J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9

available at www.sciencedirect.com

www.elsevier.com/locate/jprot

Subtle proteome differences identified between post-dormant

vegetative and floral peach buds

Constantinos Prassinos a , Stamatis Rigas a , Dimosthenis Kizis a ,

Antonia Vlahou b , Polydefkis Hatzopoulos a,⁎
a
Department of Agricultural Biotechnology, Agricultural University of Athens, Iera Odos 75, Athens 118 55, Greece
b
Center of Basic Research II-Biotechnology, Biomedical Research Foundation, Academy of Athens, Soranou Efessiou 4, Athens 115 27, Greece

AR TIC LE I N FO ABS TR ACT

Article history: Proper development of deciduous tree species, including peach, is accomplished through an
Received 30 November 2010 annual growth cycle. Freezing avoidance during winter is necessary for tree survival and is
Accepted 28 January 2011 achieved by the enclosure of meristems in floral and vegetative buds. To elucidate the role of
Available online 23 February 2011 developmentally regulated protein networks in bud break, proteins of the two bud-types were
extracted and analyzed by two-dimensional gel electrophoresis (2-DE). Of the 1107 protein spots
Keywords: that were picked, 475 were identified and annotated assembling the peach bud proteome
Bud-break reference map. The majority of these proteins are involved in stress-response, detoxification,
Hydrogen peroxide defense, carbohydrate metabolism and energy production. The protein profiles of both bud-types
Nucleoside diphosphate kinase bear high similarity, whereas only 11 proteins were differentially expressed. These proteins were
Redox signaling mainly involved in carbon–nitrogen homeostasis/metabolism and certain developmental
Rosaceae processes to sustain rapid growth of the newly emerging organs. Among these are enzymes
that differentially regulate the levels of H2O2 between floral and vegetative buds, potentially
promoting sequential bud-break. Distinct Nucleoside Diphosphate Kinase (NDPK) variants in
floral and vegetative buds were detected suggesting the potential role of NDPKs in H2O2-mediated
signaling for post-dormant bud break. This study provides data towards a better understanding of
dormancy release and bud break.
© 2011 Elsevier B.V. All rights reserved.

1. Introduction
Trees of the temperate region follow an annual growth cycle
through which they have to survive and flourish the next
growing season. This phenomenon recruits complex mecha-
nisms that allow trees to sense the seasons, protect their vital
structures and predict the optimal period for growth. In many
perennial species of the temperate climates, including peach,
environmental cues such as reduced photoperiod and low
temperature trigger growth cessation and lead to the entrance
of a state of dormancy [1,2].
Dormancy has been described as the temporary suspension
of visible growth of any plant structure containing a meristem
(buds, seeds, bulbs, cambia, etc.) and is categorized into three
states [1–3]. Paradormancy occurs by inhibition of growth due to
morphogenic factors synthesized in distal organs other than the
affected structure. Endodormancy is the result of physiological
changes internal to the bud preventing the growth during
seasonal transitions to unfavorable for growth environmental
conditions. Ecodormancy is imposed by temporary adverse
external environmental factors including abiotic stress condi-
tions like temperature extremes, nutrient deficiency or water
shortage. To strictly set dormancy as a state within meristems
rather than the seed-coat-imposed restriction to germination,
dormancy was further defined as the inability to resume growth
from meristematic tissues under favorable conditions [4].

⁎ Corresponding author. Tel./fax: +30 2105294321.

E-mail address: phat@aua.gr (P. Hatzopoulos).

