International Journal of

Molecular Sciences

Article
Comparative Effects and Mechanisms of Chitosan and
Its Derivatives on Hypercholesterolemia in High-Fat
Diet-Fed Rats
Chen-Yuan Chiu 1 , Tsai-En Yen 2 , Shing-Hwa Liu 3,4,5, * and Meng-Tsan Chiang 2, *
1 Department of Botanicals, Medical and Pharmaceutical Industry Technology and Development Center,
New Taipei City 248, Taiwan; cychiu@pitdc.org.tw
2 Department of Food Science, College of Life Science, National Taiwan Ocean University,
Keelung 202, Taiwan; tsaienyen@gmail.com
3 Institute of Toxicology, College of Medicine, National Taiwan University, Taipei 100, Taiwan
4 Department of Pediatrics, College of Medicine and Hospital, National Taiwan University, Taipei 100, Taiwan
5 Department of Medical Research, China Medical University Hospital, China Medical University,
Taichung 404, Taiwan
* Correspondence: shinghwaliu@ntu.edu.tw (S.-H.L.); a0071@mail.ntou.edu.tw (M.-T.C.)




Received: 27 November 2019; Accepted: 19 December 2019; Published: 21 December 2019


Abstract: The present study investigated and compared the effects of different molecular weights
of chitosan (high molecular weight chitosan (HC) and low molecular weight chitosan (LC)) and
its derivatives (chitosan oligosaccharide (CO)) on cholesterol regulation in high-fat (HF) diet-fed
rats. A diet supplementation of 5% HC, 5% LC, or 5% CO for 8 weeks showed hypocholesterolemic
potential in HF diet-fed rats. Unexpectedly, a 5% CO-supplemented diet exerted hepatic damage,
producing increased levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT),
and tumor necrosis factor-alpha (TNF-α). The supplementation of HC and LC, unlike CO, significantly
decreased the hepatic total cholesterol (TC) levels and increased the fecal TC levels in HF diet-fed rats.
The hepatic protein expression of the peroxisome proliferator-activated receptor-α (PPARα) in the HF
diet-fed rats was markedly decreased, which could be significantly reversed by both HC and LC,
but not CO, supplementation. Unlike the supplementation of CO, both HC and LC supplementation
could effectively reverse the HF-inhibited/induced gene expressions of the low-density lipoprotein
receptor (LDLR) and cholesterol 7α-hydroxylase (CYP7A1), respectively. The upregulated intestinal
acyl-CoA cholesterol acyltransferase 2 (ACAT2) protein expression in HF diet-fed rats could be
reversed by HC and LC, but not CO, supplementation. Taken together, a supplementation of 5% CO
in HF diet-fed rats may exert liver damage via a higher hepatic cholesterol accumulation and a higher
intestinal cholesterol uptake. Both HC and LC effectively ameliorated the hypercholesterolemia
and regulated cholesterol homeostasis via the activation and inhibition of hepatic (AMPKα and
PPARα) and intestinal (ACAT2) cholesterol-modulators, respectively, as well as the modulation of
downstream signals (LDLR and CYP7A1).

Keywords: high and low molecular weight chitosan; chitosan oligosaccharide; lipid metabolism

1. Introduction
The hepatic manifestation, non-alcoholic fatty liver disease (NAFLD), has been an emerging
public concern worldwide with an estimated 20%~30% prevalence among developing and developed
countries, which is associated with elevated mortality and morbidity, particularly due to changing
dietary habits in the consumption of western-style foods [1,2]. Hypercholesterolemia, a characteristic
disorder of lipid metabolism that arose from overloads of cholesterol-, trans-fat-, and saturated fat-rich

Int. J. Mol. Sci. 2020, 21, 92; doi:10.3390/ijms21010092 www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2020, 21, 92 2 of 11

food, is a critical risk factor for the initiation and progression of NAFLD, leading to other chronic
diseases, including cardiovascular diseases (CVD), metabolic syndrome, and cancer [3–5]. In addition,
the increment levels of very-low-density lipoprotein cholesterol (VLDL-C), low-density lipoprotein
cholesterol (LDL-C), and total cholesterol (TC) in serum or plasma have been manifested in the
occurrence of hypercholesterolemia [6]. To date, the therapeutic remedy against hypercholesterolemia
is commonly to abide in pharmacological medicines, including statins and fibrates, which may
generate many adverse effects. Hence, exploring an alternative medicine, such as natural products,
for controlling hypercholesterolemia has recently been an acceptable strategy against NAFLD.
Recently, a remarkable number of natural bioactive products have been explored from various
marine organisms for the prevention or therapy of chronic diseases, including cardiovascular diseases,
diabetes, arthritis, osteoporosis, neurodegenerative diseases, acquired immunodeficiency syndrome
(AIDS), and cancers [7]. Chitosan, as well as the partial deacetylation of chitin composed of
β-(1-4)-linked D-glucosamine and N-acetyl-d-glucosamine from the exoskeletons of marine crustaceans,
including shrimps and crabs, has had its advantages manifested as the functional food (or nutraceutical)
used in the prevention or treatment of the aforementioned chronic diseases, containing antibacterial,
antidiabetic, antioxidant, anticancer, anti-inflammatory, and hypocholesterolemic properties [8–11].
Based on the characteristics of the biocompatibility of its structure and properties, there has recently
been a growing interest in the biomedical and food applications of the depolymerized derivatives of high
molecular weight chitosan (HC), low molecular weight chitosan (LC), and chitosan oligosaccharides
(CO) against obesity, diabetes, and other metabolic disorders [12,13]. However, the comparative
regulation of the lipid metabolism among HC, LC, and CO groups is not clear. Therefore, in the
present study, high-fat (HF) diet-induced hypercholesterolemic rats were used as a metabolic imbalance
animal model to interpret the comparative effects and mechanisms among HC, LC, and CO groups in
regulating blood, hepatic, or fecal cholesterol levels.

2. Results and Discussion

2.1. Effects of High Molecular Weight Chitosan (HC), Low Molecular Weight Chitosan (LC), and Chitosan
Oligosaccharide (CO) on Body Weight, Organ Weights, and Food Intake in High-Fat (HF) Diet-Fed Rats
Firstly, we examined the effects of HC, LC, and CO on body weight, organ weights, and food intake
in HF diet-fed rats. As shown in Figure 1, rats fed with 5% LC and 5% CO for 8 weeks significantly
reduced the final body weight compared to the HF group (Figure 1A). The food consumption was not
significantly different among groups (Figure 1B). In addition, as shown in Figure 1C, liver weights
are significantly increased in HF-fed rats, which could be reversed by the supplementation of either
5% HC or 5% LC; on the contrary, the supplementation of 5% CO in HF-fed rats has no significant
improvement in the live weight. Moreover, there are no significant difference in intestinal weights
among groups (Figure 1D). Picchi et al. (2011) have shown that HF diet-administered rats do not
experience elevated weight gain but do develop a fatty liver compared to the rats that received the
normal AIN-93 diet, which is similar to our result that the liver weight significantly increases without
a significant increase in body weight gain in HF diet-fed rats [14]. Interestingly, the results show that
the supplementation of 5% CO does not exhibit the therapeutic potential in HF diet-induced liver
weight gains but causes a significant reduction in body weight, which was also found in diabetic
Goto–Kakizaki rats with the supplementation of CO by Teodoro et al. (2016) [15], implying that a 5%
CO supplementation may exert the liver damage potential.
Int. J. Mol. Sci. 2020, 21, 92 3 of 11
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 3 of 11

