Aerts Thesis RG

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/293620360
The regulation of PINK1 kinase activity: implications for Parkinson's disease
Thesis · March 2015

DOI: 10.13140/RG.2.1.3875.5603
CITATIONS READS
0 380
1 author:
Liesbeth Aerts
UNSW Sydney
19 PUBLICATIONS 482 CITATIONS
SEE PROFILE
Some of the authors of this publication are also working on these related projects:
Halting antipsychotic use in long term care: the HALT project View project
DementiaKT Hub.and toolbox: DementiaKT.com.au View project
All content following this page was uploaded by Liesbeth Aerts on 09 February 2016.
The user has requested enhancement of the downloaded file.

ACTA BIOMEDICA LOVANIENSIA 673
KU Leuven
Group Biomedical Sciences
Faculty of Medicine
Center for Human Genetics
VIB Center for the Biology of Disease
Laboratory for the Research of Neurodegenerative Diseases
Liesbeth AERTS
THE REGULATION OF
PINK1 KINASE ACTIVITY
IMPLICATIONS FOR PARKINSON’S DISEASE
LEUVEN UNIVERSITY PRESS

Thesis submitted in partial fulfillment of the requirements for the degree
of *Doctor of Biomedical Sciences+
Promoter: Bart De Strooper

Co-promoter: Vanessa A. Morais
Chair: Joris de Wit
Secretary: Patrik Verstreken
Jury members: Wim Vandenberghe
Mark Cookson
Hélène Plun-Favreau
Wim Mandemakers
8 2015 by Leuven University Press / Presses Universitaires de Louvain / Universitaire Pers

Leuven.
Minderbroedersstraat 4 - bus 5602, B-3000 Leuven (Belgium)
All rights reserved. Except in those cases expressly determined by law, no part of this
publication may be multiplied, saved in an automated data file or made public in any way
whatsoever without the express prior written consent of the publishers.
ISBN 978 94 6165 161 7

D/2015/1869/18
NUR: 876
Abstract
Mutations in the PINK1 gene cause an early-onset familial form of the

common neurodegenerative movement disorder Parkinson’s disease. PINK1 is a
mitochondrially targeted kinase that regulates multiple aspects of mitochondrial
biology, from oxidative phosphorylation to mitochondrial clearance.
Ten years after its original implication in Parkinson’s disease, several downstream
substrates have been identified. However, the underlying biochemical
mechanisms remain poorly understood. PINK1 itself can be phosphorylated,
and while it is rapidly processed in healthy mitochondria, it accumulates on the
outer mitochondrial membrane under depolarizing conditions. In this work, we
try to clarify how this complex regulation orchestrates PINK1 kinase activity
in health and disease.
We set up a robust in vitro kinase assay for human PINK1 and confirm the direct
phoshorylation of both Parkin and Ubiquitin in the absence of depolarization.
Previously reported putative substrates TRAP1 and the Complex I subunit
NDUFA10 were not found to be directly phosphorylated by PINK1 in vitro.
We find differences in (auto)phosphorylation activity between full-length and
processed PINK1, or non-human PINK1 orthologues, which indicates that
structural differences affect kinase activity.
In order to understand the phosphoregulation of PINK1 activity, we
systematically analysed four previously identified PINK1 phosphorylation sites,
S228, T257, T313 and S402, for their role in autophosphorylation, substrate
phosphorylation, and mitophagy. Our data indicate that only two of these
sites, S228 and S402, are autophosphorylated in vitro, but residual unidentified
phosphorylation sites are present in PINK1. We furthermore establish that
phosphorylation of both S228 and S402 can regulate the phosphorylation of the
iii
iv ABSTRACT
substrates Parkin and Ubiquitin, but only S402 phosphorylation appears to be

important for full-length PINK1 function and is involved in Parkin recruitment
and the induction of mitophagy. Finally, we identify T313 as a residue that is
critical for PINK1 catalytic activity, but in contrast to previous reports, we
find no evidence that this activity is regulated by phosphorylation.
These data underscore the fine-tuned regulation of PINK1 kinase activity
through multisite phosphorylation. At the same time, we challenge the flawed
assumption that PINK1 activity is dependent on mitochondrial depolarization,
underscoring the all-round function of PINK1 as a regulator of mitochondrial
homeostasis in health and disease.
Samenvatting
Mutaties in het PINK1 -gen veroorzaken een erfelijke vorm van de ziekte
van Parkinson die zich al op jonge leeftijd manifesteert. PINK1 is een
mitochondriaal kinase dat betrokken is bij de regulatie van verschillende
mitochondriale functies, waaronder oxidatieve fosforylatie en mitofagie. Sinds
PINK1 in verband werd gebracht met de ziekte van Parkinson tien jaar geleden,
zijn verschillende substraten geïdentificeerd. De biochemische basis van hun
fosforylatie door PINK1 is echter nog niet volledig uitgeklaard. Bovendien
kan PINK1 ook zelf gefosforyleerd worden. PINK1 ondergaat proteolyse
in gezonde mitochondriën, maar accumuleert snel bij depolarisatie van de
mitochondriale membraanpotentiaal. In dit werk wordt onderzocht hoe deze
complexe regulatie de kinase-activiteit van PINK1 reguleert in fysiologische en
pathologische omstandigheden.
We ontwikkelden een in vitro proefopstelling voor het meten van PINK1
kinase-activiteit en bevestigen hiermee de directe fosforylatie van zowel
Parkine als Ubiquitine door PINK1 in afwezigheid van depolarisatie. De
eerder geïdentificeerde substraten TRAP1 en NDUFA10 worden in vitro niet
gefosforyleerd door PINK1. We stellen vast dat de (auto)fosforylatie-activiteit
verschilt tussen verschillende PINK1-orthologen en afhankelijk is van PINK1-
proteolyse. Dit wijst erop dat structurele verschillen de kinase-activiteit kunnen
beïnvloeden.
Om de regulatie van PINK1 door fosforylatie in kaart te brengen hebben
we op systematische wijze de rol van vier eerder geïdentificeerde fosforylatie
residu’s, S228, T257, T313 en S402, geanalyseerd, zowel in auto- en substraat
fosforylatie als in mitofagie. Onze data tonen aan dat slechts twee van deze
residu’s, S228 en S402, autofosforylatie ondergaan in vitro. Bovendien zijn er
v
vi SAMENVATTING
bijkomende, nog niet geïdentificeerde fosforylatie residu’s aanwezig in PINK1.

We stellen vast dat zowel fosforylatie van S228 als van S402 de fosforylatie van
de substraten Parkine en Ubiquitine beïnvloedt. S402 fosforylatie is belangrijk
voor de functie van het PINK1-eiwit voorafgaand aan proteolyse en speelt
een rol bij de werving van Parkine voor de inductie van mitofagie. Tenslotte
tonen we, in tegenstelling tot eerdere publicaties, aan dat het belang van T313
voor de katalytische activiteit van PINK1 onafhankelijk is van fosforylatie.
Deze resultaten benadrukken het belang van meervoudige fosforylatie bij
de nauwgezette regulatie van de kinase-activiteit van PINK1. Tegelijkertijd
ontkrachten we de hypothese dat PINK1-activiteit afhankelijk zou zijn van
mitochondriale depolarizatie, en onderstrepen we de algemene rol die PINK1
speelt als regulator van mitochondriale homeostase.
Contents
Abstract iii
Contents vii
List of Figures xi
List of Tables xiii
1 Introduction 1
1.1 The Parkinson’s disease challenge . . . . . . . . . . . . . . . . . . 1
1.1.1 A short history of Parkinson’s disease . . . . . . . . . . . 1
1.1.2 The search for a cause and a cure . . . . . . . . . . . . . 4
1.2 Understanding PINK1 kinase biology . . . . . . . . . . . . . . . 14
1.2.1 PINK1 kinase structure . . . . . . . . . . . . . . . . . . 14
1.2.2 PINK1 regulation by processing and phosphorylation . . 17
1.2.3 PINK1’s substrates and functions . . . . . . . . . . . . . 20
2 Aims 31
vii
viii CONTENTS
3 Materials and methods 33
3.1 Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33
3.2 Cell culture and stable cell lines . . . . . . . . . . . . . . . . . . 34
3.3 Mitochondrial fractionation . . . . . . . . . . . . . . . . . . . . 36
3.4 Sodium carbonate extraction . . . . . . . . . . . . . . . . . . . 36
3.5 Proteinase K accessibility assay . . . . . . . . . . . . . . . . . . 37
3.6 Protein dephosphorylation . . . . . . . . . . . . . . . . . . . . . 37
3.7 Tris-Acetate and Phos-tag SDS-PAGE . . . . . . . . . . . . . . 38
3.8 TcPINK1 in vitro kinase assay . . . . . . . . . . . . . . . . . . 39
3.9 hPINK1 in vitro kinase assay . . . . . . . . . . . . . . . . . . . 40
3.10 Substrate expression and purification . . . . . . . . . . . . . . . . 41
3.11 Mass spectrometry . . . . . . . . . . . . . . . . . . . . . . . . . 42
3.12 Parkin recruitment . . . . . . . . . . . . . . . . . . . . . . . . . 42
3.13 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . 43
4 Results 45
4.1 PINK1 purification and substrate validation . . . . . . . . . . . 45
4.1.1 Triboleum castaneum PINK1 . . . . . . . . . . . . . . . 47
4.1.2 Human PINK1 . . . . . . . . . . . . . . . . . . . . . . . 50
4.1.3 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . 57
4.2 PINK1 regulation by phosphorylation . . . . . . . . . . . . . . 58
4.2.1 PINK1 phosphorylation occurs at the outer membrane . 58
4.2.2 PINK1 phosphorylation does not influence localization or

processing . . . . . . . . . . . . . . . . . . . . . . . . . . 63
4.2.3 T313 and S402 are required for PINK1 phosphorylation 64

CONTENTS ix
4.2.4 S228 and S402 are autophosphorylation sites . . . . . . 67
4.2.5 S228 and S402 phosphorylation regulate substrate phos-

phorylation . . . . . . . . . . . . . . . . . . . . . . . . . 69
4.2.6 S402 phosphorylation regulates Parkin recruitment . . . 72
4.2.7 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . 74
5 Discussion 75
5.1 PINK1 activity . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
5.1.1 In vitro measurement of PINK1 activity . . . . . . . . . 75
5.1.2 PINK1 substrates and interactors . . . . . . . . . . . . . 77
5.2 PINK1 regulation . . . . . . . . . . . . . . . . . . . . . . . . . . 78
5.2.1 Structural features regulate PINK1 activity . . . . . . . 78
5.2.2 PINK1 phosphoregulation . . . . . . . . . . . . . . . . . 80
5.3 Different PINK1, different activity . . . . . . . . . . . . . . . . 83
6 Conclusions and perspectives 87
Bibliography 89
Curriculum vitae 105

List of Figures
1.1 Loss of dopaminergic neurons in substantia nigra leads to reduced

motor output in Parkinson’s disease . . . . . . . . . . . . . . . 3
1.2 Models of human PD-associated proteins . . . . . . . . . . . . . 6
1.3 Pathogenic mechanisms of PD . . . . . . . . . . . . . . . . . . . 12
1.4 PINK1 mutations and predicted kinase structure . . . . . . . . 15
1.5 Chemical basis of PINK1 phosphorylation . . . . . . . . . . . . 16
1.6 Localization of PINK1 proteases and substrates . . . . . . . . . 23
1.7 PINK1 orchestrates mitophagy of dysfunctional mitochondria . 25
4.1 Human, mouse and Triboleum castaneum PINK1 alignment . . 46
4.2 TcPINK1 is active in vitro . . . . . . . . . . . . . . . . . . . . . 47
4.3 NDUFA10 is not phosphorylated by TcPINK1 in vitro . . . . . 49
4.4 Human PINK1 is active in vitro . . . . . . . . . . . . . . . . . . 52
4.5 Full-length human PINK1 is not autophosphorylated in vitro . 53
4.6 Human PINK1 phosphorylates Parkin and Ubiquitin in vitro . 56
4.7 Phosphorylated PINK1 accumulates at the mitochondria . . . . 59
4.8 Phosphorylated PINK1 is at the outer mitochondrial membrane . 61
xi
xii LIST OF FIGURES
4.9 Mutation of S228, T257, T313 and S402 affects phosphorylation

without interfering with localization or processing . . . . . . . . 65
4.10 T313 and S402 are required for PINK1 phosphorylation at the
mitochondrial outer membrane . . . . . . . . . . . . . . . . . . 66
4.11 Autophosphorylation of N PINK1 occurs at S228 and S402 . 68
4.12 T313 and S402 are important for substrate phosphorylation . . 70
4.13 S228 regulates substrate phosphorylation by N PINK1 . . . . . 71
4.14 T313 and S402 are important for Parkin recruitment . . . . . . 73
5.1 Overview of the regulatory role of S228, T257, T313 and S402 . . 81
5.2 Localization of PINK1 and its candidate substrates . . . . . . . 84

List of Tables
1.1 Genes implicated in monogenic Parkinsonism . . . . . . . . . . 9
1.2 Overview of putative PINK1 substrates . . . . . . . . . . . . . 29
3.1 Primer overview . . . . . . . . . . . . . . . . . . . . . . . . . . 35
4.1 PINK1 purification efficiencies . . . . . . . . . . . . . . . . . . . . 51
xiii
Abbreviations
BCL-xL B-cell lymphoma extra Large

CCCP carbonyl cyanide m-cholorophenyl hydrazone
DDM n-dodecyl —-D-maltoside
FL full-length
GST glutathione S-transferase
HSP heat shock protein
HtrA2 high temperature requirement A2
IMS intermembrane space
KI kinase inactive
KO knockout
LDS lithium dodecyl sulfate
LPP lambda protein phosphatase
LRRK2 leucine-rich repeat kinase 2
MARK2 MAP/microtubule affinity regulating kinase 2
MBP maltose binding protein
Mfn2 mitofusin 2
MIM mitochondrial inner membrane
MOM mitochondrial outer membrane
MPP mitochondrial processing peptidase
MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
MTS mitochondrial targeting sequence
NDUFA10 NADH dehydrogenase (Ubiquinone) 1 alpha subcomplex 10
OXPHOS oxidative phosphorylation
PARL Presinilin-associated rhomboid-like protein
PBS phosphate buffered saline
xv
xvi ABBREVIATIONS
PD Parkinson’s disease
PINK1 PTEN-induced putative kinase
PK proteinase K
PTEN phosphatase and tensin homologue
PVDF polyvinylidene difluoride
Tc Triboleum castaneum
TCA tricholoroacetic acid
TRAP1 TNF receptor-associated protein 1
Ubl Ubiquitin-like
UPS Ubiquitin proteasomal system
WT wild type
Chapter 1
Introduction
1.1 The Parkinson’s disease challenge
Parkinson’s disease (PD) is the most common neurodegenerative movement

disorder affecting 1% of the elderly population. This number is expected to
increase over the coming decades, as a consequence of our ageing demographics.
At present, there is no cure for PD, which makes the disease a major social and
economic burden.
1.1.1 A short history of Parkinson’s disease
Clinical and pathological features
James Parkinson first described the disease bearing his name in his 1817 essay on
shaking palsy (Parkinson 1817). His original observations were further refined
by the end of the 19th century by Jean-Martin Charcot and William Gowers,
which led to the establishment of the cardinal clinical features of PD: rigidity,
bradykinesia, postural instability and resting tremor (reviewed by Goetz 2011).
However, since the original report by Parkinson, it took 100 years before the
symptoms were linked to pathological lesions in the midbrain.
1
2 INTRODUCTION
The motoric dysfunction exhibited by patients is a consequence of the progressive

degeneration of dopaminergic neurons in the substantia nigra, the pathological
hallmark of PD (Figure 1.1A). These neurons not only regulate voluntary
movement through the basal ganglia circuitry (Figure 1.1B), but also play a
role in a broad array of behavioural processes such as mood, reward, addiction,
and stress, explaining the appearance of non-motor symptoms in PD patients
as the disease progresses.
A second pathological hallmark is the presence of cytoplasmic protein inclusions
called Lewy bodies throughout the brain of PD patients (Figure 1.1C). They
were first observed a century ago by Frederic Lewy, and their role in disease
onset and progression has remained controversial ever since. Lewy bodies
consist mainly of misfolded –-synuclein protein (Spillantini et al. 1997) and
are characteristic of a group of different neurological conditions, referred to as
synucleinopathies. These include Lewy body dementia and multiple system
atrophy in addition to PD.
Current treatment is limited to symptom management
To compensate for the loss of dopamine signalling in the brain, patients

are treated with levodopa, a dopamine precursor which readily crosses the
blood-brain-barrier. Levodopa can temporarily alleviate the deficit in neuronal
communication, and its discovery revolutionized the clinical management of
PD (Birkmayer et al. 1961; Barbeau et al. 1962). Unfortunately, levodopa also
causes severe dyskinesia and gradually loses its effectiveness due to habituation
as the disease progresses.
Over the past 50 years, therapeutic development has mainly been limited to
refinement of levodopa delivery and the use of other dopamine metabolism
regulating agents, such as dopamine receptor agonists and inhibitors of dopamine
catabolism. Other therapeutic avenues including deep brain stimulation, stem
cell transplants and gene therapy have been explored (reviewed by Smith et al.
2012), but to date, symptom management through levodopa remains the gold
standard for PD treatment. A disease-modifying treatment is still lacking
and will only be possible if the underlying pathological mechanisms leading to
selective dopaminergic cell loss and disease development are understood.
THE PARKINSON’S DISEASE CHALLENGE 3
Figure 1.1: Loss of dopaminergic neurons in substantia nigra leads

to reduced motor output in Parkinson’s disease
A, In the midbrain of PD patients, the dopaminergic neurons that make up the substantia
nigra are lost. While the substantia nigra is clearly visible in midbrain sections of healthy
brains, this pigmented brain section is absent in PD brains (black arrow). B, The dopaminergic
neurons in the substantia nigra (SNc) give input to the basal ganglia (Putamen, Globus
pallidus (GP) and Subthalamic nucleus (STN)). Excitatory input (green) to the putamen
activates neurons of the direct and indirect pathways. Neurons in the direct pathway inhibit
(red arrow) neurons in the internal segment of GP (GPi), and the GPi neurons in turn inhibit
neurons in the thalamus and suppress movement generation by the motor cortex. In contrast,
putamen neurons in the indirect pathway inhibit neurons in the external segment of the
GP (GPe), and the GPe neurons in turn inhibit GPi neurons. Thus the direct and indirect
pathways have opposing, but balancing, effects on the ease of movement generation. In
PD patients, dopaminergic neurons are lost and the output from SNc is strongly reduced,
ultimately leading to decreased activation of the cortex and limited activation of movement.
C, Immunohistochemical staining of Lewy bodies in brain tissue, the second pathological
hallmark of PD (adapted from ADAM Inc and Kandel et al. 2000).
4 INTRODUCTION
1.1.2 The search for a cause and a cure
Almost two centuries after James Parkinson’s seminal work, the true cause of
PD remains unresolved. Why a select neuronal population degenerates in PD
patients is still unclear. By the time patients start exhibiting motor symptoms,
60-80% of the dopaminergic neurons in their midbrain have been lost, and as a
consequence very little is known about disease onset. However, recent research
has shown that both environmental factors and genetic susceptibility - and the
interplay between the two - are important in the development of PD.
Environmental factors
Epidemiological studies show a strong correlation between PD prevalence and

age. While the prevalence stays well under 1% in the population younger than
70 years old, it rises to 2% of those aged 80 and older (Pringsheim et al. 2014).
The incidence rate of PD is 1.5 times higher in males than in females, although
this ratio depends on age and population (Taylor et al. 2007).
In addition to age and gender, there are modifiable environmental factors
associated with an altered risk of developing PD. Caffeine and nicotine
consumption are both linked to a decreased risk for PD (Hernán et al. 2002),
but the causality remains debated. Conflicting reports implicate alcohol with
an altered risk of PD. Nutrients with antioxidant properties such as resveratrol,
one of the components in red wine, may elicit neuroprotection against PD
(reviewed by Seidl et al. 2014). There is limited evidence for occupational
pesticide exposure to be positively correlated with PD (Hancock et al. 2008).
The implicated pesticides are all oxidative stressors, such as paraquat and
permethirn, or inhibitors of Complex I, the first complex of the electron transport
chain, such as rotenone (Tanner et al. 2009; Tanner et al. 2011; Dick et al.
2007). Traumatic brain injury has also been reported to increase the risk to
develop PD (S. M. Goldman et al. 2006), while physical exercise would lead to
a decreased risk (Thacker et al. 2008). Some of these modifiable environmental
factors, such as nicotine, are currently targeted therapeutically in clinical trials
(Kieburtz et al. 2013).
Parkinson’s disease genes
Recent advances in genetic studies have revolutionized PD research. Although

only a small minority of less than 5% of all PD cases is inherited, the study
of genetic defects causing PD can give important insights into the underlying
molecular pathogenesis. To date, more than 10 genes have been reported to
be implicated in monogenic PD (Table 1.1). The majority were identified
through linkage studies, well-suited for the identification of highly penetrant
disease-causing mutations. However, the advent of genome-wide association
studies using large numbers of patients and controls enables the identification
of disease risk factors. These are common genetic variants that alter the risk of
developing PD rather than cause disease.
Autosomal dominant Parkinson’s disease

Autosomal dominant PD can be caused by mutations in three genes: SNCA,
LRRK2 and VPS35. SNCA encodes –-synuclein, the main constituent of Lewy
bodies (Polymeropoulos et al. 1997; Spillantini et al. 1997). –-Synuclein is a
natively unfolded protein which comprises several imperfect repeat motifs typical
for lipid interacting domains. Its misfolding and aggregation as a consequence
of impaired protein degradation is a central feature of PD pathogenesis. The
gradual spread of Lewy bodies throughout PD patient brains and their presence
in transplanted dopaminergic neurons indicate that misfolded –-synuclein has
prion-like properties (Braak et al. 2003; Brundin et al. 2008). Both SNCA
mutations and duplications or even triplications have been found in PD patients.
They usually have a high penetrance and cause a classic PD phenotype. Patients
with a triplication display more severe phenotypes, in line with a gene dosage
effect (Singleton et al. 2003; Farrer et al. 2004). The physiological function of
–-synuclein remains poorly understood, but several lines of evidence indicate
that it plays an important role in synaptic transmission (reviewed by Snead
et al. 2014).
Mutations in Leucine-rich repeat kinase 2 (LRRK2 ) are the most common

cause of autosomal dominant PD (Paisan-Ruiz et al. 2004; Zimprich et al.
2004). Patients display classical PD symptoms, despite a broad range in disease
onset age (Healy et al. 2008; Haugarvoll et al. 2009). The gene encodes a
multi-domain protein, with GTP-ase and kinase activity and several protein
6 INTRODUCTION
interaction motifs. Consequently, LRRK2 plays a role in a wide variety of

cellular processes involving vesicle trafficking, including the proteasomal system,
the autophagic-lysosomal pathway, intracellular trafficking, endocytosis and
mitochondrial dysfunction (reviewed by Paisán-Ruiz et al. 2013). While the
most common mutation, G2019S, increases kinase activity, other mutations
affect LRRK2 protein function in an alternative way, illustrating the complexity
of the underlying pathogenic mechanisms (Rudenko et al. 2014).
Figure 1.2: Models of human PD-associated proteins

The –-Synuclein protein contains six imperfect repeats and has an N-terminal amphipathic
region, a hydrophobic central region that contains the nonamyloid-— component (NAC)
domain, and a highly acidic C-terminal tail containing several phosphorylation sites. LRRK2
is a multi-domain protein that consists of an ankyrin-repeat region (ANK), an N-terminal
leucine-rich repeat domain (LRR), a GTPase Roc domain (Roc) followed by associated
C-terminal of Roc (COR), a mitogen-activated kinase domain, and a C-terminal WD40 repeat
that might serve as a rigid scaffold for protein interactions. Parkin is a 465 amino acid
protein that contains an N-terminal ubiquitin-like (UBL) domain that binds to the RPN10
subunit of the 26S proteasome system, a central linker region, and a C-terminal RING domain
comprising two RING finger motifs (RING1 and RING2) separated by an in-between-RING
(IBR) domain. PINK1 is a 581 amino acid protein which localizes to the mitochondria via an
N-terminal mitochondrial targeting sequence (MTS) and contains a catalytic serine/threonine
kinase domain. DJ-1 is 189 amino acids long and belongs to the ThiJ/PfpI superfamily
(adapted from Mandemakers et al. 2007).
A single mutation in Vacuolar protein sorting 35 (VPS35 ) has been identified as

a novel cause of autosomal dominant PD (Vilariño-Güell et al. 2011; Zimprich
et al. 2011). As for SNCA and LRRK2, VPS35 mutation causes a classic PD
phenotype. VPS35 is part of the retromer complex, important in endosomal
trafficking and synaptic function. How VPS35 mutation can cause PD is still
unclear, but two research avenues point to its involvement in Wnt signalling
and the missorting of the iron transporter divalent metal transporter 1 (DMT1)
as a consequence of decreased retromer activity (reviewed by Deng et al. 2013).
Autosomal recessive Parkinson’s disease

Overall, autosomal recessive PD occurs less frequently but often presents at a
younger age than autosomal dominant forms. Interestingly, not all cases exhibit
Lewy body pathology (Farrer et al. 2001), which suggests that pathogenic
differences might exist between recessive and dominant genetic forms of PD.
Parkin, PINK1 and DJ-1, the three different genes implicated in this form of
familial PD, are all important for mitochondrial biology.
Mutations in Parkin account for about half of all cases of recessive PD and are
scattered over all exons (Kitada et al. 1998; Abbas et al. 1999; Lucking et al.
2000). Parkin is an E3-ubiquitin ligase that catalyzes the ubiquitination of a
wide variety of cellular proteins (Sarraf et al. 2013), flagging them for removal
by the ubiquitin proteasomal system (UPS). The protein structure of Parkin
consists of a regulatory Ubiquitin-like (Ubl) domain, a RING0 domain, a RING1
domain that binds to an E2 conjugating enzyme, in between ring domain and a
RING2 domain that mediates catalytic activity (Figure 1.2). The majority of
Parkin mutations lead to reduced E3 ligase activity. Both cellular and animal
models exhibit mitochondrial dysfunction (J. C. Greene et al. 2003; Palacino
et al. 2004; Mortiboys et al. 2008; Grünewald et al. 2010), as Parkin is required
for protein ubiquitination on impaired mitochondria (Narendra et al. 2008).
PTEN-induced putative kinase 1 (PINK1 ) encodes a mitochondria targeted

Ser/Thr kinase (Figure 1.2). Mutations in the PINK1 gene are less common
than Parkin mutations, and account for approximately 1-7% of all early-onset
PD cases (Gasser 2009). As for Parkin, PINK1 mutations lead to mitochondrial
dysfunction in cellular, Drosophila and murine models. pink1 and parkin mutant
phenotypes in Drosophila share several common features, including male sterility
and flight and climbing defects (reviewed by Dawson et al. 2010). Interestingly,
8 INTRODUCTION
PINK1 and Parkin are genetically linked: Parkin can rescue the defects caused
by pink1 deletion in Drosophila, indicating that both proteins function in the
same pathway and that PINK1 acts at least partially upstream of Parkin (Clark
et al. 2006; Park et al. 2006). Thus, both proteins act in concert in the regulation
of mitochondrial quality control (Narendra et al. 2010).
Mutations in Daisuke Junko 1 (DJ-1 ) are very rare (Bonifati et al. 2003),
and they impair cellular protection against oxidative stress in animal models
(Menzies et al. 2005; Park et al. 2005; Yang et al. 2005). DJ-1 is a member of
the ThiJ/PfpI family of molecular chaperones (Figure 1.2), it is a small protein
that forms dimers. The actual function of DJ-1 is poorly understood. One
possibility is that DJ-1 is an antioxidant scavenger. Alternatively it might act
as a chaperone or protease (reviewed by Cookson 2012). It is not clear how
DJ-1 function relates to the PINK1/Parkin pathway of mitochondrial quality
control.
Autosomal recessive atypical juvenile Parkinsonism

A number of recently identified recessive mutations cause atypical juvenile
Parkinsonism. This syndrome differs from idiopathic PD, as patients often
display additional clinical symptoms such as dystonia, supranuclear palsy,
myoclonus, visual hallucination or cognitive decline. The genes involved include
ATPase type 13A2 (ATP13A2 ) and phospholipase A2 group VI (PLA2G6 )
(Paisan-Ruiz et al. 2009; Ramirez et al. 2006), encoding proteins involved
in lysosomal function and lipid metabolism, but also F-box only protein 7
(FBXO7 ), which encodes an E3 ligase substrate-recruiting subunit (Di Fonzo
et al. 2009). Two others, DNAJC6 (Edvardson et al. 2012; Köro lu et al.
2013) and Synaptojanin 1 (SYNJ1 ; Krebs et al. 2013; Quadri et al. 2013), are
important for synaptic vesicle recycling.
For most of these mutations it remains unclear how they cause neurodegen-
eration, although some recent reports show possible interactions with other
PD genes. One example is FBXO7 which has been shown to colocalize with
–-synuclein in the brain of PD patients (Zhao et al. 2013), and to co-operate
with PINK1 and Parkin in mitochondrial maintenance (Burchell et al. 2013).
Thus, cell biological insights can lead to the grouping of several identified genes
into conserved pathological mechanisms, bringing us closer to an understanding
of the causes of PD.
Table 1.1: Genes implicated in monogenic Parkinsonism

12 genes have been confirmed to be implicated in either autosomal dominant (AD) or autosomal
recessive (AR) monogenic Parkinsonism (adapted from Spatola et al. 2014).
Gene Mutations Inheritance Gene product

SNCA A53T, A30P, H50Q, AD –-synuclein
G51D, E46K, tripli-
cation, duplication
LRRK2 G2019S, N1437H, AD Leucine-rich repeat kinase
R1441C/G/H, 2
Y1699C, I2020T
VPS35 D620N AD Vacuolar protein sorting 35
homolog
EIF4G1 R1205H AD Eukaryotic translation
initiation factor 4 “ 1
Parkin >100 mutations AR Parkin, E3 ubiquitin ligase
PINK1 >50 mutations AR PTEN-induced kinase 1
DJ-1 >10 mutations AR Daisuke Junko 1
ATP13A2 Duplications, AR Lysosomal P-type ATPase
G877R, L1059,
F182L, G504R
PLA2G6 R741Q, R747W, AR Calcium-independent,
Q452X, R635Q, phospholipase A2
R632W, D331Y
FBXO7 R378G, R498X, AR F-box only protein 7
T22M
DNAJC6 Q734X, intronic mu- AR Auxilin
tation
SYNJ1 R258Q AR Synaptojanin 1
10 INTRODUCTION
Putative genetic risk factors for Parkinson’s disease