1874-3919/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.jprot.2011.01.018
608 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9
Dormancy cycling coincides with seasonal succession despite
the effects that global warming may have on both cycles [5]. In
the northern hemisphere, the shift from paradormancy to
endodormancy in buds concurs with seasonal transition from
summer to winter when fluctuations in environmental condi-
tions become harsh for growth. The fully endodormant bud
becomes ecodormant during the winter period, while in spring
the return of elevated temperatures permit the release of
dormancy.
Endodormancy is in general appreciated as a state of reduced
metabolic activity and tissue development because many
cellular processes are inactivated [1,4,6–8]. Nevertheless, genes
responsive to dehydration resistance or cold hardiness are
up-regulated during the period of dormancy to safeguard the
buds from the harsh winter conditions [8]. Low temperature, cold
spells and short days induce the expression of protective
proteins such as dehydrins, peroxidases, late embryogenesis
abundant proteins and heat-shock proteins [9–11]. Protection is
also achieved by the accumulation of soluble carbohydrates such
as raffinose, trehalose, sucrose, glucose and fructose [10,12].
Dormancy release is associated with the resumption of
cell-to-cell communication regulated by plasmodesmata.
Meristematic cells get symplasmically isolated upon transi-
tion to endodormancy [13,14]. The restoration of symplasmic
connections by the removal of callose from plasmodesmata
allows the resumption of cell-to-cell communication and
dormancy release via trafficking of small molecules or
proteins to the meristematic cells that acquire growing
capacity. The application of dormancy-breaking agents such
as hydrogen cyanamide (HC) induces dormancy release. HC
inhibits catalase expression or activity generating oxidative
stress by the elevation of hydrogen peroxide (H2O2) [15,16].
Previous observations indicated that H2O2 elevation under
treatments with chemical compounds (e.g., azide, cyanide,
mineral oils, thidiazuron) [2,17] or by external stimuli [18]
promotes dormancy-release.
Bud break of many temperate fruit trees is dependent upon
exposure to a particular duration of low temperatures. This
period is sensed by accumulating chilling hours, leading to
dormancy release, and differs between tree species [1,2].
Quantitative Trait Loci (QTL) analysis in poplar revealed 6 QTLs
responsible for bud-break, but also showed that timing of bud-
break between genotypes is less plastic than timing of bud-set
[19]. The period between dormancy entrance and release
furnishes a protective interval against premature bud break
during mild spells in winter and early spring, leading to severe
frost damage upon subsequent abrupt return to cold periods.
Climate instability, projected by global climate models, is with
high certainty expected to increase the frequency of late-spring
frosts [20]. Climate warming could increase the risk of frost
damage to trees in the boreal and temperate zones, a paradoxical
hypothesis initially presented by Cannell and Smith [21]. Peach
buds that have acquired appropriate chilling, begin to break and
become prone to such adverse climatic phenomena, which
severely compromise fruit production and vegetative growth.
In April 2007, one such extreme widespread frost occurred in
south-eastern and central United States with devastating effects
for peach crop yield [22].
Bud break is a phenomenon unambiguously specifying the
interplay of environmental favorable conditions with gene
expression, protein synthesis and activation causing changes
in physiological state [1–5]. The molecular mechanisms that
modulate floral and vegetative bud development upon post-
dormant bud break have not as yet been elucidated. The aim of
this study is to identify the protein networks involved at this
crucial developmental stage by constructing the peach bud
proteome map. The vegetative bud proteome was set as
reference to perform comparative analysis with the proteome
of the apparently advanced in development flower bud. Even
though the proteome profile comparison identified high
degree of similarity, the relative abundance of eleven proteins
was different between the two bud types. Among these are
enzymes that regulate the levels of H2O2, potentially promot-
ing sequential floral and vegetative bud-break. This study
reveals the peach post-dormant bud proteome networks and
hence promotes our knowledge towards the elucidation of the
bud-break timing process, a challenging task that has long
term implications for sustainable fruit production.
2. Materials and methods
2.1. Plant material
Trees of the commercial variety “Everts” grew in established
peach (Prunus persica [L.] Batch) orchards located in the area of
Arnissa, Northern Greece (40o47′43.22″N, 21o50′11.51″E) at an
elevation of 597 m. Samples consisting of floral and vegetative
buds at the early stage C of post-dormancy emergence [23], were
collected by hand in early March 2008. Buds were immediately
frozen in dry ice and stored at −80 °C until further use.
2.2. RNA isolation and RT-PCR analysis
Total RNA was isolated from the bud samples that used also
for protein extraction by applying the phenol-SDS method as
previously described [24]. RNA concentrations were deter-
mined spectrophotometrically and verified by ethidium
bromide staining on agarose gels. DNA contaminations were
eliminated by treating total RNA with RQ1 RNase free DNase
(Promega, WI, USA). Reverse transcription (RT) was performed
on 0.8 μg of total DNA-free RNA using the Superscript II
Reverse Transcriptase according to manufacturer's instruc-
tions (Invitrogen, CA, USA). The gene-specific primers and
annealing conditions used for first-strand cDNA synthesis and
RT-PCR amplification for each transcript were as follows:
LEAFY (61 °C, 617 bp): PpLFY-Forward: GACAACGACTTGGAC-
GACATG and PpLFY-Reverse: AGGGGCATGCACTTTGATCAG;
AGAMOUS (57 °C, 681 bp): PpAG-Forward: GATCGAGAT-
CAAGCGGATCG and PpAG-Reverse: GTCCAAGCACATTAAAC-
TAATTG. The PCR amplification reactions were set up at 25 μL
and 29 thermal cycles were performed by the addition of 1 Unit
DyNAzyme EXT DNA Polymerase (Finnzymes, Espoo, Finland).
For comparative analysis and normalization ACTIN (58 °C,
515 bp) was chosen as the endogenous control: PpACTIN-
Forward: CGAGAAGATGACCCAAATAATG and PpACTIN-
Reverse: CTACGTCGCACTTCATGATGG. The products were
analyzed by agarose gel electrophoresis and viewed with
ethidium bromide staining.
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9
2.3. Protein sample preparation and 2-DE
Buds were ground to a fine powder in a mortar and pestle in
the presence of liquid nitrogen. For protein extraction, 250 mg
