Benchmarks
(MuLV) Reverse Transcriptase (Perkin-
Elmer) and 1 µL (50 pmol/µL) anti-
sense primer (-14 to -43) 5′-CGA-
GACCTCCCGGGGCACTCGCAAG
CACCC-3′. RT was carried out at 42°C
for 30 min followed by heating the
tubes at 99°C for 5 min and cooling to
5°C for 5 min. Following RT, 80 µL of
PCR mixture (8 µL 10× PCR buffer II,
66.5 µL distilled water, 4 µL 25 mM
MgCl2, 1 µL [50 pmol/µL] sense
primer [-285 to -256] 5′-ACTGTCT-
TCACGCAGAAAGCGTCTAGCCAT-
3′ and 0.5 µL [5 U/µL] AmpliTaq DNA
Polymerase) were added to individual
reaction tubes and subjected to PCR for
45 cycles in a GeneAmp PCR System
9600 Thermal Cycler. Cycling condi-
tions consisted of 15 s denaturation at
94°C, 15 s annealing at 55°C and 30 s
extension at 72°C. The primers recog-
nize a 272-bp sequence unique to the 5′
non-coding region of the HCV genome
(1) and a 98-bp competitor RNA. Fol-
lowing RT-PCR, 10-µL aliquots of the
272- and the 98-bp products were
mixed with 3 µL of sample buffer and
electrophoresed in a 3% NuSieve-1%
SeaKem agarose gel (FMC BioProd-
ucts, Rockland, ME, USA). After
electrophoresis, the relative intensity of
the ethidium bromide-stained DNA
Figure 2. Agarose gel electrophoresis (top) and
Southern blot analysis (bottom) of HCV RNA
(272 bp) co-amplified in the presence of in-
creasing amounts of a 98-base competitor
RNA standard. Lane 1: 102; lane 2: 103; lane 3:
104; lane 4: 105; lane 5: 106; lane 6: 107 and lane
7: 108.
36 BioTechniques
bands was evaluated visually. The
DNA bands shown in Figure 2 (top)
were then blotted onto a nylon mem-
brane (Hoefer Pharmacia Biotech, San
Francisco, CA, USA) and probed with
an alkaline phosphatase-conjugated
chemiluminescent probe (-56 to -96)
5′-CTGCTAGCCGAGTAGTGTTGG-
GTCGCGAAAGGCCTTGTGG-3 ′
(LIGHTSMITH II; Promega, Madi-
son, WI, USA). The membrane was ex-
posed to Kodak X-OMAT X-ray Film
(Eastman Kodak, Rochester, NY, USA)
at 37°C for 3 h, and relative intensity of
the bands was determined and used to
approximate the amount of viral RNA
in the patient serum as shown in Figure
2 (bottom).
In conclusion, the use of in vitro-
synthesized competitor RNA in RT-
PCR appears to be a feasible way to
quantitate HCV RNA in patient sera,
avoiding cumbersome cloning tech-
niques. Furthermore, this method could
be used to determine the presence of
PCR inhibitors because any inhibitor
influencing the efficacy of target ampli-
fication will have similar effect on the
amplification of competitor RNA.
REFERENCES
1.Aslanzadeh, J., B.B. Padilla and J.D. Shan-
ley. 1996. Evaluation of PCR and nested PCR
for laboratory diagnosis of hepatitis C virus
infection. Mol. Cell. Probes 10:173-178.
2.Clossais Besnard, N. and P.M. Andre. 1994.
Automated quantitative determination of he-
patitis C virus viremia by reverse transcrip-
tion-PCR. J. Clin. Microbiol. 32:1887-1893.
3.Gilliland, G., S. Perrin, K. Blanchard and
H.F. Bunn. 1990. Analysis of cytokine
mRNA and DNA: detection and quantification
by competitive polymerase chain reaction.
Proc. Natl. Acad. Sci. USA 87:2725-2729.
4.Lau, Y.N.J., G.L. Davis, J. Kniffen, K.-P.
Qian, M.S. Urdea, C.S. Chan, M. Mizoka-
mi, P.D. Neuwald and J.C. Wilber. 1993.