Two other genes, Eukaryotic translation initiation factor 4 gamma 1 (EIF4G1 )
and Glucocerebrosidase (GBA), are PD risk factors. EIF4G1 mutations have
been linked to PD (Chartier-Harlin et al. 2011) but it remains to be confirmed
whether they can cause or alter the risk for PD (Tucci et al. 2012). EIF4G1 is
a scaffold protein for the translation initiation factor complex assembly, and
mutations affect mRNA translation (Villa et al. 2013). Heterozygous mutations
in the GBA gene confer a 5-fold increased risk for PD (Sidransky et al. 2009).
Evidence suggests that both loss and gain of function mutations contribute to
the disease risk, but the pathogenic mechanism is not known. GBA mutation-
associated PD resembles idiopathic PD but more frequently involves cognitive
dysfunction (reviewed by Swan et al. 2013).
Dopamine selectivity: an open question
During the progression of PD, several neuronal populations are affected, and
Lewy body pathology gradually spreads throughout the brain (Braak et al.
2003). The different pathological stages could explain for example smell loss
as a pre-motor symptom in PD patients, and also cognition problems and
other non-motor symptoms in advanced cases (J. G. Goldman et al. 2014).
However, the loss of dopaminergic neurons is particulary striking and a central
but unresolved issue in PD research is why these neurons are exceptionally
vulnerable to cell death. Neither environmental factors nor genetic defects
confer a specific risk for this neuronal population, so consequentially, there must
be a unique feature of dopaminergic neurons that makes them susceptible to
these insults.
Firstly, dopaminergic neurons are of course characterized by their ability to
produce dopamine. Oxidation of dopamine and its metabolites may lead to
the generation of superoxide radicals and oxidative stress (Hastings 1995).
Defects in dopamine uptake or metabolism, or simply a higher basal exposure
to oxidative stress might render dopaminergic neurons exceptionally vulnerable
to additional insults. A second atypical feature of dopaminergic neurons lies
in their handling of calcium fluxes. Contrary to most neurons in the brain,
dopaminergic neurons exhibit autonomic pacemaking activity. Because they
also engage calcium channels in this process, they have an overall lower capacity
for calcium buffering compared to other neurons (Surmeier et al. 2010). Thirdly,
dopaminergic neurons form an enormous number of synapses, several orders
of magnitude greater than most other neurons (Arbuthnott et al. 2007). The
sheer energetic demand could be a possible reason for increased susceptibility
to cell death caused by a small but prolonged mitochondrial insult, for example.
It remains unclear which – if any – of these specific features explains the
degeneration of dopaminergic neurons in Parkinson’s disease.
Pathogenic mechanisms of Parkinson’s disease
Since clear indications with regard to the causes of dopaminergic cell loss are
lacking, there is a strong need for a better understanding of the molecular
mechanisms underlying disease development. Although genetic forms of PD
are rare, investigating the role of the affected genes can help to identify the
underlying causes of idiopathic PD as well. When 12 different genes with a
variety of functions are implicated in familial PD, several interrelated pathogenic
mechanisms emerge, which can broadly be divided into protein misfolding and
aggregation, and mitochondrial dysfunction (Figure 1.3).
Protein aggregation as a key feature in Parkinson’s disease

The accumulation of misfolded proteins is characteristic of many neurodegen-
erative diseases and highlights the relevance of defects in the clearance of
dysfunctional proteins. However, it remains unclear what the role of these
protein aggregates or their oligomeric intermediates is in disease progression.
Are they primary or secondary features; toxic species, or by-products of the
actual pathogenic process?
There are two major pathways for protein degradation: the ubiquitin
proteasomal system (UPS) and the autophagic-lysosomal pathway. Short-
lived and misfolded proteins are flagged with Ubiquitin for removal by ubiquitin
ligases. This targets them to the proteasome where they are degraded by
proteolysis. Large cellular components, such as mitochondria, are degraded
by the autophagic-lysosomal pathway, which involves the formation of double
membrane structures called autophagosomes. These fuse with lysosomes leading
to the hydrolysis of the content (reviewed in Myeku et al. 2009).
Lewy bodies are a feature of both idiopathic and genetic forms of PD. –-
Synuclein, the main constituent of Lewy bodies (Spillantini et al. 1997), is
12 INTRODUCTION
Figure 1.3: Pathogenic mechanisms of PD

The discovery of Mendelian inherited genes has enhanced our understanding of the pathways
that mediate neurodegeneration in PD. One main pathway of cell toxicity arises through
–-synuclein protein misfolding and aggregation. Misfolded proteins are ubiquitinated and
degraded by the ubiquitin proteasomal system (UPS), but failure leads to the formation of
fibrillar aggregates and Lewy bodies. –-Synuclein protofibrils may be directly toxic, leading to
the formation of oxidative stress that can further impair the UPS and accelerate accumulation
of aggregates. Another main pathway is the mitochondrial pathway. There is accumulating
evidence for impaired oxidative phosphorylation and decreased Complex I activity in PD,
which leads to reactive oxygen species (ROS) formation and oxidative stress. Loss of
the mitochondrial membrane potential leads to opening of the mitochondrial permeability
transition pore (mPTP), release of cytochrome c from the intermembrane space to the cytosol,
and activation of mitochondrial-dependent apoptosis resulting in caspase activation and cell
death. Recessive inherited PD-genes Parkin, PINK1 and DJ-1 have neuroprotective effects
against the development of mitochondrial dysfunction and control mitochondrial clearance.
Dysfunction of both pathways is interrelated by feedback and feedforward mechanisms,
ultimately leading to irreversible cellular damage and death (adapted from Abou-Sleiman
et al. 2006).
degraded by both the UPS and autophagic-lysosomal pathway (Webb et al.

2003). Mutant –-synuclein is less efficiently degraded by the UPS, and elevated
levels even inhibit its function (Tanaka et al. 2001). Mutations in Parkin and
LRRK2 are also associated with impeded protein degradation (Shimura et al.
2000; Tong et al. 2010). Together, PINK1 and Parkin regulate the removal of
defective mitochondria by mitophagy (Kazlauskaite et al. 2014b).
The central role of mitochondria in the etiology of Parkinson’s disease

In addition to generating energy for the cell, mitochondria play an important
role in different signalling pathways in the cell, including the induction of
apoptosis and calcium buffering. The discovery of their involvement in PD
pathogenesis dates back to the 1980s, when several drug-addicts were found
to display Parkinsonian symptoms after intoxication with MPTP (1-methyl-4-
phenyl-1,2,3,6-tetrahydropyridine) (Langston et al. 1983). This compound is
metabolized to MPP+ and selectively taken up in dopaminergic neurons. It
blocks the function of Complex I, the first complex in the mitochondrial electron
transport chain, causing dopaminergic neuron loss in both animals and humans.
These discoveries were substantiated when it first became clear that defects at
the level of Complex I existed in the substantia nigra neurons of post-mortem
brain tissue of PD patients (Schapira et al. 1989).
Numerous epidemiological studies also implicate mitochondria in PD disease
development: while substances with antioxidant properties reduce the risk for
PD, pesticides compromising mitochondrial function cause an increased risk.
Several neurotoxin-induced Parkinsonian animal models were based on the
findings that mitochondrial toxins can cause PD. While these animals
recapitulate the progressive dopaminergic cell loss observed in patients (Bové
et al. 2005) and are useful for the development of improved symptomatic
treatment, none of the protective or restorative treatment avenues based on
studies in toxin induced models have proven successful in human patients. It is
possible that the acute toxicity does not fully recapitulate the slow progressive
mechanisms of neuronal death in PD (Dawson et al. 2010). Nevertheless,
deregulated mitochondrial function is a key feature of both sporadic and familial
PD (reviewed by Schapira 2008), and therefore it is exceptionally interesting
to unravel the function of the mitochondrial genes implicated in familial PD.
Since the kinase PINK1 works at least in part upstream of Parkin, its biological
function is essential and central to prevent the development of PD.
14 INTRODUCTION
1.2 Understanding PINK1 kinase biology
The PINK1 gene encodes a structurally unique kinase with a mitochondrial

targeting sequence (MTS). In the 10 years since its initial linkage to PD (Valente
et al. 2004), significant progress has been made in understanding its function
in mitochondrial homeostasis. More than 50 different PINK1 mutations have
been found in PD patients (Figure 1.4; reviewed by Deas et al. 2009). While
the majority lie within the kinase domain, several are found in the N-terminal
and C-terminal regions of the kinase. These might affect activity indirectly, by
altering the protein stability, interaction capacity or proteolytic processing of
PINK1.
1.2.1 PINK1 kinase structure
Human PINK1 is 581 amino acids long and is comprised of an N-terminal

MTS, a hydrophobic region, a kinase domain and a C-terminal region. Its
structure has not been resolved, but the kinase domain can be modelled using
bioinformatic analysis based on the comparison between conserved features of
the known structures of PKA and CaMKII (Figure 1.4; Mills et al. 2008).
Kinase domains typically have two lobes: the N-terminal lobe is largely made
up of —-sheets and is involved in the binding of ATP, while the C-terminal
lobe consists of –-helices and only a few —-strands and is important for
substrate binding and coordination of magnesium. The catalysis of substrate
phosphorylation takes place at the intersection of both lobes. Three conserved
motifs within the N-terminal lobe coordinate the positioning of ATP: a glycine
loop – for PINK1 this loop stretches from amino acid 163 to 170 – an essential
and invariant lysine residue and a conserved glutamic acid, K219 and E240
respectively in PINK1. Human PINK1 also has three unique insertion loops
within its N-terminal lobe. These are possibly involved in regulation of PINK1
activity or substrate binding, as is the case for other known kinases (Rafie-
Kolpin et al. 2000; Tokumitsu et al. 1999).
The most important region in the C-terminal lobe is the catalytic loop which
contains a conserved His-Arg-Asp (HRD) motif. The Aspartic acid in this
motif, D362 in PINK1, acts as a catalytic base and accepts a proton from the
hydroxyl group of the Serine or Threonine on the substrate, which leads the
UNDERSTANDING PINK1 KINASE BIOLOGY 15
Figure 1.4: PINK1 mutations and predicted kinase structure

Kinases catalyze the phosphorylation of their substrates at the interaction of their N-terminal
and C-terminal lobes. Three conserved motifs in the PINK1 N-terminal lobe contribute to the
positioning of ATP: the glycine rich loop (red), Lysine 219 (blue) and Glutamate 240 (yellow).
The Aspartic acid 384 at the start of the activation segment (purple) in the C-terminal lobe
positions Mg2+ , which interacts with the — and “ phosphates of ATP, while Aspartic acid
362 in the catalytic loop (green) interacts with the substrate. Clinical mutations are found
throughout the entire kinase domain as well as in N and C-terminal regions (grey) of the
protein that flank the kinase domain (adapted from Mills et al. 2008 and Cruts et al. 2012).
16 INTRODUCTION
Figure 1.5: Chemical basis of PINK1 phosphorylation

Glutamic acid 240 interacts with Lysine 219 which helps to position ATP in the catalytic
cleft. Mg2+ interacts with the — and “ (red) phosphate of ATP, and Aspartic acid 384 on
PINK1. Aspartic acid 362 in PINK1 acts as a catalytic base and accepts a proton from the
hydroxyl group on the substrate. This frees up the hydroxyl oxygen on the target Serine (or
Threonine) to launch a nucleophilic attack on the “-phosphate of ATP.
hydroxyl oxygen to launch a nucleophilic attack on the “-phosphate of ATP

(Figure 1.5; Madhusudan et al. 1994). A regulatory loop flanked by Asp-Phe-Gly
(DFG) and Ala-Pro-Glu (APE) motifs often contains a phosphorylation site
that can regulate the kinase conformation for optimal substrate binding. The
Aspartic acid D384, positioned at the beginning of this motif, is required for
Mg2+ binding. Magnesium interacts with the — and “ phosphates of ATP.
The N-terminal region upstream of the kinase domain harbours a mitochondrial
targeting sequence (amino acids 1 to 34) and a hydrophobic patch (amino acid
94 to 110; Silvestri et al. 2005; Zhou et al. 2008). The 70 amino acids C-terminal
of the kinase domain show no sequence similarity with known protein domains
(Mills et al. 2008). Although there are some indications that this region is
involved in kinase activity regulation and substrate binding (Silvestri et al. 2005;
Sim et al. 2006), its precise function remains to be clarified. Taken together,
PINK1 harbours the essential conserved kinase motifs, but has various unique
regulatory elements, both within and outside of the kinase domain.
1.2.2 PINK1 regulation by processing and phosphorylation
Localization and processing
Full-length PINK1 is targeted to the mitochondria through its mitochondrial

targeting sequence. It is first processed by mitochondrial processing peptidase
(MPP), a matrix protease which cleaves off N-terminal peptides from precursor
proteins, and subsequently by Presinilin-associated rhomboid-like protein
(PARL; A. W. Greene et al. 2012; Deas et al. 2010; Jin et al. 2010; Meissner et al.
2011). PARL is located in the inner mitochondrial membrane and cleaves PINK1
in its hydrophobic patch, between amino acids A103 and F104 (Deas et al. 2010).
The PARL cleavage product is retrotranslocated to the cytoplasm where it is
degraded in a proteasome dependent manner (Yamano et al. 2013; Fedorowicz
et al. 2014). The knockdown of two other mitochondrial proteases, the inner
membrane protease m-AAA and the matrix localized ClpXP, also results in
the accumulation of PINK1, indicating that at least four proteases are involved
in PINK1 processing (A. W. Greene et al. 2012). Under basal conditions, the
turnover of PINK1 is rapid, resulting in low levels of endogenous PINK1 (Lin
et al. 2008). In the absence of PARL or upon mitochondrial depolarization,
PINK1 processing is impeded resulting in strong protein accumulation (Narendra
et al. 2010; Jin et al. 2010; Deas et al. 2010; Meissner et al. 2011).
Despite recent advances in our understanding of PINK1 processing, there are

still conflicting views on the submitochondrial localization of the PINK1 kinase
domain. Some studies show that PINK1 is only partially imported inside of the
mitochondria allowing for its N-terminal cleavage by MPP and PARL while the
kinase domain remains at the outer surface of the mitochondria (Yamano et al.
2013; Becker et al. 2012). However, other studies show that PINK1 or at least
its processed forms are located inside of the mitochondria (A. W. Greene et al.
2012; Jin et al. 2010; Gandhi et al. 2006; Silvestri et al. 2005). It is not fully
understood how PINK1 can be (partially) imported and processed by inner
mitochondrial proteases, or what the functional importance of this processing
might be.
18 INTRODUCTION
Activity and (auto)phosphorylation
Multiple examples in literature illustrate that phosphorylation can regulate the

activity or even the substrate binding of kinases (Cohen 2000). PINK1 has also
been reported to be phosphorylated on at least four different residues, which
suggests that possible regulatory mechanisms are at play (Okatsu et al. 2012;
Matenia et al. 2012; Kondapalli et al. 2012).
PINK1 autophosphorylation has been observed in vitro (Silvestri et al. 2005;
Pridgeon et al. 2007; Beilina et al. 2005). The active insect orthologue TcPINK1
is also readily autophosphorylated in vitro (Woodroof et al. 2011). Two recent
studies identify three autophosphorylation sites on PINK1: residues S228, T257
and S402 (Okatsu et al. 2012; Kondapalli et al. 2012). Using cellular assays,
both studies show that CCCP-induced depolarization leads to the accumulation
of phosphorylated PINK1. Mass spectrometry, mutagenesis and the use of
phospho-specific antibodies further demonstrated the involvement of S228, T257
and S402 in autophosphorylation (Okatsu et al. 2012; Kondapalli et al. 2012).
Both S228 and T257 are located in the N-terminal kinase lobe, while S402 is
located in the activation loop of the C-terminal lobe of PINK1.
The correlation between depolarization and detection of phosphorylated PINK1
suggests that PINK1 accumulation triggers its activation, possibly through
dimerization and subsequent transphosphorylation (Okatsu et al. 2013). This
PINK1 phosphorylation has functional consequences as mutation of both S228
and S402 to Alanine affects Parkin recruitment to depolarized mitochondria
(Okatsu et al. 2012). Thus PINK1 could be activated through phosphorylation
to initiate mitophagy. However, whether or not this activation occurs
through regulation of Parkin or Ubiquitin phosphorylation remains unclear,
as phosphodead Parkin is still recruited to the mitochondrial surface after
depolarization (Song et al. 2013; Iguchi et al. 2013; Shiba-Fukushima et al.
2012).
PINK1 activity can also be regulated through phosphorylation by other
kinases. One kinase found to regulate PINK1 activity is microtubule affinity
regulating kinase 2 (MARK2; Matenia et al. 2012). MARK2 is a Ser/Thr
kinase involved in microtubule dynamics and cellular transport. MARK2
phosphorylates microtubule-associated proteins, such as tau, causing their
detachment from microtubules. PINK1 interacts with MARK2, and is
consequently phosphorylated in a MARK2-dependent manner. Truncated, but

not full-length PINK1, is phosphorylated on T313 by MARK2 in an in vitro assay
(Matenia et al. 2012). This phospho-modification regulates PINK1’s function
in mitochondrial motility, stimulating anterograde or retrograde transport via
processed or full-length PINK1 respectively (Matenia et al. 2014; Matenia et al.
2012). T313 is located in the kinase domain, adjacent to the third insertion
loop in the N-terminal lobe.
Taken together, these studies indicate that PINK1 can be regulated through
phosphorylation. Although the biochemical aspects of this regulation will need
further clarification, this phosphorylation could be important in the regulation
of different PINK1 functions such as mitochondrial clearance and motility.
20 INTRODUCTION
1.2.3 PINK1’s substrates and functions
Defects in almost all aspects of mitochondrial biology have been reported

upon PINK1 mutation or deletion in cell-based, Drosophila and murine models
(reviewed by Scarffe et al. 2014; Steer et al. 2015). Accordingly, PINK1 regulates
a whole range of proteins with diverse mitochondrial functions, including
mitochondrial dynamics (Deng et al. 2008; Poole et al. 2008; Lutz et al. 2009),
motility (Weihofen et al. 2009; Wang et al. 2011) and clearance (Narendra et al.
2010), as well as apoptosis (Pridgeon et al. 2007; Arena et al. 2013), OXPHOS
regulation (Gautier et al. 2008; Morais et al. 2009) and calcium signalling
(Gandhi et al. 2009). These PINK1 substrates include both mitochondrial and
cytoplasmic proteins (Figure 1.6; Table 1.2).
PINK1 in healthy mitochondria
PINK1 regulates mitochondrial stress-signalling via TRAP1 and HtrA2

The first reported PINK1 substrate is TNF receptor-associated protein 1/Heat
shock protein 75 (TRAP1/HSP75) (Pridgeon et al. 2007), a chaperone member
of the HSP90 family residing in the mitochondrial intermembrane space. Co-
localization and co-immunoprecipitation assays show that PINK1 interacts
with TRAP1 in cellular models (Pridgeon et al. 2007). Endogenous TRAP1
is phosphorylated in response to oxidative stress induced by H2 O2 treatment.
Overexpression of PINK1 increases phosphorylation of endogenous TRAP1,
while siRNA against PINK1 reduces it. In addition, purified PINK1 was shown
to directly phosphorylate TRAP1 in vitro (Pridgeon et al. 2007). However,
another group using catalytically active PINK1 could not confirm this finding
(Kondapalli et al. 2012).
Nevertheless, there is additional evidence for both proteins to functionally
interact in Drosophila, as TRAP1 expression ameliorates motor performance,
increases lifespan and reduces paraquat sensitivity in PINK1 mutant flies
(Costa et al. 2013). Restoration of mitochondrial oxidative phosphorylation and
ATP production in PINK1 mutant flies expressing TRAP1 was reported in an
independent study (Zhang et al. 2013). Interestingly, TRAP1 has only a limited
effect on Parkin mutant phenotypes, suggesting that TRAP1 acts downstream
of PINK1 but in parallel to Parkin.
In sum, there is clear evidence that PINK1 and TRAP1 interact genetically as
well as physically, and that this interaction is important for mitochondrial stress
response and ATP production at the cellular level. However, it remains unclear
whether and how PINK1 phosphorylation of TRAP1 influences this interaction.
A second putative partner of PINK1 is high temperature requirement A2

(HtrA2), also known as Omi (Plun-Favreau et al. 2007). This mitochondrial
serine protease is released to the cytosol during apoptosis, where it binds
apoptosis inhibiting proteins which leads to caspase activation (Vande Walle
et al. 2008). Intriguingly, both HtrA2 knockout mice and mice with a protease-
inactivating mutation in HtrA2 display a motoric phenotype reminiscent of PD
(Jones et al. 2003; Martins et al. 2004). Moreover, two HtrA2 mutations have
been identified in a cohort of PD patients, leading to the designation of HtrA2
as PD gene PARK13 (Strauss et al. 2005).
Like TRAP1, HtrA2 was shown to co-immunoprecipitate with endogenous
PINK1. Upon activation of the MEKK3/p38 pathway, HtrA2 is phosphorylated
in a PINK1-dependent manner, as siRNA against PINK1 causes a decrease in
phosphorylated HtrA2 (Plun-Favreau et al. 2007). In an in vitro phosphorylation
assay using p38 kinase, HtrA2 is phosphorylated on Ser142 (Plun-Favreau et al.
2007). However, active recombinant PINK1 does not phosphorylate HtrA2 in
vitro, indicating that PINK1 most likely regulates HtrA2 phosphorylation in
an indirect manner (Kondapalli et al. 2012). HtrA2 phosphomimetic mutants
display an increased proteolytic activity and an enhanced ability to protect cells
from cellular stress caused by 6-hydroxy dopamine or rotenone (Plun-Favreau
et al. 2007).
Through regulation of TRAP1 and HtrA2, PINK1 mediates the cellular response
to oxidative stress. However, the evidence for the role of both proteins as direct
substrates is limited. It is unclear whether TRAP1 can be phosphorylated
directly by PINK1 and how this modification alters TRAP1 activity. While for
HtrA2 the biochemical regulation by PINK1 is well-characterized (Plun-Favreau
et al. 2007), its phosphorylation most likely occurs in an indirect manner,
through an unknown intermediate partner.
22 INTRODUCTION
PINK1 controls Complex I function by phosphorylating its subunit NDUFA10

The link between Complex I and PD dates back 30 years, when a series of
drug induced Parkinsonism cases as well as sporadic PD cases were found to
display compromised Complex I activity (see section 1.1.2; Langston et al. 1983;
Schapira et al. 1989). Complex I, or NADH:ubiquinone oxidoreductase, is the
first enzyme of the electron transport chain, which couples the generation of an
electrochemical gradient across the inner membrane to energy production in
the form of ATP. It is composed of 46 subunits and catalyzes the transport of
electrons from NADH to ubiquinone (Koopman et al. 2010). Interestingly, cell-
based and animal models devoid of PINK1 also show a reduction in Complex I
activity (Gautier et al. 2008; Morais et al. 2009).
Complex I is regulated by phosphorylation on multiple residues (Maj et al.
2004). Mass spectrometry shows that the Complex I subunit NDUFA10 is
phosphorylated on residue S250 in a PINK1-dependent manner (Morais et
al. 2014). NDUFA10 is a subunit close to the ubiquinone binding pocket
of the complex (Vinothkumar et al. 2014). In contrast to the ubiquinone-
dependent activity of Complex I, NADH oxidation is not affected in the absence
of PINK1, which indicates that PINK1 phosphorylation is required for Complex I
function at the level of ubiquinone binding and/or reduction (Morais et al. 2014).
Introduction of a phosphomimetic version of NDUFA10 rescues the Complex I
dysfunction observed in PINK1 knockout cells, as well as the membrane potential
deficits and ATP content in Drosophila pink1 mutants (Morais et al. 2014).
NDUFA10 can rescue the Complex I deficiency observed in pink1 knockout flies,
but has no effect on parkin phenotypes or mitophagy, indicating that both are
part of different parallel pathways downstream of PINK1 (Pogson et al. 2014).
Similarly, the yeast Complex I Ndi1p can rescue several phenotypes observed in
pink1 mutant Drosophila, but does not alter parkin mutant phenotypes (Vilain
et al. 2012).
Although it is not clear whether NDUFA10 is phosphorylated directly by
PINK1, the fact that Complex I dysfunction is a common theme in both
sporadic and PINK1-related PD makes NDUFA10 an interesting substrate with
regard to therapeutic intervention. Indeed, in addition to the the yeast NADH
dehydrogenase Ndi1p, boosting oxidative respiration using the electron carrier
Vitamin K2 or via infra-red irradiation can rescue the deficits that occur in
pink1 mutant flies (Vilain et al. 2012; Vos et al. 2012; Vos et al. 2013).
PINK1 on damaged mitochondria
Unhealthy mitochondria are characterized by a loss of membrane potential, a

condition that can be artificially induced in cell culture by depolarizing agents
such as carbonyl cyanide m-cholorophenyl hydrazone (CCCP) or valinomycin.
Upon mitochondrial depolarization, PINK1 accumulates rapidly (Narendra et al.
2010; Jin et al. 2010) and prevents cellular apoptosis, immobilizes damaged
mitochondria, and mediates mitochondria removal through mitophagy. These
activities require the recruitment of multiple substrates and their consequent
phosphorylation and ubiquitination.
Figure 1.6: Localization of PINK1 substrates and proteases

PINK1 substrates are found in multiple mitochondrial compartments and even in the cytosol.
NDUFA10 is part of Complex I, which is located in the mitochondrial inner membrane (MIM).
TRAP1 and HtrA2 reside in the intermembrane space (IMS), while Miro, Mfn2 and BCL-xL
are associated with the mitochondrial outer membrane (MOM). Parkin and Ubiquitin are
cytosolic proteins. PINK1 is processed by several mitochondrial proteases, including MPP
and PARL, located in the matrix and MIM respectively (adapted from Aerts et al. 2015b).
24 INTRODUCTION
PINK1 triggers mitophagy through Parkin, Mitofusin2 and Ubiquitin

Mitophagy is the selective turnover of mitochondria by autophagy (Lemasters
2005), a process which has been described in yeast and mammalian cells. It
serves as quality control for the removal of damaged mitochondria as well as
for the steady-state turnover of mitochondria (Youle et al. 2011). An extensive
body of literature addresses the deregulation of this process in the absence of
PINK1, as PINK1 orchestrates mitophagy through the phosphorylation of three
substrate proteins: Parkin, Mitofusin and Ubiquitin (Kazlauskaite et al. 2014b).
Since the identification of a genetic link between PINK1 and Parkin, many groups
have tried to identify the molecular mechanisms underlying this interaction
(Park et al. 2006; Clark et al. 2006). The finding that a peptide containing
T175 of Parkin could be phosphorylated by PINK1 in vitro provided the first
preliminary evidence that Parkin could be a substrate of PINK1 (Kim et al.
2008). Other studies comparing both catalytically active and inactivated PINK1
confirmed this interaction (Sha et al. 2010), and identified residue S65 as a
PINK1 phosphorylation site on Parkin (Kondapalli et al. 2012; Shiba-Fukushima
et al. 2012).
In a cellular context, PINK1 accumulates on mitochondria following membrane
depolarization triggered by different uncouplers (Narendra et al. 2010) and
recruits Parkin to the outer mitochondrial membrane (Kim et al. 2008; Matsuda
et al. 2010). Parkin promotes the autophagic degradation of the dysfunctional
organelle by ubiquitination of various mitochondrial proteins (Figure 1.7;
Narendra et al. 2008). Recruitment of Parkin is dependent on the kinase
activity of PINK1, but it is disputed whether or not direct phosphorylation of
either T175 or S65 is required (Kim et al. 2008; Narendra et al. 2010; Song
et al. 2013; Iguchi et al. 2013; Kane et al. 2014; Shiba-Fukushima et al. 2012).
A recent study highlights that processed PINK1, upon retrotranslocation to the
cytosol (Yamano et al. 2013), interacts with Parkin to suppress its translocation
and the initiation of mitophagy (Fedorowicz et al. 2014). It is unclear whether
this interaction also relies on phosphorylation, but it highlights that the intricate
communication between PINK1 and Parkin is based on both PINK1 processing
and catalytic activity.
Two other putative PINK1 substrates, Mitofusin2 and Ubiquitin, participate in

the organization of mitophagy.
Figure 1.7: PINK1 orchestrates the clearance of dysfunctional

mitochondria through mitophagy
When mitochondria are depolarized, PINK1 accumulates at the outer membrane. Subsequently
Parkin is recruited from the cytosol and it ubiquitinates several outer mitochondrial proteins,
including Mitofusin2. This triggers the formation of an autophagosome and clearance of the
defective organelle (adapted from Haddad et al. 2013).
Mitofusin (Mfn) 1 and 2 are GTPases located at the outer mitochondrial

membrane that regulate mitochondrial fusion (Koshiba et al. 2004). They
are both ubiquitinated in a Parkin-dependent manner (Gegg et al. 2010;
Poole et al. 2010; Ziviani et al. 2010). In addition, Mfn2, but not Mfn1, is
phosphorylated by PINK1. Upon co-expression of PINK1 and Mfn2, a phospho-
Serine immunoreactive PINK1 form is detected, and through bio-informatic
prediction and mutagenesis, residues T111 and S442 were identified as Mfn2
phosphorylation sites (Chen et al. 2013).
Both residues are important for Parkin binding, as mutating both residues
to Alanine disrupts the interaction with Parkin (Chen et al. 2013). These
observations indicate that phosphorylated Mfn2 functions as a Parkin receptor.
Recently, several groups have independently demonstrated that Ubiquitin itself

also functions as a PINK1 substrate (Kane et al. 2014; Kazlauskaite et al. 2014a;
Koyano et al. 2014). Koyano et al. hypothesized that Ubiquitin could be a
PINK1 phosphorylation target, based on the fact that PINK1 phosphorylates
26 INTRODUCTION
the highly similar Ubiquitin-like domain of Parkin (Koyano et al. 2014). Mass
spectrometry analysis indeed identified phosphorylated Ubiquitin in wild type
but not in PINK1 knockout uncoupled mitochondria (Kazlauskaite et al. 2014a;
Kane et al. 2014; Koyano et al. 2014). Interestingly, the phosphorylated residue
on Ubiquitin is also S65. Direct phosphorylation of Ubiquitin at S65 could be
demonstrated in an in vitro kinase assay using the insect orthologue TcPINK1
(Kane et al. 2014; Kazlauskaite et al. 2014a; Koyano et al. 2014).
Multiple studies in the past year demonstrated that phosphorylation of both
Parkin and Ubiquitin at S65 is required to fully activate Parkin (Zheng et al.
2014). A feedforward model has been proposed in which Parkin is activated
through phosphorylation by PINK1 and initiates new ubiquitin chain synthesis
on outer mitochondrial membrane proteins (Ordureau et al. 2014). These
newly synthesized poly-Ubiquitin chains are in turn phosphorylated by PINK1
and subsequently bind and retain phosphorylated Parkin on the mitochondria
for further substrate ubiquitination (Ordureau et al. 2014). Phosphorylated
Ubiquitin chains are also less susceptible to removal by ubiquitin specific
proteases (Wauer et al. 2014), and as such PINK1 can directly alter the balance
between ubiquitination and deubiquitination.
In conclusion, there is compelling data for a role of PINK1 in the regulation of

mitophagy with no less than three different but strongly-interrelated proteins
acting as PINK1 substrates. As we are beginning to uncover the interplay
between phosphorylation and ubiquitination in mitophagy (Kazlauskaite et al.
2014b), it remains to be established how Parkin and Ubiquitin work in concert
and what part phosphorylated Mfn2 plays in this process. At the same time,
further research is needed to clarify the in vivo relevance of mitophagy in
neurons (Rakovic et al. 2013; Grenier et al. 2013; Amadoro et al. 2014).
PINK1 levels regulate mitochondrial mobility by targeting Miro for degradation