of powdered tissue was used [25]. Briefly, proteins were
precipitated in 2 mL of 10% w/v trichloroacetic acid/0.07% v/v
β-mercaptoethanol/acetone w/v/v overnight at − 20 °C. After
several washing steps, the pellet was vacuum dried and
resuspended in 1 mL solubilization buffer (7 M urea, 2 M thiourea,
50 mM Tris–HCl pH 6.8, 2% w/v 3-[(3-cholamidopropyl)dimethy-
lamonio]-1-propanesulfonate, 0.4% w/v DTE). Protein concentra-
tion was determined by the Bradford assay (Protein Assay, BioRad,
CA, USA). Twenty micrograms of protein were resolved on a 10%
SDS-polyacrylamide gel to evaluate the quality and quantity of
the samples. Samples were then stored at −20 °C until further use.
For 2-DE, 1 mg of protein was loaded on non-linear
immobilized pH gradient (IPG) strips (3–10), 17 cm long (3-10NL
Ready strips, BioRad, CA, USA). The volume of each protein
sample was adjusted to 400 μL with solubilization buffer. Prior to
loading 0.2% v/v Carrier ampholytes (Resolyte 3.5-10, BioRad, CA,
USA) and Protease Inhibitors (Protease Inhibitor Complete,
Roche, Switzerland) were added to the sample. Proteins were
loaded in a non-cup loading fashion and resolved on a Protean
IEF cell (BioRad, CA, USA). Rehydration was performed at 50 V
for 16 h, followed by pre-run at 250 V for 30 min, step-run at
250–5000 V for 12 h and then a run at 5000 V for 14 h or
120,000 Vh. Strips were equilibrated in 10 mL equilibration buffer
I (6 M urea, 50 mM Tris–HCl pH 8.8, 30% v/v Glycerol, 2% w/v SDS,
0.03 M DTE) for 10 min, followed by a second 10 min equilibra-
tion in 10 mL equilibration buffer II (6 M urea, 50 mM Tris-HCl pH
8.8, 30% v/v Glycerol, 2% w/v SDS, 0.136 M iodoacetamide, 100 μL
bromophenol blue). After equilibration strips were placed on
18 × 18 cm 12% SDS-polyacrylamide gels and run at 40 mA/gel on
a Protean II xi cell (BioRad, CA, USA). Gels were fixed for 1 h in
50% v/v methanol, 5% v/v phosphoric acid with constant shaking
and then stained in Colloidal blue stain (LC6025, Novex Corp, CA,
USA) overnight. Gels were then destained in ultra pure water,
scanned on a densitometer (GS-800 Calibrated Densitometer,
BioRad, CA, USA) and stored in plastic bags until spot picking.
Spot densities were analyzed with the PDQuest 8.0.1 software
(BioRad, CA, USA). The experimental design consisted of four
independent biological replicates for each bud type.
2.4. Protein MALDI-TOF MS identification and bioinformatics
analysis
Gels selected for spot picking were scanned on a PROTEINEER
spII (Brucker-Daltonics, Bremen, Germany) robot and spots
were selected for picking by the use of the Melanie software
(Brucker-Daltonics, Bremen, Germany). Picked spots were
placed in 96-well plates, destained in 50 mM ammonium
bicarbonate, 30% v/v acetonitrile for 20 min and rinsed in
water for 30 min with constant shaking. Protein spots were
dried for 40 min in a vacuum centrifuge and digested with
trypsin according to established procedures [26]. Ten micro-
liters of extraction solution (50% v/v acetonitrile, 0.1% v/v
trifluoroacetic acid) were added to the digested spots and
mixed by shaking for 15 min. Peptide mixtures were then
applied on MALDI ground steel target plates in a 50% v/v
acetonitrile, 0.1% v/v trifluoroacetic acid, 0.75% a-cyano-4-
609
hydroxycinnamic acid matrix (Sigma Corporation). Peptide
analysis was performed on a Brucker Daltonics Ultraflex
III MALDI-TOF-TOF-MS spectrometer (Brucker Daltonics,
Bremen, Germany). Mass spectra analysis was performed
through the FlexAnalysis 2.2 software (Brucker Daltonics,
Bremen, Germany).
A database was designed for proteins of plant species
belonging to the Rosaceae family. EST and contig sequences
were obtained from the Genome Database for Rosaceae (GDR,
http://www.bioinfo.wsu.edu/gdr/) for the following genera:
Prunus (peach, cherry, almond and apricot), Malus (apple), Fragaria
(strawberry), Pyrus (pear) [27]. Nucleotide sequences were trans-
lated in peptide sequences and annotated with common Perl
scripts. The Populus (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.
home.html) and Arabidopsis thaliana (Swissprot) databases were
also individually downloaded and loaded on MASCOT (Matrix
Science, www.matrixscience.com, London, UK). The parameters
for MASCOT were: Database, Rosaceae or Populus or Arabidopsis;
mass tolerance, 35 ppm; MS/MS tolerance, 0.5 Da; missed clea-
vages per peptide, 0; partial oxidation at methionine residues;
fixed modification of carbamidomethylation of cysteine residues;
no constraint on the protein mass and pI. MASCOT results based
on the Rosaceae database were used for further identification of
the spots. Spots with MALDI score below 60 were also analyzed
with the Populus and Arabidopsis databases in MASCOT. If the spot
was identified in either of the two databases it was incorporated
into the positively identified spots. Gene ontology search was
performed using the Blast2GO tool [28]. Amino acid sequences of
proteins returned by MASCOT analysis were piped into Blast2GO.
The sequences were blasted against the NCBI “nr” protein
database, mapped to obtain gene-ontology information and
finally annotated. The default settings were applied to the Blast
search (Database: nr, No. of Blast Hits: 20, Blast Expect Value:
1.0E−3, Blast program: blastx, Blast Mode: QBlast-NCBI, HSP length
cutoff: 33 Low complexity filter: on) and Annotation (E-value-hit-
filter: 1.0E−6, Annotation CutOff: 55, GO Weight: 5, Hsp-Hit
Coverage CutOff: 0).
2.5. nLC–ESI-MS/MS analysis
The nLC-ESI-MS/MS experiment for protein identification was
performed on an Agilent Technologies 6330 Ion Trap mass
spectrometer coupled online with a nano-flow liquid chroma-
tography system-Agilent Technologies 1200 series (Agilent
Technologies, CA, USA). The protein spots were cut out,
digested with trypsin, desalted with C18 Omix tips, lyophilized
and reconstituted in 10 μL of 1% formic acid. A 3 μL of the
sample was injected on the nLC–ESI-MS/MS system which was
equipped with RP-C 18 material for both the trapping
(0.30 × 5 mm, Zorbax C18, 300 Å pore, 5.0 μm particle, Agilent
Technologies, Karlsruhe, Germany) and the nano-scale ana-
lytical column (0.075 × 200 mm, Zorbax C18, 300 Å pore, 3.5 μm
particle). The mobile phase used an initial isocratic condition
for 20 min with mobile phase A at a flow rate of 200 nL/min.
Peptides were eluted into the MS system with a binary
gradient (200 nL/min) from 100% mobile phase A (0.1% formic
acid in H2O) to 70% mobile phase B (0.1% formic acid in
acetonitrile) over 110 min, then 70−100% mobile phase B in
20 min and held at mobile phase B for an additional 10 min.
The MS was operated in an IDA mode. During the MS mode,
610 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9
