype, as a complex of
known genetic markers, and phenotype) was confirmed by the
Cramer factor, which was found to be 0.53 for tetracycline
resistance.
Genotypes and ciprofloxacin susceptibility. Among the stud-
ied isolates, 251 (54.1%) were susceptible to ciprofloxacin, 2
(0.4%) had intermediate susceptibility, and 211 (45.5%) were
resistant (Table 5).
The known amino acid substitutions in the QRDR region
were identified in 208 of 211 ciprofloxacin-resistant isolates.
Most of them (n ⫽ 193) possessed double mutations in GyrA,
at Ser91 and Asp95. One isolate with a ciprofloxacin MIC of
0.25 ␮g/ml revealed a single mutation in GyrA (Ser913Phe).
The ParC alterations occurred in the QRNG region in 194
isolates, at residue Asp86, Ser87, or Glu91. Commonly, muta-
tions in the parC gene were represented with the same fre-
quencies as those in gyrA. Alterations in both gyrA and parC
genes were found for 176 resistant strains with fluoroquinolone
MICs of ⱖ4 ␮g/ml.
The wild type (no mutations in genes involved in resistance
development) was detected in 148 (31.9%) isolates. In 85
(18.3%) isolates, mtrRmut was detected as a single resistance
determinant; the ciprofloxacin MIC distribution for these iso-
lates did not differ significantly from that for wild-type isolates.
Both genotypes were significantly associated with clinical sus-
ceptibility (␹2 ⫽ 180.8; P ⬍ 0.001).
Isolated mutations in ParC and a combination of a mutation
in GyrA with mtrRmut were rare, and we were unable to find
any significant association with a particular phenotype.
Four genotypes (gyrAmut, parCmut mtrRmut, gyrAmut parCmut,
and gyrAmut parCmut mtrRmut) were detected in 17 (3.7%), 13
(2.8%), 70 (15.1%), and 119 (25.6%) isolates, respectively. All
of these genotypes were significantly associated with clinical
nonsusceptibility (␹2 ⫽ 404.1; P ⬍ 0.001), and the Cramer
factor was found to be 0.89 for fluoroquinolone resistance.
Our work focused on estimation of the impact of molecular
mechanisms on the development of N. gonorrhoeae clinical
strains with resistance to penicillin, tetracycline, and fluoro-
quinolones. Previously, a number of mechanisms were found
to be significant for the development of N. gonorrhoeae resis-
tance in transformation and site-directed mutagenesis experi-
ments, but the data dealing with their prevalence in large
groups of clinical isolates were lacking (11, 15, 25, 32). These
data are also important for the improvement of resistance
detection molecular tools. Because the majority of resistance
mechanisms in N. gonorrhoeae are linked to mutations in
the chromosomal DNA, adequate methods for SNP scanning
should be created. MALDI-TOF mass spectrometry-based
minisequencing or a sequencing procedure for the detection of
SNPs was applied successfully for hepatitis C virus genotyping
(13), detection of genetic markers of antibacterial resistance in
Mycobacterium tuberculosis (12), and discrimination of mef
genes in Streptococcus pneumoniae (unpublished data). This
approach has been applied to N. gonorrhoeae strains for the
first time.
The nonclonal character of the analyzed strains was con-
firmed by por typing. Different genotypes were found for the
whole group as well as for samples from a particular region of
Russia.
Analysis of the prevalence of known resistance determinants
in a large set of clinical isolates of N. gonorrhoeae indicates that
their absence is associated with clinical susceptibility to peni-
cillin, tetracyclines, and fluoroquinolones. The majority of iso-
lates carrying penBmut, mtrRmut, penAmut, or rpsJmut as a single
genetic marker demonstrated some antibiotic MIC shift to-
ward higher values than those for wild-type isolates, but nev-
ertheless, they remained in the susceptible category. As far as
penB and mtrR mutations are concerned, this statement is in
agreement with the observations that mutations in PorB1b
have no effect alone and that both mtrR and penB mutations
are required to decrease permeability of the cell membrane
and to develop antimicrobial resistance in gonococci (20, 27).
VOL. 52, 2008
Most of the penicillin-resistant N. gonorrhoeae strains either
carried the blaTEM-1 gene or had different combinations of
nucleotide substitutions in the penA, mtrR, penB, or ponA gene.