In addition and perhaps even preceding the recruitment of the mitophagic
machinery, PINK1 also prevents the transport of defective mitochondria along
microtubules through phosphorylation of Miro. The mitochondrial Rho-GTPase
Miro and its partner Milton, located at the outer mitochondria membrane,
are two essential adaptor proteins for kinesin (Glater et al. 2006). The
Miro/Milton/Kinesin complex is conserved in Drosophila and mammals, but
in humans two Miro orthologues, RHOT1 and RHOT2, exist (from here on
refered to as Miro1 and Miro2; Fransson et al. 2006).
PINK1 interacts with Miro2 independent of its kinase activity, and Miro and
Milton expression can recruit PINK1 to the mitochondria (Weihofen et al.
2009). Moreover, overexpression of Miro and Milton can rescue morphological
deficits observed in cells after siRNA downregulation of PINK1 (Weihofen et al.
2009), making Miro an interesting candidate substrate of PINK1. Bacterially
expressed Drosophila Miro lacking its transmembrane domain is phosphorylated
on a Serine residue in vitro by wild type but not catalytically inactive PINK1,
while in cellular assays phosphorylation of an unidentified Threonine residue in
Miro could be detected in the presence of PINK1 (Wang et al. 2011). These
findings remain controversial as another study using active recombinant PINK1
failed to detect direct in vitro phosphorylation of Miro by PINK1 (Liu et al.
2012; Kondapalli et al. 2012).
Overexpression of wild type but not kinase inactive PINK1 leads to selective
degradation of Miro and Milton (Wang et al. 2011). Parkin overexpression has
the same effect, and Parkin is also required for PINK1-induced loss of Miro.
Miro degradation is accompanied by a decrease in mitochondrial movement in
both directions (Wang et al. 2011), as removal of Miro also detaches kinesin from
the mitochondrial surface, preventing transport of the dysfunctional organelle.
Indeed, both PINK1 overexpression and Miro downregulation lead to a decreased
flux and net velocity of mitochondrial transport. A modest reduction of human
Miro1 and Miro2 levels is detected when both PINK1 and Parkin were co-
expressed (Liu et al. 2012). According to one study, S156 mutation in Miro2
prevented Parkin or PINK1-induced degradation of Miro, suggesting this residue
is a putative PINK1 phosphorylation site (Wang et al. 2011). In contrast, a
second study found that S156 mutant Miro1 and Miro2 were equally susceptible
to PINK1/Parkin-mediated degradation (Liu et al. 2012).
28 INTRODUCTION
Nevertheless, both studies propose the prevention of mitochondrial movement

as a novel mechanism by which the PINK1/Parkin pathway may quarantine
damaged mitochondria prior to their clearance. It remains unclear whether or
not Miro is directly phosphorylated by PINK1 and if this regulation is required
for its degradation.
PINK1 phosphorylates BCL-xL to prevent apoptosis upon depolarization

B-cell lymphoma extra large (BCL-xL) is a survival protein of the Bcl-2 family.
This family consists of both pro- and anti-apoptotic proteins, and collectively
they regulate the permeabilization of the mitochondrial membrane in the
induction of apoptosis (Adams et al. 2007). BCL-xL is located at the outer
mitochondrial membrane, where it prevents the release of cytochrome c and
caspases, inhibiting apoptosis (Adams et al. 2007).
Overexpressed PINK1 and BCL-xL interact as shown by reciprocal co-
immunoprecipitation and a two-hybrid luciferase assay (Arena et al. 2013). After
CCCP treatment, PINK1 co-localizes with BCL-xL at the outer mitochondrial
membrane (Arena et al. 2013). Using a phospho-specific antibody directed
against phosphorylated S62 on BCL-xL, endogenous BCL-xL was found to
be phosphorylated in SH-SY5Y cells, and this phosphorylation increases with
higher concentrations and longer exposures of CCCP (Arena et al. 2013; Hertz
et al. 2013). BCL-xL phosphorylation is dependent on PINK1 activity, as
PINK1 silencing decreases its detection levels, while overexpression of wild type
but not kinase inactive PINK1 has the opposite effect (Arena et al. 2013).
To their surprise, Arena et al. found no effect for BCL-xL in the regulation
of mitophagy, but rather report that BCL-xL phosphorylation by PINK1
protects against CCCP-induced apoptosis by impairing the pro-apoptotic
cleavage of the protein (Arena et al. 2013). Indeed, while PINK1 protects
against CCCP-induced apoptosis, this effect was abolished upon BCL-xL
knockdown, indicating that BCL-xL acts downstream of PINK1 to promote
survival. Phosphomimetic S62E mutation but not a phospho-inactive S62A
mutation of BCL-xL could rescue this effect. In accordance, downregulation
of PINK1 resulted in an increased detection of the pro-apoptotic cleaved form
of BCL-xL, while overexpression of either BCL-xL S62E or wild type but not
kinase inactive PINK1, leads to decreased levels of cleaved BCL-xL (Arena et al.
2013). Thus, in addition to HtrA2, BCL-xL is a second partner of PINK1 in
the regulation of apoptotic signalling.
Table 1.2: Overview of putative PINK1 substrates

A total of 9 different targets of PINK1 have been identified: 8 proteins localized in different
mitochondrial compartments or in the cytosol, and PINK1 itself through autophosphorylation.
Via these downstream partners, PINK1 regulates mitophagy, cellular stress signalling and
apoptosis, as well as mitochondrial motility and oxidative phosphorylation (OXPHOS).
Although target phosphosites have been identified, only Parkin and PINK1 itself have
been confirmed to be specifically and directly phosphorylated by human PINK1 in vitro
(MOM: mitochondrial outer membrane; IMS: intermembrane space; MIM: mitochondrial inner
membrane).
Direct
Substrate Localization Function Residue
substrate
BCL-xL MOM Apoptosis S62 ?
HtrA2 IMS Apoptosis S142 ?
Miro MOM Mitochondrial S156 ?
motility
Mitofusin2 MOM Mitophagy T111, S442 ?
NDUFA10 MIM OXPHOS S250 ?
Parkin Cytosol/MOM Mitophagy S65 Yes
T175 ?
TRAP1 IMS/MIM Stress response Unknown ?
Ubiquitin Cytosol/MOM Mitophagy S65 ?
PINK1 MOM T257 ?
S228, S402 Yes
30 INTRODUCTION
Non-physiological substrates
Several proteins have been used to study the catalytic activity of PINK1 in
vitro, independent of their designation as PINK1 substrates. These include
–-casein, Histone H1 and myelin basic protein (Sim et al. 2006; Silvestri et al.
2005; Woodroof et al. 2011). All of these proteins are multiphosphorylated and
they are often used as generic substrates in in vitro assays of many different
kinases.
Exploring the activity of different PINK1 orthologues, the group of Muqit found
that the insect orthologue TcPINK1 is more active than human PINK1 in vitro.
By screening a peptide library they identified a peptide, which was named
PINKtide, that functions as an in vitro TcPINK1 substrate and could provide
clues towards PINK1 substrate sequence specificity (Woodroof et al. 2011).
Chapter 2
Aims
Understanding the physiological function of the PINK1 kinase is of exceptional

interest. Mutations in the PINK1 gene are causal of early-onset familial PD,
and the involvement of PINK1 in mitochondrial homeostasis resembles what
is observed for sporadic cases. This suggests that PINK1 plays a role in a
general molecular mechanism that underlies both familial and idiopathic forms
of PD. PINK1 acts at least in part upstream of Parkin, another PD-related
gene, corroborating its central role in pathogenic pathways at the level of the
mitochondria. Indeed, intense research over the past decade shows that PINK1
is involved in numerous aspects of mitochondrial biology, and acts through
different putative downstream targets. However, the underlying molecular
mechanisms remain unknown. In this work we aim to characterize the kinase
activity of PINK1 by assessing the enzymatic activity in vitro and its potential
regulation through phosphorylation.
In vitro PINK1 activity and substrate validation
To understand the function of a kinase is to identify its substrates. A major

technical challenge in studying the catalytic activity of PINK1 is obtaining
purified enzyme that is active in vitro. Many studies have reported difficulties
in obtaining active PINK1 (Sim et al. 2006; Plun-Favreau et al. 2007; Mills
31
32 AIMS
et al. 2008; Woodroof et al. 2011), and consequentially few of the candidate
substrates have been independently confirmed in vitro. For this study, our first
goal is to establish a robust in vitro phosphorylation assay for full-length and
a truncated form of human PINK1. Consequently, we aim to study the direct
phosphorylation of PINK1 candidate substrates.
PINK1 regulation by phosphorylation
Intriguingly, besides phosphorylating putative downstream substrates, PINK1

itself is also phosphorylated upon depolarization. Understanding the regulation
of PINK1 activity is pivotal to interpret how PINK1 executes its different
functions in both healthy and depolarized mitochondria. The second part of
this work will focus on the analysis of the phosphorylation status of PINK1 under
basal and depolarizing conditions at the mitochondria. We will investigate how
phosphorylation of previously identified PINK1 phosphosites alters substrate
phosphorylation and PINK1 function.
Chapter 3
Materials and methods
3.1 Plasmids
TcPINK1 constructs were kindly provided by Miratul Muqit, University of

Dundee (Woodroof et al. 2011). Full-length cDNA of human PINK1, mouse
Parkin and NDUFA10 was obtained from Origene and cloned into pcDNA3.1-
V5/His-TOPO according to manufacturer’s protocol (Life Technologies). A
3xFLAG/Strep-tag was amplified via PCR (Matta et al. 2012) and cloned
on the C-terminus of PINK1 and NDUFA10 in the pcDNA3.1 vector using
conventional methods. Briefly, PCR products as well as digested vectors were
run on 0.8-1.5% agarose gels and extracted using Qiaquick Gel Extraction kit
(Qiagen). Ligation was performed using T4 DNA ligase (Promega) according to
a 1 to 3 molar ratio of vector and insert.
Mutant PINK1 constructs were generated by QuickChange II XL site-directed
mutagenesis (Agilent technologies) according to the manufacturer’s guidelines.
This method allows for the introduction of a mutation of interest in plasmid
DNA via PCR with primers containing the desired genetic alteration. After
PCR amplification, the parental non-mutated DNA is specifically digested and
the remaining mutated plasmid DNA is transformed. Subsequently, the DNA
of single colonies is analysed for the presence of the mutation via restriction
digest where possible, and Sanger sequencing.
33
34 MATERIALS AND METHODS
To obtain kinase inactive (KI) PINK1, Lysine 219 in the ATP-binding pocket
and Aspartic acid 362 in the catalytic core were both mutated to Alanine (K219A
D362A; Figure 1.5). For each of the reported phosphosites on PINK1 (Serine
228, Threonine 257, Threonine 313 and Serine 402) constructs were generated
with mutations to Aspartic acid (D) or Glutamic acid (E) (phosphomimetic) and
Alanine (A, phosphodead), referred to as S228D, S228E and S228A, etc. PINK1
harbouring a mutation at each of these four sites is referred to as quadruple
mutant PINK1 (4xD, 4xE, 4xA). PINK1 phosphomutants were also cloned into
the pMSCV retroviral vector.
A truncated form ( N) of PINK1 in pcDNA3.1 was created by PCR
amplification of PINK1 sequence from amino acid 113 to 581 and subsequent
TOPO-cloning according to manufacturer’s instructions (Life Technologies).
The Ubiquitin-like (Ubl) domain of Parkin was obtained by PCR amplification
of amino acids 1 to 108 from the pCMV-Parkin plasmid (Origene). The PCR
product was further cloned into pGEX-4T-1 (Addgene) in frame with the N-
terminal GST-tagged fusion construct, as was NDUFA10. All plasmids were
confirmed by performing sequencing analysis. An overview of the primers used
in this study is given in Table 3.1.
3.2 Cell culture and stable cell lines
Human embryonic kidney (HEK), HeLa, COS and mouse embryonic fibroblast
(MEF) cells were cultured at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s
medium/F-12 containing 10% fetal bovine serum (Life technologies). HEK, COS
and HeLa cells were transfected using TransIT transfection reagent (Mirus Bio)
according to the manufacturer’s instructions. Briefly, a ratio of 1 µg of DNA
plasmid per 3 µl transfection reagent was used. Stable cell lines expressing WT
PINK1 or quadruple mutant PINK1 were generated by retroviral transduction
of immortalized MEFs derived from PINK1 knockout (KO) mice (Morais et al.
2009) and PARL KO mice (Cipolat et al. 2006). At 30-40% confluence, the MEFs
were transduced using a replication-defective recombinant retroviral expression
system (Clontech) with either WT or quadruple mutant PINK1-FLAG in the
PINK1 KO MEFs, and PINK1-V5 in the case of PARL KO MEFs. Cell lines
stably expressing the desired proteins were selected based on their acquired
CELL CULTURE AND STABLE CELL LINES 35
Table 3.1: Primer overview

All primers used in this study for PCR cloning or quick change mutagenesis are listed per
gene for Parkin, NDUFA10 and PINK1.
Parkin
PCR cDNA Ubl F ccggaattcatgatagtgtttg
domain R cgctcgagtcagctcaggtcc
NDUFA10
PCR cDNA F gcgtcgacagatctgtcatggccttgaggttg
R cttcagccagatccacttgtcaccc
PINK1
PCR cDNA F atggcggtgcgacag
R cagggctgccctcca
PCR cDNA N F ccaccatggaaaaacaggcgg
Mutagenesis K219A F cccttggccatcgcgatgatgtggaac
R gttccacatcatcgcgatggccaaggg
Mutagenesis D362A F catcgcgcacagagctctgaaatccgacaac
R gttgtcggatttcagagctctgtgcgcgatg
Mutagenesis S228D F ggaacatctcggcaggtgactcgagcgaagccatcttg
R caagatggcttcgctcgagtcacctgccgagatgttcc
Mutagenesis S228E F ggaacatctcggcaggtgagtcgagcgaagccatcttgaac
R gttcaagatggcttcgctcgactcacctgccgagatgttcc
Mutagenesis S228A F ggaacatctcggcaggtgcctcgagcgaagccatcttg
R caagatggcttcgctcgaggcacctgccgagatgttcc
Mutagenesis T257D F ggggagtatggagcagtggattacagaaaatccaagagagg
R cctctcttggattttctgtaatccactgctccatactcccc
Mutagenesis T257E F ggggagtatggagcagtggactacagaaaatccaagagaggtcc
R ggacctctcttggattttctgtagtccactgctccatactcccc
Mutagenesis T257A F ggggagtatggagcagtggcttacagaaaatccaagag
R ctcttggattttctgtaagccactgctccatactcccc
Mutagenesis T313D F ggcctgggccatggccgggatctcttcctcgttatg
R cataacgaggaagagatcccggccatggcccaggcc
Mutagenesis T313E F ggcctgggccatggccgggagctcttcctcgttatg
R cataacgaggaagagctcccggccatggcccaggcc
Mutagenesis T313A F ggcctgggccatggccgggcgctcttcctcgttatg
R cataacgaggaagagcgcccggccatggcccaggcc
Mutagenesis S402D F gttgcccttcagcgactggtacgtcgatcggggcgg
R ccgccccgatcgacgtaccagtcgctgaagggcaac
Mutagenesis S402E F gttgcccttcagcgagtggtacgtcgatcggggcgg
R ccgccccgatcgacgtaccactcgctgaagggcaac
Mutagenesis S402A F gttgcccttcagcgcctggtacgtcgatcggggcg
R cgccccgatcgacgtaccaggcgctgaagggcaac
resistance to 5 µg/ml puromycin.

PINK1 KO HeLa cells were generated using CRISPR/Cas technology (Cong
et al. 2013). A target sequence was selected from the first exon spanning
the start codon of PINK1 (CGCCACCATGGCGGTGCGAC). This target
sequence was cloned in pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene) and
the plasmid was transfected in WT HeLa cells. Transfected cells were seeded at
single cell density and PINK1 expression in each clone was analysed via WB.
Selected clones in which PINK1 expression was absent were subjected to MiSeq
Next Generation sequencing analysis (Illumina) for the PINK1 gene sequence as
well as the top five off-target regions in the HeLa genome for the CRISPR guide
RNA. Results showed an 84bp deletion spanning the start codon of PINK1 on
all chromosomal copies. The five strongest predicted off-targets sites in the
HeLa genomic DNA were not cleaved by Cas9.
To induce mitochondrial membrane depolarization, MEFs, HEK and HeLa cells
were treated with 10 µM carbonyl cyanide m-chlorophenyl hydrazone (CCCP)
for 3 h. Proteasomal inhibition was induced by treating MEF cells with 10 µM
Lactacystin for 3 h.
3.3 Mitochondrial fractionation
Cells were collected and homogenized in isolation buffer (10 mM Tris-MOPS

pH 7.4, 0.5 mM EGTA-Tris pH 7.4, 0.2 M sucrose) at 1000 rpm using a Teflon
pestle for 30 strokes. Cell debris was pelleted at 600x g for 10 min. The
supernatant (post-nuclear or homogenate fraction) was centrifuged at 7,000x g
to separate the mitochondria-enriched fraction (pellet) from the mitochondria-
depleted or cytosol-enriched fraction (supernatant). The pellet was subsequently
washed in isolation buffer and re-centrifuged at 7,000x g for 10 min. Protein
concentration was measured using the Bradford assay (Thermo Scientific).
3.4 Sodium carbonate extraction
Na2 CO3 extraction of the mitochondrial fraction was performed by resuspending

a three times snap freeze-thawed mitochondrial pellet in freshly prepared 0.1 M
PROTEINASE K ACCESSIBILITY ASSAY 37
Na2 CO3 pH 11.5. After incubation on ice for 30 min, membrane-associated

proteins were separated by centrifugation at 100,000x g for 30 min. The pellet
was resuspended in 0.1 M Na2 CO3 pH 11.5 and subjected to a second incubation
on ice and centrifugation (Fujiki et al. 1982). Supernatants (containing extracted
proteins) of both centrifugation steps were pooled and the pellet was resuspended
in STE buffer (0.1 M NaCl, 10 mM Tris-HCl pH 8.0 and 1 mM EDTA) containing
1% Triton X-100 and Protease Inhibitors (Roche).
3.5 Proteinase K accessibility assay
Mitochondria were subjected to proteinase K (PK) digestion (Dimmer

et al. 2008). Briefly, 100 µg/ml PK (Roche) was applied in the following
buffer conditions: isolation buffer (10 mM Tris-MOPS pH 7.4, 0.5 mM
EGTA-Tris, 0.2 M sucrose), hypotonic medium (20 or 2 mM HEPES (N-2-
hydroxyethylpiperazine-N’-2-ethanesulfonic acid) as indicated) with or without
0.3% Triton X-100. All samples were incubated with end-over-end rotation
at 4°C for 30 min. PK was inactivated and proteins were precipitated with
tricholoroacetic acid (TCA, Sigma). All samples were incubated for 1 5min
at room temperature in TCA at 10% final concentration. After centrifugation
at 20,000x g for 10 min, protein pellets were resuspended in lithium dodecyl
sulfate (LDS) sample buffer (Life Sciences) with 4% —-mercaptoethanol, and
adjusted to neutral pH using Tris-HCl pH 11.
3.6 Protein dephosphorylation
Mitochondria enriched fractions were lyzed in PBS with 1% n-dodecyl —-D-

maltoside (DDM) and protease inhibitors (Roche). Mitochondrial lysate was
incubated at 30°C for 1 h with 200 U lambda protein phosphatase (LPP) in a
total reaction volume of 50 µl following manufacturer’s instructions (NEB).
Purified PINK1 bound to FLAG-beads was dephosphorylated either prior to or
post in vitro kinase assay by incubation at 30°C for 15 min with 800 U LPP
(NEB) in a total volume of 20 µl.
3.7 SDS-PAGE and immunoblotting on Tris-Acetate

and Phos-tag gels
Proteins were separated by SDS-PAGE on NuPage 7% Tris-Acetate gels (Life

Technologies) according to manufacturer’s instructions. Gel electrophoresis
was performed at 150 V for 80 min to allow optimal separation of different
PINK1 forms. Proteins were transferred from gels to nitrocellulose membranes
by wet transfer in 20% MeOH in NuPage Transfer buffer (25 mM Bicine, 25 mM
Bis-Tris, 1mM EDTA) at 25 V for 90 min.
For analysis on Phos-tag gels, samples were incubated for 10 min at 70°C in
Tris-Glycine SDS sample buffer (Life Sciences) with 4% —-mercaptoethanol.
Resolution gels with 7.5% acrylamide (Acryl/Bis 29:1), 50 µM Phos-TagT M
AAL-107 (Wako chemicals) and 100 µM MnCl2 were casted according to
manufacturer’s instructions, including 4.5% acrylamide stacking gels. Mn2+ -
Phos-TagT M interacts with phosphorylated proteins, altering their migration
pattern. Prior to transfer to polyvinylidene difluoride (PVDF) membrane, gels
were washed for 10 min with gentle shaking in Transfer buffer containing 1 mM
of EDTA to eliminate the manganese.
After transfer, membranes were blocked for 1 h in 5% milk in TBS-T (20 mM
Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Tween), and incubated with agitation in
primary antibody dilutions for 2 h at room temperature or overnight at 4°C.
Before and after incubation with secondary antibody dilutions, membranes were
washed three times 10 min in TBS-T. The following antibodies were used at
the indicated dilutions in TBS-T with 5% milk: mouse anti-FLAGM2 (Sigma;
1/5,000 dilution), mouse anti-V5 (Invitrogen; 1/5,000 dilution), rabbit anti-
PARL (Cipolat et al., 2006; 1/5,000 dilution), rabbit anti-PINK1 (BC100-494
Novus Biologics; 1/1,000 dilution), mouse anti-HSP60 (BD; 1/5,000 dilution),
rabbit anti-HtrA2 (R&D systems; 1/1,000 dilution), rabbit anti-TOM20 (Santa
Cruz; 1/1,000 dilution), rabbit anti-GST (Invitrogen; 1/5,000 dilution), mouse
anti-His (Invitrogen; 1/2,000 dilution), mouse anti-Ubiquitin (Santa Cruz;
1/2,000 dilution), goat anti-mouse HRP and goat anti-rabbit HRP (Biorad;
1/10,000 dilution). Signals were detected using ECL chemiluminescence with a
Fujifilm LAS-4000 imager and quantified using AIDA software.
TCPINK1 IN VITRO KINASE ASSAY 39
3.8 Purification of active Triboleum castaneum

PINK1 and in vitro kinase assay
MBP-tagged Triboleum castaneum (Tc) PINK1 was expressed in BL21 bacteria

and purified as previously described (Woodroof et al. 2011). Bacterial pellets
were lyzed in lysis buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1%
Triton X-100, 2 mM EDTA, 0.1% —-mercaptoethanol, 0.2 mM PMSF and 1 mM
benzamidine. Cleared lysate was added to amylose resin for binding at 4°C for
2 h. After several washes with wash buffer (50 mM Tris-HCl pH 7.5, 15 0mM
NaCl, 0.1 mM EGTA, 0.03% Brij-35, 0.1% —-mercaptoethanol, 0.2 mM PMSF
and 1 mM benzamidine), MBP-TcPINK1 was eluted with 12 mM maltose. The
eluted fractions were dialyzed overnight at 4°C in 50 mM Tris-HCl pH 7.5,
150 mM NaCl, 0.1 mM EGTA, 0.03% Brij-35, 0.7% —-mercaptoethanol and
270 mM sucrose and subsequently snap-frozen.
To measure peptide substrate phosphorylation, assays were set up in a total
volume of 50 µl, with all kinases at 1 µM and peptide substrates at 1 mM
concentration. For protein substrates, 1 µg of kinase and 2 µM substrate were
incubated in a total volume of 40 µl. In both cases the assay was performed in
50 mM Tris–HCl (pH 7.5), 0.1 mM EGTA, 10 mM MgCl2 , 2 mM dithiothreitol
(DTT) using 100 µM [“-32 P]-ATP (Perkin Elmer). Assays were incubated for
30 min at 30°C while shaking at 1200 rpm.
Peptide phosphorylation reactions were terminated by spotting the reaction
mixture onto P81 phosphocellulose paper and washing three times 10 min in
50 mM phosphoric acid. After a final wash in acetone, incorporation of [“-32 P]-
ATP was quantified by scintillation counting. Kinase activity was expressed in
units per mg as previously described (Hastie et al. 2006), where 1 unit represents
the incorporation of 1 nmol phosphate into the peptide or protein substrate in
1 min.
Protein substrate reactions were terminated by addition of LDS sample buffer
(Life Technologies) with 4% —-mercaptoethanol. The samples were separated
by SDS-PAGE electrophoresis and transferred onto a PVDF membrane.
Incorporation of radiolabelled phosphor was assessed via a storage phosphor
screen and development on Typhoon FLA-7000. AIDA software was used for
signal quantification.
3.9 Purification of active human PINK1 and in

vitro kinase assay
The procedure for human PINK1 purification and kinase activity measurement
was adapted from Hertz et al. 2013. Briefly, COS cells were transfected with
pcDNA-3.1-hPINK1-3xFLAG/Strep using TransIT transfection reagent (Mirus
Bio) according to manufacturer’s instructions. 48 h post transfection, cells
were harvested and lyzed in 25 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM
NaF, 1 mM MgCl2 , 1 mM MnCl2 , 0.5% Igepal, mammalian protease inhibitors
(Sigma), Complete protease inhibitor (Roche), 50 mg/L DNAse I, 50 mg/L
RNAse A and 1 mM DTT, and homogenized using a 22-G needle in 5 strokes.
After 25 min of centrifugation at 20,000x g, the cleared lysate was incubated
with FLAG-magnetic beads (Sigma) at 4°C for 45 min. The unbound fraction
was separated by magnetic force and removed, and the beads were washed 2
times in lysis buffer, followed by 3 washes with kinase assay buffer (50 mM
Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2 , 3 mM MnCl2 and 0.5 mM
DTT).
Kinase assays were performed immediately after purification, with hPINK1-
FLAG bound on beads and 1 to 2 µg of recombinant substrate protein and
100 µM ATP containing 5 µCi [“-32 P]-ATP in kinase assay buffer containing
10 mM DTT for autophosphorylation and Parkin substrate phosphorylation or
0.5 mM DTT for ubiquitin substrate phosphorylation. Reactions were incubated
at 22°C while shaking at 14,000 rpm for 1 h.
For peptide phosphorylation reactions, the supernatant fraction was seperated
by magnetic force and spotted onto P81 phosphocellulose paper. These
subsequently underwent three 10 min washes in 50 mM phosphoric acid, and
after a final wash in acetone, incorporation of [“-32 P]-ATP was quantified by
scintillation counting. PINK1 was eluted from the beads by incubation in
NuPage LDS sample buffer (Life Technologies) with 4% —-mercaptoethanol at
70°C for 10 min and vortexing twice.
Protein substrate assay samples and eluted PINK1 were separated by SDS-
PAGE electrophoresis and transferred onto PVDF membrane. Incorporation
of radiolabelled phosphor was assessed via a storage phosphor screen and
development on Typhoon FLA-7000. AIDA software was used for signal
quantification.
SUBSTRATE EXPRESSION AND PURIFICATION 41
3.10 Substrate expression and purification
BL21 bacteria were transformed with N-terminally GST-tagged Ubl-domain of