Significance of serum hepatitis C virus RNA
levels in chronic hepatitis C. Lancet 341:
1501-1504.
5.Manzin, A., P. Bagnarelli, S. Menzo, F.
Giostra, M. Brugia, R. Francesconi, F.B.
Bianchi and M. Clementi. 1994. Quantita-
tion of hepatitis C virus genome molecules in
plasma samples. J. Clin. Microbiol. 32:1939-
1944.
This work is supported by a grant from
Walter Marget Stiftung, Germany. Address
correspondence to Jaber Aslanzadeh, Uni-
versity of Connecticut School of Medicine,
Department of Laboratory Medicine, 263
Farmington Avenue, Farmington, CT
06030, USA.
Received 17 June 1996; accepted 3
December 1996.
Manfred Fille, John D. Shan-
ley and Jaber Aslanzadeh
University of Connecticut
Farmington, CT, USA
Combining Multiplex
and Touchdown PCR to
Screen Murine Micro-
satellite Polymorphisms
BioTechniques 23:36-44 (July 1997)
We describe an improved, non-
radioactive method for simultaneous
amplification of up to three murine mi-
crosatellites. This strategy, which we
term multiplex-touchdown polymerase
chain reaction (PCR), is done in a sin-
gle PCR tube with three pairs of pri-
mers. In general, a number of different-
ly sized bands (Figure 1, lanes 1 and 2)
are usually obtained from PCR amplifi-
cation of microsatellites. These spuri-
ous bands are probably caused by
primer mispairing and/or the template
switching by Taq DNA polymerase
(5,11), and they can seriously compli-
cate genotypic interpretation. To over-
come this problem, we first established
rigorous conditions for touchdown
PCR using a hot-start step (2) (96°C for
3 min). Our protocol was modified
from those reported previously (3,7,9);
however, we optimized the amplifica-
tion conditions so that only DNA bands
of the expected size were present as the
single major bands observed on the
non-denaturing polyacrylamide gel
(Figure 1, lanes 3 and 4). An initial an-
nealing temperature of 65°C gave good
results for all 55 microsatellite markers
listed in Table 1. This temperature is 5°
or 10°C higher than the targeted an-
nealing temperature calculated from
the melting temperature for each pri-
mer pair [2°C (A+T) plus 4°C (G+C)]
Vol. 23, No. 1 (1997)
Benchmarks
(10). Next, we decreased the annealing
temperature at the rate of 1°C for every
PCR cycle (denaturation at 96°C for 30
s, annealing for 30 s and extension at
72°C for 30 s) until the targeted anneal-
ing temperature was reached. After five
to ten cycles that depended on the dif-
ference between the initial and target
temperatures, 20 regular PCR cycles
were performed (denaturation at 96°C
for 30 s, annealing at 55°C [or 60°C]
for 30 s, extension at 72°C for 30 s).
Following final extension, the samples
were incubated at 72°C for an addition-
al 7 min. In general, we found that in-
creasing the number of regular PCR cy-
cles (>20 cycles) resulted in decreased
specificity and the appearance of spuri-
ous bands.
Although the above protocol is very
efficient, the touchdown PCR proce-
dure is somewhat tedious because only
one microsatellite marker is analyzed
per reaction. Our protocol was intended
to expedite the detection of multiple
microsatellite-length polymorphisms in
one reaction by combining touchdown
PCR and multiplex PCR (1). Routinely,
three amplified DNA products of dif-
ferent sizes (Table 1) from one multi-
plex PCR can be analyzed simultane-
ously and unambiguously on the same
lane of a non-denaturing polyacryl-
amide gel (Figure 2, lane 4). We have
successfully applied this protocol for
the amplification of the 55 microsatel-
lite loci listed in Table 1 for homozy-
gous, inbred CBA/Ca mice. We further
tested the efficacy of the method for
analysis of these microsatellites in het-
erozygous individuals using DNA sam-
ples from the C3HeB/HeJ male ×
C57BL/6J female F1 hybrid (The Jack-
son Laboratory, Bar Harbor, ME,
USA). As shown in Figure 3, products
within the allelic size difference of
8–30 bp in these heterozygous hybrids
can be determined unambiguously on
an 8% non-denaturing polyacrylamide
gel. These results demonstrate the po-
tential usefulness of the protocol for
genotypic analysis of hybrids, provided
that the allelic size difference between
two parental genotypes is amenable to
Figure 1. PCR amplification of the mouse mi-
crosatellite IL1β β locus. Mouse genomic DNA
was isolated from bone marrow of two CBA/Ca
mice using a standard phenol/chloroform tech-
nique (8). The PCR was carried out in a 10-µL
mixture consisting of 1× PCR buffer (Perkin-
Elmer, Norwalk, CT, USA), 200 µM of each
dNTP, 0.5 µM of each primer, 0.25 U AmpliTaq
DNA Polymerase (Perkin-Elmer), 2 mM MgCl2
and 10 ng of mouse genomic DNA template.