The presence of the blaTEM-1 gene was observed in 12 strains
with high-level resistance to penicillin (MICs ⫽ 4.0 to 16.0
␮g/ml), but for six blaTEM-1-positive isolates the MICs of pen-
icillin varied from 1.0 ␮g/ml to 2.0 ␮g/ml. This may be ex-
plained by a decreased ␤-lactamase activity due to amino acid
substitutions. However, whole blaTEM-1 gene sequencing did
not reveal any alterations (data not shown). This phenomenon
requires further investigation. Nevertheless, the difference
between susceptible and resistant groups for that genotype
(blaTEM-1) was found to be reliable (P ⬍ 0.001).
An isolated alteration in the penA gene was found only for
51 isolates. Insertion of an aspartic acid (Asp345a) in PBP2
was linked to the decreased rate of acylation by penicillin (7)
and to an increase of the antibiotic MIC to 0.12 to 0.25 ␮g/ml
and is considered to be the first step in the acquisition of
high-level resistance to penicillin (2). However, the distribu-
tion of penicillin MICs for isolates possessing this mutation as
a single possible mechanism of resistance to penicillin was
bimodal, with peaks at 0.015 ␮g/ml and 0.12 ␮g/ml. Probably,
additional mutations in penA or other genes are necessary for
the expression of resistance, and the development of compen-
satory mutations is less likely. The absence of a statistically
significant correlation between susceptible and nonsusceptible
strains (P ⬎ 0.05) confirmed the ambiguous impact of penA
mutation on penicillin resistance phenotype formation. Similar
data were obtained for 28 strains which had penA alteration
with additional mutations in penB or mtrR loci.
The combination of mutations in both the penA and ponA
genes with any nucleotide sequence in penB or mtrR loci was
shown for 310 strains, especially those with penicillin MICs of
0.5 to 1.0 ␮g/ml. Previously, it was shown that a Leu4213Pro
substitution in PBP1 (ponA gene) was involved in high-level
penicillin resistance of gonorrhea, but only as an additional
locus (25). Our data are not in complete agreement with this
finding. Among the strains examined, only those with muta-
tions in both the ponA and penA loci were found, especially for
N. gonorrhoeae strains with MICs of 0.12 to 1.0 ␮g/ml. The
high-level penicillin-resistant strains had alterations in almost
all loci studied, i.e., penA, ponA, penB, and mtrR. Nevertheless,
significant differences between strains that were susceptible
and nonsusceptible to penicillin were found for all of these
genotypes (P ⬍ 0.001). This was the reason that genotypes
ponAmut penAmut, ponAmut penAmut mtrRmut, ponAmut penAmut
penBmut, and ponAmut penAmut penBmut mtrRmut were selected
as predictive of antimicrobial resistance of N. gonorrhoeae to
penicillin.
Although 12 N. gonorrhoeae strains were identified as having
high-level resistance to tetracycline (MICs of ⱖ16 ␮g/ml), only
4 of them carried the plasmid-encoded Tet(M) determinant.
For the remaining eight strains, it might be the contributions of
other, unstudied chromosomally mediated mechanisms that
result in high-level tetracycline resistance. Ninety-one isolates
that had neither tet(M) nor alterations in rspJ, mtrR, and penB
loci were susceptible or intermediately resistant to tetracycline
(MICs of ⬍1.0 ␮g/ml). A similar trend was observed for six
strains with mutations only in either mtrR or penB loci.
The amino acid substitution Val453Met in ribosomal pro-
NEISSERIA GONORRHOEAE RESISTANCE MARKERS 2181
tein S10 (encoded by the rpsJ gene) was found for 363 N.
gonorrhoeae strains. Fifty-nine samples revealed only an rpsJ
nucleotide alteration. Among them, 18 were susceptible to
tetracycline, with MICs of ⬍0.25 ␮g/ml, and the others were
nonsusceptible (30 were intermediately resistant strains with
MICs of 0.5 to 1.0 ␮g/ml, and 11 had MICs of 2.0 to 4.0 ␮g/ml).
As expected, we did not find significant differences in this
marker between strains that were susceptible and resistant to
tetracycline (P ⬎ 0.05). The point mutation in the rpsJ gene
was initially described as an additional mechanism for chro-
mosomally mediated tetracycline resistance in N. gonorrhoeae
(11).