Parkin in pGEX-4T-1. For GST-Ubl Parkin, protein expression was induced
using 100 µM IPTG, and cells were incubated at 280 rpm and 37°C for 2 h.
Bacterial pellets were lyzed in 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1%
Triton X-100, 2 mM EDTA, 0.1% b-mercaptoethanol, 0.2 mM PMSF and 1 mM
benzamidine and purified using Glutathione SepharoseTM 4B (GE Healthcare)
according to manufacturer’s instructions.
Recombinant NDUFA10 was produced both in mammalian and bacterial
cells. HEK cells were transfected with FLAG-tagged NDUFA10 in pcDNA3.1.
NDUFA10 was purified using anti-FLAGM2 beads (Sigma) according to the
manufacturer’s instruction. GST-tagged NDUFA10 was produced in BL21
bacteria by transformation with an NDUFA10 pGEX-4T-1 plasmid. GST-
NDUFA10 expression was induced using 400 µM IPTG and cells were incubated
overnight at 20°C. Bacterial pellets were lyzed using BugBuster (Merck), leaving
GST-NDUFA10 unextracted in inclusion bodies. Inclusion bodies were washed
two times with 0.5 M NaCl PBS containing EDTA-free protease inhibitors
(Roche). Next, the inclusion bodies were resuspended in solubilization buffer,
containing 8 M urea and 0.5 M NaCl in PBS. Solubilization was allowed to
occur during 4 hour incubation with rotation at 4°C. Afterwards, solubilized
material was separated via centrifugation at 20,000x g for 10 min at 4°C and
dialyzed in PBS overnight.
To immunoprecipitate Complex I, 1 mg of mitochondria was lyzed in 1% DDM
in PBS with protease inhibitors (Roche) on ice for 30 min. After centrifugation
at 100,000x g for 30 min at 4°C, the supernatant was incubated overnight at
4°C with Complex I agarose (MitoSciences) and washed in PBS with protease
inhibitors and 0.05% DDM.
PINKtide (KKWI(pY)RRSPRRR), NDUFA10 S250 (KTFLPKMSEMCEVLV)
and A250 (KTFLPKMAEMCEVLV) peptides were synthesized by Biomatik.
Ubiquitin-His (Sigma), Histone H1 (Merck), TRAP1 (Enzo Life Sciences) and
–-casein (Sigma) were commercially obtained. The quality and purity of all
substrates was assessed via SDS-PAGE followed by Coomassie staining.
3.11 Mass spectrometry
Mass spectrometric analysis was performed within a collaboration with the

laboratory of Kirs Gevaert, VIB & Ghent University. Briefly, proteins subjected
to SDS-PAGE were stained using Coomassie and bands of interest were cut out
from the gel. Gel bands were washed to remove disturbing components and
subsequently proteins were in-gel digested by trypsin. The digests were acidified
and measured with LC-MS/MS. The MS/MS data, obtained by the Q-Exactive
mass spectrometer, were searched against the human SwissProt database.
3.12 Parkin recruitment
HeLa cells were seeded on 13mm coverslips and transfected at ±60% confluence
with Parkin-GFP and pMSCV-hPINK1-3xFLAG plasmids. 24 h post
transfection, cells were treated with 10 µM CCCP for 3 h or equivalent volume
of DMSO as control. Cells were washed three times in PBS, fixed in 4%
paraformaldehyde for 20 min, washed three times in PBS, permeabilized in
0.1% Triton X-100 in PBS for 10 min, followed by three washes in PBS. Cells
were blocked in blocking buffer (0.2% gelatin, 2% fetal bovine serum, 2% BSA,
0.3% bovine serum albumin, 0.3% TritonX-100 in PBS) with 5% donkey serum
(Jackson Immunolabs) for 1 h. They were stained using the following primary
antibodies at the indicated dilutions: 1/500 Turbo-GFP (Evrogen), 1/500
FLAGM2 (Sigma) and 1/500 Cytochrome c (Sigma) for 2 h. After 3 washes in
PBS they were incubated with secondary antibodies: 1/500 Alexa Fluor 647
donkey anti-mouse, 555 donkey anti-sheep and 488 donkey anti-rabbit (Life
Technologies). Images were acquired on a Zeiss LSM 510 confocal microscope
using a 60x objective and analysed with Image J software.
STATISTICAL ANALYSIS 43
3.13 Statistical analysis
The statistical significance of differences between conditions was tested with

GraphPad software using Student’s t-test or one-way ANOVA and post-hoc
Dunnett’s multiple comparison test as indicated (*: p < 0.05; **: p < 0.01; ***:
p < 0.001; ns: non-significant). All results are depicted as mean ± standard
error of the mean (SEM) of minimum 3 independent replicates.
Chapter 4
Results
4.1 PINK1 purification and substrate validation
We use an in vitro radioactive kinase assay to analyse PINK1 kinase activity

towards different putative substrates. Measuring specific kinase activity using
total cell extract is rarely possible, as for most substrates multiple kinases will
contribute to its phosphorylation. Therefore, these types of in vitro assays
rely on successful purification of both enzyme and substrate. It is important
that during the purification of the enzyme, its activity is not compromised.
Furthermore, a catalytic inactive form of the kinase of interest needs to be
included to confirm specificity of the detected phosphorylation.
We are interested in the study of human PINK1 kinase activity, which imposes
the initial challenge of obtaining purified active human PINK1 (see also section
4.1.2). Since several insect orthologues of PINK1 show higher catalytic activity
in vitro when compared to human PINK1 (Woodroof et al. 2011), we used the
insect orthologue TcPINK1 in addition to human PINK1 for our in vitro studies
and substrate validation (Figure 4.1).
45
46 RESULTS
Figure 4.1: Human, mouse and T. castaneum PINK1 alignment

A, Sequence alignment of human, mouse and Triboleum castaneum PINK1. Mouse and
human PINK1 are 82% identical, Tc and human PINK1 are 36% identical. Polar, non-charged
amino acids (green), basic (blue) and negatively charged hydrophilic (red) amino acids are
indicated, as well as the start and end of the kinase domain (black arrowhead). B, Schematic
representation of human, mouse and TcPINK1 indicating one of the 3 unique insertion regions
in the kinase domain of PINK1 is lacking in TcPINK1 (MTS, mitochondrial targeting sequence;
INS, insertion; CTD, C-terminal domain; adapted from Woodroof et al. 2011).
PINK1 PURIFICATION AND SUBSTRATE VALIDATION 47
4.1.1 Triboleum castaneum PINK1
Purification and activity
We expressed TcPINK1 with an N-terminal maltose binding protein (MBP) tag

in E. coli (Woodroof et al. 2011). Fusion with MBP dramatically enhances the
solubility of proteins otherwise accumulating in the insoluble fraction (Kapust
et al. 1999), and allows for purification of the fusion protein on an amylose resin
under non-denaturing conditions.
Coomassie staining confirmed successful purification of both WT and KI MBP
tagged TcPINK1 (Figure 4.2A). Kinase inactive (KI) TcPINK1 is catalytically
inactivated by mutation of D359, one of the conserved Aspartic acids in the
catalytic core, corresponding to D384 in hPINK1. Using both enzymes, we set
up an in vitro kinase assay with radiolabelled ATP, with and without PINKtide
substrate. Via the measurement of radiolabelled phosphor incorporation through
scintillation counts we find that WT TcPINK1 is catalytically active. We
detect PINK1 autophosphorylation and high levels of PINKtide phosphorylation
specifically for WT, and not for KI TcPINK1 (Figure 4.2B-C).
Figure 4.2: TcPINK1 is active in vitro

A, Purity of immunoprecipitated WT and KI TcPINK1 was evaluated by Coomassie staining.
Both forms of TcPINK1 are equally enriched. B, Quantification of [“-32 P]-ATP in vitro
autophosphorylation of purified WT or KI TcPINK1. C, Quantification of [“-32 P]-ATP in vitro
phosphorylation of PINKtide by purified WT or KI TcPINK1 (mean ± SEM, n=4 independent
experiments). Statistical significance was calculated between WT and KI TcPINK1 using
Student’s t-test (*: p-value < 0.05; **: p-value < 0.01).
48 RESULTS
Substrate validation
Having established that WT TcPINK1 is active in vitro, we proceeded to

test whether it can directly phosphorylate several putative PINK1 substrates.
We successfully purified the recombinant GST-tagged Ubl domain of Parkin,
and commercially obtained purified Histone H1, a non-physiological PINK1
substrate (Figure 4.3A). In addition to the PINKtide, TcPINK1 is able to
directly phosphorylate both of these proteins in vitro (Figure 4.3B; Sim et al.
2006; Kondapalli et al. 2012).
We thus wanted to verify if TcPINK1 could also phosphorylate NDUFA10, the

Complex I subunit that is regulated by PINK1 (Morais et al. 2014). We set
up different approaches to measure NDUFA10 phosphorylation by TcPINK1 in
vitro.
First, we designed peptides containing the target residue S250 in NDUFA10.
Via scintillation we measured radioactive phosphor incorporation in this peptide
upon incubation with either WT or KI TcPINK1 and compared this to a
phospho-inactive peptide, with S250 mutated to Alanine (A250). Although
we could detect a trace amount of peptide phosphorylation for WT TcPINK1,
this was not found to be significantly different from our phospho-inactive A250
peptide, indicating that specific phosphorylation of S250 peptide does not take
place in vitro (Figure 4.3C).
In a second approach, we expressed and purified FLAG-tagged NDUFA10
protein from mammalian cells for use in our in vitro set-up. NDUFA10 was
isolated using FLAGM2 antibody-linked beads, and subsequently eluted using
FLAG peptide, resulting in purified NDUFA10-FLAG protein (Figure 4.3A).
Additionally, since NDUFA10 is part of a multi-subunit complex, we considered
the possibility that it is only phosphorylated upon incorporation in the complex.
We therefore immunoprecipitated Complex I using a conformation specific
antibody and assessed in vitro phosphorylation by TcPINK1. However, we did
not detect specific NDUFA10 phosphorylation in either of these approaches,
despite detecting TcPINK1 autophosphorylation (Figure 4.3D). These results
indicate that NDUFA10 might not be a direct phosphorylation substrate of
PINK1.
Figure 4.3: NDUFA10 is not phosphorylated by TcPINK1 in vitro

A, Purity of Histone H1 and immunoprecipitated GST-tagged Ubl Parkin and FLAG-tagged
NDUFA10 was evaluated by Coomassie staining. B, In vitro phosphorylation assay using
[“-32 P]-ATP, purified TcPINK1 and Ubl Parkin or Histone H1 shows that both are specifically
phosphorylated by WT and not KI TcPINK1. WT TcPINK1 also displays autophosphorylation
activity. C, Quantification of [“-32 P]-ATP in vitro phosphorylation of NDUFA10 peptide
containing S250, or a mutant peptide with this residue mutated to Ala, by purified WT or
KI TcPINK1. There was no significant difference between S250 and A250 phosphorylation,
indicating there is no specific phosphorylation of this residue by WT TcPINK1. Statistical
significance was calculated between S250 and A250 using Student’s t-test (mean ± SEM, n=4
independent experiments, ns: non-significant). D, [“-32 P]-ATP in vitro phosphorylation of
Histone H1, NDUFA10, or Complex I by purified WT or KI TcPINK1. While Histone H1 is
phosphorylated by WT TcPINK1, NDUFA10 is not phosphorylated by TcPINK1 in vitro,
neither alone nor in Complex I. TcPINK1 is active in all conditions as autophosphorylation is
observed.
50 RESULTS
4.1.2 Human PINK1
Despite the fact that TcPINK1 is active in vitro and is easily produced and
purified, there are some limitations to its use. The TcPINK1 kinase domain is
different from that of human PINK1: only two out of the three unique insertion
regions present in human PINK1 are found in the TcPINK1 kinase domain
(Figure 4.1). The fact that the use of the same expression and purification
methods does not yield active human PINK1 (Woodroof et al. 2011), indicates
that there might be regulatory differences between the two orthologues. We
thus continued our efforts to obtain a reproducible method for the purification
of active human PINK1.
Purification and activity
We tested several protein tags for the expression and purification of human
PINK1 in mammalian cells, including the tandem affinity purification tags
V5/polyhistidine and 3xFLAG/Streptavidin. Although His binding on a
Ni2+ column lead to a similar enrichment in PINK1 (Table 4.1), we opted
for a 3xFLAG tag and FLAGM2 immunoprecipitation because it resulted in
substantially less unspecific binding (data not shown). The 3xFLAG tag is a
convenient epitope for immunoprecipitation that, like MBP, allows for elution
in non-denaturing conditions. However, we obtained very low elution recoveries
for PINK1, most probably due to PINK1 protein aggregation, and therefore,
we proceeded by conducting in vitro kinase assays with PINK1 still bound to
anti-FLAGM2 beads.
The number of studies demonstrating PINK1 kinase activity is limited, and most
of them report on truncated forms of PINK1 lacking parts of the N-terminal
region in front of the PINK1 kinase domain (Beilina et al. 2005; Kim et al.
2008; Sim et al. 2006; Silvestri et al. 2005). We therefore generated a truncated
PINK1 FLAG-tagged construct which lacks the first 112 N-terminal amino
acids (from here on referred to as N PINK1).
We expressed and purified both N and full-length (FL) human PINK1 from
transfected COS cells (Figure 4.4A; note that while the levels of purified N
PINK1 are higher than those of FL PINK1, this is solely due to differences
Table 4.1: PINK1 purification efficiencies

His-purification over a Ni2+ column resulted in 60% recovery of total PINK1 and a 10-fold
enrichment. V5 immunopurification displayed very low binding and elution efficiencies
resulting in a very low recovery rate and enrichment. The recovery of PINK1 using FLAG
immunopurification was limited, but a good enrichment could be obtained. Streptavidin
purification using biotin showed intermediate purification efficiency.
Tag Recovery Enrichment

His 60% approx. 10-fold
V5 <1% none
FLAG 25% approx. 12-fold
Streptavidin 30% approx. 3-fold
in expression level, as recovery and enrichment rates of the purification are

the same for both N and FL PINK1). Coomassie staining consistenly
showed the presence of several co-immunoprecipitated proteins, which were not
detected in the absence of FLAG-tagged PINK1 (Figure 4.4A; coloured arrows).
Interestingly, one of these interactors was found specifically for N and not FL
PINK1.
Because these interactors are as a consequence present in our in vitro kinase
assay and potentially influence PINK1’s activity, we decided to determine their
identity via mass-spectrometry. We identified HSP90, the translation initiation
factor eIF4B, and for N PINK1 also the chaperones HSP70 and HSP71. Two
of these, HSP90 and HSP70, were previously found to interact with PINK1
(Weihofen et al. 2008; Rakovic et al. 2011). Interaction with these chaperones
might be important to keep PINK1 in the correct conformation, as has already
been documented for HSP90 (Caplan et al. 2007).
Neither N nor FL human PINK1 showed catalytic activity in vitro when

using the same kinase assay conditions as for TcPINK1. We did not observe
autophosphorylation or phosphorylation of substrates Histone H1, PINKtide
or Parkin (data not shown), all three readily phosphorylated by TcPINK1
(Section 4.1.1). However based on a publication by Hertz et al. that uses PINK1
expressed in insect cells for in vitro phosphorylation assays, we successfully
altered our technical set-up by changing both the conditions and the timing of
our purification and kinase assay to obtain active human PINK1 from COS cells
(Hertz et al. 2013). Crucially, we shortened the overall time frame of protein
52 RESULTS
Figure 4.4: Human PINK1 is active in vitro

A, Coomassie staining of FLAG-immunoprecipitated N and FL PINK1 (black arrows).
Mass-spectrometry identified several PINK1 interactors: HSP90 (green arrowhead), eIF4B
(red arrowhead) and HSP70/71 (purple arrowhead). Asterisk: heavy-chain of FLAGM2
antibody. B, An in vitro phosphorylation assay using [“-32 P]-ATP was performed with
purified WT and KI N PINK1-FLAG with and without TRAP1 co-expression. WT N
PINK1 is active independently of TRAP1 co-expression.
purification, allowing less than 2 h between cell lysis and the kinase assay, which
was performed at 22°C instead of 30°C. We further verified whether addition of
detergent, BSA, reducing agents, or protease and phosphatase inhibitors in the
kinase assay buffer could increase the detected phosphorylation and found a
marked increase in catalytic activity in highly reduced conditions using 10 mM
or more DTT. In the reference study, N human PINK1 was purified after
co-expression with TRAP1 in insect cells (Hertz et al. 2013). Since TRAP1 is
a known interactor of PINK1, we wanted to know whether its co-expression
is required to get PINK1 in an active conformation. We tested the activity
of purified PINK1 with and without TRAP1 co-expression in COS cells, but
found that it was active in both cases, indicating that TRAP1 is not essential
for PINK1 in vitro activity (Figure 4.4B).
Using these optimized methods for purification and in vitro phosphorylation

N PINK1 is autophosphorylated, and also phosphorylates the Ubl domain of
Parkin (Figure 4.5A; N PINK1-FLAG). Purified FL PINK1, on the contrary,
is not autophosphorylated. Nonetheless, FL PINK1 is catalytically active, as
it is able to phosphorylate the Ubl domain of Parkin (Figure 4.5A; P32: Ubl
Figure 4.5: Full-length human PINK1 is not autophosphorylated in

vitro
A, An in vitro phosphorylation assay using [“-32 P]-ATP was performed with purified WT and
KI PINK1-FLAG and purified GST-Ubl Parkin as substrate. While WT N PINK1 shows
autophosphorylation and is able to phosphorylate the substrate Parkin, the autoradiogram
shows no detectable autophosphorylation for FL PINK1, not even after CCCP-induced
depolarization, although FL PINK1 phosphorylates the Ubl domain of Parkin. B, PINK1 was
dephosphorylated using lambda protein phosphatase (LPP) prior to (pre) incubation with
[“-32 P]-ATP and Ubl Parkin in an in vitro phosphorylation assay. This dephosphorylation
did not reveal an increase in detectable FL PINK1 autophosphorylation. The same LPP
treatment of PINK1 and Parkin after (post) completion of the kinase assay did lead to a
considerable amount of Parkin and N PINK1 dephosphorylation indicating that protein
dephosphorylation was successful under the applied conditions.
54 RESULTS
Parkin). This phosphorylation activity is specific, as it is not observed for

purified KI PINK1, which is catalytically inactivated by two mutations, K219A
and D362A in the ATP-binding pocket and catalytic core respectively (Figure
1.5; Beilina et al. 2005).
Several reports claim that depolarization is required for PINK1 activation (Kon-
dapalli et al. 2012; Okatsu et al. 2012). However, CCCP-induced depolarization
prior to PINK1 purification does not induce autophosphorylation or affect
Parkin phosphorylation (Figure 4.5A; CCCP). We observe increased amounts
of FL PINK1 upon CCCP-treatment, but decouple PINK1 accumulation from
its activation.
We considered the possibility that perhaps FL PINK1 was already phos-

phorylated prior to purification, and that dephosphorylation of the purified
kinase was needed so that in vitro radioactive phosphor incorporation could be
assessed. Therefore, we treated both N and FL PINK1 with lambda protein
phosphatase (LPP) immediately after purification, and subsequently washed
away the phosphatase before incubating the purified kinase with radiolabelled
ATP. However, pre-treatment of FL PINK1 with LPP did not lead to the
detection of autophosphorylation activity (Figure 4.5B, P32: PINK1). N
PINK1 autophosphorylation and Ubl Parkin phosphorylation were still detected
after LPP pre-treatment confirming successful removal of the phosphatase before
performing the kinase assay (Figure 4.5B, P32: Ubl Parkin). Addition of LPP
after incubation of kinase and substrate in the presence of radiolabelled ATP,
leads to a reduction in phosphorylated Parkin and autophosphorylated N
PINK1, confirming phosphatase activity under these experimental conditions.
Thus, the lack of in vitro autophosphorylation activity of FL PINK1 is not
due to prior phosphorylation and occupancy of the sites by non-radioactive
phosphates. The absence of detectable in vitro autophosphorylation of FL
PINK1 suggests that the N-terminal region has an inhibitory effect on the
autophosphorylation activity of PINK1 in these experimental conditions. Since
we observe phosphorylation of Ubl Parkin, we conclude that non-phosphorylated
PINK1 is able to phosphorylate its substrate, although we cannot exclude that
the efficiency is lower.
Substrate validation
We proceeded to test the direct phosphorylation of several other putative

substrates. In addition to Parkin, we investigated the phosphorylation of
–-casein, Histone H1, and PINKtide peptide, three non-physiological substrates
used to study the activity of PINK1 and other kinases in vitro (Woodroof
et al. 2011; Sim et al. 2006), but also previously reported PINK1 candidate
substrates TRAP1, Ubiquitin and NDUFA10 (Pridgeon et al. 2007; Koyano
et al. 2014; Kane et al. 2014; Kazlauskaite et al. 2014a; Morais et al. 2014).
Under the conditions used in our in vitro assay, we found reproducible and
specific phosphorylation for Ubiquitin, despite the detection of residual Ubiquitin
phosphorylation by a contaminating kinase when applying KI PINK1 (Figure
4.6C). None of the other tested substrates was found to be phosphorylated by
FL human PINK1 (Figure 4.6C).
Thus, human PINK1 phosphorylates Parkin and Ubiquitin, confirming previous
observations using TcPINK1 (Figure 4.3; Kondapalli et al. 2012; Koyano et al.
2014; Kane et al. 2014; Kazlauskaite et al. 2014a). However, other TcPINK1
substrates such as Histone H1 and PINKtide (Figure 3.5; Woodroof et al.
2011) are not phosphorylated by full-length human PINK1, hinting at different
substrate selectivity between the two orthologues.
56 RESULTS
Figure 4.6: Human PINK1 phosphorylates Parkin and Ubiquitin in

vitro
A, Coomassie staining of the different substrates tested for in vitro phosphorylation by human
PINK1. B, Quantification of in vitro [“-32 P]-ATP PINKtide phosphorylation by purified
N and FL PINK1-FLAG. Neither N nor FL PINK1 could specifically phosphorylate the
PINKtide in vitro (n = 2 technical replicates, cpm: counts per minute). C, An in vitro
phosphorylation assay using [“-32 P]-ATP was performed with purified WT and KI FL PINK1-
FLAG and different putative PINK1 substrates. While WT PINK1 specifically phosphorylates
both Parkin and Ubiquitin, –-casein, Histone H1, TRAP1 and NDUFA10 were not found to
be phosphorylated in vitro.
4.1.3 Conclusion
Both Tc and human PINK1 are catalytically active in vitro, but their
kinase activity is regulated differently. Not only are different experimental
conditions required to maintain both orthologues in an active conformation,
both orthologues also show differences with regards to substrate selection
and phosphorylation, as not all substrates phosphorylated by TcPINK1 are
phosphorylated by human PINK1.
Interestingly, autophosphorylation can be detected for TcPINK1 and for N
human PINK1, but not for FL human PINK1. Our results suggest that PINK1
catalytic activity is regulated by the N-terminal region. While the majority of
PINK1 studies underscore the importance of CCCP-induced depolarization for
PINK1 autophosphorylation or kinase activity (Kondapalli et al. 2012; Kane
et al. 2014; Kazlauskaite et al. 2014a; Okatsu et al. 2012; Okatsu et al. 2013),
we find PINK1 phosphorylation in the absence of depolarization for N PINK1
and no induction of FL PINK1 autophosphorylation upon CCCP treatment.
58 RESULTS
4.2 PINK1 regulation by phosphorylation
These results are published in: Aerts L, Craessaerts K, De Strooper B, Morais VA. PINK1
Catalytic Activity is Regulated by Phosphorylation on Serines 228 and 402. Journal of
Biological Chemistry 2015, Jan 30;290(5):2798-811.
We were intrigued by the differences in catalytic activity between different

orthologues and processed forms of PINK1. Interestingly, PINK1 was found
to be phosphorylated in cells (Okatsu et al. 2012). We therefore set out to
characterize PINK1 phosphorylation and explore its implications for PINK1
catalytic activity.
4.2.1 PINK1 phosphorylation occurs at the outer membrane
PINK1 accumulates under different conditions and has been reported to be

phosphorylated upon depolarization in cells (Okatsu et al. 2012; Jin et al.
2010; Kondapalli et al. 2012). To clarify how exactly PINK1 processing and
phosphorylation are related, we expressed human PINK1 with a C-terminal
FLAG-tag in HEK293T cells and analysed its expression pattern in the
post-nuclear cell homogenate (H), the mitochondria-depleted or cytoplasm-
enriched (C), and the mitochondria-enriched (M) fraction (Figure 4.7B). Under
basal conditions, FL PINK1 is targeted to the mitochondria where it is
processed by MPP (A. W. Greene et al. 2012), resulting in the cleavage of the
mitochondrial targeting sequence (MTS) and the detection of MTS PINK1
in the mitochondrial fraction. Subsequent N-terminal processing by other
proteases, including PARL and m-AAA (A. W. Greene et al. 2012; Deas
et al. 2010; Meissner et al. 2011), leads to the appearance of further processed
PINK1 forms N1 and N2 PINK1 (Figure 4.7A-B). When mitochondria are
depolarized using 10 µM of the uncoupler CCCP, FL PINK1 accumulates in
the mitochondrial fraction, accompanied by a decrease in the levels of processed
MTS and N1 PINK1. However, a strong increase of a higher-molecular
weight form of PINK1 is observed specifically in the mitochondrial fraction
(Figure 4.7B). This represents phosphorylated full-length (P-FL) PINK1 (Okatsu
et al. 2012; Kondapalli et al. 2012).
Dephosphorylation of mitochondrial lysate from CCCP-treated cells with LPP
PINK1 REGULATION BY PHOSPHORYLATION 59
Figure 4.7: Phosphorylated PINK1 accumulates at the mitochondria

A, Scheme representing full-length (FL) PINK1 including kinase domain and mitochondrial
targeting sequence (MTS). MPP cleaves off the MTS resulting in MTS PINK1 and further
processing by PARL at residue 103 results in the N1 PINK1 product. The 4 phosphorylation
sites analysed in this study (blue) and the sites mutated in kinase inactive (KI; green) PINK1
are indicated. B, HEK cells transiently transfected with wild-type (WT) or kinase inactive
(KI) FLAG-tagged human PINK1 and treated with 10 µM CCCP for 3 h were fractionated in
post-nuclear or homogenate fraction (H), and subsequent supernatant and pellet after 7000xg
centrifugation, the mitochondria-depleted or cytosol-enriched (C) and mitochondria-enriched
(M) fractions respectively. Expression of PINK1 was evaluated after SDS-PAGE on 7.5%
Tris-Acetate gel and immunoblotted using anti-FLAGM2. Immunoblotting for mitochondrial
marker HSP60 serves as fractionation quality control. For WT, but not KI, a doublet is
observed that corresponds to the phosphorylated and non-phosphorylated FL form of PINK1
(P-FL and FL, respectively). Further processed PINK1 forms are indicated as MTS, N1
and N2. C, Mitochondria-enriched fractions, obtained from HEK cells transfected with
WT and KI PINK1-FLAG and incubated with 10 µM CCCP for 3h, were treated with
lambda protein phosphatase (LPP) at 30°C. Samples were analysed by SDS-PAGE on a 7.5%
Tris-Acetate gel and 7.5% Phos-tag gel, and immunoblotted with anti-FLAGM2 antibody for
PINK1 detection. A control for loss of phosphorylation by 30°C incubation alone was included.
Phosphatase treatment confirms that the upper band (P-FL) is a phosphorylated form of
PINK1. D, Fractionation of HEK cells treated for 3 h with either 10 µM CCCP or 10 µM
Lactacystin were analysed by SDS-PAGE on a 7.5% Tris-Acetate or 7.5% Phos-tag gel and
further immunoblotted for PINK1 detection using anti-FLAGM2 antibody. Mitochondrial
PINK1 is phosphorylated in control (DMSO) conditions, but accumulates upon CCCP-induced
depolarization. Proteasomal blockage with Lactacystin also leads to a modest increase of
P-FL PINK1, in addition to accumulation of the N1 processed form.
60 RESULTS
confirms that this PINK1 form is phosphatase sensitive (Figure 4.7C, upper
panel). Moreover, when we separate the same samples on a Phos-tag gel,
in which negatively-charged phosphorylated proteins migrate slower due to
their interaction with Mn2+ -PhostagTM complex conjugated with the poly-
acrylamide gel, we strongly increase the resolution between phosphorylated
and non-phosphorylated FL PINK1 (Figure 4.7C, lower panel). The altered
migration pattern on Phos-tag gel and the clear decrease in intensity of the
phosphorylated versus the non-phosphorylated PINK1 upon LPP treatment,
suggest that despite the detection of residual LPP-insensitive PINK1, the higher
molecular weight band represents phosphorylated PINK1.
KI PINK1 is also enriched in the mitochondrial fraction upon depolarization
using CCCP (Figure 4.7B, KI PINK1). However, no phosphorylated PINK1 is
detected, indicating that the observed phosphorylation event is dependent on
PINK1 kinase activity (Figure 4.7B-C, KI PINK1).
Although CCCP treatment leads to a strong accumulation of this phosphorylated
form of PINK1, we nevertheless detect low amounts of phosphorylated PINK1
in control conditions, especially when enriching for mitochondria (Figure 4.7B,
lane 6; Figure 4.7D, lane 3). This suggests that the increased intensity of the
phosphorylated band after CCCP treatment reflects the general accumulation of
PINK1 as a consequence of the decreased import of PINK1 into the mitochondria
under those conditions and not necessarily induction of phosphorylation per se.
Indeed, when we block the rapid degradation of processed PINK1 by treating
cells with the proteasomal inhibitor lactacystin, we do not only observe a
robust accumulation of N1 PINK1, known to be degraded in a proteasome-
dependent manner (Yamano et al. 2013), but we also see a modest increase
in phosphorylated FL PINK1 (Figure 4.7D). Via Phos-tag gels we obtain a
better resolution of the phosphorylated PINK1 (Figure 4.7D, lower panel). The
detection of phosphorylated PINK1 in DMSO control as well as in lactacystin
treated conditions confirms that PINK1 phosphorylation occurs in the absence
of CCCP treatment.
To verify that phosphorylated PINK1 is located at the mitochondrial outer
membrane (MOM), we used a proteinase K (PK) sensitivity assay (Dimmer
et al. 2008). We isolated mitochondria from PINK1 KO MEFs rescued by stable
PINK1-FLAG expression. First we add PK to purified mitochondria in isotonic
buffer, which leads to digestion of proteins at the outer leaflet of the MOM. Under
Figure 4.8: Phosphorylated PINK1 is present at the outer

mitochondrial membrane
A, Mitochondria-enriched fractions of MEF cells stably expressing FL PINK1-FLAG were
subjected to a Proteinase K (PK) sensitivity assay to assess submitochondrial localization
of P-FL PINK1. P-FL is PK sensitive, while non-phosphorylated FL PINK1 and PINK1
lacking the mitochondrial targeting sequence ( MTS) are at least partially protected from
PK even in hypotonic conditions (2mM HEPES). As a control, the PK sensitivity of outer
membrane protein TOM20, intermembrane space protein HtrA2 and the matrix protein
HSP60 was evaluated by immunoblotting. B, MEFs derived from PARL WT and PARL
KO mice stably expressing WT PINK1-V5 were fractionated and expression of PINK1 was
evaluated after SDS-PAGE and anti-V5 immunoblotting. MTS PINK1 accumulates in
PARL KO cells and further N-terminal processing is altered leading to an accumulation of
PINK1 C-terminal fragments in the mitochondria (M) of PARL KO cells. C, Mitochondrial
enriched fractions from PARL WT and KO MEFs stably expressing WT PINK1-V5 were
subjected to PK treatment in isotonic and hypotonic (20mM and 2mM HEPES) conditions
in the presence or absence of detergent. Equal amounts are loaded for PARL WT and
KO, a higher exposure inset for PARL WT allows for better analysis of PINK1 expression
under these conditions. MTS PINK1 is cleaved by PARL and accumulates in PARL KO
mitochondria but is only digested by PK in the presence of detergent. Depolarization induced
by CCCP leads to the accumulation of phosphorylated full-length (P-FL) PINK1, sensitive to
proteinase K in isotonic conditions. Thus the accumulation caused by absence of PARL or
caused by CCCP-induced depolarization concerns different PINK1 forms present in different
submitochondrial compartments.
62 RESULTS
these conditions, phosphorylated FL PINK1 is indeed accessible and degraded

by PK, as is the MOM-associated protein TOM20 (Figure 4.8A). Digestion in
hypotonic 2mM HEPES buffer, which causes the rupture of the MOM by osmotic
shock, makes all proteins from the intermembrane space (IMS), the inner leaflet
of MOM and finally the outer leaflet of the mitochondrial inner membrane
(MIM) accessible to PK, but preserves the remaining mitoplast consisting of the
matrix and MIM. While IMS-localized HtrA2 is degraded under these conditions,
no further digestion of PINK1 is observed, indicating that the residual pool of
PINK1 is associated with the mitoplast. This is confirmed in the third step of
the experiment where all membranes are solubilized using detergent and addition
of PK results in full degradation of all PINK1 protein forms, as well as the
matrix protein HSP60 (Figure 4.8A). We therefore conclude that phosphorylated
PINK1 is mainly localized at the MOM, while non-phosphorylated FL PINK1
is partially protected inside the mitoplast.
The PARL protease, located in the MIM, is implicated in the processing of
PINK1 (Deas et al. 2010; Meissner et al. 2011; Jin et al. 2010; A. W. Greene et al.
2012). Stable expression of C-terminal V5-tagged PINK1 in WT and PARL
KO MEFs shows the specific accumulation of MTS PINK1 in the absence
of PARL (Figure 4.8B), confirming that MPP-processed PINK1 and not FL
PINK1 is the substrate for PARL cleavage (A. W. Greene et al. 2012). We
also find an altered pattern of further processed C-terminal PINK1 fragments
(Figure 4.8B, processed forms). We reasoned that studying PINK1 under basal
and depolarizing conditions in PARL KO cells, where we observe much higher
levels of MTS PINK1, could unequivocally confirm the submitochondrial
localization of this PINK1 form in the IMS and matrix.
When we examine PK susceptibility in mitochondrial fractions obtained from
PARL KO MEFs we observe high levels of MTS PINK1 in the presence
of PK in both isotonic and hypotonic conditions (Figure 4.8C). Only when
detergent is added and proteins localized inside the mitoplast become accessible
to PK, is MTS PINK1 degraded. These results demonstrate unambiguously
that MTS PINK1 is indeed protected in the mitoplast. Moreover, CCCP
treatment in PARL KO cells leads to the accumulation of phosphorylated and
non-phosphorylated FL PINK1 at the MOM which is sensitive to PK, while at
the same time a reduction in the amount of accumulated MTS is observed in
these conditions, indicating that transport of PINK1 into the matrix is blocked
(Figure 4.8C, right).