Products were separated in a 5% non-denaturing
polyacrylamide gel (19:1 acrylamide:bisacryl-
amide) run at 85 V (constant) for 1 h. The gel was
stained with ethidium bromide (0.5 µg/mL) and
photographed under UV light. The arrow indi-
cates the position of the expected 257-bp product.
The molecular marker (HaeIII-digested pBR332
DNA) is shown in lane M. PCR products ob-
tained using a constant annealing temperature
(55°C) are shown in lanes 1 (mouse no. 1) and 2
(mouse no. 2). In contrast, touchdown PCR prod-
ucts obtained using the same primer set are
shown in lanes 3 and 4. Lane 5 represents a PCR
control without added mouse DNA. The primers,
as suggested by Love et al. (6) were: forward: 5′-
CCAAGCTTCCTTGTGCAAGTA-3′ and re-
verse: 5′-AAGCCCAAAGTCCATCAGTGG-3′.
separation by electrophoresis. The only
drawback to the use of the combined
methods for the detection of micro-
satellite-length polymorphisms is that
each protocol depends largely on
Figure 2. Touchdown PCR products of mouse
microsatellites at the IL2 (232 bp), IL6 (78 bp)
and Myc (107 bp) loci are shown in lanes 1, 2 and
3, respectively (at the arrows). Multiplex-touch-
down PCR products of these three loci are shown
in lane 4. The molecular marker (HaeIII-digested
pBR332 DNA) is shown in lane M. Lane 5 is a
PCR control without mouse template DNA. The
primers, as suggested by Hearne et al. (4), were:
IL2 forward: 5′-ACTAGCAAGAGTTGGTCTC-
TG-3′ and reverse: 5′-ATTTTATATGTCTCTA-
GTTGCAC-3′; IL6 forward: 5′-TGTATAGAGC-
CCAATAAAGTG-3′ and reverse: 5′-ACCATG-
CCCAGCCTAATCTAG-3′; Myc: forward: 5′-C-
GTCACTGATAGTAGGGAGTA-3′ and reverse:
5′-TCAGCGTGCTGTACTTCCAAG-3′.
Figure 3. Lanes 1–3 show touchdown PCR prod-
ucts of microsatellites at the D2Mit126 in CBA/
Ca (160 bp), C57BL/6J (190 bp) and C3HeB/HeJ
× C57BL/6J F1 hybrid (160–190 bp), respective-
ly. Lanes 4–6 show touchdown PCR products of
microsatellites at the D2Mit43 in CBA/Ca (242
bp), C57BL/6J (210 bp) and C3HeB/HeJ ×
C57BL/6J F1 hybrid (242–210 bp), respectively.
Lanes 7 and 8 are multiplex-touchdown PCR
products of these two loci in CBA/Ca and
C57BL/6J, respectively, and lane 9 demonstrates
the products of these two loci in the F1 hybrid.
The molecular marker (HaeIII-digested pBR332
DNA) is shown in lane M. Arrows indicate the
position of the expected products. The primers
(Murine MapPairs, Research Genetics, Hunts-
ville, AL, USA) were: D2Mit126 forward: 5′-
GCTGAACTGAGCAAATTCTGG-3′ and re-
verse: 5′-TGACAATGGGAAGTTATGTGTAT-
G-3′; D2Mit43 forward: 5′-GGGAGGGGTC-
AGAATTCAAT-3′ and reverse: 5′-GTGCAGG-
ATACTTGATGTCTTCC-3′.