In most cases (n ⫽ 304), rpsJ alteration was combined with
the mtrR and penB resistance determinants. A significant dif-
ference (P ⬍ 0.01) was found between strains that were sus-
Downloaded from http://aac.asm.org/ on August 5, 2013 by guest
ceptible and resistant to tetracycline for genotypes rpsJmut
mtrRmut, rpsJmut penBmut, and rpsJmut penBmut mtrRmut. All of
them were selected as considerable for the prediction of tet-
racycline resistance in N. gonorrhoeae, but it should be men-
tioned that the predictive markers of tetracycline resistance
were selected with less significance than those for penicillin or
fluoroquinolone resistance. This clearly shows that known ge-
netic markers are not yet completely sufficient to explain the
phenomenon of N. gonorrhoeae tetracycline resistance.
For most isolates, the association between the presence of
particular mutations in the QRDR region and the fluoroquin-
olone resistance phenotype has been shown. In cases of fluo-
roquinolone resistance with substitutions analyzed in neither
the GyrA nor ParC protein (six strains), one can suppose the
existence of unknown alterations in the genes for gyrase and
topoisomerase or the involvement of specific efflux mecha-
nisms (26). As mentioned above, most QRNG regions exhib-
ited double mutations at both positions in GyrA. Among the
strains examined, we revealed one with a single mutation in
GyrA that agrees with a low level of fluoroquinolone resistance
(MIC ⫽ 0.25 ␮g/ml). The other, with a MIC of 0.12 ␮g/ml for
ciprofloxacin, had no alterations in the analyzed loci.
A significant difference (P ⬍ 0.001) was found between
strains that were susceptible and resistant to fluoroquinolones
for genotypes gyrAmut, parCmut mtrRmut, gyrAmut parCmut, and
gyrAmut parCmut mtrRmut. Thus, these genotypes were selected
as considerable for prediction of fluoroquinolone resistance.
Two other genotypes, gyrAmut mtrRmut and parCmut, were too
rare, and it was impossible to evaluate their statistical signifi-
cance. It looks like efflux derepression due to substitutions in
the mtrR locus might play a role in fluoroquinolone resistance
revealed by strains with altered ParC proteins.
Thus, based on the explanations described above, the anal-
ysis of the distributions of individual genetic markers and their
combinations among susceptible and resistant N. gonorrhoeae
strains allowed us to select particular genotypes for prediction
of antimicrobial resistance to penicillin, tetracycline, and fluo-
roquinolones (set off with spaces in Tables 3, 4, and 5), with
significance at P levels of ⬍0.01. The average positive predic-
tive values of these genetic determinants were found to be
different for fluoroquinolones (90.3%), penicillin (91.1%), and
tetracycline (81.9%).
The first representative molecular study of the prevalence of
resistance mechanisms in a large set of N. gonorrhoeae clinical
isolates allowed us to conclude that the surveillance of genetic
2182 ILINA ET AL.
changes may be useful for the prediction of clinical resistance,
improvement of gonorrhea treatment, and prevention of dis-
ease spread.
ACKNOWLEDGMENTS
We sincerely thank V. A. Karpov for oligonucleotide primer
synthesis.
This work was supported by development contract BDALIPCM
270505 from Bruker Daltonik, Germany, and by development contract
24-05 from the Russian Agency of Health.
REFERENCES
1. Boom, R., C. J. A. Sol, M. M. M. Salimans, C. H. Jansen, P. M. E. Wertheim-
van Dillen, and J. van der Noordaa. 1990. Rapid and simple method for
purification of nucleic acids. J. Clin. Microbiol. 28:495–503.
2. Brannigan, J. A., I. A. Tirodimos, Q.-Y. Zhang, C. G. Dowson, and B. G.
Spatt. 1990. Insertion of extra amino acid is the main cause of the low affinity
of penicillin-binding protein 2 in penicillin-resistant strains of N. gonor-
rhoeae. Mol. Microbiol. 4:913–919.
3. Clinical Laboratory Standards Institute. 2002. Performance standards for
antimicrobial susceptibility testing; 15th informational supplement. CLSI
document no. M100–S15. CLSI, Wayne, PA.
4. Cousin, S., Jr., M. C. Roberts, and W. L. Whittington. 2004. Insertion of a
thymine (⫹T) in the 13 base pair inverted repeat of the Neisseria gonor-
rhoeae mtr promoter region and antibiotic susceptibility. Int. J. Antimicrob.