ions were screened from m/z 350–1500 for a 1.0 s acquisition
cycle, and MS/MS data was acquired from m/z 80–1500 for the
three most abundant ions with charge states between 2 and 4
with pulsing mode on for a 2.0 s acquisition cycle each.
The raw data from each LC–MS/MS analysis were exported to
an MGF (MASCOT generic format) file using Data Analysis
software and submitted to Mascot Server 2.1 (Matrix Science,
London, UK), for an MS/MS ion search. The search for each sample
was performed on a self-made protein database containing the
protein sequences of 19 known NDPKs (Arabidopsis thaliana:
AtNDPK1, NP_567346; AtNDPK2, NP_568970; AtNDPK3,
NP_192839; AtNDK4, NP_567690; Brassica rapa: BrNDPK1,
BAB86292; Drosophila melanogaster: DmAWD, NP_476761; Danio
rerio: DrNM23B, NP_571001; Homo sapiens: HsNM23A, NP_937818;
HsNM23Ai, NP_000260; Mus musculus: MmNDPK1, NP_032730;
Physcomitrella patens: PpatensNDPK1, XP_001773617; Prunus persica:
PpNDPK1, GDR Prunus_v3_Contig6241; Pisum sativum: PsNDPK1,
CAA50511; PsNDPK3, AAF08537; Populus trichocarpa: PtNDPK1,
JGI-591761; PtNDPK2, JGI-773138; PtNDPK3, JGI-410110; PtNDPK4,
JGI-640355; PtNDPK5, JGI-554495).
MASCOT was searched with a fragment ion mass tolerance
of 0.70 Da and a parent ion tolerance of 2.5 Da. Deamidation of
asparagine or glutamine and oxidation of methionine were
specified in MASCOT as variable modifications. Scaffold
(version Scaffold_3_00_04, Proteome Software Inc., Portland,
USA) was used to validate MS/MS based peptide and protein
identifications. Peptide identifications were accepted if they
could be established at greater than 50.0% probability as
specified by the Peptide Prophet algorithm [29]. Protein
identifications were accepted if they could be established at
greater than 90.0% probability and contained at least 2
identified peptides. Protein probabilities were assigned by
the Protein Prophet algorithm [30]. Proteins that contained
similar peptides and could not be differentiated based on
MS/MS analysis alone were grouped to satisfy the principles of
parsimony.
3. Results and discussion
3.1. Peach proteome analysis during bud-break
Peach trees develop distinct buds that differentiate into floral
and vegetative buds at the end of summer and beginning of
fall during the previous growing season and hence they are
established before the onset of endodormancy [23,31]. The
floral peach buds are the first to break, followed after two or
three days by the vegetative buds (Fig. 1A). At the peach-
growing areas located in Macedonia, Northern part of Greece,
dormancy release and subsequent bud-break occurs early in
March leading to full bloom (Fig. 1A). One crucial point in
regulating the genetic information flow for proper develop-
ment is at the protein level. To determine the proteomic
profile of the two bud-types, floral and vegetative buds were
collected from the peach variety ‘Everts’ just before bud-break
(Fig. 1B). At this point, the petals appear as a pink spot on the
tip, showing that flower buds have reached stage C of post-
dormancy emergence [23]. In terms of size, flower buds are
larger compared to vegetative buds (Fig. 1C and D). Prior to
protein analysis, RNA from the bud samples was analyzed by
semi-quantitative RT-PCR to monitor the expression of genes
that determine floral identity. LEAFY controls floral meristem
identity in Arabidopsis thaliana [32,33] and AGAMOUS encodes
for a transcription factor that modulates carpel and stamen
formation [34,35]. Both genes were exclusively expressed in
the samples corresponding to flower buds, confirming the
avoidance of cross contamination and the autonomous imple-
mentation of different developmental programs between
the two bud-types (Fig. 1E). In addition, the results show that
floral identity genes have already been established prior to
bud break to provide the means for proper development and
differentiation.
Proteins were extracted from floral and vegetative bud
samples and analyzed by 2-DE (Fig. 2). The current protocol for
peach protein extraction from buds produced multiple spots
and adequate 2-DE resolution, avoiding the high content of
secondary metabolites that affect protein migration. Protein
profiles showed a high degree of similarity between the two
bud types. Autumnal bud formation has been accomplished
upon transition to dormancy by the enclosure of densely
packed young embryonic leaves or floral organs in vegetative
or floral buds, respectively. Upon dormancy release, cell
proliferation and metabolic reconfiguration mainly occur to
cause bud break. The similarity of the two proteomes at this
stage could reflect the organ-independent developmental
transition from dormancy to growth represented by highly
abundant proteins depicted in both proteomes. Nevertheless,
significant changes in protein spectrum have been reported
during the advanced stages of leaf or flower organ develop-
ment [36,37]. Totally, 1107 protein spots were detected on gels
of vegetative and floral bud samples and picked for MALDI-
TOF MS analysis. The floral sample gel was used as the
primary source of spots returning 915 picked spots, while the
vegetative sample gel was used as supplemental source
especially for high spot-density areas returning 192 picked
spots. These spots were matched between vegetative and
floral bud 2-DE gels. In addition, intense protein spots from
both gels were selected for cross-reference. Efficient spot
annotation was achieved using ESTs from the genome database
for Rosaceae [27] and MASCOT analysis employing stringent
identification criteria (see Materials and methods). The Populus
and Arabidopsis proteomes were used as supporting databases for
the spots with marginal or low identification score in the Rosaceae
database. The successfully identified spots from both bud types
assembled the peach bud-specific reference map which is
presented in Supplementary Table 1. Likewise the results
obtained by MALDI-TOF MS analysis are shown in Supplementary
Table 2. Of the 915 spots picked from the floral gel, 394 were
positively identified at a 43% rate. Likewise, 81 of the 192 spots
from the vegetative gel were positively identified at a 42.2% rate.
The similarity in protein spot identification efficiency between
the two gels indicates the consistency of the techniques applied
for protein analysis.
Functional classification of the identified proteins revealed
that in peach post-dormant meristematic tissues the meta-
bolic pathways are reactivated to sustain bud-break and
subsequent development of the emerging organs (Fig. 3A).
Thus, almost half of the identified proteins possess a catalytic
activity, whereas a significant percentage bears binding
capacity (38.5%) (Fig. 3B). Despite the documented inability of
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9 611