Vol. 23, No. 1 (1997)
Benchmarks
Table 1. Microsatellite Markers Used in This Study
Chromosome Product Touchdown Annealing Temperature
(cM) Locus Size (bp) Group I (55°°C) Group II (60°°C)
1 (41) MMBCl2 132 60
2 (8) D2MIT316 121 60
2 (18) D2MIT83 114 60
2 (18) D2MIT151 134 55
2 (18) D2MIT180 147 55
2 (20) D2MIT64 178 55
2 (28) D2NdS1 192 55
2 (28) D2MIT85 116 60
2 (32) D2MIT8 188 55
2 (34) D2MIT9 190 55
2 (34) D2MIT34 138 60
2 (34) D2MIT61 142 60
2 (37) D2MIT90 100 60
2 (37) D2MIT91 174 60
2 (37) D2MIT182 151 60
2 (39) D2MIT56 114 60
2 (44) D2MIT37 123 55
2 (44) D2MIT271 148 55
2 (45) D2MIT35 140 55
2 (45) D2MIT93 142 60
2 (47) MMILIB 257 55
2 (49) D2MIT126 160 60
2 (53) D2MIT13 180 60
2 (53) D2MIT41 118 55
2 (53) D2MIT42 142 55
2 (53) D2MIT43 242 60
2 (57) D2MIT129 110 55
2 (57) D2MIT131 150 55
2 (66) D2MIT133 203 55
2 (66) D2MIT104 148 60
2 (66) D2MIT395 122 55
2 (70) D2MIT105 108 55
2 (75) D2MIT106 154 55
2 (76) D2MIT135 240 55
2 (76) D2MIT192 146 55
2 (77) D2MIT46 118 55
2 (83) D2MIT261 113 55
2 (84) D2MIT26 195 55
2 (85) D2MIT140 107 55
3 (32) IL2 232 55
4 (29) D4NDS3 132 55
4 (45) D4NDS1 100 55
4 (53) D4NDS2 95 55
4 (30) D4MIT17 144 55
4 (3) D4MIT104 241 60
4 (4) D4MIT317 92 55
4 (39) D4MIT15 329 60
4 (10) D4MIT261 123 60
4 (2) D4MIT316 112 60
5 (11) MMIL6A 78 55
7 (74) MMINT2 161 55
11 (59) D11MIT54(MMHOX23R) 138 55
11 (9) D11MIT107(MMP53IN4) 142 55
11 (25) D11MIT111(MMIL4G12) 132 60
15 (18) MMYCE12 107 55

42 BioTechniques Vol. 23, No. 1 (1997)

Benchmarks
primer melting temperature compatibil-
ity. Nevertheless, this approach should
facilitate the analysis of mouse mi-
crosatellite-length polymorphisms and,
in principle, should be applicable to
similar studies in other species.
REFERENCES
1.Chamberlain, J.S., R.A. Gibbs, J.E. Ranier,
P.N. Nguyen and C.T. Caskey. 1988. Detec-
tion screening of the Duchenne muscular dys-
trophy via multiplex DNA amplification. Nu-
cleic Acids Res. 16:11141-11156.
2.Chou, Q., M. Russell, D.E. Birch, J. Ray-
mond and W. Bloch. 1992. Prevention of pre-
PCR mis-priming and primer dimerization
improves low-copy-number amplifications.
Nucleic Acids Res. 20:1717-1723.
3.Don, R.H., P.T. Cox, B.J. Wainright, K.
Baker and J.S. Mattick. 1991. ‘Touchdown’
PCR to circumvent spurious priming during
gene amplification. Nucleic Acids Res.
19:4008.
4.Hearne, C.M., M.A. McAleer, J.M. Love,
T.J. Aitman, R.J. Cornall, S. Ghosh, A.M.
Knight, J.-B. Prins and J.A. Todd. 1991.
Additional microsatellite markers for mouse
genome mapping. Mamm. Genome 1:273-
282.
5.Li, H., X. Cui and N. Arnheim. 1990. Direct
electrophoretic detection of allelic state of sin-
gle DNA molecules in human sperm by using
the polymerase chain reaction. Proc. Natl.