Figure1.1.Effects
Figure of high-molecular
Effects weight
of high-molecular and low-molecular
weight weight (MW)
and low-molecular weightchitosan
(MW) (high molecular
chitosan (high
weight chitosan (HC), low molecular weight chitosan (LC), respectively) or chitosan oligosaccharide
molecular weight chitosan (HC), low molecular weight chitosan (LC), respectively) or chitosan
(CO) on body weight
oligosaccharide (A),body
(CO) on foodweight
consumption
(A), food(B), liver weight(B),
consumption (C),liver
andweight
intestine
(C),weight (D) in
and intestine
high-fat (HF) diet-fed rats. The rats were fed with different experimental diets for 8 weeks. Data are
weight (D) in high-fat (HF) diet-fed rats. The rats were fed with different experimental diets for 8
presented as the mean ± SD (n = 6). * p < 0.05 as compared with the control group; # p < 0.05 as
weeks. Data are presented as the mean ± SD (n = 6). * p < 0.05 as compared with the control group; #
compared with the HF group. NC, normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC,
p < 0.05 as compared with the HF group. NC, normal control +5% cellulose; HF, high-fat diet +5%
high-fat diet +5% high-MW chitosan; LC, high-fat diet +5% low-MW chitosan; CO, high-fat diet +5%
cellulose; HC, high-fat diet +5% high-MW chitosan; LC, high-fat diet +5% low-MW chitosan; CO,
chitosan oligosaccharide.
high-fat diet +5% chitosan oligosaccharide.
2.2. Effects of HC, LC, and CO on Hepatic and Fecal Lipid Responses in HF Diet-Fed Rats
2.2. Effects of HC, LC, and CO on Hepatic and Fecal Lipid Responses in HF Diet-Fed Rats
We next evaluated the effects of HC, LC, and CO on lipid profiles in the plasma, the liver, and
We next
in feces. evaluated
As shown the effects
in Figure 2, theofhypercholesterolemia
HC, LC, and CO on lipid profiles in influenced
is significantly the plasma,by theincreasing
liver, and
in feces. As shown in Figure 2, the hypercholesterolemia is significantly
plasma total cholesterol levels (TC) (Figure 2A), LDL-C+VLDL-C (Figure 2B), and the TC/HDL-C ratio influenced by increasing
plasma 2C)
(Figure totalincholesterol
rats fed with levels
HF (TC)
diets (Figure 2A), LDL-C+VLDL-C
for 8 weeks. In addition, the (Figure elevated2B), (TC,and the TC/HDL-C
LDL-C+VLDL-C,
ratioTC/HDL-C
and (Figure 2C)ratio)
in ratsplasma
fed withlipid
HF diets for 8inweeks.
profiles In addition,
HF diet-fed rats the
are elevated
markedly (TC, LDL-C+VLDL-C,
attenuated by the
and TC/HDL-C ratio) plasma lipid profiles in HF diet-fed rats
supplementation of 5% HC, 5% LC, and 5% CO, suggesting that a diet supplemented with 5% chitosanare markedly attenuated by the
supplementation of 5% HC, 5% LC, and 5% CO, suggesting that a
and its derivatives effectively exerts the amelioration of the imbalance of circulated cholesterol and diet supplemented with 5%
chitosan and
lipoprotein its in
levels derivatives
HF diet-fedeffectively
rats. Yao et exerts the have
al. (2008) amelioration
observedofthethe imbalance of circulated
hypocholesterolemic effect
cholesterol and lipoprotein levels in HF diet-fed rats.
of 5% HC in streptozotocin-induced diabetic rats [16]. Moreover, Pan et al. (2016) Yao et al. (2008) have haveobserved
suggested the
hypocholesterolemic
that both chitosan andeffect CO couldof 5%lower
HC incirculated
streptozotocin-induced
TC and LDL-C diabetic levels [17]. ratsTherefore,
[16]. Moreover, Pan et
these results
al. (2016) have suggested that both chitosan and CO could lower circulated
are consistent with our present results that suggest that chitosan and its derivatives have significant TC and LDL-C levels
[17]. Therefore, these results are
therapeutic potential in hypercholesterolemia. consistent with our present results that suggest that chitosan and its
derivatives
On the otherhave significant therapeutic potential
hand, the supplementation of 5%inHC hypercholesterolemia.
and 5% LC shows a non-statistical inhibition
On the other hand, the supplementation
in the plasma levels of biomarkers for liver damage, aspartate of 5% HC and 5%aminotransferase
LC shows a non-statistical (AST) (Figureinhibition
3A),
in the plasma levels of biomarkers for liver damage, aspartate aminotransferase
and alanine aminotransferase (ALT) (Figure 3B) in HF diet-fed rats; unexpectedly, the supplementation (AST) (Figure 3A),
and
of 5% CO alanine aminotransferase
obviously elevated plasma (ALT)
AST (Figure
and ALT3B) levels incompared
HF diet-fed to other rats; unexpectedly,
groups, implying that the
supplementation of 5% CO obviously elevated plasma AST and
liver injury, as well as the inflammatory response, was induced. The supplementation of 5% CO ALT levels compared to other
groups,
could alsoimplying
elevate thethatcirculated
liver injury,
levelsasofwell
tumor asnecrosis
the inflammatory
factor-alpharesponse,
(TNF-α) in was HFinduced. The
diet-fed rats
supplementation of 5% CO could also elevate the circulated levels
(Figure 3C). Kakino et al. (2018) have suggested that TNF-α plays a pivotal role in the development of tumor necrosis factor-alpha
(TNF-α)
and in HF of
progression diet-fed
NAFLD rats
by (Figure 3C). Kakino
the association with lipidet al. (2018) have
metabolism andsuggested
inflammation that in TNF-α plays
the liver [18],a
pivotalisrole
which in the development
consistent with our finding and progression
in the present of study
NAFLD thatbydiets
the association
supplemented withwith
lipid5% metabolism
CO may
induce liver damage. Moreover, as shown in Figure 4, rats fed with HF diets for 8 weeksstudy
and inflammation in the liver [18], which is consistent with our finding in the present exhibitthat
a
diets supplemented with 5% CO may induce liver damage. Moreover, as
significant increase in hepatic (Figure 4A) and fecal (Figure 4B) TC levels. These abnormal TC levels, shown in Figure 4, rats fed
with HF
under the diets for 8 weeks of
supplementation exhibit
5% HC a significant
and 5% LC,increase in hepatic
were effectively (Figure 4A)
ameliorated andand fecal (Figure
promptly excreted4B)
TC levels. These abnormal TC levels, under the supplementation of 5% HC and 5% LC, were
effectively ameliorated and promptly excreted in the feces. On the contrary, the supplementation of
Int. J. Mol. Sci. 2020, 21, 92 4 of 11

Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 4 of 11

Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 4 of 11
in the feces. On the contrary, the supplementation of 5% CO has no significantly reversed effect on
the5% CO
CO has
abnormal
5% no
has TC significantly
no levels in the reversed
significantly liver andeffect
reversed feces on
effect the
of HF
on abnormal
the diet-fed
abnormal TC
rats. levels
TC The in
in the
the liver
paradoxical
levels and
and feces
feces of
liverphenomena HF
ofunder
HF
thediet-fed rats.
rats. The
supplementation
diet-fed The paradoxical
of 5% CO in
paradoxical phenomena
HF diet-fed
phenomena under
rats,the
under as supplementation
the mentioned above,
supplementation of 5%
5% CO
ofmay be in
CO in HF
HF diet-fed
based rats,
on the dosage
diet-fed rats,
as
as mentioned
mentioned above,
above, A may
may be
be based
based on
on the
the dosage
dosage of ofbyCO
CO administration.
administration. A previous study described
of CO administration. previous study described Choi et al. (2012) Ahasprevious study
suggested described
that a 3% CO
by Choi et al. (2012)
by Choi et al. (2012) has suggested
has suggested that a 3% CO
that a 3%improve supplementation
CO supplementation for 5 months could markedly
supplementation for 5 months could markedly the imbalancefor of 5circulated
months could markedly
and hepatic lipid
improve
improve the
the imbalance
imbalance of
of circulated
circulated and
and hepatic
hepatic lipid
lipid profiles
profiles [19].
[19]. Moreover,
Moreover, Yao
Yao et
et al.
al. (2015)
(2015) have
have
profiles [19]. Moreover, Yao et al. (2015) have indicated that a 3% CO diet could significantly reduce
indicated
indicated that
that aa 3%
3% CO diet
diet could
could significantly
CO hepatotoxicitysignificantly reduce
reduce acetaminophen-induced
acetaminophen-induced hepatotoxicity
hepatotoxicity [20].
acetaminophen-induced [20]. Taken together, the therapeutic window of CO[20].
used
Taken
Taken together,
together, the
the therapeutic
therapeutic window
window of
of CO
CO used
used against
against chronic
chronic diseases
diseases without
without observed
observed
against chronic
adverse
diseases without observed adverse effects in the liver is a supplementation level of
effects in the liver is a supplementation level of below 5%.
adverse
below 5%. effects in the liver is a supplementation level of below 5%.

Figure2. 2. Effectsofofhigh-molecular
Effects high-molecular weight and and low-molecular weight weight(MW) (MW)chitosan
chitosanor chitosan
Figure
Figure 2. Effects of high-molecularweight weight and low-molecular
low-molecular weight (MW) chitosan ororchitosan
chitosan
oligosaccharideononlevels
oligosaccharide levelsofoftotal
totalcholesterol
cholesterol (A),
(A), low-density
low-density lipoprotein
lipoprotein cholesterol
cholesterol (LDL-C),
(LDL-C),
oligosaccharide on levels of total cholesterol (A), low-density lipoprotein cholesterol (LDL-C),
very-low-density
very-low-density lipoprotein
lipoprotein cholesterol
cholesterol (VLDL-C)
(VLDL-C) (B),theand
(B), and ratiothe ratiocholesterol
of total of total cholesterol and
and high-density
very-low-density lipoprotein cholesterol (VLDL-C) (B), and the ratio of total cholesterol and
high-density lipoprotein cholesterol (HDL-C) (C) in the plasma of high-fat (HF) diet-fed rats. The
lipoprotein cholesterol
high-density (HDL-C)
lipoprotein (C) in the
cholesterol plasma(C)
(HDL-C) of in
high-fat (HF) diet-fed
the plasma of high-fat rats.(HF)
Thediet-fed
rats were fedThe
rats. with
rats were fed with different experimental diets for 8 weeks. Data are presented as the mean ± SD (n =
rats were
different fed with different
experimental experimental
diets for 8 weeks. Datadiets are
for 8presented
weeks. Data are mean
as the presented± SD the=mean
as(n 6). * p± <
SD0.05
(n =as
6). * p < 0.05 as compared with the control group; # p < 0.05 as compared with the HF group. NC,
6). * p <with
compared 0.05 the
as compared
control group; p <control
with #the 0.05 asgroup;
compared# p <with
0.05 the
as compared
HF group.with NC,the HF group.
normal controlNC,+5%
normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet +5% high-MW
normalHF,
cellulose; control +5%diet
high-fat +5% cellulose;
cellulose; HF, high-fat diet +5%diet
HC, high-fat +5% high-MW
cellulose; HC, high-fat diet LC,
chitosan; +5%high-fat
high-MW diet
chitosan; LC, high-fat diet +5% low-MW chitosan; CO, high-fat diet +5% chitosan oligosaccharide.
+5% low-MW chitosan; CO, high-fat diet +5% chitosan oligosaccharide.
chitosan; LC, high-fat diet +5% low-MW chitosan; CO, high-fat diet +5% chitosan oligosaccharide.

Figure Effects
3. 3.
Figure Effectsofofhigh-molecular
high-molecularweight
weight and
and low-molecular weight(MW)
low-molecular weight (MW)chitosan
chitosanororchitosan
chitosan
Figure 3. Effects of high-molecular weight and low-molecular weight (MW) chitosan or chitosan
oligosaccharide
oligosaccharide on levels of aspartate aminotransferase (A), alanine aminotransferase, (B) tumor
on levels of aspartate aminotransferase (A), alanine aminotransferase, (B) and and
oligosaccharide on levels of aspartate aminotransferase (A), alanine aminotransferase, (B) and
Int. J. Mol.
Int. J. Mol. Sci.
Sci. 2019, 21, x92FOR PEER REVIEW
2020, 20, 55 of
of 11
11

tumor necrosis factor-alpha (TNF-α) (C) in the plasma of high-fat (HF) diet-fed rats. The rats were
necrosis
fed with factor-alpha (TNF-α) (C)diets
different experimental in the
forplasma of high-fat
8 weeks. Data are(HF) diet-fed
presented as rats. The rats
the mean ± SDwere
(n =fed
6). with
*p<
different experimental diets for 8 weeks. Data are presented as the mean ± SD (n
0.05 as compared with the control group; # p < 0.05 as compared with the HF group. NC, normal = 6). * p < 0.05 as
compared
control +5%with the control
cellulose; HF, group; p < 0.05
high-fat# diet +5%ascellulose;
compared HC,with the HFdiet
high-fat group.
+5%NC, control +5%
normalchitosan;
high-MW LC,
cellulose; HF,+5%
high-fat diet high-fat diet +5%
low-MW cellulose;
chitosan; HC, high-fat
CO: high-fat +5% high-MW
diet chitosan
diet +5% chitosan; LC, high-fat diet
oligosaccharide.
+5% low-MW chitosan; CO: high-fat diet +5% chitosan oligosaccharide.