Fig. 1 – The leaf and flower primordia in peach are enclosed in dormant vegetative and floral buds, respectively. (Α) Floral buds
break earlier than vegetative buds. Peach orchard in full bloom is vulnerable to freeze damage by late-spring frosts. (Β) Peach
tree branch with post-dormant ready to break buds. (C) Floral and (D) vegetative buds at phenological stage C. Scale bar = 1 cm.
(E) Expression analysis by RT-PCR of floral identity genes LEAFY and AGAMOUS between the two bud types. The housekeeping
gene ACTIN was used as internal control. Veg: vegetative buds; Flor: floral buds.

the 2-DE coupled to mass spectrometry (MS) technology to
analyze proteins of low abundance [38], our employed protocol
led to the successful identification of few rare proteins such
as transcription (0.8%) or translation (1.7%) factors (Fig. 3B).
Taken together, the data of protein identification with high
confidence and functional classification suggest that the
constructed peach bud proteome may serve as a high-quality
reproducible reference map to study tissue-specific regulatory
mechanisms and metabolic pathways that modulate the
growth of emerging organs.
3.2. The highly abundant proteins are indicative of bud
dormancy release or break
The 2-DE data revealed at least 50 protein spots with a high
density profile. Dehydrin was among the most abundant proteins
in the two bud-types. At least four abundant isoforms were
detected (Fig. 2; Spots 572, 575/1035, 873, 875). Τhe dehydrin gene
expression level has been reported to be tightly synchronized
with the process of bud-break [11,39,40]. The role of dehydrin
in dormant plants still remains unclear; however it is anticipated
to be a cryo-protectant with antifreeze activity in response to a
variety of abiotic stress conditions that have dehydration as a
common component [41].
Superoxide dismutase (Spots 308/1046) and a pathogenesis-
related protein (Spot 352) were also highly accumulated in
peach buds (Fig. 2). Superoxide dismutase has a protective
role by reducing the titer of oxygen free radical molecules in
the cell, reactive species implicated in a number of damages,
including freezing injury [42,43]. Likewise, antifreeze proper-
ties have been proposed for certain pathogenesis-related
proteins showing significant increase in gene expression [8]
and protein abundance [37] during dormancy. Upon dormancy,
the bud undergoes the stress of dehydration while it is exposed
to considerably low temperatures. Thus, the accumulation of
stress response, defense and detoxification-related proteins
contributing to the protection of the meristematic tissues
against freezing injury coincides with dormancy release
[6,10,37,44].
Carbohydrate and energy metabolism is generally consid-
ered to be repressed during the entire period of bud chilling
requirement, as several genes responsible for glycolysis are
down-regulated [6,7]. On the contrary, after dormancy release
and once the environmental conditions are favorable for bud
612 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9