Based on these results, we propose that FL PINK1 is phosphorylated at the
outer mitochondrial membrane, prior to mitochondrial import and processing by
MPP and PARL. This phosphorylation event is independent of mitochondrial
membrane depolarization induced by CCCP, but as a consequence of import
blockage, phosphorylated PINK1 accumulates on depolarized mitochondria.
4.2.2 PINK1 phosphorylation does not influence localization

or processing
PINK1 has been reported to be phosphorylated on at least four different

residues: S228, T257, T313 and S402 (Kondapalli et al. 2012; Matenia et al.
2012; Okatsu et al. 2012). To verify the role of these residues, we made a
4xA quadruple mutant PINK1 construct, in which all four sites are mutated
to an Alanine, and we assessed the accumulation of phosphorylated PINK1 in
CCCP-induced depolarization conditions. The 4xA quadruple mutant PINK1
is processed by MPP to MTS PINK1 under basal conditions, and FL 4xA
PINK1 accumulates upon CCCP treatment. It is also clear that phosphorylation
of this phosphomutant is affected when compared to WT PINK1 (Figure
4.9A), confirming that at least one of these four sites is important for the
phosphorylation of PINK1 to occur. Furthermore it follows that phosphorylation
at none of these four residues is required for accumulation of PINK1 upon
mitochondrial depolarization.
To exclude that the observed effect on PINK1 phosphorylation is due to mislo-
calization of the quadruple mutant PINK1, we analysed its mitochondrial and
submitochondrial localization and processing using two different complementing
techniques. We first treated purified mitochondria with Na2 CO3 at pH 11.5
to determine the membrane association of the different forms of PINK1. The
Na2 CO3 treatment converts closed vesicles to open membrane sheets, releasing
content proteins and peripheral membrane proteins (Fujiki et al. 1982). We
observe that the majority of PINK1, including the phosphorylated form of
PINK1, is resistant to this treatment and follows the pattern of the membrane-
associated protein TOM20 (Figure 4.9B, WT). In contrast, soluble matrix
protein HSP60 and IMS-located HtrA2, are extracted. Thus, PINK1 remains
strongly associated with the mitochondrial membrane. Interestingly, not only
64 RESULTS
the 4xA mutant, but also quadruple mutant PINK1 harboring phosphomimetic
mutations to Aspartic (4xD) and Glutamic (4xE) acid, phenocopy the PINK1
wild type form upon Na2 CO3 treatment (Figure 4.9B).
To further distinguish between inner and outer membrane associated proteins,
we performed the PK susceptibility assay. For both phosphomimetic 4xD and
4xE, and for phosphodead 4xA mutant PINK1, we observe PK susceptibility
patterns that are comparable to the pattern obtained for WT PINK1 (Figure
4.9C).
The fact that quadruple PINK1 mutants show no changes in Na2 CO3 extraction
or PK digestion pattern indicates that loss of phosphorylation of the 4xA
phosphodead mutant is not due to mislocalization or misprocessing of PINK1,
and furthermore, phosphorylation of PINK1 does not affect its mitochondrial
transport and insertion.
4.2.3 T313 and S402 are required for PINK1 phosphorylation
In order to evaluate which of the four residues under investigation are responsible
for the observed effect on PINK1 phosphorylation, we mutated S228, T257,
T313 and S402 individually to Alanine and evaluated the effect on PINK1
phosphorylation in a cell-based approach, using CCCP-induced depolarization
to trigger accumulation of phosphorylated PINK1. Mutation of S228 or T257
does not affect the phosphorylation of PINK1 as both mutant forms present
a migration profile identical to that of wild type PINK1 in Tris-Acetate or
Phos-tag gel (Figure 4.10A). Mutation of residue T313 or S402 appears to
abolish the P-FL PINK1 band (Figure 4.10A, top panel), indicating that both
T313A and S402A interfere with PINK1 phosphorylation. However, when
phosphorylation of these mutants was analysed on a Phos-tag gel, a slower
migrating band was still detected for the S402A mutant (Figure 4.10A, lower
panel). This band is LPP sensitive (Figure 4.10B, P-FL (B)), indicating
that there is residual phosphorylation occurring on S402A mutated PINK1.
The identification of two different phosphorylated PINK1 forms points to the
occurrence of multiphosphorylation of PINK1. These results indicate that
PINK1 is phosphorylated and that residue T313 and S402 are required for this
post-translational modification to occur.
Figure 4.9: Mutation of S228, T257, T313 and S402 affects PINK1
phosphorylation without interfering with localization or processing
A, Mitochondrial enriched fractions of DMSO (control) or 10 µM CCCP treated HEK cells
transiently expressing WT and kinase inactive (KI) PINK1-FLAG WT with and without the
quadruple mutation of the putative phosphorylation sites S228, T257, T313 and S402 (4xA)
were analysed by SDS-PAGE and immunoblotting against anti-FLAGM2 for PINK1 detection.
Results show that P-FL PINK1 no longer accumulates for 4xA quadruple mutant PINK1.
B, Mitochondrial enriched fractions from MEF cells stably expressing WT, phosphomimetic
(4xD and 4xE) or phosphodead (4xA) quadruple PINK1-FLAG mutants were treated with
Na2 CO3 pH 11.5. The majority of PINK1 is not extracted by Na2 CO3 indicating that WT
and quadruple mutants are membrane-associated proteins. Expression of soluble HSP60 and
HtrA2, and membrane-associated TOM20 was evaluated as a control for Na2 CO3 extraction.
C, Proteinase K sensitivity was tested on mitochondria enriched fractions from MEF cells
stably expressing either 4xD, 4xE and 4xA quadruple mutant PINK1-FLAG. The distribution
of FL and processed PINK1 forms is not altered as the pattern for mitochondrial fractions
and PK sensitivity in isotonic and hypotonic (2mM HEPES) is unchanged. As a control for
protein digestion in each condition, the PK sensitivity of outer membrane protein TOM20,
intermembrane space protein HtrA2 and matrix protein HSP60 was evaluated.
66 RESULTS
Figure 4.10: T313 and S402 are required for PINK1 phosphorylation
at the mitochondria outer membrane
A, Mitochondrial enriched fractions from HEK cells transiently transfected with different
phosphomutant forms of PINK1-FLAG and treated with DMSO or 10 µM CCCP were
analysed by SDS-PAGE on 7.5% Tris-Acetate and 7.5% Phos-tag gels. The presence of P-FL,
FL and MTS PINK1 was assessed by immunoblotting using anti-FLAGM2 antibody. While
FL PINK1 accumulates upon CCCP treatment for every evaluated mutant, P-FL PINK1 is not
detected or altered for T313A, S402A and 4xA quadruple mutant PINK1. B, Mitochondrial
fractions from CCCP-treated HEK cells transfected with different phosphomutant PINK1-
FLAG forms were treated with lambda phosphatase (LPP) and further probed with anti-
FLAGM2 antibody for PINK1 detection. The bands P-FL(A) and P-FL(B) show sensitivity
to LPP indicating that they are both phosphorylated forms of PINK1 (P-FL A and B).
4.2.4 Truncated human PINK1 is autophosphorylated at

residues S228 and S402
To investigate how either of these residues affects PINK1 autophosphorylation,

we analysed the kinase activity of purified N PINK1 using PINK1
phosphomutants at the four candidate residues (Figure 4.11A). Remarkably,
mutation of residue S228 interferes with N PINK1 autophosphorylation,
as the incorporation of radiolabelled ATP is significantly reduced albeit not
completely lost, compared to N WT PINK1 levels (Figure 4.11A). Mutation
of residues T257 and, intriguingly, T313 to Alanine, did not affect N PINK1
autophosphorylation, indicating that these residues are not involved in the in
vitro autophosphorylation of N PINK1. Finally, S402A mutation results in a
marked inhibition of in vitro N PINK1 autophosphorylation (Figure 4.11A-B).
While the separate mutations of S228A and S402A both lower N PINK1
autophosphorylation, they do not lead to a complete inhibition. To scrutinize
the interplay between these two sites we constructed phosphomimetic mutants
of N PINK1 at either the S228 or the S402 site by mutating the Serine to
an Aspartic acid (D) residue. N PINK1 autophosphorylation is significantly
higher for both S228D and S402D PINK1, when compared to their phosphodead
counterparts S228A and S402A, despite the fact that in both cases one candidate
phosphosite is blocked by a mutation (Figure 4.11C). This confirms that both
the S228 and S402 residues regulate PINK1 kinase activity.
The fact that single Alanine mutation of each site largely abolishes autophospho-
rylation suggests that both sites need to be phosphorylated to make N PINK1
fully active. Finally, residual autophosphorylation activity of N PINK1 is
observed in the double S228A/S402A mutant indicating that at least one other
residue in PINK1 is autophosphorylated apart from these two sites (and besides
T257 and T313). Double mutation of S228 and S402 to Aspartic acid residues
confirms PINK1’s increased activity upon phosphorylation and the existence of
additional phosphorylation site(s) (Figure 4.11D).
68 RESULTS
Figure 4.11: Autophosphorylation of N PINK1 occurs at residues

S228 and S402
A, An in vitro phosphorylation assay using [“-32 P]-ATP was performed with purified
human N PINK1 harboring phosphodead mutations on four putative phosphosites. The
phosphomutants S228A and S402A showed reduced phosphorylation, while mutation of T257
and T313 did not affect N PINK1 autophosphorylation when compared to WT. B, In
vitro phosphorylation assay using [“-32 P]-ATP and purified N PINK1 with phosphomimetic
and phosphodead mutant PINK1 for residues S228 and S402 shows that a phosphomimetic
mutant PINK1 can restore PINK1 phosphorylation levels observed for the corresponding
phosphodead mutation. C, Quantification of N PINK1 autophosphorylation relative to
WT (mean ± SEM, n=3 independent experiments). Statistical significance was calculated
between each mutant and WT N PINK1 using Dunnett’s test (*: p-value < 0.05; **:
p-value < 0.01; ns: non-significant). D, In vitro phosphorylation assay using [“-32 P]-ATP and
purified N PINK1 with combined S228A and S402A mutation shows decreased N PINK1
autophosphorylation levels, comparable to the levels for the single mutations, indicating
the existence of residual phosphorylated residue(s) on PINK1. Combined phosphomimetic
mutation S228D and S402D shows increased in vitro autophosphorylation levels, showing that
phosphorylation of these two residues increases PINK1 kinase activity and phosphorylation of
the residual phosphoresidue(s). Immunoblot using anti-FLAGM2 shows that equal amounts
of PINK1 were applied.
4.2.5 S228 and S402 phosphorylation regulate substrate

phosphorylation
To understand how each of the different putative phosphosites can influence

substrate phosphorylation, we incubated mutant FL PINK1 with Parkin. We
find that neither S228 nor T257 mutation affect Parkin phosphorylation in the
context of FL PINK1. Mutation of T313, in contrast, completely abrogates the
phosphorylation of Parkin. The effects of S402A are less severe, but nevertheless
substrate phosphorylation is reduced by more than 50% (Figure 4.12A, upper
panel). We next investigated whether phosphorylation of Ubiquitin, another
PINK1 substrate, is affected in a similar way. Despite residual phosphorylation
by a contaminating kinase for KI PINK1 in this assay, we observe that S228 and
T257 mutants of FL PINK1 do not affect Ubiquitin phosphorylation. As is the
case for Parkin, both T313 and S402 are important, as Ubiquitin phosphorylation
is reduced by more than 60% when either of these two residues are mutated
(Figure 4.12A, lower panel). We next evaluated the role of S228 and S402
phosphorylation on substrate phosphorylation by introducing phosphomimetic
mutations at these sites. Interestingly, both phosphomimetic mutations S228D
and S402D are able to increase substrate phosphorylation (Figure 4.12B). While
neither Parkin nor Ubiquitin phosphorylation are significantly reduced for S228A
PINK1, introduction of a phosphomimetic mutation at this residue results in
a 3 and 4-fold increase of Parkin and Ubiquitin phosphorylation respectively.
S402D mutation restores Parkin and Ubiquitin phosphorylation levels to those
of WT PINK1 (Figure 4.12D). Thus, phosphorylation at both S228 and S402
residues regulates substrate phosphorylation.
Our results studying N PINK1 autophosphorylation indicated already that

T313 is not an autophosphorylation site (Figure 4.11B). Nevertheless, mutation
of this residue drastically affects Parkin phosphorylation by PINK1 (Figure
4.12A), and importantly, mutation of this residue also leads to the complete
absence of PINK1 phosphorylation in cells (Figure 4.10A). To investigate the
role of this residue for the kinase activity of FL PINK1 we evaluated the
effect of an Aspartic (T313D) or Glutamic (T313E) acid phosphomimetic
residue at this position. The T313 phosphomimetic mutant PINK1 forms are
unable to phosphorylate Parkin (Figure 4.12C), thus behaving the same as
the phosphodead Alanine counterpart mutant. Taken together, these results
70 RESULTS
Figure 4.12: The residues T313 and S402 are important for substrate
phosphorylation
A, In vitro phosphorylation assay using [“-32 P]-ATP was performed on purified FL PINK1
with purified Ubl Parkin or His-tagged Ubiquitin. Autoradiographic exposure shows that for
FL PINK1, mutation of S228 and T257 does not affect Parkin or Ubiquitin phosphorylation.
Mutation of T313 completely abrogates substrate phosphorylation, while S402A mutation leads
to a substantial decrease. There is still phosphorylation detectable for KI PINK1, indicating
the presence of a contaminating kinase capable of phosphorylating Ubiquitin at low levels.
Immunoblot using anti-GST or anti-His confirms equal amounts of Parkin and Ubiquitin were
applied. B, In vitro phosphorylation assay using [“-32 P]-ATP, FL PINK1 and Ubl Parkin
or Ubiquitin shows S228D and S402D mutation increases substrate phosphorylation. S228D
mutation increases substrate phosphorylation beyond WT levels, which are comparable to
that obtained for S228A PINK1. The decreased Parkin phosphorylation for FL S402A PINK1
can be rescued by a phosphomimetic mutation S402D. C, In vitro phosphorylation assay
using [“-32 P]-ATP was performed on purified FL PINK1 mutated at the T313 residue with
purified Ubl Parkin. Phosphomimetic (T313D or T313E) mutation of T313 does not rescue
the decrease in Parkin phosphorylation observed for T313A. D, Quantification of Ubl Parkin
and Ubiquitin phosphorylation relative to WT. Statistical significance was calculated between
each mutant and WT FL PINK1 using Dunnett’s test (*: p-value < 0.05; **: pvalue <0.01;
***: p-value < 0.001; ns: non-significant; mean ± SEM, n=3 independent experiments).
Figure 4.13: S228 regulates substrate phosphorylation by N PINK1

A, In vitro phosphorylation assay using [“-32 P]-ATP was performed using purified N PINK1
and purified Ubl Parkin. Similar to FL PINK1, Parkin phosphorylation is abolished upon
T313A mutation in N PINK1, while S228A and S402A mutation reduce it significantly.
S228D and S402D phosphomimetic mutations restore Parkin phosphorylation back to WT
levels. B, Quantification of Ubl Parkin phosphorylation by N PINK1. Statistical significance
was calculated between each mutant and WT N PINK1 using Dunnett’s test (*: p-value <
0.05; **: p-value <0.01; ns: non-significant; mean ± SEM, n=3 independent experiments).
indicate that although the T313 residue is relevant for substrate phosphorylation,
it is not regulated through phosphorylation.
Due to the different outcomes of the mutations of the candidate phosphosites
with regard to in vitro autophosphorylation and PINK1 phosphorylation
observed in cells, we decided to analyse the role of all four residues for Parkin
phosphorylation in the context of N PINK1 as well. While the effects of T257,
T313 and S402 mutation are similar to those observed for FL PINK1, it is of
particular interest that Parkin phosphorylation is significantly decreased by
more than 50% for N PINK1 harboring the S228A mutation (Figure 4.13A-B).
Since we have shown that phosphomimetic mutation of both S228D and S402D
restores N PINK1 autophosphorylation levels to WT levels (Figure 4.11B), we
proceeded to check their effect on Parkin phosphorylation. As expected, both
mutations increase Parkin phosphorylation, however, in contrast to our results
with FL PINK1 (Figure 4.12B), N PINK1 S228D and S402D both restore
Parkin phosphorylation levels to those of WT N PINK1 (Fig 4.13A-B).
In sum, phosphorylation of S228 and S402 can regulate the phosphorylation
of both Parkin and Ubiquitin, but their individual contribution depends on
the context, as S228 phosphorylation only occurs for WT PINK1 when the
N-terminus is deleted. Though T313 is required for substrate phosphorylation,
this residue does not regulate PINK1 activity through phosphorylation.
72 RESULTS
4.2.6 S402 phosphorylation regulates Parkin recruitment
It is well established that PINK1 and Parkin cooperate to flag defective

mitochondria for mitophagic removal (section 1.2.3). When PINK1 accumulates
on the outer membrane of depolarized mitochondria, it recruits Parkin from the
cytosol. However, previous reports indicate that besides PINK1 accumulation,
PINK1 also needs to be activated by phosphorylation (Kondapalli et al. 2012;
Okatsu et al. 2012; Okatsu et al. 2013). Thus, we decided to investigate the
implication of each of the four putative phosphosites in Parkin recruitment. We
created PINK1 KO HeLa cells using CRISPR/Cas technology (Cong et al. 2013).
In these cells, absence of PINK1 expression leads to lack of Parkin recruitment
to depolarized mitochondria (Figure 4.14A-C). Transient transfection of PINK1
in these PINK1 KO HeLa cells leads to near-to-endogenous PINK1 expression
levels under the pMSCV LTR promoter, and accumulation upon CCCP-induced
depolarization (Figure 4.14A). Note that while a doublet can clearly be observed
on Tris-Acetate gels, the accumulated PINK1 band does not resolve as a doublet
on a conventional Bis-Tris gel.
Reintroducing WT PINK1 in the PINK1 KO HeLa cells rescues Parkin
recruitment, confirming that the mitophagy defects we observe are caused by
lack of PINK1 expression (Figure 4.14B-C). When we express PINK1 mutants
S228A or T257A in our PINK1 KO HeLa cell line, we observe a rescue of Parkin
recruitment upon CCCP treatment to the same extent as for WT PINK1.
However, T313 or S402 mutation results in a reduction of Parkin recruitment
of 30% and 20% respectively (Figure 4.14D-E).
Interestingly, when we try to rescue the defect in Parkin recruitment using
phosphomimetic constructs T313D and S402D PINK1, we find that expression
of T313D PINK1 does not rescue Parkin recruitment at all, while S402D PINK1
is able to restore Parkin recruitment to WT levels (Figure 4.14D-E, T313D and
S402D).
Our findings identify that PINK1 residue T313 is not only crucial for PINK1
and substrate phosphorylation in vitro, it also affects Parkin recruitment in cells.
Additionally, the phosphorylation event of residue S402 is required for PINK1
to be fully active. We find no role for S228 phosphorylation in regulating FL
PINK1 function in cells.
Figure 4.14: T313 and S402 are important for Parkin recruitment
A, WT (PINK1+/+ ) and PINK1 KO (PINK1≠/≠ ) HeLa cells were treated with 10 µM
CCCP for 3 h and analysed for PINK1 expression via WB. No endogenous PINK1 is detected
in PINK1≠/≠ cells. Immunoblot using anti-—-actin shows equal loading. B, HeLa cells
were transfected with Parkin-GFP and treated with CCCP for 3h. Immunhistochemistry
for Parkin-GFP (green) and mitochondrial marker Cytochrome c (red) shows that WT
(PINK1+/+ ) but not PINK1 KO (PINK1≠/≠ ) HeLa cells display mitochondrial Parkin
recruitment. Expression of WT PINK1 in PINK1 KO cells rescues Parkin recruitment. The
scale bar represents 10 µm. C, Quantification of Parkin recruitment in WT (PINK1+/+ ),
KO (PINK1≠/≠ ) and KO HeLa cells rescued with human WT PINK1 after 3 h DMSO
or 10 µM CCCP treatment (mean ± SEM, n=6 independent experiments). D, PINK1
KO HeLa cells were transiently transfected with WT and mutant PINK1 and subsequently
treated with DMSO or 10 µM CCCP for 3h. PINK1 expression levels were analysed by WB.
Immunoblot using anti-—-actin shows equal loading. E, Quantification of Parkin recruitment
in PINK1 KO HeLa cells rescued with human WT or mutant PINK1 after 3 h of 10 µM
CCCP treatment. Statistical significance was calculated between each mutant and WT PINK1
using Dunnett’s test (**: p-value <0.01; ***: p-value < 0.001; ns: non-significant; mean ±
SEM, n=4 independent experiments).
74 RESULTS
4.2.7 Conclusion
We show that both Parkin and Ubiquitin phosphorylation can be regulated by

PINK1 phosphorylation on residues S228 and S402. Additionally, we reveal that
while the residue T313 is not required for autophosphorylation, it is essential
for substrate phosphorylation and Parkin recruitment. T257 phosphorylation
however is dispensable for PINK1 activity.
Phosphoregulation via residue S402 plays a role in Parkin recruitment on
depolarized mitochondria.
Chapter 5
Discussion
5.1 PINK1 activity
5.1.1 In vitro measurement of PINK1 activity
In this thesis, we have successfully employed an in vitro radioactive assay to

measure the kinase activity for N and FL human PINK1. We and others
report high activity for TcPINK1 in vitro (Woodroof et al. 2011; Kondapalli et al.
2012; Kane et al. 2014; Kazlauskaite et al. 2014a; Koyano et al. 2014). However,
our work reveals that human PINK1 requires more stringent purification and
activity measurement conditions to remain in its active confirmation. The
difficulties reported by other researchers in the field undertaking similar efforts
corroborate this notion (Sim et al. 2006; Plun-Favreau et al. 2007; Woodroof
et al. 2011).
Essential factors for the human PINK1 in vitro phosphorylation assay are time
and temperature. Although kinase assays are usually performed at 30°C, we
observe specific human PINK1 kinase activity by incubating PINK1 at 22°C for
1h. The reason why better results are obtained at this low temperature is unclear.
One possibility is that contaminating kinases are not active at this temperature,
allowing for a better detection of PINK1 activity. Delayed activity measurement
also strongly reduces the resulting phosphorylation signals. While loss of
75
76 DISCUSSION
enzymatic activity over time is not necessarily illogical, it is not accompanied by

marked PINK1 degradation. Which biochemical parameters explain the rapid
loss of PINK1 activity remains to be established. Additionally, strong reducing
conditions stimulate PINK1 catalytic activity, as an increased phosphorylation
signal was observed with 10 mM DTT. The use of such high DTT concentrations
in kinase assays is uncommon, but can stimulate activity through conformational
changes as is the case for insulin receptor kinase (Massague et al. 1982; Boni-
schnetzlers et al. 1986).
Because radioactive read-outs allow for direct measurement of enzyme activity

in a highly sensitive and accurate manner, they are ideally suited for the study
of enzyme kinetics and for the confirmation of direct substrates. However, as
with every method, there are some limitations. One is that an active kinase
can phosphorylate non-physiological targets in vitro. Nevertheless, such non-
physiological targets can be used to study enzyme kinetics. In the case of
PINK1 for example, the non-physiological substrate –-casein has been used to
study the effects of different mutations on kinase activity of PINK1 (Silvestri
et al. 2005). Another disadvantage is that both kinase and substrate might
obtain a different conformation in vitro, depending on purification and assay
conditions, and these conformational changes could influence substrate binding
and enzymatic activity. Essential interactors could also be absent in vitro,
precluding the detection of phosphorylation. A combination of both an in vitro
and in vivo or cell-based approach is required to confirm a candidate substrate
as a bona fide phosphorylation target of any kinase.
We successfully establish a robust in vitro protocol for assessing the activity
of human PINK1 towards its putative substrates. Nevertheless, PINK1’s
unconventional preferences with regards to the assay conditions require further
research.
PINK1 ACTIVITY 77
5.1.2 PINK1 substrates and interactors
Our results confirm that Parkin is a direct substrate of TcPINK1 (Figure 4.3).
We also show that both Parkin and Ubiquitin are phosphorylated by human
PINK1 (Figure 4.6). Although the non-physiological substrates Histone H1 and
PINKtide peptide prove useful to measure TcPINK1 activity in vitro, they are
not specifically phosphorylated by human PINK1. Human PINK1 also does not
phosphorylate TRAP1 in our set-up, contradicting previous reports identifying
it as a direct substrate (Pridgeon et al. 2007).
Our group recently demonstrated that PINK1 regulates Complex I activity
through the phosphorylation of NDUFA10 at S250 (Morais et al. 2014). However,
we could not confirm its role as a direct phosphorylation target of Tc or human
PINK1 in this study (Figure 4.3C and D; Figure 4.6C). It is possible that
the PINK1-dependent phosphorylation of NDUFA10 requires one or more
intermediate partners, or alternatively, that in the tested in vitro conditions the
conformation of PINK1, NDUFA10, or both, was not optimal for interaction.
Through mass spectrometry we identified different PINK1 interactors that

co-immunoprecipitate with PINK1 (Figure 4.6A), but are not phosphorylated
in our assays. They include members of the heat shock protein family, HSP90,
HSP70 and HSP71, but also eIF4B, involved in translation initiation. HSPs
are essential in the folding and refolding of native or damaged proteins, and
regulate protein assembly, translocation or degradation (reviewed by De Maio
1999). They also assist in the mitochondrial import of nuclear-encoded proteins.
It has previously been described that PINK1 is a HSP90 client kinase, and that
the chaperone system influences PINK1 cellular distribution (Weihofen et al.
2008; Rakovic et al. 2011). eIF4B is phosphorylated by multiple kinases but is
dephosphorylated upon heat shock (Duncan et al. 1989).
We did not address whether any of these interactors affect PINK1 kinase activity.
One could postulate that chaperones assist in keeping the PINK1 kinase in
an active (or inactive) conformation. This question would be particularly
interesting for HSP70 and HSP71, which show a preference for N over FL
PINK1 (Figure 4.4A).
78 DISCUSSION
5.2 PINK1 regulation
5.2.1 Structural features regulate PINK1 activity
Our work, in line with that of others, shows that PINKtide as well as Histone H1
are phosphorylated by TcPINK1 (Figure 4.2 and 4.3B; Woodroof et al. 2011).
However we observed no specific phosphorylation of PINKtide or Histone H1 by
human PINK1 (Figure 4.6B-C), indicating substrate interaction differs between
these two orthologues.
Kinase substrate recognition can occur through a consensus phosphorylation
sequence on the substrate, or through distal interactions mediated by docking
motifs spatially separated from the phosphorylation site in the substrate and
the active site of the kinase (Ubersax et al. 2007). Discrepancies between the
two kinases could thus be the result of both proximal and distal kinase-substrate
interaction. Bioinformatic analysis predicts that the two orthologues exhibit
different target sequence preferences (Sim et al. 2012). The fact that PINKtide is
not specifically phosphorylated by human PINK1 demonstrates that indeed the
consensus phosphorylation sequence of both kinases is different and undermines
the value of peptide library screens using insect orthologues instead of the human
protein. However, differences in Histone H1 phosphorylation are probably due
to altered distal interaction parameters. TcPINK1 and human PINK1 display
differences in the C-terminal lobe and in the number of unique insertion loops
in the N-terminal kinase lobe (Figure 4.1).
Interestingly, in vitro autophosphorylation is different between N and FL