Figure
Figure 4. Effects of
4. Effects of high
high molecular
molecular weight
weight and
and low-molecular
low-molecular weight
weight (MW)
(MW) chitosan
chitosan or
or chitosan
chitosan
oligosaccharide on levels of total cholesterol in the liver (A) and feces (B) of high-fat (HF) diet-fed
oligosaccharide on levels of total cholesterol in the liver (A) and feces (B) of high-fat (HF) diet-fed rats.
The rats were fed with different experimental diets for 8 weeks. Data are presented as the mean ± SD
rats. The rats were fed with different experimental diets for 8 weeks. Data are presented as the mean
(n = 6). * p < 0.05 as compared with the control group; # p < 0.05 as compared with the HF group.
± SD (n = 6). * p < 0.05 as compared with the control group; # p < 0.05 as compared with the HF
NC, normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet +5% high-MW
group. NC, normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet +5%
chitosan; LC, high-fat diet +5% low-MW chitosan; CO, high-fat diet +5% chitosan oligosaccharide.
high-MW chitosan; LC, high-fat diet +5% low-MW chitosan; CO, high-fat diet +5% chitosan
oligosaccharide.
2.3. The Mechanism of HC, LC, and CO in the Livers and Intestines of HF Diet-Fed Rats
To determine
2.3. The Mechanism the potential
of HC, LC, andmolecular
CO in the mechanism of the preventive
Livers and Intestines effects
of HF Diet-Fed Ratsof HC, LC, and CO
on hepatic and intestinal lipid profiles in HF diet-fed rats, we investigated the protein or gene
To determine
expressions the potential
of lipometabolic molecularincluding
modulators, mechanism the of the preventive
adenosine effects of HC,
monophosphate LC, and CO
(AMP)-activated
on hepatic and intestinal lipid profiles in HF diet-fed rats, we investigated the
protein kinase-α (AMPKα), the peroxisome proliferator-activated receptor-α (PPARα), the LDL receptorprotein or gene
expressions
(LDLR), of lipometabolic
Cholesterol modulators,
7α-hydroxylase including
(CYP7A1), and the adenosine
acyl-CoA monophosphate
cholesterol (AMP)-activated
acyltransferase 2 (ACAT2).
protein kinase-α (AMPKα), the peroxisome proliferator-activated receptor-α
As shown in Figure 5A, the protein expression of phosphorylated AMPKα in the liver is shown (PPARα), theto LDL
be a
non-statistically significant inhibition in the livers of HF diet-fed rats. This could have exhibited a2
receptor (LDLR), Cholesterol 7α-hydroxylase (CYP7A1), and acyl-CoA cholesterol acyltransferase
(ACAT2).trend
reversed As shown
if bothin5%Figure
HC and5A,5%theLC
protein expression of
supplementations phosphorylated
were AMPKα
used; similarly, in therats
HF diet-fed liver is
had
shown to be a non-statistically significant inhibition in the livers of HF diet-fed
a markedly inhibited hepatic protein expression of PPARα, which could be also reversed by both 5% rats. This could
haveand
HC exhibited a reversed trend if(Figure
5% LC supplementations both 5%5B).HC andsupplemented
Diets 5% LC supplementations
with 5% CO in were
HF used; similarly,
diet-fed rats do
HF diet-fed rats had a markedly inhibited hepatic protein expression of PPARα,
not improve HF diet-inhibited protein expressions of phosphorylated AMPKα and PPARα (Figure which could 5A
be
also reversed by both 5% HC and 5% LC supplementations (Figure 5B). Diets supplemented
and 5B). Previous studies have indicated that AMPKα as well as PPARα activation plays pivotal roles with
5% CO in HF diet-fed rats do not improve HF diet-inhibited protein expressions of phosphorylated
in cholesterol homeostasis by inhibiting hepatic cholesterol synthesis and promoting the cholesterol
AMPKα and PPARα (Figure 5A and 5B). Previous studies have indicated that AMPKα as well as
efflux capacity, respectively [21,22]. Next, we respectively evaluated the upregulated/downregulated
PPARα activation plays pivotal roles in cholesterol homeostasis by inhibiting hepatic cholesterol
transcriptional expressions functioned for cholesterol synthesis, LDLR, and CYP7A1, while AMPKα
synthesis and promoting the cholesterol efflux capacity, respectively [21,22]. Next, we respectively
was activated. As shown in Figure 5C and 5D, 5% HC and 5% LC can effectively reverse the
evaluated the upregulated/downregulated transcriptional expressions functioned for cholesterol
HF-inhibited/induced gene expressions of LDLR and CYP7A1, respectively. Contrariwise, neither
synthesis, LDLR, and CYP7A1, while AMPKα was activated. As shown in Figure 5C and 5D, 5%
hepatic LDLR nor CYP7A1 gene expressions could be improved by the supplementation of 5% CO in HF
HC and 5% LC can effectively reverse the HF-inhibited/induced gene expressions of LDLR and
diet-fed rats. Previous studies have suggested that LDLR may be responsible for lowering the synthesis
CYP7A1, respectively. Contrariwise, neither hepatic LDLR nor CYP7A1 gene expressions could be
of hepatic cholesterol by increasing the reabsorption of LDL-C [23,24]. Additionally, Bieghs et al. (2012)
improved by the supplementation of 5% CO in HF diet-fed rats. Previous studies have suggested
have indicated that LDLR gene knockout mice may develop prolonged hepatic inflammation and liver
that LDLR may be responsible for lowering the synthesis of hepatic cholesterol by increasing the
damage under long-term high-fat-high-cholesterol diet administration [25], which could be consistent
reabsorption of LDL-C [23,24]. Additionally, Bieghs et al. (2012) have indicated that LDLR gene
with our result that 5% CO-supplemented diets could not improve abnormal levels of hepatic and fecal
knockout mice may develop prolonged hepatic inflammation and liver damage under long-term
TC and also induced biomarkers (AST and ALT, Figure 3A,B) and the inflammatory modulator (TNF-α,
high-fat-high-cholesterol diet administration [25], which could be consistent with our result that 5%
Figure 3C) of liver injuries under the dysregulation of the AMPKα/LDLR pathway. On the other
CO-supplemented diets could not improve abnormal levels of hepatic and fecal TC and also
hand, Hoang et al. (2011) have shown that the efflux of cholesterol from the body is via conversion
induced biomarkers (AST and ALT, Figure 3A,B) and the inflammatory modulator (TNF-α, Figure
to bile acids [26], and CYP7A1 is notoriously functioned as the rate-limiting enzyme in the bile acid
3C) of liver injuries under the dysregulation of the AMPKα/LDLR pathway. On the other hand,
biosynthetic pathways [27]. Moreover, Ferrell et al. (2016) have suggested that CYP7A1-deficient
Hoang et al. (2011) have shown that the efflux of cholesterol from the body is via conversion to bile
acids [26], and CYP7A1 is notoriously functioned as the rate-limiting enzyme in the bile acid
 Int.J. J.Mol.
Int. Mol.Sci.
Sci.2020,
2019,21,
20,92x FOR PEER REVIEW 66ofof1111