Fig. 2 – Peach bud-type specific protein maps. Equal amounts of proteins were extracted from post-dormant floral (A) and
vegetative (B) buds, and separated by 2-DE. Representative gels for each bud-type, stained with Colloidal blue, are presented.
Selected protein spots that are highly abundant in both bud-types are depicted in magnified sections. The numbers correspond
to proteins successfully identified by mass spectrometry (see Supplementary Table 1).

break, the mobilization of storage reserves is promoted. This
transition between dormancy and growth induction coincides
with the accumulation of enolase in post-dormant peach buds
(Fig. 2; Spots 86/1074), a key enzyme of plant glycolysis [45].
In plants, glycolysis is the main biochemical pathway that
provides plant mitochondria with pyruvate, supporting plant
respiration and biosynthesis of numerous essential metabolic
compounds. Post-dormant buds are metabolically active with
considerable high energy requirements to sustain break and
organ emergence. Recently, several proteomic results showed
that energy metabolism is a prerequisite for leaf and flower
development [36,37].
3.3. Differential protein expression patterns between floral
and vegetative buds
Quantification of 2-DE protein spots revealed that 11 proteins
were consistently differentially expressed between floral and
vegetative peach buds representing 2.5% of the identified
proteins (Fig. 3C). Eight proteins accumulated higher in floral
buds compared to three proteins that were higher in vegetative
buds (Table 1; Supplementary Table 3). The majority of the floral
bud up-regulated proteins are involved in the mobilization of
energy and nitrogen reserves to compensate the demands of
cell proliferation in the developing flower (Fig. 4A; Table 1). More
precisely, xylose isomerase (Spot 38) and alpha-D-galactoside
galactohydrolase (Spot 191) are enzymes modulating carbon
metabolic pathways. Alpha-galactosidases remobilize oligosac-
charides during seed germination [46]. Therefore, it may be
plausible to suggest that the expression of these proteins to
remobilize stored oligosaccharides could be a prerequisite for
the later stages of floral bud-break, which is more developmen-
tally advanced than the break of vegetative buds.
The alanine-glyoxylate aminotransferase (AlaAT, Spot 521)
regulates the efficient use of nitrogen that is mainly depen-
dent upon the recycling and remobilization of nitrogen from
senescing tissues to developing organs [47]. AlaAT is involved
in the synthesis or degradation of alanine by a reversible
biochemical reaction. In doing so, it is involved in the production
of either alanine or pyruvate, and may facilitate the mainte-
nance of the carbon–nitrogen homeostasis throughout plant
organ growth [48]. Complementary to these metabolic path-
ways, the level of coproporphyrinogen oxidase (LIN2, Spot
195), an enzyme of the tetrapyrrole biosynthesis pathway, is
detected in floral buds. Tetrapyrrole compounds are critical for a
variety of biological processes, including energy metabolism,
photoperception, signaling, and detoxification of oxidizing
agents [49]. Since floral buds are developmentally advanced,
these results indicate that the sequential steps for bud break
require the accumulation of a number of enzymes involved in
energy resources mobilization.
Furthermore, proteins with specialized role in plant mor-
phological development were up-regulated in floral buds, such
as the cell division control protein 48 homolog E (CDC48E;
Spot 594) and a Populus trichocarpa predicted protein (Spot 183).
CDC48E is a highly abundant type II AAA+ protein (ATPase
associated with different cellular activities) involved in cell cycle
and proliferation [50,51]. In accordance, high expression of the
AtCDC48A gene has been detected in the flowers of rapidly
growing plants [51]. Analysis of the gymnosperm Pinus sylvestris
apical bud proteome also revealed that CDC48 is highly
abundant upon the transition from dormancy to growth [37].
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9 613

Fig. 3 – Statistics on functional classification of the peach bud proteins. (A) Categorization of peach bud proteins in terms of their
biological role using Gene Ontology (www.geneontology.org). (B) Classification of peach bud proteins based on their functional role by
Gene Ontology. (C) Venn diagram showing the distribution of bud-specific proteins in floral (red) and vegetative (green) peach buds.

Even though, the initial survey returned insufficient data to
characterize the poplar predicted protein, thorough searches
using BLASTP identified a significant homology with DEAD-box
proteins (DBPs; Spot 183). DBPs, characterized by the conserved
motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases.
They have been implicated in mRNA nuclear export, abiotic
stress response, germination and plant development [52].
By contrast, peach vegetative buds exhibited an approximate
6-fold increase in glyceraldehyde 3-phosphate dehydrogenase
(GAPDH; Spot 993) levels (Fig. 4B; Table 1). GAPDH is involved
in the cytosolic glycolytic network, which provides metabolic
flexibility facilitating plant development and acclimation
to environmental stress such as cold or freezing [45]. The
expression of GAPDH genes is inhibited during the chilling
requirement period in woody perennial buds [6,7], whereas
the increase in GAPDH protein level is most likely associated
with the rapid growth of autotrophic tissues such as the leaf
primordia within vegetative buds.
3.4. Differential expression of enzymes mediating hydrogen
peroxide homeostasis
Even though superoxide dismutase (Spots 308/1046) was
highly abundant in both bud types, other enzymes that
regulate cellular homeostasis of H2O2 were differentially
accumulated in peach floral and vegetative buds. Catalase,
the major antioxidative enzyme that degrades H2O2 into water
and oxygen and thus prevents the accumulation of reactive
oxygen species (ROS), was detected only in floral buds (Fig. 4A,
Spot 687). On the contrary, peroxidase that generates H2O2 by
NADH oxidation was up-regulated in vegetative buds (Fig. 4B,
Spot 1089).
Taken together with the fact that floral buds are more
advanced than vegetative buds, these results suggest that
oxidative stress caused by increased levels of H2O2 might
activate the bud-break process. The transient peak of H2O2
preceding dormancy release could act as a signaling molecule
614 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9

Table 1 – Proteins with consistent differential expression between floral and vegetative buds.
Spot GenBank Annotation a Floral/ Floral Vegetative Predicted Experimental Score Sequence Matching
no. accession a vegetative mean c mean c MW/pI MW/pI coverage% peptides
b
ratio (SD) (SD)