PINK1. Our results suggest that PINK1 catalytic activity is regulated by the
N-terminal region preceding the kinase domain (Figure 4.5A). In cellular models,
processed PINK1 relocalizes to the cytosol where it interacts with Parkin and
subsequently represses mitophagy (Yamano et al. 2013; Fedorowicz et al. 2014).
In its interaction with MARK2 in the regulation of mitochondrial transport,
PINK1’s functional outcome is also dependent on cleavage (Matenia et al. 2012).
While truncated PINK1 promotes anterograde mitochondrial movement, full
length PINK1 stimulates retrograde transport, underscoring the importance of
PINK1 activity regulation through N-terminal processing.
The sequential N-terminal processing of PINK1 by different mitochondrial
proteases results in multiple cleaved forms of the kinase (Figure 4.7A). It
PINK1 REGULATION 79
remains unclear which role these different processed forms of PINK1 play
in mitochondrial homeostasis, but since several truncated forms contain the
complete PINK1 kinase domain and are catalytically active in vitro (Figure 4.4
and 4.5; Hertz et al. 2013), they certainly have potential functional importance.
Our results show that FL human PINK1 readily phosphorylates both Parkin
and Ubiquitin in vitro (Figure 4.6), even though autophosphorylation is not
observed. This indicates that autophosphorylation is not a prerequisite for
substrate phosphorylation, contrary to what is routinely proposed in the PINK1
literature (Okatsu et al. 2012; Kondapalli et al. 2012). Additionally, although
depolarization leads to rapid accumulation of phosphorylated PINK1 at the
outer membrane (Figure 4.7), we show that this is also not required for PINK1
activation (Figure 4.5A). However, the altered balance of FL versus processed
PINK1, induced by blockage of PINK1 import in depolarized mitochondria,
could explain why certain experimental read-outs on PINK1 function are
positively or negatively increased by CCCP or other uncoupling agents.
80 DISCUSSION
5.2.2 PINK1 phosphoregulation
We used a systematic approach evaluating the role of four reported PINK1

phosphosites for PINK1 phosphorylation and activity (Figure 4.7A). There was
no indication that residue T257, the first phosphosite identified on human PINK1
(Kondapalli et al. 2012), plays a role as a regulatory phosphorylation site, neither
in cell-based nor in the different in vitro assays that we employed. Kondapalli
et al. already acknowledged the necessary involvement of other additional sites
in PINK1 phosphorylation, as they also observe post-translationally modified
PINK1 even upon T257A mutation (Kondapalli et al. 2012). Therefore, based on
the lack of effect on autophosphorylation, substrate phosphorylation or Parkin
recruitment, we exclude the possibility of a role for T257 phosphorylation in
the regulation of PINK1 kinase activity (Figure 5.1).
Mutation of T313, however, fully abrogated FL PINK1 phosphorylation at the
mitochondria (Figure 4.10A) and also severely affected Parkin and Ubiquitin
phosphorylation in vitro (Figure 4.12A and C), as well as Parkin recruitment
(Figure 4.14E). These observations, and the fact that T313M is a known PD-
associated polymorphism (Luo et al. 2014), underscore the importance of this
residue for PINK1 function. However, autophosphorylation of N PINK1 was
not altered by T313 mutation (Figure 4.11A), indicating catalytic activity
is unaffected. Moreover, a T313 phosphomimetic version of PINK1 cannot
rescue the adverse effects on substrate phosphorylation (Figure 4.12C), and
completely abrogates Parkin recruitment to the mitochondria in CCCP-treated
HeLa cells (Figure 4.14E). Therefore, T313 is not a regulatory phosphorylation
site, but rather a structurally important amino acid, possibly involved in
substrate binding (Figure 5.1). T313 has been reported to be phosphorylated
in a truncated PINK1 form by MARK2, and an in vitro phosphorylation assay
performed in the presence of MARK2 showed increased PINK1 phosphorylation
for a T313E phosphomimetic mutant (Matenia et al. 2012). In light of the
results we obtained, it is questionable whether this reflects the importance of
this residue as a phosphorylation residue and we suggest further studies to
elucidate the mechanism by which MARK2 and PINK1 interact to influence
each other’s function and activity.
We provide in vitro evidence showing S228 and S402 are true PINK1
autophosphorylation sites (Figure 4.11) and that they are both capable of
PINK1 REGULATION 81
Figure 5.1: Overview of the role of S228, T257, T313 and S402
residues in PINK1 activity regulation
S228 is an autophosphorylation site in N PINK1 and it can regulate substrate
phosphorylation in vitro. However, both in vitro and in cells, S228 phosphorylation plays no
role in the regulation of WT FL PINK1 activity. Nevertheless, we propose it as a regulatory
phosphosite for processed PINK1. We found no implication for T257 as a (regulatory)
phosphosite in any of our experimental set-ups and therefore propose that this putative
phosphosite has no functional role for PINK1 activity. While T313 is an essential residue,
its function is not regulated through phosphorylation as autophosphorylation is not affected
upon T313 mutation and phosphomimetics rescue none of the observed functional defects.
Like S228, S402 is an autophosphorylation site in N PINK1, but it also regulates FL PINK1
in vitro and in cells. S402 is a thus regulatory phosphosite for both FL and N PINK1.
regulating PINK1 kinase activity and substrate phosphorylation (Figure 4.11;

Figure 4.12 and Figure 4.13). Phosphorylation of the S228 residue is of special
interest, as its involvement in PINK1 regulation differs for N and FL PINK1.
While an artificial phosphomimetic mutation at this residue promotes Parkin
and Ubiquitin phosphorylation by both PINK1 forms, this regulation does not
occur in vitro for WT FL PINK1 (Figure 4.12B). In our cell-based assays, we
also observe no alteration of PINK1 phosphorylation or of Parkin recruitment
when we compare S228A to WT PINK1 (Figure 4.10; Figure 4.14). Our results
enable a refinement of the role of S228 in the sense that phosphorylation of
this residue is only of regulatory importance in processed and not FL PINK1
(Figure 5.1).
The discrepancies observed between FL and N PINK1, with regard to their
respective regulation by phosphorylation, shed new light on the interpretation of
studies on PINK1 function and possible physiological substrates using different
PINK1 forms (see also section 5.2.1).
82 DISCUSSION
Our in vitro findings also put into question whether PINK1 phosphorylation at
the mitochondrial outer membrane is truly an autophosphorylation event, since
FL PINK1 shows no autophosphorylation activity in vitro. Interestingly, the
fact that T313A mutation does not affect N PINK1 autophosphorylation in
vitro (Figure 4.11A), but clearly abrogates FL PINK1 phosphorylation in cells
(Figure 4.10), indicates that this is unlikely to be autophosphorylation in the
strict sense. However, PINK1 phosphorylation in cells is dependent on PINK1
kinase activity, and so the most plausible interpretation is that intermolecular
phosphorylation occurs, as has been suggested by the detection of PINK1 dimers
at the outer mitochondrial membrane upon depolarization (Okatsu et al. 2013).
It is unclear why this transphosphorylation would not occur in vitro for FL
PINK1. Possibly, other interacting partners that are not present in an in vitro
context are required.
The distinct localization of phosphorylated PINK1 at the MOM indicates that
phosphoregulation is important for PINK1’s role at the outer mitochondrial
membrane in the initiation of mitophagy. However, the evidence that Parkin
phosphorylation is a prerequisite for mitophagy to occur is still somewhat
unclear, as S65 and T175 phosphodead Parkin mutants are still recruited to
damaged mitochondria (Iguchi et al. 2013; Song et al. 2013; Ordureau et al.
2014). Recently, several models have been proposed to explain how both Parkin
and Ubiquitin phosphorylation by PINK1 relate to mitochondrial relocalization
and ubiquitination (Kane et al. 2014; Koyano et al. 2014; Kazlauskaite et al.
2014a; Ordureau et al. 2014). We find that PINK1 mutations T313A and S402A
not only affect both Parkin and Ubiquitin phosphorylation, but also result in
reduced Parkin recruitment (Figure 4.14E). Phosphomimetic S402D PINK1,
which restores Parkin phosphorylation in vitro (Figure 4.12B and D), is able to
rescue Parkin recruitment back to WT levels (Figure 4.14E), suggesting Parkin
phosphorylation is required but not essential for its recruitment to depolarized
mitochondria.
Of note, we detect residual N PINK1 autophosphorylation after double
mutation of both S228 and S402 (Figure 4.11D). This demonstrates that PINK1
harbours additional as-of-yet unidentified autophosphorylation residues. It
will be interesting to establish their role in the regulation of PINK1 in Parkin
recruitment and other downstream pathways.
DIFFERENT PINK1, DIFFERENT ACTIVITY 83
5.3 Different PINK1, different activity
The recent identification of several additional PINK1 substrates continues to add

new dimensions to our understanding of PINK1 function. PINK1’s substrate
promiscuousness underlines its involvement in processes both on the outside and
inside of mitochondria, and its functional diversity underscores the importance
of regulation through post-translational modification, such as phosphorylation
and proteolytic processing.
While some PINK1 substrates are only functionally relevant in depolarizing

conditions, for others it is exactly the reverse (Section 1.2.3; Figure 5.2). Under
basal conditions, the turnover of PINK1 is very rapid, resulting in very low
levels of endogenous PINK1. Nevertheless, PINK1 is continuously expressed,
as deletion of PARL for example leads to a rapid and strong accumulation of
multiple PINK1 fragments (Figure 4.8B and C), indicating PARL is an important
player in the homeostatic mechanisms that keep endogenous PINK1 levels low.
Depolarizing conditions cause a strong accumulation of PINK1 as well (Narendra
et al. 2010), although the mechanism and location of PINK1 accumulation is
completely different from the PARL knockout situation (Figure 4.7 and Figure
4.8). These two examples show that a rapid switch from barely detectable protein
levels to strong accumulation depending on the mitochondrial context provides
a useful means for regulation of PINK1 by compartmentalization. Depending
on the mitochondrial membrane potential status, PINK1’s trafficking is altered
allowing for PINK1 to switch from one substrate to another. Through the
control of both HtrA2 and BCL-xL phosphorylation for example, PINK1 holds
a central position in apoptotic signalling. PINK1 can also alternate between
different parallel pathways, such as the initiation of mitophagy via Parkin and
Ubiquitin at the outer mitochondrial membrane upon depolarization (Kane
et al. 2014; Kazlauskaite et al. 2014a; Koyano et al. 2014; Ordureau et al. 2014),
versus regulation of ATP production via Complex I subunit NDUFA10 and
ubiquinone binding in the inner membrane of healthy mitochondria (Morais
et al. 2014; Pogson et al. 2014).
84 DISCUSSION
Figure 5.2: Localization of PINK1 and its candidate substrates

PINK1 is imported inside healthy mitochondria (left), where it mediates the phosphorylation
of TRAP1, HtrA2 and the Complex I subunit NDUFA10. After import, PINK1 is
processed by several proteases including MPP and PARL, and the resulting processed
protein retrotranslocates to the cytosol. Only under depolarizing conditions (right), PINK1
accumulates at the outer mitochondrial membrane where it is phosphorylated and subsequently
regulates the phosphorylation of Mfn2, Miro and BCL-xL, as well as Ubiquitin and Parkin after
their recruitment form the cytosol (MOM: mitochondrial outer membrane; IMS: intermembrane
space; MIM: mitochondrial inner membrane; Âm : mitochondrial membrane potential; Aerts
et al. 2015b).
DIFFERENT PINK1, DIFFERENT ACTIVITY 85
The work presented here underscores the potential of phosphorylation as an

additional regulation mechanism of PINK1 kinase activity. Numerous biological
examples illustrate that protein phosphorylation can alter kinase stability,
dynamics and binding of proteins (Nishi et al. 2014). However, this seldom is an
on-off process. Multisite phosphorylation allows for signal integration and fine-
tuning in the regulation of target proteins (Cohen 2000; Salazar et al. 2009). Such
complex phosphorylation codes are known to determine the ultimate biological
effect of kinases, for example those of the MAPK and Src-kinase families (Huang
et al. 1996; Markevich et al. 2004; Ingley 2008). Multisite phosphorylation in
Ser/Thr kinases often occurs in a sequential manner (Salazar et al. 2009), and
the interplay of S228 and S402 for PINK1 autophosphorylation in vitro indeed
indicates that phosphorylation of one site stimulates phosphorylation of the
other. In addition to altering substrate interaction, phosphorylation on different
sites can be modified by kinases and phosphatases which are located in different
cellular or mitochondrial compartments, thus allowing for increased specificity
through compartmentalization (Salazar et al. 2009).
In the case of PINK1, its complex processing and localization pattern could
underlie distinct phosphorylation conformations that refine its catalytic activity.
In light of this, one could postulate that besides the role for S402 in the
regulation of mitophagy, additional unidentified phosphorylation sites and other
post-translational modifications could be required to regulate other PINK1
functions in the mitochondria or the cytosol.
Indeed, accumulating evidence illustrates that PINK1 orchestrates multiple

parallel pathways through various downstream targets. While PINK1’s role
in CCCP-induced mitochondrial clearance is well-characterized in cell cultures
(Narendra et al. 2010), one of the major challenges in the field at present is to
demonstrate to what extent and under which (patho)physiological conditions
these mitophagic mechanisms become activated in neurons or other brain cells
in vivo (Rakovic et al. 2013; Grenier et al. 2013; Amadoro et al. 2014).
On the other hand, the deregulation of Complex I and OXPHOS function has
been reported in the brain of PINK1 loss-of-function animal models and in PD
patients harbouring PINK1 mutations, as well as in sporadic cases (Schapira
et al. 1989; Gautier et al. 2008; Morais et al. 2009; Vilain et al. 2012; Vos
et al. 2012; Morais et al. 2014). Although NDUFA10 could not be confirmed as
a direct PINK1 substrate in this study, these findings underscore the in vivo
86 DISCUSSION
relevance of PINK1 kinase activity in the regulation of electron transport chain

function in healthy mitochondria.
The parallel roles PINK1 could play in vivo under depolarizing and non-
depolarizing conditions (Figure 5.2), highlight the potential importance of
the regulatory mechanisms described in this work.
Chapter 6
Conclusions and perspectives
PINK1 is an unconventional kinase with a complex life cycle and it plays

multiple roles at different time points and places and through various substrates.
The molecular mechanisms underlying these functions are beginning to unravel,
as more and more putative substrates are identified. Since the start of this
PhD work, candidate substrates for PINK1 have more than doubled, and novel
genetic factors implicated in PD that can be linked to PINK1 or mitochondrial
function in general continue to be identified. This illustrates the enormous
progress that has been made in recent years towards understanding the molecular
pathogenesis of PINK1-related PD.
The work presented here illustrates that the health status of the mitochondria
in combination with the post-translational modification of PINK1 determine
the functional outcome of this intricate kinase. All these processes are closely
intertwined and most likely highly fine-tuned, requiring much more precise
biochemical studies to correctly interpret in vivo findings on PINK1’s role in
mitochondrial biology. While there are many speculations and assumptions
regarding PINK1 function and activity taken for granted in the field, the
underlying biochemical evidence is still limited.
An important unanswered question is how PINK1 clinical mutations affect

catalytic activity, substrate binding, subcellular localization or processing. As
they are scattered both throughout and outside of the kinase domain (Figure
87
88 CONCLUSIONS AND PERSPECTIVES
1.4), different disease-related mutations in PINK1 are likely to affect PINK1

activity in different ways, via one or more of the proposed regulatory mechanisms.
It is not unlikely that these mutations have different effects on downstream
pathways, which ultimately all converge on the disruption of mitochondrial
homeostasis and cause very similar phenotypes, even when different mechanisms
underlie the defect.
At present, only a small subset of mutations has been characterized in functional
read-outs. While PINK1 kinase activity is expected to be essential based on
the recessive inheritance pattern of mutations, not all clinical mutations affect
catalytic activity or PINK1 phosphorylation to the same degree (Woodroof
et al. 2011; Okatsu et al. 2012). We speculate that mutations that lie
outside of the kinase domain can affect PINK1 activity by disturbing PINK1
phosphorylation or proteolysis, or by hampering substrate recognition and
binding. A combination of both in vitro kinase assays as well as cell-based
biochemical studies is required to map the mechanism of action of each of
the clinical mutations in PINK1. Taking into account the various pathways
downstream of PINK1, we would not be surprised if their contribution to
each of them would vary. This variation would shed more light on the clinical
relevance of each of the proposed pathways reflecting the heterogeneity in disease
mechanisms underlying PINK1-related PD.
A solid biochemical understanding of the kinase regulation of PINK1 is the

basis for potential therapeutic modulation. So far, the development of kinase-
directed drugs has been limited to functional inhibition, but in the case of
PINK1, decreased activity leads to disease. Detailed insight into the upstream
regulatory mechanisms and downstream functional targets could therefore yield
interesting therapeutic targets.
An exciting example is the finding that PINK1 activity is increased using a
neo-substrate approach involving the ATP-analog kinesin triphosphate (Hertz
et al. 2013). This encouraging precedent illustrates the value of a thorough
comprehension of the regulation of PINK1 activity in health and disease.
Bibliography
[1] N. Abbas, C. B. Lücking, S. Ricard, A. Dürr, V. Bonifati, G. D. Michele, S. Bouley,

J. R. Vaughan, T. Gasser, R. Marconi, E. Broussolle, C. Brefel-courbon, B. S. Harhangi,
B. A. Oostra, E. Fabrizio, G. A. Böhme, L. Pradier, N. W. Wood, A. Filla, G. Meco,
P. Denefle, Y. Agid, and A. Brice. “A wide variety of mutations in the parkin gene are
responsible for autosomal recessive parkinsonism in Europe”. In: Human molecular
genetics 8.4 (1999), pp. 567–574.
[2] P. M. Abou-Sleiman, M. M. K. Muqit, and N. W. Wood. “Expanding insights of
mitochondrial dysfunction in Parkinson’s disease”. In: Nat Rev Neurosci 7.3 (2006),
pp. 207–219.
[3] J. M. Adams and S. Cory. “The Bcl-2-regulated apoptosis switch: mechanism and
therapeutic potential”. In: Curr Opin Immunol 19.5 (2007), pp. 488–496.
[4] L. Aerts, K. Craessaerts, B. De Strooper, and V. A. Morais. “PINK1 Catalytic Activity
is Regulated by Phosphorylation on Serines 228 and 402”. In: J Biol Chem 290.5
(2015), pp. 2798–811.
[5] L. Aerts, B. De Strooper, and V. A. Morais. “PINK1 activation - turning on a
promiscuous kinase”. In: Biochemical Society transactions In press (2015).
[6] G. Amadoro, V. Corsetti, F. Florenzano, A. Atlante, A. Bobba, V. Nicolin, S. L. Nori,
and P. Calissano. “Morphological and bioenergetic demands underlying the mitophagy
in post-mitotic neurons: the pink-parkin pathway.” In: Frontiers in aging neuroscience
6.February (2014), p. 18.
[7] G. W. Arbuthnott and J. Wickens. “Space, time and dopamine.” English. In: Trends
in neurosciences 30.2 (2007), pp. 62–9.
[8] G. Arena, V. Gelmetti, L. Torosantucci, D. Vignone, G. Lamorte, P. De Rosa, E.
Cilia, E. A. Jonas, and E. M. Valente. “PINK1 protects against cell death induced
by mitochondrial depolarization, by phosphorylating Bcl-xL and impairing its pro-
apoptotic cleavage.” In: Cell death and differentiation (2013), pp. 1–11.
[9] A. Barbeau, T. Sourkes, and C. Murphy. “Les catecholamines de la maladie de
Parkinson”. In: Monoamines et systeme Nerveux Central. Ed. by J. de Ajuriaguerra.
Geneva: Goerg & Cie SA, 1962, pp. 247–262.
[10] D. Becker, J. Richter, M. a. Tocilescu, S. Przedborski, and W. Voos. “Pink1 kinase and
its membrane potential (DeltaÂ)-dependent cleavage product both localize to outer
mitochondrial membrane by unique targeting mode.” In: The Journal of biological
chemistry 287.27 (2012), pp. 22969–87.
89
90 BIBLIOGRAPHY
[11] A. Beilina, M. V. D. Brug, R. Ahmad, S. Kesavapany, D. W. Miller, G. A. Petsko,

and M. R. Cookson. “Mutations in PTEN-induced putative kinase 1 associated with
recessive parkinsonism have differential effects on protein stability.” In: Proc Natl
Acad Sci U S A 102.16 (2005), pp. 5703–5708.
[12] W. Birkmayer and O. Homykiewicz. “(The L-3,4-dioxyphenylalanine (DOPA)-effect
in Parkinson-akinesia)”. In: Wien Klin Wochenschr 73 (1961), pp. 787–788.
[13] V. Bonifati, P. Rizzu, F. Squitieri, E. Krieger, N. Vanacore, J. C. van Swieten, A. Brice,
C. M. van Duijn, B. Oostra, G. Meco, and P. Heutink. “DJ-1 (PARK7), a novel gene
for autosomal recessive, early onset parkinsonism”. English. In: Neurological Sciences
24.3 (2003), pp. 159–160.
[14] M. Boni-schnetzlers, J. B. Rubin, and P. F. Pilchs. “Structural Requirements for the
Transmembrane Activation of the Insulin Receptor Kinase”. In: Journal of Biological
Chemistry 261.32 (1986), pp. 15281–15287.
[15] J. Bové, D. Prou, C. Perier, and S. Przedborski. “Toxin-Induced Models of Parkinson’s
Disease”. In: NeuroRx 2.3 (2005), pp. 484–494.
[16] H. Braak, K. Del Tredici, U. Rüb, R. A. de Vos, S. E. N. Jansen, and E. Braak.
“Staging of brain pathology related to sporadic Parkinson’s disease”. In: Neurobiology
of Aging 24.2 (2003), pp. 197–211.
[17] P. Brundin, J.-Y. Li, J. L. Holton, O. Lindvall, and T. Revesz. “Research in motion:
the enigma of Parkinson’s disease pathology spread”. In: Nat Rev Neurosci 9.10 (2008),
pp. 741–745.
[18] V. S. Burchell, D. E. Nelson, A. Sanchez-Martinez, M. Delgado-Camprubi, R. M. Ivatt,
J. H. Pogson, S. J. Randle, S. Wray, P. a. Lewis, H. Houlden, A. Y. Abramov, J. Hardy,
N. W. Wood, A. J. Whitworth, H. Laman, and H. Plun-Favreau. “The Parkinson’s
disease–linked proteins Fbxo7 and Parkin interact to mediate mitophagy”. In: Nature
Neuroscience 16.9 (2013).
[19] A. J. Caplan, A. K. Mandal, and M. A. Theodoraki. “Molecular chaperones and
protein kinase quality control”. In: Trends in Cell Biology 17.2 (2007), pp. 87–92.
[20] M.-C. Chartier-Harlin, J. C. Dachsel, C. Vilariño-Güell, S. J. Lincoln, F. Leprêtre,
M. M. Hulihan, J. Kachergus, A. J. Milnerwood, L. Tapia, M.-S. Song, E. Le Rhun,
E. Mutez, L. Larvor, A. Duflot, C. Vanbesien-Mailliot, A. Kreisler, O. A. Ross,
K. Nishioka, A. I. Soto-Ortolaza, S. A. Cobb, H. L. Melrose, B. Behrouz, B. H. Keeling,
J. A. Bacon, E. Hentati, L. Williams, A. Yanagiya, N. Sonenberg, P. J. Lockhart,
A. C. Zubair, R. J. Uitti, J. O. Aasly, A. Krygowska-Wajs, G. Opala, Z. K. Wszolek,
R. Frigerio, D. M. Maraganore, D. Gosal, T. Lynch, M. Hutchinson, A. R. Bentivoglio,
E. M. Valente, W. C. Nichols, N. Pankratz, T. Foroud, R. A. Gibson, F. Hentati,
D. W. Dickson, A. Destée, and M. J. Farrer. “Translation Initiator EIF4G1 Mutations
in Familial Parkinson Disease”. In: American Journal of Human Genetics 89.3 (2011),
pp. 398–406.
[21] Y. Chen and G. W. Dorn. “PINK1-Phosphorylated Mitofusin 2 is a Parkin Receptor
for Culling Damaged Mitochondria”. In: Science 340.6131 (2013), pp. 471–475.
[22] S. Cipolat, T. Rudka, D. Hartmann, V. Costa, L. Serneels, K. Craessaerts, K. Metzger,
C. Frezza, W. Annaert, L. D’Adamio, C. Derks, T. Dejaegere, L. Pellegrini, R. D’Hooge,
L. Scorrano, and B. D. Strooper. “Mitochondrial rhomboid PARL regulates cytochrome
c release during apoptosis via OPA1-dependent cristae remodeling.” In: Cell 126.1
(2006), pp. 163–175.
[23] I. E. Clark, M. W. Dodson, C. Jiang, J. H. Cao, J. R. Huh, J. H. Seol, S. J. Yoo,
B. A. Hay, and M. Guo. “Drosophila pink1 is required for mitochondrial function and
interacts genetically with parkin.” In: Nature 441.7097 (2006), pp. 1162–1166.
BIBLIOGRAPHY 91
[24] P. Cohen. “The regulation of protein function by multisite phosphorylation–a 25 year

update.” In: Trends in biochemical sciences 25.12 (2000), pp. 596–601.
[25] L. Cong, F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang,
L. a. Marraffini, and F. Zhang. “Multiplex genome engineering using CRISPR/Cas
systems.” In: Science 339.6121 (2013), pp. 819–23.
[26] M. R. Cookson. “Parkinsonism Due to Mutations in PINK1, Parkin, and DJ-1 and
Oxidative Stress and Mitochondrial Pathways”. In: Cold Spring Harbor Perspectives
in Medicine 2.9 (2012), a009415.
[27] A. C. Costa, S. H. Y. Loh, and L. M. Martins. “Drosophila Trap1 protects against
mitochondrial dysfunction in a PINK1/parkin model of Parkinson’s disease.” In: Cell
death & disease 4.1 (2013), e467.
[28] M. Cruts, J. Theuns, and C. Van Broeckhoven. “Locus-specific mutation databases
for neurodegenerative brain diseases.” In: Human mutation 33.9 (2012), pp. 1340–4.
[29] T. M. Dawson, H. S. Ko, and V. L. Dawson. “Genetic Animal Models of Parkinson’s
Disease”. In: Neuron 66.5 (2010), pp. 646–661.
[30] A. De Maio. “Heat shock proteins: facts, thoughts, and dreams”. In: Shock 11.1 (1999),
pp. 1–22.
[31] E. Deas, H. Plun-Favreau, S. Gandhi, H. Desmond, S. Kjaer, S. H. Y. Loh, A. E. M.
Renton, R. J. Harvey, A. J. Whitworth, L. M. Martins, A. Y. Abramov, and N. W.
Wood. “PINK1 cleavage at position A103 by the mitochondrial protease PARL.” In:
Human molecular genetics 20.5 (2010), pp. 867–879.
[32] E. Deas, H. Plun-Favreau, and N. W. Wood. “PINK1 function in health and disease.”
In: EMBO Mol Med 1.3 (2009), pp. 152–65.
[33] H. Deng, M. W. Dodson, H. Huang, and M. Guo. “The Parkinson’s disease genes
pink1 and parkin promote mitochondrial fission and/or inhibit fusion in Drosophila.”
In: Proc Natl Acad Sci U S A 105.38 (2008), pp. 14503–14508.
[34] H. Deng, K. Gao, and J. Jankovic. “The VPS35 gene and Parkinson’s disease”. In:
Movement Disorders 28.5 (2013), pp. 569–575.
[35] A. Di Fonzo, M. Dekker, P. Montagna, A. Baruzzi, E. Yonova, L. Correia Guedes,
A. Szczerbinska, T. Zhao, L. Dubbel-Hulsman, C. Wouters, E. de Graaff, W. Oyen,
E. Simons, G. Breedveld, B. Oostra, M. Horstink, and V. Bonifati. “FBXO7
mutations cause autosomal recessive, early-onset parkinsonian-pyramidal syndrome”.
In: Neurology 72.3 (2009), pp. 240–5.
[36] F. D. Dick, G. De Palma, A. Ahmadi, A. Osborne, N. W. Scott, G. J. Prescott,
J. Bennett, S. Semple, S. Dick, P. Mozzoni, N. Haites, S. B. Wettinger, A. Mutti,
M. Otelea, A. Seaton, P. Soderkvist, and A. Felice. “Geneenvironment interactions in
parkinsonism and Parkinson’s disease: the Geoparkinson study”. In: Occupational and
Environmental Medicine 64.10 (2007), pp. 673–680.
[37] K. S. Dimmer, F. Navoni, A. Casarin, E. Trevisson, S. Endele, A. Winterpacht,
L. Salviati, and L. Scorrano. “LETM1, deleted in Wolf-Hirschhorn syndrome is required
for normal mitochondrial morphology and cellular viability.” In: Human molecular
genetics 17.2 (2008), pp. 201–14.
[38] R. Duncan and J. Hershey. “Protein synthesis and protein phosphorylation during
heat stress, recovery, and adaptation”. In: The Journal of Cell Biology 109.4 (1989),
pp. 1467–1481.
92 BIBLIOGRAPHY
[39] S. Edvardson, Y. Cinnamon, A. Ta-Shma, A. Shaag, Y.-I. Yim, S. Zenvirt, C. Jalas,

S. Lesage, A. Brice, A. Taraboulos, K. H. Kaestner, L. E. Greene, and O. Elpeleg. “A
deleterious mutation in DNAJC6 encoding the neuronal-specific clathrin-uncoating
co-chaperone auxilin, is associated with juvenile parkinsonism.” In: PloS one 7.5
(2012). Ed. by C. Wider, e36458.
[40] M. Farrer, P. Chan, R. Chen, L. Tan, S. Lincoln, D. Hernandez, L. Forno, K. Gwinn-
Hardy, L. Petrucelli, J. Hussey, A. Singleton, C. Tanner, J. Hardy, and J. W. Langston.
“Lewy bodies and parkinsonism in families with parkin mutations”. In: Annals of
Neurology 50.3 (2001), pp. 293–300.
[41] M. Farrer, J. Kachergus, L. Forno, S. Lincoln, D. Wang, M. Hulihan, D. Maraganore, K.
Gwinn-Hardy, Z. Wszolek, D. Dickson, and J. Langston. “Comparison of kindreds with
parkinsonism and alpha-synuclein genomic multiplications”. In: Annals of neurology
55.2 (2004), pp. 174–9.
[42] M. A. Fedorowicz, R. L. A. de Vries-Schneider, C. Rüb, D. Becker, Y. Huang, C. Zhou,
D. M. Alessi Wolken, W. Voos, Y. Liu, and S. Przedborski. “Cytosolic cleaved PINK1
represses Parkin translocation to mitochondria and mitophagy.” In: EMBO reports
15.1 (2014), pp. 86–93.
[43] A. Fransson, A. Ruusala, and P. Aspenström. “The atypical Rho GTPases Miro-1
and Miro-2 have essential roles in mitochondrial trafficking.” In: Biochemical and
biophysical research communications 344.2 (2006), pp. 500–10.
[44] Y. Fujiki, a. L. Hubbard, S. Fowler, and P. B. Lazarow. “Isolation of intracellular
membranes by means of sodium carbonate treatment: application to endoplasmic
reticulum.” In: The Journal of cell biology 93.1 (1982), pp. 97–102.
[45] S. Gandhi, M. M. K. Muqit, L. Stanyer, D. G. Healy, P. M. Abou-Sleiman, I. Hargreaves,
S. Heales, M. Ganguly, L. Parsons, a. J. Lees, D. S. Latchman, J. L. Holton, N. W.
Wood, and T. Revesz. “PINK1 protein in normal human brain and Parkinson’s disease.”
In: Brain : a journal of neurology 129.Pt 7 (2006), pp. 1720–31.
[46] S. Gandhi, A. Wood-Kaczmar, Z. Yao, H. Plun-Favreau, E. Deas, K. Klupsch, J.
Downward, D. S. Latchman, S. J. Tabrizi, N. W. Wood, M. R. Duchen, and A. Y.
Abramov. “PINK1-associated Parkinson’s disease is caused by neuronal vulnerability
to calcium-induced cell death.” In: Molecular cell 33.5 (2009), pp. 627–38.
[47] T. Gasser. “Molecular pathogenesis of Parkinson disease: insights from genetic studies”.
In: Expert Reviews in Molecular Medicine 11 (2009), null–null.
[48] C. A. Gautier, T. Kitada, and J. Shen. “Loss of PINK1 causes mitochondrial functional
defects and increased sensitivity to oxidative stress.” In: Proc Natl Acad Sci U S A
105.32 (2008), pp. 11364–11369.
[49] M. E. Gegg, J. M. Cooper, K.-y. Chau, M. Rojo, and A. H. V. Schapira. “Mitofusin
1 and mitofusin 2 are ubiquitinated in a PINK1 / parkin-dependent manner upon
induction of mitophagy”. In: Hum Mol Genet 19.24 (2010), pp. 4861–70.
[50] E. E. Glater, L. J. Megeath, R. S. Stowers, and T. L. Schwarz. “Axonal transport
of mitochondria requires milton to recruit kinesin heavy chain and is light chain
independent.” In: The Journal of cell biology 173.4 (2006), pp. 545–57.
[51] C. G. Goetz. “The history of Parkinson’s disease: early clinical descriptions and
neurological therapies.” In: Cold Spring Harbor perspectives in medicine 1.1 (2011),
a008862.
[52] J. G. Goldman and R. Postuma. “Premotor and nonmotor features of Parkinson’s
disease.” In: Current opinion in neurology 27.4 (2014), pp. 434–41.
BIBLIOGRAPHY 93
[53] S. M. Goldman, C. M. Tanner, D. Oakes, G. S. Bhudhikanok, A. Gupta, and J. W.