biosynthetic pathways [27]. Moreover, Ferrell et al. (2016) have suggested that CYP7A1-deficient
mice
micecould
couldbebeagainst
againstHF/high-cholesterol
HF/high-cholesteroldiet-induced
diet-inducedmetabolic
metabolicdisorders
disordersby byincreasing
increasingthethefecal
fecal
cholesterol efflux [28]. In this study, our findings show that a 5% CO supplementation
cholesterol efflux [28]. In this study, our findings show that a 5% CO supplementation cannot cannot increase
fecal cholesterol
increase efflux (Figure
fecal cholesterol 4B) (Figure
efflux due to the
4B)activation
due to theofactivation
CYP7A1 gene expression
of CYP7A1 genein expression
HF diet-fedin rats
HF
(Figure
diet-fed5D). Furthermore,
rats (Figure 5D).it Furthermore,
is well-knownitthat the absorption
is well-known of the
that cholesterol in the
absorption of intestine is also
cholesterol a
in the
critical process in lipid homeostasis, and that ACAT2 is a key enzyme for modulating
intestine is also a critical process in lipid homeostasis, and that ACAT2 is a key enzyme for the intestinal
absorption
modulating of the
cholesterol [29].
intestinal As shown
absorption ofincholesterol
Figure 6, ACAT2
[29]. Asprotein
shownexpression
in Figure is 6, upregulated
ACAT2 protein in
HF diet-fed rats,
expression which can in
is upregulated beHF
reversed
diet-fedbyrats,
the which
supplementation of 5%by
can be reversed HCtheand 5% LC, but notof5%
supplementation 5%
CO.
HCZhou
and 5% et al.
LC,(2017) have
but not 5%discovered
CO. Zhou theet al.cholesterol-lowering
(2017) have discoveredactivity of the co-administration
the cholesterol-lowering of
activity
berberine and evodiamine supplementation
of the co-administration of berberine and by the inhibition
evodiamine of ACAT2 protein
supplementation expression
by the inhibition[30], which
of ACAT2
isprotein
also consistent
expression with ourwhich
[30], findings in the
is also present study.
consistent with our findings in the present study.

Figure Effectsof of
Figure5.5. Effects high-molecular
high-molecular weight
weight and and low-molecular
low-molecular weightweight
(MW) (MW)
chitosanchitosan or
or chitosan
chitosan oligosaccharide on hepatic (AMP)-activated protein kinase-α (AMPKα)
oligosaccharide on hepatic (AMP)-activated protein kinase-α (AMPKα) and peroxisome and peroxisome
proliferator-activated
proliferator-activatedreceptor-α
receptor-α(PPARα)
(PPARα)protein
proteinexpressions
expressionsand low-density
and low-densitylipoprotein
lipoproteinreceptor
receptor
(LDLR)
(LDLR) and cholesterol 7α-hydroxylase (CYP7A1) gene expressions in high-fat(HF)
and cholesterol 7α-hydroxylase (CYP7A1) gene expressions in high-fat (HF)diet-fed
diet-fedrats.
rats.
The rats were fed with different experimental diets for 8 weeks. Protein expressions of phosphorylated
The rats were fed with different experimental diets for 8 weeks. Protein expressions of
AMPKα/AMPKα (A) and PPARα (B) were determined using Western blot analysis. Gene expressions
phosphorylated AMPKα/AMPKα (A) and PPARα (B) were determined using Western blot analysis.
of LDLR (C) and CYP7A1 (D) were determined by a real-time reverse transcription polymerase chain
Gene expressions of LDLR (C) and CYP7A1 (D) were determined by a real-time reverse
reaction RT-PCR. Data are presented as the mean ± SD (n = 4–6). * p < 0.05 as compared with the control
transcription polymerase chain reaction RT-PCR. Data are presented as the mean ± SD (n = 4–6). * p <
group; # p < 0.05 as compared with the HF group. NC, normal control +5% cellulose; HF, high-fat diet
0.05 as compared with the control group; # p < 0.05 as compared with the HF group. NC, normal
+5% cellulose; HC, high-fat diet +5% high-MW chitosan; LC, high-fat diet +5% low-MW chitosan; CO,
control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet +5% high-MW chitosan; LC,
high-fat diet +5% chitosan oligosaccharide.
high-fat diet +5% low-MW chitosan; CO, high-fat diet +5% chitosan oligosaccharide.
Int. J. Mol. Sci. 2020, 21, 92 7 of 11
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 7 of 11

Figure 6.
Figure Effects of
6. Effects of high-molecular
high-molecular weight
weight and
and low-molecular
low-molecular weight
weight (MW)
(MW) chitosan
chitosan or
or chitosan
chitosan
oligosaccharide on intestinal acyl-CoA cholesterol acyltransferase 2 (ACAT2) protein
oligosaccharide on intestinal acyl-CoA cholesterol acyltransferase 2 (ACAT2) protein expression in expression in
high-fat (HF) diet-fed rats. The rats were fed with different experimental diets for 8 weeks.
high-fat (HF) diet-fed rats. The rats were fed with different experimental diets for 8 weeks. The The protein
expression
protein of ACAT2
expression of was
ACAT2determined using Western
was determined usingblot analysis.
Western blotData are presented
analysis. Data are as the meanas±
presented
the (n = 6).
SD mean ± SD < 0.05
* p (n = 6).as
* pcompared with the control
< 0.05 as compared group;
with the control < 0.05 as
# p group; # pcompared with the HF
< 0.05 as compared group.
with the
NC, normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet
HF group. NC, normal control +5% cellulose; HF, high-fat diet +5% cellulose; HC, high-fat diet +5%+5% high-MW
chitosan; LC,
high-MW high-fatLC,
chitosan; +5% low-MW
diethigh-fat chitosan;
diet +5% CO, high-fat
low-MW chitosan; +5%high-fat
dietCO, chitosandiet
oligosaccharide.
+5% chitosan
oligosaccharide.
3. Materials and Methods