Floral bud up-regulated proteins

38 NP_568861 Xylose isomerase 3.3 833(97) 253(70) 53.7/5.6 57/5.3 94 25 11
family protein
[Arabidopsis thaliana]
183 XP_002304418 Predicted protein 55.8 941(117) 17(14) 30.9/6.0 37/5.6 33 12 2
[Populus trichocarpa]
191 Q42656 Alpha-D-galactoside 41.3 333(144) 8(2) 41.3/5.6 34/5.7 37 10 4
galactohydrolase
[Coffea arabica]
195 XP_002518396 Coproporphyrinogen 196.0 1026(432) 5(4) 44.3/7.1 38/5.7 33 12 3
III oxidase, putative
[Ricinus communis]
345 NP_567346 NDPK1; ATP 770.1 770(729) nd(na) 18.8/8.4 13/6.4 84 35 6
binding/nucleoside
diphosphate kinase
[Arabidopsis thaliana]
521 NP_187498 Alanine-glyoxylate 30.3 986(226) 33(13) 52.4/8.1 52/6.0 67 20 6
aminotransferase,
putative
[Arabidopsis thaliana]
594 ABF59516 Putative spindle 8.5 626(307) 74(26) 89.9/5.1 109/5.3 109 13 9
disassembly related
protein CDC48
[Nicotiana tabacum]
687 CAD42909 Catalase [Prunus persica] 21.0 241(79) 11(12) 57.0/6.9 59/7.0 50 7 4

Vegetative bud up-regulated proteins

943 NP_567346 NDPK1; ATP − 2.5 1500(1092) 3803(2572) 18.8/8.4 13/6.4 78 35 6
binding/nucleoside
diphosphate kinase
[Arabidopsis thaliana]
993 CAA42103 Glycolytic glyceraldehyde − 6.1 79(12) 486(147) 36.5/8.3 46/6.2 42 30 2
3-phosphate
dehydrogenase
[Antirrhinum majus]
1089 AAK52084 Peroxidase − 2.3 618(415) 1431(593) 39.0/5.9 54/5.6 141 34 11
[Nicotiana tabacum]

nd: not detected na: not available.

a
Blast results for the best hit returned by MASCOT.
b
Student's t-test was applied to associate a level of confidence between the differentially expressed proteins (p < 0.01).
c
Expression in arbitrary units.