Langston. “Head injury and Parkinson’s disease risk in twins”. In: Annals of Neurology
60.1 (2006), pp. 65–72.
[54] A. W. Greene, K. Grenier, M. A. Aguileta, S. Muise, R. Farazifard, M. E. Haque,
H. M. McBride, D. S. Park, and E. A. Fon. “Mitochondrial processing peptidase
regulates PINK1 processing, import and Parkin recruitment.” In: EMBO reports 13.4
(2012), pp. 378–385.
[55] J. C. Greene, A. J. Whitworth, I. Kuo, L. A. Andrews, M. B. Feany, and L. J. Pallanck.
“Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin
mutants”. In: Proceedings of the National Academy of Sciences of the United States
of America 100.7 (2003), pp. 4078–4083.
[56] K. Grenier, G.-L. McLelland, and E. A. Fon. “Parkin- and PINK1-Dependent
Mitophagy in Neurons: Will the Real Pathway Please Stand Up?” In: Frontiers
in neurology 4.July (2013), p. 100.
[57] A. Grünewald, L. Voges, A. Rakovic, M. Kasten, H. Vandebona, C. Hemmelmann,
K. Lohmann, S. Orolicki, A. Ramirez, A. H. V. Schapira, P. P. Pramstaller, C. M. Sue,
and C. Klein. “Mutant Parkin Impairs Mitochondrial Function and Morphology in
Human Fibroblasts”. In: PLoS ONE 5.9 (2010). Ed. by M. R. Cookson, e12962.
[58] D. M. Haddad, S. Vilain, M. Vos, G. Esposito, S. Matta, V. M. Kalscheuer, K.
Craessaerts, M. Leyssen, R. M. P. Nascimento, A. M. Vianna-Morgante, B. De Strooper,
H. Van Esch, V. a. Morais, and P. Verstreken. “Mutations in the intellectual disability
gene Ube2a cause neuronal dysfunction and impair parkin-dependent mitophagy.” In:
Molecular cell 50.6 (2013), pp. 831–43.
[59] D. B. Hancock, E. R. Martin, G. M. Mayhew, J. M. Stajich, R. Jewett, M. A. Stacy,
B. L. Scott, J. M. Vance, and W. K. Scott. “Pesticide exposure and risk of Parkinson’s
disease: A family-based case-control study”. In: BMC Neurology 8 (2008), p. 6.
[60] C. J. Hastie, H. J. McLauchlan, and P. Cohen. “Assay of protein kinases using
radiolabeled ATP: a protocol.” In: Nature protocols 1.2 (2006), pp. 968–71.
[61] T. G. Hastings. “Enzymatic Oxidation of Dopamine: The Role of Prostaglandin H
Synthase”. In: Journal of neurochemistry 64.2 (1995), pp. 919–24.
[62] K. Haugarvoll and Z. Wszolek. “Clinical features of LRRK2 parkinsonism”. In:
Parkinsonism & related disorders 15.Suppl 3 (2009), S205–8.
[63] D. G. Healy, M. Falchi, S. S. O’Sullivan, V. Bonifati, A. Durr, S. Bressman, A. Brice,
J. Aasly, C. P. Zabetian, S. Goldwurm, J. J. Ferreira, E. Tolosa, D. M. Kay, C. Klein,
D. R. Williams, C. Marras, A. E. Lang, Z. K. Wszolek, J. Berciano, A. H. V. Schapira,
T. Lynch, K. P. Bhatia, T. Gasser, A. J. Lees, N. W. Wood, and o. b. o. t. I. L.
Consortium. “Phenotype, genotype, and worldwide genetic penetrance of LRRK2-
associated Parkinson’s disease: a case-control study”. In: Lancet Neurology 7.7 (2008),
pp. 583–590.
[64] M. A. Hernán, B. Takkouche, F. Caamaño-Isorna, and J. J. Gestal-Otero. “A meta-
analysis of coffee drinking, cigarette smoking, and the risk of Parkinson’s disease”. In:
Annals of Neurology 52.3 (2002), pp. 276–284.
[65] N. T. Hertz, A. Berthet, M. L. Sos, K. S. Thorn, A. L. Burlingame, K. Nakamura,
and K. M. Shokat. “A Neo-Substrate that Amplifies Catalytic Activity of Parkinson’s-
Disease-Related Kinase PINK1”. In: Cell 154.4 (2013), pp. 737–747.
[66] C. F. Huang and J. E. Ferrell. “Ultrasensitivity in the mitogen-activated protein kinase
cascade”. In: Proceedings of the National Academy of Sciences 93.September (1996),
pp. 10078–10083.
94 BIBLIOGRAPHY
[67] M. Iguchi, Y. Kujuro, K. Okatsu, F. Koyano, H. Kosako, M. Kimura, N. Suzuki,

S. Uchiyama, K. Tanaka, and N. Matsuda. “Parkin catalyzed ubiquitin-ester transfer
is triggered by PINK1-dependent phosphorylation”. In: Journal of Biological Chemistry
288.30 (2013), pp. 22019–32.
[68] E. Ingley. “Src family kinases: regulation of their activities, levels and identification of
new pathways.” In: Biochimica et biophysica acta 1784.1 (2008), pp. 56–65.
[69] S. M. Jin, M. Lazarou, C. Wang, L. a. Kane, D. P. Narendra, and R. J.
Youle. “Mitochondrial membrane potential regulates PINK1 import and proteolytic
destabilization by PARL.” In: The Journal of Cell Biology 191.5 (2010), pp. 933–42.
[70] J. M. Jones, P. Datta, S. M. Srinivasula, W. Ji, S. Gupta, Z. Zhang, E. Davies,
G. Hajnóczky, T. L. Saunders, M. L. Van Keuren, T. Fernandes-Alnemri, M. H.
Meisler, and E. S. Alnemri. “Loss of Omi mitochondrial protease activity causes the
neuromuscular disorder of mnd2 mutant mice.” In: Nature 425.6959 (2003), pp. 721–7.
[71] E. R. Kandel, J. H. Schwartz, and T. M. Jessel. Principles of Neural Science. 4th.
McGraw-Hill, New York, 2000.
[72] L. A. Kane, M. Lazarou, A. I. Fogel, Y. Li, K. Yamano, S. A. Sarraf, S. Banerjee, and
R. J. Youle. “PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase
activity”. In: Journal of Cell Biology 205.2 (2014), pp. 143–53.
[73] R. B. Kapust and D. S. Waugh. “Escherichia coli maltose-binding protein is
uncommonly effective at promoting the solubility of polypeptides to which it is
fused.” In: Protein Science 8.8 (1999), pp. 1668–1674.
[74] A. Kazlauskaite, C. Kondapalli, R. Gourlay, D. G. Campbell, M. S. Ritorto, K.
Hofmann, D. R. Alessi, A. Knebel, M. Trost, and M. M. K. Muqit. “Parkin is activated
by PINK1-dependent phosphorylation of ubiquitin at Serine65”. In: Biochemical
Journal 460.1 (2014), pp. 127–39.
[75] A. Kazlauskaite and M. M. K. Muqit. “PINK1 and Parkin: mitochondrial interplay
between phosphorylation and ubiquitylation in Parkinson’s disease.” In: FEBS J
(2014).
[76] K. Kieburtz and K. B. Wunderle. “Parkinson’s disease: evidence for environmental
risk factors.” In: Movement disorders : official journal of the Movement Disorder
Society 28.1 (2013), pp. 8–13.
[77] Y. Kim, J. Park, S. Kim, S. Song, S.-K. Kwon, S.-H. Lee, T. Kitada, J.-M. Kim,
and J. Chung. “PINK1 controls mitochondrial localization of Parkin through direct
phosphorylation.” In: Biochemical and biophysical research communications 377.3
(2008), pp. 975–80.
[78] T. Kitada, S. Asakawa, N. Hattori, H. Matsumine, Y. Yamamura, S. Minoshima,
M. Yokochi, Y. Mizuno, and N. Shimizu. “Mutations in the parkin gene cause autosomal
recessive juvenile parkinsonism.” In: Nature 392.6676 (1998), pp. 605–8.
[79] C. Kondapalli, A. Kazlauskaite, N. Zhang, H. I. Woodroof, D. G. Campbell, R.
Gourlay, L. Burchell, H. Walden, T. J. Macartney, M. Deak, A. Knebel, D. R. Alessi,
and M. M. K. Muqit. “PINK1 is activated by mitochondrial membrane potential
depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65.”
In: Open biology 2.5 (2012), p. 120080.
[80] W. J. H. Koopman, L. G. J. Nijtmans, C. E. J. Dieteren, P. Roestenberg, F. Valsecchi,
J. A. M. Smeitink, and P. H. G. M. Willems. “Mammalian mitochondrial complex I:
biogenesis, regulation, and reactive oxygen species generation.” In: Antioxidants &
redox signaling 12.12 (2010), pp. 1431–70.
BIBLIOGRAPHY 95
[81] Ç. Köro lu, L. Baysal, M. Cetinkaya, H. Karasoy, and A. Tolun. “DNAJC6 is

responsible for juvenile parkinsonism with phenotypic variability”. In: Parkinsonism
and related Disorders 19.3 (2013), pp. 320–4.
[82] T. Koshiba, S. a. Detmer, J. T. Kaiser, H. Chen, J. M. McCaffery, and D. C. Chan.
“Structural basis of mitochondrial tethering by mitofusin complexes.” In: Science (New
York, N.Y.) 305.5685 (2004), pp. 858–62.
[83] F. Koyano, K. Okatsu, H. Kosako, Y. Tamura, E. Go, M. Kimura, Y. Kimura,
H. Tsuchiya, H. Yoshihara, T. Hirokawa, T. Endo, E. a. Fon, J.-F. Trempe, Y. Saeki,
K. Tanaka, and N. Matsuda. “Ubiquitin is phosphorylated by PINK1 to activate
parkin”. In: Nature 510.7503 (2014), pp. 162–6.
[84] C. E. Krebs, S. Karkheiran, J. C. Powell, M. Cao, V. Makarov, H. Darvish, G. Di Paolo,
R. H. Walker, G. A. Shahidi, J. D. Buxbaum, P. De Camilli, Z. Yue, and C. Paisán-
Ruiz. “The Sac1 domain of SYNJ1 identified mutated in a family with early-onset
progressive parkinsonism with generalized seizures”. In: Human mutation 34.9 (2013),
pp. 1200–1207.
[85] J. Langston, P. Ballard, J. Tetrud, and I. Irwin. “Chronic Parkinsonism in humans
due to a product of meperidine-analog synthesis”. In: Science 25.219(4587) (1983),
pp. 979–80.
[86] J. J. Lemasters. “Selective Mitochondrial Autophagy, or Mitophagy, as a Targeted
Defense Against Oxidative Stress, Mitochondrial Dysfunction, and Aging”. In:
Rejuvenation Research 8.1 (2005), pp. 3–5.
[87] W. Lin and U. J. Kang. “Characterization of PINK1 processing, stability, and
subcellular localization.” In: Journal of neurochemistry 106.1 (2008), pp. 464–74.
[88] S. Liu, T. Sawada, S. Lee, W. Yu, G. Silverio, P. Alapatt, I. Millan, A. Shen, W. Saxton,
T. Kanao, R. Takahashi, N. Hattori, Y. Imai, and B. Lu. “Parkinson’s Disease-
Associated Kinase PINK1 Regulates Miro Protein Level and Axonal Transport of
Mitochondria.” In: PLoS genetics 8.3 (2012), e1002537.
[89] C. B. Lucking, A. Durr, V. Bonifati, J. Vaughan, G. De Michele, T. Gasser, B. S.
Harhangi, G. Meco, P. Denefle, N. W. Wood, Y. Agid, and A. Brice. “Association
between early-onset Parkinson’s Disease and mutations in the parkin gene”. In: The
New England Journal of Medicine 342.21 (2000), pp. 1560–7.
[90] Q. Luo, X. Yang, Y. Yao, H. Li, and Y. Wang. “T313M polymorphism of the PINK1
gene in Parkinson’s disease.” In: Experimental and therapeutic medicine 8.1 (2014),
pp. 286–290.
[91] a. K. Lutz, N. Exner, M. E. Fett, J. S. Schlehe, K. Kloos, K. Lämmermann, B. Brunner,
A. Kurz-Drexler, F. Vogel, A. S. Reichert, L. Bouman, D. Vogt-Weisenhorn, W. Wurst,
J. Tatzelt, C. Haass, and K. F. Winklhofer. “Loss of parkin or PINK1 function increases
Drp1-dependent mitochondrial fragmentation.” In: The Journal of biological chemistry
284.34 (2009), pp. 22938–51.
[92] Madhusudan, E. A. Trafny, N. H. Xuong, J. A. Adams, L. F. Ten Eyck, S. S. Taylor,
and J. M. Sowadski. “cAMP-dependent protein kinase: crystallographic insights into
substrate recognition and phosphotransfer.” In: Protein Science : A Publication of
the Protein Society 3.2 (1994), pp. 176–187.
[93] M. C. Maj, S. Raha, T. Myint, and B. H. Robinson. “Regulation of NADH/CoQ
oxidoreductase: do phosphorylation events affect activity?” In: Protein J 23.1 (2004),
pp. 25–32.
[94] W. Mandemakers, V. A. Morais, and B. D. Strooper. “A cell biological perspective on
mitochondrial dysfunction in Parkinson disease and other neurodegenerative diseases.”
In: J Cell Sci 120.Pt 10 (2007), pp. 1707–1716.
96 BIBLIOGRAPHY
[95] N. I. Markevich, J. B. Hoek, and B. N. Kholodenko. “Signaling switches and bistability

arising from multisite phosphorylation in protein kinase cascades.” In: The Journal of
cell biology 164.3 (2004), pp. 353–9.
[96] L. M. Martins, A. Morrison, K. Klupsch, V. Fedele, N. Moisoi, P. Teismann, A. Abuin,
E. Grau, M. Geppert, G. P. Livi, C. L. Creasy, A. Martin, I. Hargreaves, S. J. Heales,
H. Okada, S. Brandner, B. Schulz, T. Mak, and J. Downward. “Neuroprotective Role
of the Reaper-Related Serine Protease HtrA2 / Omi Revealed by Targeted Deletion
in Mice”. In: Molecular and cellular biology 24.22 (2004), pp. 9848–9862.
[97] J. Massague and M. P. Czech. “Role of Disulfides in the Subunit Structure of the
Insulin Receptor”. In: Journal of Biological Chemistry 257.12 (1982), pp. 6729–6738.
[98] D. Matenia, C. Hempp, T. Timm, A. Eikhof, and E.-M. Mandelkow. “MARK2 Turns
on PINK1 at Thr-313, a Mutation Site in Parkinson Disease: effects on mitochondrial
transport”. In: The Journal of Biological Chemistry 287.11 (2012), pp. 8174–86.
[99] D. Matenia and E. M. Mandelkow. “Emerging modes of PINK1 signaling: another
task for MARK2.” In: Frontiers in molecular neuroscience 7 (2014), pp. 1–6.
[100] N. Matsuda, S. Sato, K. Shiba, K. Okatsu, K. Saisho, C. a. Gautier, Y.-S. Sou, S. Saiki,
S. Kawajiri, F. Sato, M. Kimura, M. Komatsu, N. Hattori, and K. Tanaka. “PINK1
stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria
and activates latent Parkin for mitophagy.” In: The Journal of cell biology 189.2
(2010), pp. 211–21.
[101] S. Matta, K. Van Kolen, R. da Cunha, G. van den Bogaart, W. Mandemakers,
K. Miskiewicz, P.-J. De Bock, V. a. Morais, S. Vilain, D. Haddad, L. Delbroek, J. Swerts,
L. Chávez-Gutiérrez, G. Esposito, G. Daneels, E. Karran, M. Holt, K. Gevaert,
D. W. Moechars, B. De Strooper, and P. Verstreken. “LRRK2 controls an EndoA
phosphorylation cycle in synaptic endocytosis.” In: Neuron 75.6 (2012), pp. 1008–21.
[102] C. Meissner, H. Lorenz, A. Weihofen, D. J. Selkoe, and M. K. Lemberg. “The
mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1
trafficking.” In: Journal of neurochemistry 117.5 (2011), pp. 856–67.
[103] F. M. Menzies, S. C. Yenisetti, and K.-T. Min. “Roles of Drosophila DJ-1 in Survival
of Dopaminergic Neurons and Oxidative Stress”. In: Current Biology 15.17 (2005),
pp. 1578–1582.
[104] R. D. Mills, C. H. Sim, S. S. Mok, T. D. Mulhern, J. G. Culvenor, and H.-C. Cheng.
“Biochemical aspects of the neuroprotective mechanism of PTEN-induced kinase-1
(PINK1).” In: Journal of neurochemistry 105.1 (2008), pp. 18–33.
[105] V. A. Morais, D. Haddad, K. Craessaerts, P.-J. De Bock, J. Swerts, S. Vilain, L. Aerts,
L. Overbergh, A. Grünewald, P. Seibler, C. Klein, K. Gevaert, P. Verstreken, and
B. De Strooper. “PINK1 Loss of Function Mutations Affect Mitochondrial Complex I
Activity via NdufA10 Ubiquinone Uncoupling”. In: Science 344.6180 (2014), pp. 203–7.
[106] V. A. Morais, P. Verstreken, A. Roethig, J. Smet, A. Snellinx, M. Vanbrabant,
D. Haddad, C. Frezza, W. Mandemakers, D. Vogt-Weisenhorn, R. V. Coster, W. Wurst,
L. Scorrano, and B. D. Strooper. “Parkinson’s disease mutations in PINK1 result in
decreased Complex I activity and deficient synaptic function.” In: EMBO Mol Med
1.2 (2009), pp. 99–111.
[107] H. Mortiboys, K. J. Thomas, W. J. H. Koopman, S. Klaffke, P. Abou-Sleiman,
S. Olpin, N. W. Wood, P. H. G. M. Willems, J. A. M. Smeitink, M. R. Cookson,
and O. Bandmann. “Mitochondrial function and morphology are impaired in parkin
mutant fibroblasts”. In: Annals of neurology 64.5 (2008), pp. 555–565.
BIBLIOGRAPHY 97
[108] N. Myeku and M. E. Figueiredo-Pereira. “Ubiquitin/Proteasome and Autophagy/Lysosome

Pathways: Comparison and Role in Neurodegeneration”. English. In: Handbook of
Neurochemistry and Molecular Neurobiology SE - 21. Ed. by A. Lajtha, N. Banik,
and S. Ray. Springer US, 2009, pp. 513–524.
[109] D. P. Narendra, S. Jin, A. Tanaka, D.-f. Suen, C. Gautier, J. Shen, M. R. Cookson, and
R. J. Youle. “PINK1 Is Selectively Stabilized on Impaired Mitochondria to Activate
Parkin”. In: PLoS Biology 8.1 (2010), e1000298.
[110] D. P. Narendra, A. Tanaka, D.-F. Suen, and R. J. Youle. “Parkin is recruited selectively
to impaired mitochondria and promotes their autophagy.” In: The Journal of cell
biology 183.5 (2008), pp. 795–803.
[111] H. Nishi, A. Shaytan, and A. R. Panchenko. “Physicochemical mechanisms of protein
regulation by phosphorylation.” In: Frontiers in genetics 5.August (2014), p. 270.
[112] K. Okatsu, T. Oka, M. Iguchi, K. Imamura, H. Kosako, N. Tani, M. Kimura, E. Go,
F. Koyano, M. Funayama, K. Shiba-Fukushima, S. Sato, H. Shimizu, Y. Fukunaga,
H. Taniguchi, M. Komatsu, N. Hattori, K. Mihara, K. Tanaka, and N. Matsuda.
“PINK1 autophosphorylation upon membrane potential dissipation is essential for
Parkin recruitment to damaged mitochondria”. In: Nature Communications 3.1016
(2012), pp. 1–10.
[113] K. Okatsu, M. Uno, F. Koyano, E. Go, M. Kimura, T. Oka, K. Tanaka, and N. Matsuda.
“A dimeric PINK1-containing complex on depolarized mitochondria stimulates Parkin
recruitment.” In: The Journal of Biological Chemistry 288.51 (2013), pp. 36372–84.
[114] A. Ordureau, S. A. Sarraf, D. M. Duda, J.-m. Heo, M. P. Jedrykowski, V. O. Sviderskiy,
J. L. Olszewski, J. T. Koerber, T. Xie, S. A. Beausoleil, J. A. Wells, S. P. Gygi, B. A.
Schulman, and J. W. Harper. “Article Quantitative Proteomics Reveal a Feedforward
Mechanism for Mitochondrial PARKIN Translocation and Ubiquitin Chain Synthesis”.
In: Molecular Cell 56.3 (2014), pp. 360–75.
[115] C. Paisan-Ruiz, K. P. Bhatia, A. Li, D. Hernandez, M. Davis, N. W. Wood, J. Hardy,
H. Houlden, A. Singleton, and S. A. Schneider. “Characterization of PLA2G6 as a
locus for dystonia-parkinsonism”. In: Annals of Neurology 65.1 (2009), pp. 19–23.
[116] C. Paisan-Ruiz, S. Jain, E. W. Evans, W. P. Gilks, J. Simo, D. Munain, M. van der
Brug, A. Lopez de Munian, S. Aparicio, A. Martınez Gil, N. Khan, J. Johnson,
J. Ruiz Martinez, D. Nicholl, I. M. Carrera, A. Saenz Pena, R. de Silva, A. Lees,
N. W. Wood, and A. B. Singleton. “Cloning of the Gene Containing Mutations that
Cause PARK8-Linked Parkinson’s Disease”. In: Neuron 44 (2004), pp. 595–600.
[117] C. Paisán-Ruiz, P. A. Lewis, and A. B. Singleton. “LRRK2: Cause, Risk, and
Mechanism”. In: Journal of Parkinson’s disease 3.2 (2013), pp. 85–103.
[118] J. J. Palacino, D. Sagi, M. S. Goldberg, S. Krauss, C. Motz, M. Wacker, J. Klose, and
J. Shen. “Mitochondrial dysfunction and oxidative damage in parkin-deficient mice.”
In: The Journal of biological chemistry 279.18 (2004), pp. 18614–22.
[119] J. Park, S. Y. Kim, G.-H. Cha, S. B. Lee, S. Kim, and J. Chung. “Drosophila DJ-1
mutants show oxidative stress-sensitive locomotive dysfunction.” In: Gene 361 (2005),
pp. 133–9.
[120] J. Park, S. B. Lee, S. Lee, Y. Kim, S. Song, S. Kim, E. Bae, J. Kim, M. Shong,
J.-M. Kim, and J. Chung. “Mitochondrial dysfunction in Drosophila PINK1 mutants
is complemented by parkin.” In: Nature 441.7097 (2006), pp. 1157–1161.
[121] J. Parkinson. An essay on the shaking palsy. Whitting- ham, Rowland for Sherwood,
Needly, and Jones, London. Reichert, 1817.
98 BIBLIOGRAPHY
[122] H. Plun-Favreau, K. Klupsch, N. Moisoi, S. Gandhi, S. Kjaer, D. Frith, K. Harvey,