3. Materials
3.1. Materialsand Methods
Low-MW chitosan and chitooligosaccharide from crustacean shells were purchased from Koyo
3.1. Materials
Chemical Industry Company (Tokyo, Japan) and high-MW chitosan was purchased from Charming
and Low-MW
Beauty Co,chitosan and chitooligosaccharide
LTD (Taipei, Taiwan). Fourier from crustacean
transform shells were
infrared purchased
spectroscopy from
was Koyo
used to
Chemical Industry Company (Tokyo, Japan) and high-MW chitosan was purchased from Charming
detect the deacetylation degree of chitosan and chitooligosaccharide while high-performance liquid
and Beauty Co, LTD
chromatography was(Taipei,
appliedTaiwan). Fourier
to measure the transform
average MW infrared spectroscopy
of chitosan was used to detect
and chitooligosaccharide.
the deacetylation degree of chitosan and chitooligosaccharide while high-performance
The average MW of high-MW chitosan, low-MW chitosan, and chitooligosaccharide was about 740 liquid
kDa,
chromatography was applied to measure the average MW of chitosan and chitooligosaccharide.
80 kDa, and 719 Da, respectively. In addition, the deacetylation degree of high-MW chitosan, low-MW The
average
chitosan,MW
andof high-MW chitosan, were
chitooligosaccharide low-MW
aboutchitosan, and and
91%, 83.9%, chitooligosaccharide was about 740 kDa,
100%, respectively.
80 kDa, and 719 Da, respectively. In addition, the deacetylation degree of high-MW chitosan,
3.2. Animals
low-MW and Diets
chitosan, and chitooligosaccharide were about 91%, 83.9%, and 100%, respectively.
Male six-week-old Sprague-Dawley (SD) rats were procured from BioLASCO Taiwan Co., Ltd.
3.2. Animals and Diets
(Taipei, Taiwan) and were habituated at the animal facility of the National Taiwan Ocean University
Male six-week-old
(Keelung, Taiwan) for one Sprague-Dawley (SD) rats
week of ad libitum were procured
feeding from BioLASCO
(Rodent Laboratory Chow,Taiwan
RalstonCo., Ltd.
Purina,
(Taipei, Taiwan)
St. Louis, and were
MO, USA). The habituated at the animal
animal husbandry facilitywere
conditions of theasNational
follows: Taiwan Ocean University
in the temperature range
23 ± 1 ◦ C,Taiwan)
(Keelung, a light for
cycleoneofweek
12 h of ad libitumand
light/dark, feeding
in the(Rodent
humidityLaboratory Chow, Ralston
range 40–60%. Purina,
All animals St.
were
Louis, MO, USA).
individually housedThein animal husbandry conditions
stainless-steel-made cages. were as follows:
Acclimatized in the temperature
animals were randomly range 23 ± 1
divided
°C,
intoa five cycle of(n12=h6 light/dark,
lightgroups and in(1)
of each group): thestandard
humidityrodent
range diet-fed
40–60%. rats
All animals
(NC); (2)were
HF individually
diet-fed rats;
housed in stainless-steel-made
(3) HF diet-fed cages. Acclimatized
rats with 5% high-MW chitosan (HF + HC);
animals were
(4) randomly
HF diet-fed divided into5%
rats with fivelow-MW
groups
(n = 6 of each
chitosan + LC); (1)
(HFgroup): andstandard rodent diet-fed
(5) HF diet-fed rats withrats
5%(NC); (2) HF diet-fed rats;
chitooligosaccharide (HF(3)+ HF diet-fed
CO). rats
In normal
with 5% high-MW
and high-fat diets,chitosan (HF +was
5% cellulose HC);added
(4) HFindiet-fed
place ofrats with 5%
chitosan low-MW chitosan
derivatives. (HF + LC);ofand
The formulation the
(5) HF diet-fed
experimental ratsis with
diets shown 5%in chitooligosaccharide
Table 1. The body weight (HF was+ CO). In normal
recorded weekly and high-fat
until diets,
sacrifice. 5%8
After
cellulose
weeks of was added in administration,
experimental place of chitosan thederivatives.
fasted animalsThe were
formulation
sacrificedof by
theexsanguination
experimental dietsduring is
shown in Table
the inhalation 1. The body
of anesthesia. weight
Plasma was were
samples recorded weekly
collected untilonsacrifice.
for tests Afterand
liver function 8 weeks
indicators of
experimental administration,
of hypercholesterolemia. the fasted liver
The harvested animals were sacrificed
and intestine by exsanguination
tissues were shaved, defatted, during
weighed,the
inhalation of anesthesia. Plasma samples were collected for tests on liver function and indicators of
hypercholesterolemia. The harvested liver and intestine tissues were shaved, defatted, weighed,
Int. J. Mol. Sci. 2020, 21, 92 8 of 11

flash-frozen, and stored at −80 ◦ C until histological and biomolecular analyses were completed. Feces
collected for 3 consecutive days before sacrifice were flash-frozen at −80 ◦ C until fecal cholesterol
content analysis was completed. All the animal protocols in this study obeyed the Guide for the Care
and Use of Laboratory Animals (Institute of Laboratory Animal Resources, 2011) [31] and were ratified
by the Animal House Management Committee of the National Taiwan Ocean University (approval
number: 106029).

Table 1. Composition of experimental diets (%).

Ingredient (%) NC HF HC LC CO
Corn starch 63.8 56.2 56.2 56.2 56.2
Casein 20 20 20 20 20
Lard 3 10 10 10 10
Soybean oil 2 2 2 2 2
Vitamin 1 1 1 1 1 1
Mineral 2 5 5 5 5 5
Cholesterol 0.5 0.5 0.5 0.5
Cholic acid 0.1 0.1 0.1 0.1
Choline chloride 0.2 0.2 0.2 0.2 0.2
Cellulose 5 5
High-MW chitosan 5
Low-MW chitosan 5
Chitooligosaccharide 5
NC: Normal control diet
HF: HF diet
HC: HF diet + 5% high-MW chitosan
LC: HF diet + 5% low-MW chitosan
CO: HF diet + 5% chitooligosaccharide
DD: Degrees of deacetylation
1 AIN-93 vitamin mixture. 2 AIN-93 mineral mixture.

3.3. Determination of Total Cholesterol (TC) and Plasma Lipoprotein Cholesterol

The levels of TC in the plasma, liver, and feces were determined by the Audit Diagnostics
Cholesterol assay kits (Cork, Ireland) according to the manufacturer’s protocols. Plasma lipoprotein
cholesterol was separated and measured as previously described by Takehisa and Suzuki (1990) [32].
Briefly, plasma high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol
(LDL-C), and very low-density lipoprotein cholesterol (VLDL-C) were segregated by density gradient
ultracentrifugation (194000× g at 10 ◦ C for 3 h) using a Hitachi SP85G preparative ultracentrifuge
(Tokyo, Japan), and HDL-C, LDL-C, and VLDL-C were recovered by tube slicing.

3.4. Determination of Activities of Aspartate Aminotransferase (AST) and Alanine Aminotransferase (ALT)
The activities of AST and ALT were measured with RANDOX AST and ALT enzymatic kits (Antrim,
UK), under an absorbance reading of 340 nm, equipped with a Hitachi U-2880A spectrophotometer
(Tokyo, Japan) in a kinetic manner according to the manufacturer’s protocols.

3.5. Determination of Plasma Tumor Necrosis Factor-α (TNF-α)

The levels of plasma TNF-α were determined by an Assay Designs Rat enzyme-linked
immunosorbent assay kit (Ann Arbor, MI, USA) according to the manufacturer’s protocols.

3.6. Western Blot Analysis

Protein extraction and Western blotting were assayed as described previously by Chiu et al.
(2018) [33]. Briefly, the chilled radioimmunoprecipitation assay (RIPA) buffer with the Thermo Fisher
Scientific cocktail of phosphatase and protease inhibitors (Waltham, MA, USA) was applied for tissue
Int. J. Mol. Sci. 2020, 21, 92 9 of 11

protein extraction. The Thermo Fisher Scientific BCA protein assay kit was used to determine the
protein concentration of tissue samples. Next, 50–100 µg of tissue proteins were separated by 8–12%
SDS-PAGE gel and then transferred onto polyvinylidene difluoride (PVDF) membranes (Bio-Rad,
Hercules, CA, USA). After blocking in 5% non-fat dry milk (Fonterra Brands, Taipei, Taipei) or 3%
bovine serum albumin (Sigma-Aldrich, St. Louis, MO, USA) solution for 1 h, PVDF membranes
were probed with primary antibodies for anti-phosphorylated (Thr172) AMP-activated protein
kinase α (p-AMPKα), anti-AMPKα (Cell Signaling Technology, Danvers, MA, USA), anti-PPARα,
anti-Acetyl-CoA acetyltransferase (ACAT)-2, and anti-β-actin (Santa Cruz Biotechnology, Santa Cruz,
CA, USA) at 4 ◦ C overnight. The PVDF membranes were then probed with anti-rabbit or anti-mouse
horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology). Target protein
expressions were detected by a BioRad Laboratories Enhanced Chemiluminescence kit (Redmond, WA,
USA) and then exposed to a Fujifilm X-ray film (Tokyo, Japan). Image J 1.8 software (National Institutes
of Health, Bethesda, MD, USA) was applied to quantify the band densitometry of target proteins.