Agents 23:418–419.
5. Deguchi, T., M. Yasuda, M. Asano, K. Tada, H. Iwata, H. Komeda, T. Ezaki,
I. Saito, and Y. Kawada. 1995. DNA gyrase mutations in fluoroquinolone-
resistant clinical isolates of Neisseria gonorrhoeae. Antimicrob. Agents Che-
mother. 39:561–563.
6. Dewi, B. E., S. Akira, H. Hayashi, and W. Ba-Thein. 2004. High occurrence
of simultaneous mutations in target enzymes and MtrRCDE efflux system in
quinolone-resistant Neisseria gonorrhoeae. Sex. Transm. Dis. 31:353–359.
7. Dowson, C. G., A. E. Jephcott, K. R. Gough, and B. G. Spratt. 1989. Peni-
cillin-binding protein 2 genes of non-beta-lactamase-producing, penicillin-
resistant strains of Neisseria gonorrhoeae. Mol. Microbiol. 3:35–41.
8. Fudyk, T. C., I. W. Maclean, N. J. Simonsen, E. N. Njagi, J. Kimani, R. C.
Brunham, and F. A. Plummer. 1999. Genetic diversity and mosaicism at the
por locus of Neisseria gonorrhoeae. J. Bacteriol. 181:5591–5599.
9. Gill, M. J., S. Simjee, K. Al-Hattawi, B. D. Robertson, C. S. Easmon, and
C. A. Ison. 1998. Gonococcal resistance to ␤-lactams and tetracycline in-
volves mutation in loop 3 of the porin encoded at the penB locus. Antimi-
crob. Agents Chemother. 42:2799–2803.
10. Hagman, K. E., W. Pan, B. G. Spratt, J. T. Balthazar, R. C. Judd, and W. M.
Shafer. 1995. Resistance of Neisseria gonorrhoeae to antimicrobial hydropho-
bic agents is modulated by the mtrRCDE efflux system. Microbiology 141:
611–622.
11. Hu, M., S. Nandi, C. Davies, and R. Nicholas. 2005. High-level chromo-
somally mediated tetracycline resistance in Neisseria gonorrhoeae results
from a point mutation in the rpsJ gene encoding ribosomal protein S10 in
combination with the mtrR and penB resistance determinants. Antimicrob.
Agents Chemother. 49:4327–4334.
12. Ikryannikova, L. N., M. V. Afanas’ev, T. A. Akopian, E. N. Il’ina, A. V.
Kuz’min, E. E. Larionova, T. G. Smirnova, L. N. Chernousova, and V. M.
Govorun. 2007. Mass-spectrometry based minisequencing method for the
rapid detection of drug resistance in Mycobacterium tuberculosis. J. Micro-
biol. Methods 70:395–405.
13. Ilina, E. N., M. V. Malakhova, E. V. Generozov, E. N. Nikolaev, and V. M.
Govorun. 2005. Matrix-assisted laser desorption ionization–time of flight
(mass spectrometry) for hepatitis C virus genotyping. J. Clin. Microbiol.
43:2810–2815.
14. Il’ina, E. N., M. V. Malakhova, V. A. Vereshchagin, V. M. Govorun, V. I.
ANTIMICROB. AGENTS CHEMOTHER.
Sergienko, M. M. Zubkov, M. M. Vasil’ev, and A. A. Kubanova. 2003.
Molecular typing of N. gonorrhoeae strains prevalent in the Russian Feder-
ation. Bull. Exp. Biol. Med. 136:179–182.
15. Lindbäck, E., S. Islam, M. Unemo, C. Lang, and B. Wretlind. 2006. Trans-
formation of ciprofloxacin-resistant Neisseria gonorrhoeae gyrA, parE and
porB1b genes. Int. J. Antimicrob. Agents 28:206–211.
16. Lucas, C. E., J. T. Balthazar, K. E. Hagman, and W. M. Shafer. 1997. The
MtrR repressor binds the DNA sequence between the mtrR and mtrC genes
of Neisseria gonorrhoeae. J. Bacteriol. 179:4123–4128.
17. Ministry of Health Care in the Russian Federation. 20 August 2003. Order
415. About the statement of the protocol of conducting patients with gono-
coccal infection. Ministry of Health Care in the Russian Federation, Mos-
cow, Russian Federation.