E. Deas, R. J. Harvey, N. McDonald, N. W. Wood, L. M. Martins, and J. Downward.
“The mitochondrial protease HtrA2 is regulated by Parkinson’s disease-associated
kinase PINK1.” In: Nat Cell Biol 9.11 (2007), pp. 1243–1252.
[123] J. H. Pogson, R. M. Ivatt, A. Sanchez-Martinez, R. Tufi, E. Wilson, H. Mortiboys, and
A. J. Whitworth. “The Complex I Subunit NDUFA10 Selectively Rescues Drosophila
pink1 Mutants through a Mechanism Independent of Mitophagy”. In: PLoS Genetics
10.11 (2014), e1004815.
[124] M. H. Polymeropoulos, C. Lavedan, E. Leroy, S. E. Ide, A. Dehejia, A. Dutra,
B. Pike, H. Root, J. Rubenstein, R. Boyer, E. S. Stenroos, S. Chandrasekharappa,
A. Athanassiadou, T. Papapetropoulos, W. G. Johnson, A. M. Lazzarini, R. C.
Duvoisin, G. Di Iorio, L. I. Golbe, and R. L. Nussbaum. “Mutation in the –-Synuclein
Gene Identified in Families with Parkinson’s Disease”. In: Science 276.5321 (1997),
pp. 2045–2047.
[125] A. C. Poole, R. E. Thomas, L. A. Andrews, H. M. Mcbride, A. J. Whitworth, and
L. J. Pallanck. “The PINK1 / Parkin pathway regulates mitochondrial morphology”.
In: Proc Natl Acad Sci U S A 105.5 (2008), pp. 1638–43.
[126] A. C. Poole, R. E. Thomas, S. Yu, E. S. Vincow, and L. Pallanck. “The mitochondrial
fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway.” In:
PloS one 5.4 (2010), e10054.
[127] J. W. Pridgeon, J. A. Olzmann, L.-S. Chin, and L. Li. “PINK1 protects against
oxidative stress by phosphorylating mitochondrial chaperone TRAP1.” In: PLoS Biol
5.7 (2007), e172.
[128] T. Pringsheim, N. Jette, A. Frolkis, and T. D. L. Steeves. “The prevalence of Parkinson’s
disease: A systematic review and meta-analysis.” In: Movement disorders (2014), [Epub
ahead of print].
[129] M. Quadri, M. Fang, M. Picillo, S. Olgiati, G. J. Breedveld, J. Graafland, B. Wu,
F. Xu, R. Erro, M. Amboni, S. Pappatà, M. Quarantelli, G. Annesi, A. Quattrone,
H. F. Chien, E. R. Barbosa, T. I. P. G. Network, B. A. Oostra, P. Barone, J. Wang,
and V. Bonifati. “Mutation in the SYNJ1 Gene Associated with Autosomal Recessive,
Early-Onset Parkinsonism”. In: Human Mutation 34.9 (2013), pp. 1208–1215.
[130] M. Rafie-Kolpin, P. Chefalo, Z. Hussain, J. Hahn, S. Uma, R. Matts, and J. Chen.
“Two Heme-binding Domains of Heme-regulated Eukaryotic Initiation Factor-2alpha
Kinase”. In: Journal of Biological Chemistry 275.7 (2000), pp. 5171–8.
[131] A. Rakovic, A. Grünewald, L. Voges, S. Hofmann, S. Orolicki, K. Lohmann, and
C. Klein. “PINK1-Interacting Proteins: Proteomic Analysis of Overexpressed PINK1”.
In: Parkinson’s Disease 2011 (2011), p. 153979.
[132] A. Rakovic, K. Shurkewitsch, P. Seibler, A. Grünewald, A. Zanon, J. Hagenah,
D. Krainc, and C. Klein. “Phosphatase and tensin homolog (PTEN)-induced
putative kinase 1 (PINK1)-dependent ubiquitination of endogenous Parkin attenuates
mitophagy: study in human primary fibroblasts and induced pluripotent stem cell-
derived neurons.” In: The Journal of biological chemistry 288.4 (2013), pp. 2223–37.
[133] A. Ramirez, A. Heimbach, J. Grundemann, B. Stiller, D. Hampshire, L. P. Cid,
I. Goebel, A. F. Mubaidin, A.-L. Wriekat, J. Roeper, A. Al-Din, A. M. Hillmer,
M. Karsak, B. Liss, C. G. Woods, M. I. Behrens, and C. Kubisch. “Hereditary
parkinsonism with dementia is caused by mutations in ATP13A2, encoding a lysosomal
type 5 P-type ATPase”. In: Nat Genet 38.10 (2006), pp. 1184–1191.
BIBLIOGRAPHY 99
[134] I. N. Rudenko and M. R. Cookson. “Heterogeneity of leucine-rich repeat kinase 2

mutations: genetics, mechanisms and therapeutic implications.” In: Neurotherapeutics
: the journal of the American Society for Experimental NeuroTherapeutics 11.4 (2014),
pp. 738–50.
[135] C. Salazar and T. Höfer. “Multisite protein phosphorylation–from molecular
mechanisms to kinetic models.” In: The FEBS journal 276.12 (2009), pp. 3177–98.
[136] S. a. Sarraf, M. Raman, V. Guarani-Pereira, M. E. Sowa, E. L. Huttlin, S. P. Gygi,
and J. W. Harper. “Landscape of the PARKIN-dependent ubiquitylome in response
to mitochondrial depolarization”. In: Nature (2013), pp. 1–7.
[137] L. A. Scarffe, D. A. Stevens, V. L. Dawson, and T. M. Dawson. “Parkin and PINK1:
much more than mitophagy”. In: Trends in Neurosciences 37.6 (2014), pp. 315–324.
[138] A. H. V. Schapira, J. Cooper, D. Dexter, P. Jenner, J. Clark, and C. Marsden.
“Mitochondrial Complex I deficency in Parkinson’s disase”. In: The Lancet June 3
(1989), p. 1269.
[139] A. H. V. Schapira. “Mitochondria in the aetiology and pathogenesis of Parkinson’s
disease.” In: Lancet Neurol 7.1 (2008), pp. 97–109.
[140] S. E. Seidl, J. A. Santiago, H. Bilyk, and J. A. Potashkin. “The emerging role of
nutrition in Parkinson’s disease”. In: Frontiers in Aging Neuroscience 6 (2014), p. 36.
[141] D. Sha, L. Chin, and L. Li. “Phosphorylation of parkin by Parkinson disease-linked
kinase PINK1 activates parkin E3 ligase function and NF-kB signaling”. In: Human
molecular genetics 19.2 (2010), pp. 352–363.
[142] K. Shiba-Fukushima, Y. Imai, S. Yoshida, Y. Ishihama, and T. Kanao. “PINK1-
mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial
translocation of Parkin and regulates mitophagy”. In: Scientific reports 2.1002 (2012),
pp. 1–8.
[143] H. Shimura, N. Hattori, S.-i. Kubo, Y. Mizuno, S. Asakawa, S. Minoshima, N. Shimizu,
K. Iwai, T. Chiba, K. Tanaka, and T. Suzuki. “Familial Parkinson disease gene product,
parkin, is a ubiquitin-protein ligase”. In: Nat Genet 25.3 (2000), pp. 302–305.
[144] E. Sidransky, M. A. Nalls, J. O. Aasly, J. Aharon-Peretz, G. Annesi, E. R. Barbosa,
A. Bar-Shira, D. Berg, J. Bras, A. Brice, C.-M. Chen, L. N. Clark, C. Condroyer,
E. V. De Marco, A. Dürr, M. J. Eblan, S. Fahn, M. Farrer, H.-C. Fung, Z. Gan-Or,
T. Gasser, R. Gershoni-Baruch, N. Giladi, A. Griffith, T. Gurevich, C. Januario,
P. Kropp, A. E. Lang, G.-J. Lee-Chen, S. Lesage, K. Marder, I. F. Mata, A. Mirelman,
J. Mitsui, I. Mizuta, G. Nicoletti, C. Oliveira, R. Ottman, A. Orr-Urtreger, L. V.
Pereira, A. Quattrone, E. Rogaeva, A. Rolfs, H. Rosenbaum, R. Rozenberg, A. Samii,
T. Samaddar, C. Schulte, M. Sharma, A. Singleton, M. Spitz, E.-K. Tan, N. Tayebi,
T. Toda, A. Troiano, S. Tsuji, M. Wittstock, T. G. Wolfsberg, Y.-R. Wu, C. P. Zabetian,
Y. Zhao, and S. G. Ziegler. “Multi-center analysis of glucocerebrosidase mutations
in Parkinson disease”. In: The New England journal of medicine 361.17 (2009),
pp. 1651–1661.
[145] L. Silvestri, V. Caputo, E. Bellacchio, L. Atorino, B. Dallapiccola, E. M. Valente, and
G. Casari. “Mitochondrial import and enzymatic activity of PINK1 mutants associated
to recessive parkinsonism.” In: Hum Mol Genet 14.22 (2005), pp. 3477–3492.
[146] C. H. Sim, K. Gabriel, R. D. Mills, J. G. Culvenor, and H.-C. Cheng. “Analysis of the
regulatory and catalytic domains of PTEN-induced kinase-1 (PINK1).” In: Human
mutation 33.10 (2012), pp. 1408–22.
100 BIBLIOGRAPHY
[147] C. H. Sim, D. S. S. Lio, S. S. Mok, C. L. Masters, A. F. Hill, J. G. Culvenor, and

H.-C. Cheng. “C-terminal truncation and Parkinson’s disease-associated mutations
down-regulate the protein serine/threonine kinase activity of PTEN-induced kinase-1.”
In: Hum Mol Genet 15.21 (2006), pp. 3251–3262.
[148] A. B. Singleton, M. Farrer, J. Johnson, A. Singleton, S. Hague, J. Kachergus, M.
Hulihan, T. Peuralinna, A. Dutra, R. Nussbaum, S. Lincoln, A. Crawley, M. Hanson,
D. Maraganore, C. Adler, M. R. Cookson, M. Muenter, M. Baptista, D. Miller,
J. Blancato, J. Hardy, and K. Gwinn-Hardy. “–-Synuclein Locus Triplication Causes
Parkinson’s Disease”. In: Science 302.5646 (2003), p. 841.
[149] Y. Smith, T. Wichmann, S. a. Factor, and M. R. DeLong. “Parkinson’s disease
therapeutics: new developments and challenges since the introduction of levodopa.”
In: Neuropsychopharmacology : official publication of the American College of
Neuropsychopharmacology 37.1 (2012), pp. 213–46.
[150] D. Snead and D. Eliezer. “Alpha-synuclein function and dysfunction on cellular
membranes.” In: Experimental neurobiology 23.4 (2014), pp. 292–313.
[151] S. Song, S. Jang, J. Park, S. Bang, S. Choi, K.-Y. Kwon, X. Zhuang, E. Kim, and
J. Chung. “Characterization of phosphatase and tensin homolog (PTEN)-induced
putative kinase 1 (PINK1) mutations associated with Parkinson’s disease in mammalian
cells and Drosophila.” In: The Journal of biological chemistry 288.8 (2013), pp. 5660–72.
[152] M. Spatola and C. Wider. “Genetics of Parkinson’s disease: the yield”. In: Parkinsonism
and realted Disorders 20.S1 (2014), S35–S38.
[153] M. G. Spillantini, M. L. Schmidt, V. M.-Y. Lee, J. Q. Trojanowski, R. Jakes, and M.
Goedert. “[alpha]-Synuclein in Lewy bodies”. In: Nature 388.6645 (1997), pp. 839–840.
[154] E. K. Steer, M. K. Dail, and C. T. Chu. “Beyond Mitophagy: Cytosolic PINK1 as
a messenger of mitochondrial health.” In: Antioxidants & redox signaling 6 (2015),
pp. 1–39.
[155] K. Strauss, L. Martins, H. Plun-Favreau, F. Marx, S. Kautzmann, D. Berg, T. Gasser,
Z. Wszolek, T. Müller, A. Bornemann, H. Wolburg, J. Downward, O. Riess, J. Schulz,
and R. Krüger. “Loss of function mutations in the gene encoding Omi/HtrA2 in
Parkinson’s disease”. In: Hum Mol Genet 14.15 (2005), pp. 2099–111.
[156] J. D. Surmeier, J. N. Guzman, and J. Sanchez-Padilla. “Calcium, cellular aging, and
selective neuronal vulnerability in Parkinson’s disease”. In: Cell calcium 47.2 (2010),
pp. 175–182.
[157] M. Swan and R. Saunders-Pullman. “The association between ß-glucocerebrosidase
mutations and parkinsonism”. In: Current neurology and neuroscience reports 13.8
(2013), p. 368.
[158] Y. Tanaka, S. Engelender, S. Igarashi, R. K. Rao, T. Wanner, R. E. Tanzi, A. Sawa,
V. L. Dawson, T. M. Dawson, and C. A. Ross. “Inducible expression of mutant
–-synuclein decreases proteasome activity and increases sensitivity to mitochondria-
dependent apoptosis”. In: Human Molecular Genetics 10.9 (2001), pp. 919–926.
[159] C. M. Tanner, F. Kamel, G. W. Ross, J. A. Hoppin, S. M. Goldman, M. Korell,
C. Marras, G. S. Bhudhikanok, M. Kasten, A. R. Chade, K. Comyns, M. B. Richards,
C. Meng, B. Priestley, H. H. Fernandez, F. Cambi, D. M. Umbach, A. Blair, D. P.
Sandler, and J. W. Langston. “Rotenone, Paraquat, and Parkinson’s Disease”. In:
Environmental Health Perspectives 119.6 (2011), pp. 866–872.
[160] C. M. Tanner, G. Ross, S. Jewell, R. Hauser, J. Jankovic, S. Factor, S. Bressman,
A. Deligtisch, C. Marras, K. Lyons, G. Bhudhikanok, D. Roucoux, C. Meng, R. Abbott,
and J. Langston. “Occupation and risk of parkinsonism: A multicenter case-control
study”. In: Archives of Neurology 66.9 (2009), pp. 1106–1113.
BIBLIOGRAPHY 101
[161] K. S. M. Taylor, J. a. Cook, and C. E. Counsell. “Heterogeneity in male to female risk

for Parkinson’s disease.” In: Journal of neurology, neurosurgery, and psychiatry 78.8
(2007), pp. 905–6.
[162] E. L. Thacker, H. Chen, A. V. Patel, M. L. McCullough, E. E. Calle, M. J. Thun,
M. A. Schwarzschild, and A. Ascherio. “Recreational physical activity and risk of
Parkinson’s disease”. In: Movement Disorders 23.1 (2008), pp. 69–74.
[163] H. Tokumitsu, N. Takahashi, K. Eto, S. Yano, T. R. Soderling, and M.-A. Muramatsu.
“Substrate Recognition by Ca2+/Calmodulin-dependent Protein Kinase Kinase: role
of the Arg-Pro-rich insert domain”. In: Journal of Biological Chemistry 274.22 (1999),
pp. 15803–15810.
[164] Y. Tong, H. Yamaguchi, E. Giaime, S. Boyle, R. Kopan, R. J. Kelleher, and J. Shen.
“Loss of leucine-rich repeat kinase 2 causes impairment of protein degradation pathways,
accumulation of alpha-synuclein, and apoptotic cell death in aged mice.” In: Proceedings
of the National Academy of Sciences of the United States of America 107.21 (2010),
pp. 9879–84.
[165] A. Tucci, G. Charlesworth, U.-M. Sheerin, V. Plagnol, N. W. Wood, and J. Hardy.
“Study of the genetic variability in a Parkinson’s Disease gene: EIF4G1”. In:
Neuroscience Letters 518.1 (2012), pp. 19–22.
[166] J. A. Ubersax and J. E. Ferrell Jr. “Mechanisms of specificity in protein
phosphorylation”. In: Nat Rev Mol Cell Biol 8.7 (2007), pp. 530–541.
[167] E. M. Valente, P. M. Abou-Sleiman, V. Caputo, M. M. K. Muqit, K. Harvey, S. Gispert,
Z. Ali, D. Del Turco, A. R. Bentivoglio, D. G. Healy, A. Albanese, R. Nussbaum,
R. González-Maldonado, T. Deller, S. Salvi, P. Cortelli, W. P. Gilks, D. S. Latchman,
R. J. Harvey, B. Dallapiccola, G. Auburger, and N. W. Wood. “Hereditary early-onset
Parkinson’s disease caused by mutations in PINK1.” In: Science 304.5674 (2004),
pp. 1158–1160.
[168] L. Vande Walle, M. Lamkanfi, and P. Vandenabeele. “The mitochondrial serine protease
HtrA2/Omi: an overview”. In: Cell Death Differ 15.3 (2008), pp. 453–460.
[169] S. Vilain, G. Esposito, D. Haddad, O. Schaap, M. P. Dobreva, M. Vos, S. Van Meensel,
V. a. Morais, B. De Strooper, and P. Verstreken. “The yeast complex I equivalent
NADH dehydrogenase rescues pink1 mutants.” In: PLoS genetics 8.1 (2012), e1002456.
[170] C. Vilariño-Güell, C. Wider, O. A. Ross, J. C. Dachsel, J. M. Kachergus, S. J. Lincoln,
A. I. Soto-Ortolaza, S. A. Cobb, G. J. Wilhoite, J. A. Bacon, B. Behrouz, H. L. Melrose,
E. Hentati, A. Puschmann, D. M. Evans, E. Conibear, W. W. Wasserman, J. O. Aasly,
P. R. Burkhard, R. Djaldetti, J. Ghika, F. Hentati, A. Krygowska-Wajs, T. Lynch,
E. Melamed, A. Rajput, A. H. Rajput, A. Solida, R.-M. Wu, R. J. Uitti, Z. K. Wszolek,
F. Vingerhoets, and M. J. Farrer. “VPS35 Mutations in Parkinson Disease”. In:
American Journal of Human Genetics 89.1 (2011), pp. 162–167.
[171] N. Villa, A. Do, J. W. B. Hershey, and C. S. Fraser. “Human Eukaryotic Initiation
Factor 4G (eIF4G) Protein Binds to eIF3c, -d, and -e to Promote mRNA Recruitment
to the Ribosome”. In: The Journal of Biological Chemistry 288.46 (2013), pp. 32932–
32940.
[172] K. R. Vinothkumar, J. Zhu, and J. Hirst. “Architecture of mammalian respiratory
complex I”. In: Nature 515.7525 (2014), pp. 80–84.
[173] M. Vos, G. Esposito, J. N. Edirisinghe, S. Vilain, D. M. Haddad, J. R. Slabbaert,
S. Van Meensel, O. Schaap, B. De Strooper, R. Meganathan, V. A. Morais, and
P. Verstreken. “Vitamin K2 Is a Mitochondrial Electron Carrier That Rescues Pink1
Deficiency”. In: Science 336.June (2012), pp. 1306–1310.
102 BIBLIOGRAPHY
[174] M. Vos, B. Lovisa, A. Geens, V. A. Morais, G. Wagnières, H. van den Bergh, A. Ginggen,
B. De Strooper, Y. Tardy, and P. Verstreken. “Near-Infrared 808 nm Light Boosts
Complex IV-Dependent Respiration and Rescues a Parkinson-Related pink1 Model”.
In: PLoS ONE 8.11 (2013). Ed. by B. D. McCabe, e78562.
[175] H. Wang, M. Karbowski, and M. J. Monteiro. “Mitochondrial Dynamics and
Neurodegeneration”. In: (2011). Ed. by B. Lu, pp. 235–257.
[176] T. Wauer, K. N. Swatek, J. L. Wagstaff, C. Gladkova, J. N. Pruneda, M. A. Michel,
M. Gersch, C. M. Johnson, S. M. V. Freund, and D. Komander. “Ubiquitin Ser65
phosphorylation affects ubiquitin structure , chain assembly and hydrolysis”. In: The
EMBO journal (2014), e201489847 [Epub ahead of print].
[177] J. L. Webb, B. Ravikumar, J. Atkins, J. N. Skepper, and D. C. Rubinsztein. “Alpha-
Synuclein is degraded by both autophagy and the proteasome.” In: The Journal of
biological chemistry 278.27 (2003), pp. 25009–13.
[178] A. Weihofen, B. Ostaszewski, Y. Minami, and D. J. Selkoe. “Pink1 Parkinson mutations,
the Cdc37/Hsp90 chaperones and Parkin all influence the maturation or subcellular
distribution of PINK1.” In: Hum Mol Genet 17.4 (2008), pp. 602–616.
[179] A. Weihofen, K. J. Thomas, B. L. Ostaszewski, M. R. Cookson, and D. J. Selkoe.
“Pink1 forms a multiprotein complex with Miro and Milton, linking Pink1 function to
mitochondrial trafficking.” In: Biochemistry 48.9 (2009), pp. 2045–2052.
[180] H. I. Woodroof, J. H. Pogson, M. Begley, L. C. Cantley, M. Deak, D. G. Campbell,
D. M. F. van Aalten, A. J. Whitworth, D. R. Alessi, and M. K. Muqit. “Discovery of
catalytically active orthologues of the Parkinson’s disease kinase PINK1 : analysis of
substrate specificity and impact of mutations”. In: Open Biology 1.3 (2011), p. 110012.
[181] K. Yamano and R. J. Youle. “PINK1 is degraded through the N-end rule pathway”.
In: Autophagy 9.11 (2013), pp. 1758–69.
[182] F. Yang, Q. Jiang, J. Zhao, Y. Ren, M. D. Sutton, and J. Feng. “Parkin stabilizes
microtubules through strong binding mediated by three independent domains.” In: J
Biol Chem 280.17 (2005), pp. 17154–17162.
[183] R. J. Youle and D. P. Narendra. “Mechanisms of mitophagy.” In: Nature reviews.
Molecular cell biology 12.1 (2011), pp. 9–14.
[184] L. Zhang, P. Karsten, S. Hamm, J. H. Pogson, A. K. Lutz, N. Exner, C. Haass,
A. Whitworth, K. Winklhofer, J. B. Schulz, and A. Voigt. “TRAP1 rescues PINK1
loss-of-function phenotypes”. In: Human molecular genetics 22.14 (2013), pp. 2829–41.
[185] T. Zhao, L. Severijnen, M. van der Weiden, P. Zheng, B. Oostra, R. Hukema,
R. Willemsen, J. Kros, and V. Bonifati. “FBXO7 immunoreactivity in –-synuclein-
containing inclusions in Parkinson disease and multiple system atrophy”. In: Journal
of neuropathology and experimental neurology 72.6 (2013), pp. 482–8.
[186] X. Zheng and T. Hunter. “Pink1, the first ubiquitin kinase”. In: The EMBO Journal
(2014), pp. 2013–2015.
[187] C. Zhou, Y. Huang, Y. Shao, J. May, D. Prou, C. Perier, W. Dauer, E. a. Schon, and
S. Przedborski. “The kinase domain of mitochondrial PINK1 faces the cytoplasm.”
In: Proceedings of the National Academy of Sciences of the United States of America
105.33 (2008), pp. 12022–7.
BIBLIOGRAPHY 103
[188] A. Zimprich, A. Benet-Pagès, W. Struhal, E. Graf, S. H. Eck, M. N. Offman, D.

Haubenberger, S. Spielberger, E. C. Schulte, P. Lichtner, S. C. Rossle, N. Klopp,
E. Wolf, K. Seppi, W. Pirker, S. Presslauer, B. Mollenhauer, R. Katzenschlager,
T. Foki, C. Hotzy, E. Reinthaler, A. Harutyunyan, R. Kralovics, A. Peters, F. Zimprich,
T. Brücke, W. Poewe, E. Auff, C. Trenkwalder, B. Rost, G. Ransmayr, J. Winkelmann,
T. Meitinger, and T. M. Strom. “A Mutation in VPS35, Encoding a Subunit of the
Retromer Complex, Causes Late-Onset Parkinson Disease”. In: American Journal of
Human Genetics 89.1 (2011), pp. 168–175.
[189] A. Zimprich, S. Biskup, P. Leitner, P. Lichtner, M. Farrer, S. Lincoln, J. Kachergus,
M. Hulihan, R. J. Uitti, D. B. Calne, A. J. Stoessl, R. F. Pfeiffer, N. Patenge,
I. C. Carbajal, P. Vieregge, F. Asmus, B. Müller-Myhsok, D. W. Dickson, T. Meitinger,
T. M. Strom, Z. K. Wszolek, and T. Gasser. “Mutations in LRRK2 cause autosomal-
dominant parkinsonism with pleomorphic pathology.” English. In: Neuron 44.4 (2004),
pp. 601–7.
[190] E. Ziviani, R. N. Tao, and A. J. Whitworth. “Drosophila parkin requires PINK1
for mitochondrial translocation and ubiquitinates mitofusin.” In: Proceedings of the
National Academy of Sciences of the United States of America 107.11 (2010), pp. 5018–
23.
Curriculum vitae
Personalia
Liesbeth Aerts
°22 November 1986
Smidsestraat 37 box 102

9000 Gent, Belgium
+32 498 63 67 39
aerts.lb@gmail.com
Education
Current education
PhD candidate in Biomedical Sciences, KU Leuven & VIB, Belgium

Promoters: Prof. Bart De Strooper & Prof. Vanessa A. Morais
Thesis research on PINK1 kinase activity at the Laboratory for Research

of Neurodegenerative diseases at the Center for Human Genetics,
Leuven Institute for Neuroscience and Disease (LIND) and
the VIB Center for the Biology of Disease
Doctoral programme in Molecular and Cognitive Neuroscience
105
106 CURRICULUM VITAE
Qualifications
2013 Postgraduate Degree in Science Communication,

KU Leuven, Belgium
2010 MSc in Clinical Neuroscience,

University College London, UK
2009 MSc in Biosciences engineering: Molecular engineering,

KU Leuven, Belgium
Erasmus exchange at Universidad de Salamanca, Spain
2007 BSc in Biosciences engineering: Molecular engineering,

KU Leuven, Belgium
Additional courses and workshops
2014 LERU Summer School on Research Integrity

University of Helsinki, Finland
2013 Summer School in Science Communication

VUB & Flemish Government, Brussels
2012 Effective Writing for Life Sciences Research

University of Oxford course, Leuven
2010 Parkinson’s disease Summer School for Healthcare Students

Ljubljana, Slovenia
2009 Laboratory Animal Science: FELASA certificate B

KU Leuven, Belgium
Honors
2014 Keystone Symposia Future of Science Fund scholarship
2011 IWT doctoral scholarship
2010 BOF doctoral scholarship
2009 Rotary district scholarship for specialized studies abroad

LIESBETH AERTS 107
Publications
Research papers
Aerts L, Craessaerts K, De Strooper B, Morais VA. PINK1 Catalytic

Activity is Regulated by Phosphorylation on Serines 228 and 402. Journal
of Biological Chemistry 2015, Jan 30;290(5):2798-811
Morais VA, Haddad D, Craessaerts K, De Bock PJ, Swerts J, Vilain S,

Aerts L, Overbergh L, Grünewald A, Seibler P, Klein C, Gevaert K,
Verstreken P, De Strooper B. PINK1 loss of function mutations affect
mitochondrial Complex I activity via ubiquinone coupling at subunit
NdufA10. Science 2014, Apr 11;344(6180):203-7
Ruiz de Almodovar C, Fabre P, Knevels E, Coulon C, Segura I, Haddick

PCG, Aerts L, Delattin N, Strasser G, Oh WJ, Lange C, Vinckier
S, Haigh JJ, Fouquet C, Henderson C, Gu C, Alitalo K, Castellani V,
Tessier-Lavigne M, Chedotal A, Charron F, Carmeliet P. VEGF mediates
commissural axon chemoattraction through its receptor Flk1. Neuron
2011, June 9 (70):966-78
Reviews and viewpoints
Aerts L, De Strooper B, Morais VA. PINK1 activation – turning on a

promiscuous kinase. Biochemical Society Transactions, In press
Titeca K, Aerts L, Krols M, Vandersarren L, Akay O, Yilmaz S,

Hristozova N, Janiak M. From challenges to perspectives: Reflections
of young scientists on the current state of academic research. EMBO
Reports 2014, Oct;15(10):1010-4
Conference abstracts and proceedings
Aerts L, Craessaerts K, De Strooper B, Morais VA. Regulation of PINK1

kinase activity and function by phosphorylation. PINK1-Parkin Signalling
in Parkinson’s Disease and Beyond, London, UK. December 2, 2014. Oral
presentation
108 CURRICULUM VITAE
Aerts L, Craessaerts K, De Strooper B, Morais VA. Regulation of the

mitochondrial kinase PINK1. CME PhD student symposium, Leuven,
Belgium. September 25-26, 2014. Oral presentation
Aerts L, Morais VA, Craessaerts K, Oettinghaus B, De Bock PJ, Gevaert

K, De Strooper B. Regulation of the Parkinson’s disease-related kinase
PINK1. PhD interaction day, Leuven, Belgium. December 19, 2013.
Poster presentation
Aerts L, Morais VA, Craessaerts K, Oettinghaus B, De Bock PJ,

Gevaert K, De Strooper B. Regulation of the mitochondrial kinase PINK1:
implications for PD. Keystone Parkinson’s Disease, Keystone, CO, USA.
March 2-6, 2014. Poster presentation
Aerts L, Morais VA, Craessaerts K, Oettinghaus B, Overbergh L, De Bock

PJ, Gevaert K, De Strooper B. Analysis of the impact of Parkinson-related
PINK1 mutations on its mitochondrial processing and phosphorylation
activity. AD/PD, Florence, Italy. March 6-10, 2013. Poster presentation
Aerts L, Morais VA, Craessaerts K, Oettinghaus B, Overbergh L, De Bock

PJ, Gevaert K, De Strooper B. The role of mitochondrial kinase PINK1
in Parkinson’s disease: impact of clinical mutations on mitochondrial
processing and phosphorylation activity. VIB seminar, Blankenberge,
Belgium. February 6-8, 2013. Poster presentation
Aerts L, Morais VA, Craessaerts K, Oettinghaus B, Overbergh L, De

Bock PJ, Gevaert K, De Strooper B. Mitochondrial processing and
phosphorylation activity of PINK1: analysis of the impact of Parkinson-
related mutations. LIND seminar, Mechelen, Belgium. December 17, 2012.
Poster presentation
Aerts L, Morais VA, Craessaerts K, Overbergh L, Helbig AO, Heck AJR,

De Strooper B. Identification and validation of substrates of the PD-
related kinase PINK1. Centre for Brain Repair Spring School, Cambridge,
UK. March 30 - April 1st, 2011. Poster presentation
View publication stats

Aerts Thesis RG

Uploaded by

Copyright:

Available Formats

You might also like

Aerts Thesis RG

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Aerts Thesis RG

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

The regulation of PINK1 kinase activity: implications for Parkinson's disease

Thesis · March 2015

DementiaKT Hub.and toolbox: DementiaKT.com.au View project

The user has requested enhancement of the downloaded file.

LEUVEN UNIVERSITY PRESS

Promoter: Bart De Strooper

8 2015 by Leuven University Press / Presses Universitaires de Louvain / Universitaire Pers

ISBN 978 94 6165 161 7

Mutations in the PINK1 gene cause an early-onset familial form of the

substrates Parkin and Ubiquitin, but only S402 phosphorylation appears to be

bijkomende, nog niet geïdentificeerde fosforylatie residu’s aanwezig in PINK1.

List of Tables xiii

1.1 The Parkinson’s disease challenge . . . . . . . . . . . . . . . . . . 1

1.1.1 A short history of Parkinson’s disease . . . . . . . . . . . 1

1.1.2 The search for a cause and a cure . . . . . . . . . . . . . 4

1.2 Understanding PINK1 kinase biology . . . . . . . . . . . . . . . 14

1.2.1 PINK1 kinase structure . . . . . . . . . . . . . . . . . . 14

1.2.2 PINK1 regulation by processing and phosphorylation . . 17

1.2.3 PINK1’s substrates and functions . . . . . . . . . . . . . 20

3 Materials and methods 33

3.2 Cell culture and stable cell lines . . . . . . . . . . . . . . . . . . 34

3.3 Mitochondrial fractionation . . . . . . . . . . . . . . . . . . . . 36

3.4 Sodium carbonate extraction . . . . . . . . . . . . . . . . . . . 36

3.5 Proteinase K accessibility assay . . . . . . . . . . . . . . . . . . 37

3.6 Protein dephosphorylation . . . . . . . . . . . . . . . . . . . . . 37

3.7 Tris-Acetate and Phos-tag SDS-PAGE . . . . . . . . . . . . . . 38

3.8 TcPINK1 in vitro kinase assay . . . . . . . . . . . . . . . . . . 39

3.9 hPINK1 in vitro kinase assay . . . . . . . . . . . . . . . . . . . 40

3.10 Substrate expression and purification . . . . . . . . . . . . . . . . 41

3.11 Mass spectrometry . . . . . . . . . . . . . . . . . . . . . . . . . 42

3.12 Parkin recruitment . . . . . . . . . . . . . . . . . . . . . . . . . 42

3.13 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . 43

4.1 PINK1 purification and substrate validation . . . . . . . . . . . 45

4.1.1 Triboleum castaneum PINK1 . . . . . . . . . . . . . . . 47

4.1.2 Human PINK1 . . . . . . . . . . . . . . . . . . . . . . . 50

4.2 PINK1 regulation by phosphorylation . . . . . . . . . . . . . . 58

4.2.1 PINK1 phosphorylation occurs at the outer membrane . 58

4.2.2 PINK1 phosphorylation does not influence localization or

4.2.3 T313 and S402 are required for PINK1 phosphorylation 64

4.2.4 S228 and S402 are autophosphorylation sites . . . . . . 67

4.2.5 S228 and S402 phosphorylation regulate substrate phos-

4.2.6 S402 phosphorylation regulates Parkin recruitment . . . 72

5.1 PINK1 activity . . . . . . . . . . . . . . . . . . . . . . . . . . . 75

5.1.1 In vitro measurement of PINK1 activity . . . . . . . . . 75

5.1.2 PINK1 substrates and interactors . . . . . . . . . . . . . 77

5.2 PINK1 regulation . . . . . . . . . . . . . . . . . . . . . . . . . . 78

5.2.1 Structural features regulate PINK1 activity . . . . . . . 78

5.2.2 PINK1 phosphoregulation . . . . . . . . . . . . . . . . . 80

5.3 Different PINK1, different activity . . . . . . . . . . . . . . . . 83

6 Conclusions and perspectives 87

Curriculum vitae 105

1.1 Loss of dopaminergic neurons in substantia nigra leads to reduced

1.2 Models of human PD-associated proteins . . . . . . . . . . . . . 6

1.3 Pathogenic mechanisms of PD . . . . . . . . . . . . . . . . . . . 12

1.4 PINK1 mutations and predicted kinase structure . . . . . . . . 15

1.5 Chemical basis of PINK1 phosphorylation . . . . . . . . . . . . 16