3.7. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis

Total RNA extraction and qRT-PCR analysis were determined by using a TRIzol kit (Life
Technologies, Carlsbad, CA, USA), an ABI StepOne™ Real-Time PCR system, and StepOne 2.1 software
(Applied Biosystems, Foster City, CA, USA) as described previously by Chiu et al. (2017) [34]. Briefly,
the real-time SYBR Green PCR reagent (Life Technologies, Carlsbad, CA, USA) was used to amplify the
complementary DNA (cDNA), which was converted from the total RNAs (0.5–1 µg) extracted from liver
tissues by avian myeloblastosis virus reverse transcriptase. The specific primers used are as follows:
LDLR (forward: TGCTACTGGCCAAGGACAT; reverse: CTGGGTGGTCGGTACAGTG), CYP7A1
(forward: CTGCAACCTTTTGGAGCTTATT; reverse: GCACTCTGTAAAGCTCCACTC), and GAPDH
(forward: CTGGAGAAACCTGCCAAGTATGAT; reverse: TTCTTACTCCTTGGAGGCCAGTA).
An internal control GAPDH was used. The comparative threshold cycle method (∆∆Ct ) was used
to determine the relative quantification of gene expressions. The levels of mRNA expressions were
normalized by the GAPDH level. The fold changes of mRNA levels compared to the HF group were
expressed as 2−∆∆Ct .

3.8. Statistical Evaluation

All results are presented as the mean ± Standard Deviation (SD). The statistical significance
(p < 0.05) is assessed by a one-way analysis of variance (ANOVA) with post-hoc Tukey’s test for
multiple comparisons using GraphPad Prism V6.0 software (GraphPad Software, San Diego, CA,
USA).

4. Conclusions
Both HC and LC can effectively ameliorate hypercholesterolemia and regulate cholesterol
homeostasis via the activation and inhibition of hepatic (AMPKα and PPARα) and intestinal (ACAT2)
cholesterol-modulators, respectively, as well as the modulation of downstream signals (LDLR and
CYP7A1). Unexpectedly, 5% CO-supplemented diets do not improve a HF diet-induced imbalance
of cholesterol levels in the liver and feces, and it may induce liver damage, suggesting that the
therapeutic dosage of CO used against chronic diseases without observed adverse effects in the liver is
a supplementation level of below 5%.

Author Contributions: Conceptualization, S.-H.L. and M.-T.C.; Data curation, C.-Y.C. and T.-E.Y.; Funding
acquisition, M.-T.C.; Investigation, C.-Y.C. and T.-E.Y.; Methodology, C.-Y.C. and T.-E.Y.; Supervision, S.-H.L.;
Writing—original draft, C.-Y.C.; Writing—review & editing, S.-H.L. and M.-T.C. All authors have read and agreed
to the published version of the manuscript.
Funding: This study was supported by a grant from the Ministry of Science and Technology, Taiwan (R.O.C)
(MOST 106-2320-B-019-004).
Int. J. Mol. Sci. 2020, 21, 92 10 of 11

Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the
study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to
publish the results.

References
1. Du, S.; Wang, C.; Jiang, W.; Li, C.; Li, Y.; Feng, R.; Sun, C. The impact of body weight gain on nonalcoholic
fatty liver disease and metabolic syndrome during earlier and later adulthood. Diabetes Res. Clin. Pract.
2016, 116, 183–191. [CrossRef] [PubMed]
2. Feng, R.N.; Du, S.S.; Wang, C.; Li, Y.C.; Liu, L.Y.; Guo, F.C.; Sun, C.H. Lean-non-alcoholic fatty liver disease
increases risk for metabolic disorders in a normal weight Chinese population. World J. Gastroenterol. 2014, 20,
17932–17940. [CrossRef] [PubMed]
3. Targher, G.; Marra, F.; Marchesini, G. Increased risk of cardiovascular disease in non-alcoholic fatty liver
disease: Causal effect or epiphenomenon? Diabetologia 2008, 51, 1947–1953. [CrossRef] [PubMed]
4. Nseir, W.; Hellou, E.; Assy, N. Role of diet and lifestyle changes in nonalcoholic fatty liver disease. World J.
Gastroenterol. 2014, 20, 9338–9344. [PubMed]
5. Choi, J.H.; Rhee, E.J.; Bae, J.C.; Park, S.E.; Park, C.Y.; Cho, Y.K.; Oh, K.W.; Park, S.W.; Lee, W.Y. Increased
risk of type 2 diabetes in subjects with both elevated liver enzymes and ultrasonographically diagnosed
nonalcoholic fatty liver disease: A 4-year longitudinal study. Arch. Med. Res. 2013, 44, 115–120. [CrossRef]
[PubMed]
6. Bunnoy, A.; Saenphet, K.; Lumyong, S.; Saenphet, S.; Chomdej, S. Monascus purpureus-fermented Thai
glutinous rice reduces blood and hepatic cholesterol and hepatic steatosis concentrations in diet-induced
hypercholesterolemic rats. BMC Complement. Altern. Med. 2015, 15, 88. [CrossRef]
7. Senthilkumar, K.; Kim, S.K. Marine invertebrate natural products for anti-inflammatory and chronic diseases.
Evid. Based Complement. Altern. Med. 2013, 2013, 572859. [CrossRef]
8. Xia, W.; Liu, P.; Zhang, J.; Chen, J. Biological activities of chitosan and chitooligosaccharides. Food Hydrocoll.
2011, 25, 170–179. [CrossRef]
9. Anitha, A.; Sowmya, S.; Sudheesh Kumar, P.T.; Deepthi, S.; Chennazhi, K.P.; Ehrlich, H.; Tsurkan, M.;
Jayakumar, R. Chitin and chitosan in selected biomedical applications. Prog. Polym. Sci. 2014, 39, 1644–1667.
[CrossRef]
10. Laurienzo, P. Marine polysaccharides in pharmaceutical applications: An overview. Mar. Drugs 2010, 8,
2435–2465. [CrossRef]
11. Kerch, G. The potential of chitosan and its derivatives in prevention and treatment of age-related diseases.
Mar. Drugs 2015, 13, 2158–2182. [CrossRef] [PubMed]
12. Huang, L.; Chen, J.; Cao, P.; Pan, H.; Ding, C.; Xiao, T.; Zhang, P.; Guo, J.; Su, Z. Anti-obese effect of glucosamine
and chitosan oligosaccharide in high-fat diet-induced obese rats. Mar. Drugs 2015, 13, 2732–2756. [CrossRef]
[PubMed]
13. Sumiyoshi, M.; Kimura, Y. Low molecular weight chitosan inhibits obesity induced by feeding a high-fat
diet long-term in mice. J. Pharm. Pharmacol. 2006, 58, 201–207. [CrossRef] [PubMed]
14. Picchi, M.G.; Mattos, A.M.; Barbosa, M.R.; Duarte, C.P.; Gandini Mde, A.; Portari, G.V.; Jordão, A.A. A high-fat
diet as a model of fatty liver disease in rats. Acta Cir. Bras. 2011, 26 (Suppl. 2), 25–30. [CrossRef]
15. Teodoro, J.S.; Gomes, A.P.; Varela, A.T.; Duarte, F.V.; Rolo, A.P.; Palmeira, C.M. Hepatic and skeletal muscle
mitochondrial toxicity of chitosan oligosaccharides of normal and diabetic rats. Toxicol. Mech. Methods 2016,
26, 650–657. [CrossRef] [PubMed]
16. Yao, H.T.; Huang, S.Y.; Chiang, M.T. A comparative study on hypoglycemic and hypocholesterolemic effects
of high and low molecular weight chitosan in streptozotocin-induced diabetic rats. Food Chem. Toxicol. 2008,
46, 1525–1534. [CrossRef] [PubMed]
17. Pan, H.; Yang, Q.; Huang, G.; Ding, C.; Cao, P.; Huang, L.; Xiao, T.; Guo, J.; Su, Z. Hypolipidemic effects of
chitosan and its derivatives in hyperlipidemic rats induced by a high-fat diet. Food Nutr. Res. 2016, 60, 31137.
[CrossRef] [PubMed]
18. Kakino, S.; Ohki, T.; Nakayama, H.; Yuan, X.; Otabe, S.; Hashinaga, T.; Wada, N.; Kurita, Y.; Tanaka, K.;
Hara, K.; et al. Pivotal Role of TNF-α in the Development and Progression of Nonalcoholic Fatty Liver
Disease in a Murine Model. Horm. Metab. Res. 2018, 50, 80–87. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2020, 21, 92 11 of 11