18. Morse, S. A., S. R. Johnson, J. W. Biddle, and M. C. Roberts. 1986. High-
level tetracycline resistance in Neisseria gonorrhoeae is result of acquisition of
streptococcal tetM determinant. Antimicrob. Agents Chemother. 30:664–
670.
19. Olesky, M., M. Hobbs, and R. A. Nicholas. 2002. Identification and analysis
of amino acid mutations in porin IB that mediate intermediate-level resis-
tance to penicillin and tetracycline in Neisseria gonorrhoeae. J. Antimicrob.
Chemother. 46:2811–2820.
Downloaded from http://aac.asm.org/ on August 5, 2013 by guest
20. Olesky, M., S. Zhao, R. L. Rosenberg, and R. A. Nicholas. 2006. Porin-
mediated antibiotic resistance in Neisseria gonorrhoeae: ion, solute, and
antibiotic permeation through PIB proteins with penB mutations. J. Bacteriol.
188:2300–2308.
21. Pagotto, F., T. Aman, L.-K. Ng, K.-H. Yeung, M. Brett, and J. R. Dillon.
2000. Sequence analysis of the family of penicillinase-producing plasmids of
Neisseria gonorrhoeae based on DNA sequencing. Plasmid 43:24–34.
22. Palmer, H. M., J. P. Leeming, and A. Turner. 2000. A multiplex polymerase
chain reaction to differentiate ␤-lactamase plasmids of Neisseria gonorrhoeae.
J. Antimicrob. Chemother. 45:777–782.
23. Piddock, L. J. V. 2006. Clinically relevant chromosomally encoded multidrug
resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 19:382–402.
24. Posada, D., K. A. Crandall, M. Nguyen, J. C. Demma, and R. P. Viscidi.
2000. Population genetics of the porB gene of Neisseria gonorrhoeae: different
dynamics in different homology groups. Mol. Biol. Evol. 17:423–436.
25. Ropp, P. A., M. Hu, M. Olesky, and R. A. Nicholas. 2002. Mutations in ponA,
the gene encoding penicillin-binding protein 1, and a novel locus, penC, are
required for high-level chromosomally mediated penicillin resistance in Neis-
seria gonorrhoeae. Antimicrob. Agents Chemother. 46:769–777.
26. Rouquette-Loughlin, C., S. A. Dunham, M. Kuhn, J. T. Balthazar, and W. M.
Shafer. 2003. The NorM efflux pump of Neisseria gonorrhoeae and Neisseria
meningitidis recognizes antimicrobial cationic compounds. J. Bacteriol. 185:
1101–1106.
27. Shafer, W. M., and J. P. Folster. 2006. Towards an understanding of chro-
mosomally mediated penicillin resistance in Neisseria gonorrhoeae: evidence
for a porin-efflux pump collaboration. J. Bacteriol. 188:2297–2299.
28. Trees, D. L., A. L. Sandul, W. L. Whittington, and J. S. Knapp. 1998.
Identification of novel mutation patterns in the parC gene of ciprofloxacin-
resistant isolates of Neisseria gonorrhoeae. Antimicrob. Agents Chemother.
42:2103–2105.
29. Veal, W. L., R. A. Nicholas, and W. M. Shafer. 2002. Overexpression of the
MtrCMtrD-MtrE efflux pump due to an mtrR mutation is required for
chromosomally mediated penicillin resistance in Neisseria gonorrhoeae. J.
Bacteriol. 184:5619–5624.
30. Viscidi, R. P., J. C. Demma, J. Gu, and J. Zenilman. 2000. Comparison of
sequencing of the por gene and typing of the opa gene for discrimination of
Neisseria gonorrhoeae strains from sexual contacts. J. Clin. Microbiol. 38:
4430–4438.
31. Vorobieva, V., N. Firsova, T. Ababkova, I. Leniv, B. C. Haldorsen, M. Unemo,
and V. Skogen. 2007. Antibiotic susceptibility of Neisseria gonorrhoeae in
Arkhangelsk, Russia. Sex. Transm. Infect. 83:133–135.
32. Zhao, S., D. M. Tobiason, M. Hu, H. S. Seifert, and R. A. Nicholas. 2005. The
penC mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises
from a mutation in the PilQ secretin that interferes with multimer stability.
Mol. Microbiol. 57:1238–1251.