Acad. Sci. USA 87:4580-4584.
6.Love, J.M., A.M. Knight, M.A. McAleer
and J.A. Todd. 1991. Towards construction
of a high resolution map of the mouse genome
using PCR-analyzed microsatellites. Nucleic
Acids Res. 18:4123-4129.
7.Mellersh, C. and J. Sampson. 1993. Simpli-
fying detection of microsatellite length poly-
morphisms. BioTechniques 15:582-584.
8.Sambrook, J., E.F. Fritsch and T. Maniatis.
1989. Molecular Cloning: A Laboratory Man-
ual, 2nd ed. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
9.Scrimshaw, B.J. 1992. A simple nonradioac-
tive procedure for visualization of (dC-dA)n
dinucleotide repeat length polymorphisms.
BioTechniques 13:189.
10.Thein, S.L. and R.B. Wallace. 1986. The use
of synthetic oligonucleotides as specific hy-
bridization probes in the diagnosis of genetic
disorders, p. 33-50. In K.E. Davis (Ed.), Hu-
man Genetic Diseases: A Practical Approach.
IRL Press, Herndon.
11.Tindall, K.R. and T.A. Kunkell. 1988. Fi-
delity of DNA sequence by the Thermus
aquaticus DNA polymerase. Biochemistry
27:6008-6013.
We thank Dr. V.P. Bond for his critical
review of this paper. This work was support-
ed by US DOE Contract No. DE-AC02-
76CH00016. Address correspondence to K.
Noy Rithidech, Medical Department, Bldg.
490, Brookhaven National Laboratory, New
44 BioTechniques
York, NY 11973-5000, USA. Internet: diploid nature of the template DNA,
rithidech@bnlarm.bnl.gov with aa defined as code 1, tt as code 2
and at as code 3. This approach has
Received 12 February 1996; accepted clear potential for individual identifica-
6 January 1997. tion because the resulting digital code
varies greatly between individuals.
Kanokporn Noy Rithidech, The methodology currently used to
John J. Dunn and Chris R. detect MVR codes, based on agarose
gel electrophoresis and hybridization
Gordon with the appropriate probe, is tedious
Brookhaven National and time-consuming. Preliminary data
Laboratory using automated sequencers and fluor-
Upton, NY, USA escence-based technology have recent-
ly been published with promising re-
sults (2,5,6). We report an alternative
non-isotopic, high-resolution and rapid
method for the separation of MVR alle-
les on a partially automated electro-
phoretic system, the PhastSystem
(Pharmacia Biotech, Uppsala, Sweden).
Blood samples were obtained from
Minisatellite Variant healthy, unrelated individuals from the
Repeat Coding Using a Galician population (NW Spain). DNA
Semiautomatic System was extracted from whole-blood ali-
quots using a phenol-chloroform proce-
dure. Briefly, the samples were incubat-
BioTechniques 23:44-46 (July 1997)
ed in 50 mM Tris-HCl, 150 mM NaCl
and 100 mM Na2 EDTA, with the addi-
Individual-specific variation of hy- tion of 1.25% sodium dodecyl sulfate
pervariable minisatellites is not limited
to the number of repeats that constitute
these loci; minisatellites also differ in
the order of the basic repeating units
(4). The analysis of the interspersion
pattern of these variant repeat units
along minisatellite alleles using the
polymerase chain reaction (PCR) is a
new approach to assess individual vari-
ation in DNA. Minisatellite variant re-
peat mapping by PCR (MVR-PCR)
was developed by Jeffreys et al. (3) and
has been successfully applied to the hy-
pervariable human minisatellite MS32
(locus D1S8). This minisatellite con-
sists of a 29-bp repeat unit showing two
major classes of MVRs (designated a-
type and t-type) that differ by a single-
base substitution (7) and show highly
diverse dispersion patterns within alle-
les (4). Using MVR-specific amplifica-
tion primers, which prime specifically
either a- or t-type repeats, and a specific
primer located in the DNA flanking the
minisatellite, it is possible to generate a
ladder of PCR products corresponding
to the position of each a- and t-type re-
peat. The ocurrence of a- and t-type re-
peats along the minisatellite can be de-
scribed by a ternary code due to the