19. Choi, E.H.; Yang, H.P.; Chun, H.S. Chitooligosaccharide ameliorates diet-induced obesity in mice and affects
adipose gene expression involved in adipogenesis and inflammation. Nutr. Res. 2012, 32, 218–228. [CrossRef]
20. Yao, H.T.; Luo, M.N.; Li, C.C. Chitosan oligosaccharides reduce acetaminophen-induced hepatotoxicity by
suppressing CYP-mediated bioactivation. J. Funct. Foods 2015, 12, 262–270. [CrossRef]
21. Loh, K.; Tam, S.; Murray-Segal, L.; Huynh, K.; Meikle, P.J.; Scott, J.W.; van Denderen, B.; Chen, Z.;
Steel, R.; LeBlond, N.D.; et al. Inhibition of Adenosine Monophosphate-Activated Protein Kinase-3-Hydroxy-
3-Methylglutaryl Coenzyme A Reductase Signaling Leads to Hypercholesterolemia and Promotes Hepatic
Steatosis and Insulin Resistance. Hepatol. Commun. 2018, 3, 84–98. [CrossRef] [PubMed]
22. Khera, A.V.; Millar, J.S.; Ruotolo, G.; Wang, M.D.; Rader, D.J. Potent peroxisome proliferator-activated
receptor-α agonist treatment increases cholesterol efflux capacity in humans with the metabolic syndrome.
Eur. Heart J. 2015, 36, 3020–3022. [CrossRef] [PubMed]
23. Kemper, M.F.; Srivastava, S.; Todd King, M.; Clarke, K.; Veech, R.L.; Pawlosky, R.J. An ester of
β-Hydroxybutyrate regulates cholesterol biosynthesis in rats and a cholesterol biomarker in humans.
Lipids 2015, 50, 1185–1193. [CrossRef] [PubMed]
24. Levinson, S.S.; Wagner, S.G. Implications of reverse cholesterol transport: Recent studies. Clin. Chim. Acta
2015, 439, 154–161. [CrossRef] [PubMed]
25. Bieghs, V.; Van Gorp, P.J.; Wouters, K.; Hendrikx, T.; Gijbels, M.J.; van Bilsen, M.; Bakker, J.; Binder, C.J.;
Lütjohann, D.; Staels, B.; et al. LDL receptor knock-out mice are a physiological model particularly vulnerable
to study the onset of inflammation in non-alcoholic fatty liver disease. PLoS ONE 2012, 7, e30668. [CrossRef]
[PubMed]
26. Hoang, M.H.; Houng, S.J.; Jun, H.J.; Lee, J.H.; Choi, J.W.; Kim, S.H.; Kim, Y.R.; Lee, S.J. Barley intake induces
bile acid excretion by reduced expression of intestinal ASBT and NPC1L1 in C57BL/6J mice. J. Agric. Food
Chem. 2011, 59, 6798–6805. [CrossRef]
27. Musso, G.; Gambino, R.; Cassader, M. Cholesterol metabolism and the pathogenesis of non-alcoholic
steatohepatitis. Prog. Lipid Res. 2013, 52, 175–191. [CrossRef]
28. Ferrell, J.M.; Boehme, S.; Li, F.; Chiang, J.Y. Cholesterol 7α-hydroxylase-deficient mice are protected from
high-fat/high-cholesterol diet-induced metabolic disorders. J. Lipid Res. 2016, 57, 1144–1154. [CrossRef]
29. Lee, R.G.; Willingham, M.C.; Davis, M.A.; Skinner, K.A.; Rudel, L.L. Differential expression of ACAT1 and
ACAT2 among cells within liver, intestine, kidney, and adrenal of nonhuman primates. J. Lipid Res. 2000, 41,
1991–2001.
30. Zhou, X.; Ren, F.; Wei, H.; Liu, L.; Shen, T.; Xu, S.; Wei, J.; Ren, J.; Ni, H. Combination of berberine and
evodiamine inhibits intestinal cholesterol absorption in high fat diet induced hyperlipidemic rats. Lipids
Health Dis. 2017, 16, 239. [CrossRef]
31. Institute of Laboratory Animal Resources. Guide for the Care and Use of Laboratory Animals; National Academy
Press: Washington, DC, USA, 2011.
32. Takehisa, F.; Suzuki, Y. Effect of guar gum and cholestyramine on plasma lipoprotein cholesterol in rats.
J. Jap. Soc. Nutr. Food Sci. 1990, 43, 269–274. [CrossRef]
33. Chiu, C.Y.; Wang, L.P.; Liu, S.H.; Chiang, M.T. Fish Oil Supplementation Alleviates the Altered Lipid
Homeostasis in Blood, Liver, and Adipose Tissues in High-Fat Diet-Fed Rats. J. Agric. Food Chem. 2018, 66,
4118–4128. [CrossRef] [PubMed]
34. Chiu, C.Y.; Chang, T.C.; Liu, S.H.; Chiang, M.T. The regulatory effects of fish oil and chitosan on hepatic
lipogenic signals in high-fat diet-induced obese rats. J. Food Drug Anal. 2017, 25, 919–930. [CrossRef]
[PubMed]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).