to trigger dormancy transitioning into subsequent bud-break.
Previous studies provided solid experimental evidence in
support of this hypothesis. First, inhibition of catalase activity
in grapevines that caused oxidative stress due to the increased
H2O2 content resulted in bud-break [15,18,53]. Secondly,
transcription of genes encoding for H2O2 scavenging enzymes
in woody perennial plants is induced after dormancy release,
suggesting a need for ROS detoxification soon after the
molecular signal transduction pathways for bud-break are
activated [6,54]. Furthermore, the enzymes associated with
ROS removal are activated in post-dormant buds to reduce
toxicity effect and allow bud-break [17,53]. In consistency,
antioxidant proteins of the ROS scavenging pathways includ-
ing catalase (Spot 687), ascorbate peroxidases (Spots 235, 243,
391, 412), superoxide dismutase (Spot 308) and glutathione
reductase (Spot 529) were detected in peach floral buds.
Notably, floral buds are the first to receive the molecular signal
for bud break (Fig. 1A). Interestingly, the proteome analysis
of Pinus sylvestris apical buds indicated an increase of plant
antioxidant enzymes during dormancy release suggesting a
H2O2-mediated mechanism in bud break of both angiosperms
and gymnosperms [37].
3.5. Distinct NDPK1 protein variants are associated with
bud-break
Two major spots were identified as the Prunus persica nucleoside
diphosphate kinase1 (PpNDPK1) protein and appeared to be
linearly shifted between gels of the two bud-types, indicating
the existence of protein variants with different pI values (Fig. 4C;
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9
Fig. 4 – Comparative protein expression profiling of floral and
vegetative buds in peach. (A) Floral bud up-regulated proteins.
(B) Vegetative bud up-regulated proteins. (C) Evidence of
PpNDPK1 protein variants pI shifting between vegetative and
floral buds. The arrows denote the differentially expressed
protein spots. Annotation information can be found in Table 1.
Table 1). The acidic variant predominantly occurred in vegetative
buds (Spot 943), whereas its level significantly decreased in floral
buds (Spot 344). On the contrary, the basic variant was exclusively
615
present in floral buds (Spot 345). The nLC–ESI-MS/MS analysis of
the protein variants confirmed, with significantly high sequence
coverage, the spot annotation obtained by MALDI-TOF MS (Fig. 5A;
Supplementary Table 4).
NDPKs were originally described to catalyze the transfer of
a γ-phosphoryl group from nucleotide triphosphates to nucle-
oside diphosphates maintaining the intracellular homeostasis
of nucleotide concentrations [55]. Additional functions have
been assigned to NDPKs including the role of transcriptional
regulation, protein phosphotransferase or being involved in
protein interactions [55]. However, the activity of NDPKs as
multifunctional enzymes in plants remains obscure. The
identified isoforms exhibit the consensus NH2-MEQTFI motif
at the N-terminus (Fig. 5B, C and D) that is a common feature
of dicotyledonous cytosolic isoforms (Supplementary Fig. 1A).
Consequently, the peach NDPK1 belongs into the cluster of
putative plant cytosolic isoforms (Supplementary Fig. 1B). In
potato the cytosolic NDPK is predominantly localized in the
meristematic zones and provascular tissues of the apical
regions, probably playing a critical role in cellular differentiation
and plant growth [56].
Biochemical and genetic studies in Arabidospsis thaliana
revealed the association of NDPKs with the H2O2-mediated
mitogen-activated protein kinase signaling [57]. Furthermore,
NDPK1 has been shown to interact with the three isoforms
of Arabidopsis catalase to induce their activity [58]. Hence, the
PpNDPK1 variants could be signaling components that differ-
entially regulate the cellular redox state between the two bud
types. Since the break of floral buds precedes that of vegetative
in peach, it is plausible that the reduction of the acidic PpNDPK1
variant in floral buds modulates hydrogen peroxide-scavenging
enzymatic mechanisms to prevent prolonged exposure to the
transient peak of free radicals.
The shift of PpNDPK1 variants on 2-DE is most likely
attributed to post-translational modifications that change the
pI value and consequently affect isoelectric focusing of the
respective protein. The purification of plant NDPK isoforms
revealed autophosphorylation at the catalytic histidine residue
with effects on the enzymatic activity [59,60].
4. Conclusions
Peach (Prunus persica [L.] Batch) is a deciduous fruit tree of the
temperate region that belongs to the Rosaceae, a plant family
encompassing numerous agriculturally important fruit, nut,
ornamental and wood crops [61]. Rosaceous crops, due to
their high fruit content in health-related compounds have
become targets for the development of biofunctional foods.
Peach trees provide fleshy drupe type fruits that can be
consumed fresh or processed. Hence, peach cultivation is
of high importance for agro-economic development in
temperate regions. Nevertheless, unpredictable climatic con-
ditions leading to high risk of spring frost damage impels
the application of innovative methods to evaluate genetic
resources, tolerant to such abiotic stress. The timing of bud-
break is an important factor affecting vigor and productivity
of the peach tree. Any deviation, due to mostly environmen-
tal factors like frost, has detrimental effects on fruit setting
and tree growth.
616 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9
This analysis indicates that among others, proteins related
to stress-response, cell defense and detoxification are highly
abundant in post-dormant peach buds. These proteins are
mainly involved in the protection of meristematic tissues
against freezing injury upon bud-break. Furthermore, dor-
mancy transition is consistent with great redirection of
cellular metabolism. Major biochemical pathways associated
with the mobilization of storage reserves, energy production
and metabolites synthesis are activated to sustain rapid
tissue growth. Similarly to other woody perennial species,
H2O2 could function as the signaling molecule triggering
bud-break. Currently, H2O2 is widely accepted as the most
likely ROS to be involved in signal transduction due to its
relative stability and ability to pass through membrane
compartments [62]. A dynamic H2O2 regulatory protein
network consisting of peroxidases and several antioxidant
enzymes including catalase, results in transient modulation of
H2O2 levels [2,15–18,53]. Once the signal transduction pathway
is activated, the enzymes that regulate endogenous hydrogen
peroxide homeostasis decrease the level of H2O2 to prevent
toxicity effects and allow organs' emergence. The PpNDPK1
protein variants detected in the two bud-types could serve
as components of this signaling pathway. Even though in
Rosaceaous species the transient increase of H2O2 content in
flower buds has been correlated with dormancy release [63], it
would be interesting to elucidate the dynamic changes of H2O2
content during successive stages of vegetative and floral
peach bud breaking. Overall, peach post-dormant bud
development is a perplexed physiological scenario defined
by concurrent biochemical, molecular and environmental
processes that could be potentially interconnected from a
regulatory point of view. The elucidation of these networks
relies more on a holistic rather than a single process study
approach. The recently released peach genome (www.
rosaceae.org/peach/genome) will promote combinatorial
experimental designs incorporating high throughput data
analysis to reveal the cascade of post-dormant bud break.
Supplementary materials related to this article can be
found online at doi:10.1016/j.jprot.2011.01.018.
Acknowledgements
The authors thank the personnel of ALMME Ltd for fruitful
collaboration. We are also grateful to Michalis Aivaliotis and
Ploumisti Dimitraki from BRFAA, Greece for technical help and
valuable comments. This work was supported by EPAN Grant
No.18/05DSBEPRO-31 from GSRT to ALMME Ltd and P.H. A.V
and P.H gratefully acknowledge COST Action FA 0603 for the
expertise gained in plant proteomics.
Fig. 5 – The nLC–ESI-MS/MS analysis confirmed that the pI shifted protein spots correspond to cytosolic variants of PpNDPK1.
(A) The amino acid sequence coverage of the PpNDPK1 protein highlighted in red and bold is increased to 59.5% compare to
MALDI-TOF MS analysis. Presentation of the annotated MS/MS spectrum identified for the N-terminal peptide
MEQTFIMIKPDGVQR of the spots s943 (B), s344 (C) and s345 (D) corresponding to the PpNDPK1 variants. The m/z values of y and
b fragments, the charge state and the ppm error are shown for each peptide. Assessed y and b ions are color-annotated by blue
and red, respectively, whereas the peaks in green depict Methionine oxidation (M) or deamidation of Asparagine (N) and
Glutamine (Q) residues.
617
REFERENCES
[1] Lang GA, Early JD, Martin GC, Darnell RL. Endo-para and
eco-dormancy: physiological terminology and classification
for dormancy research. HortScience 1987;22:371–7.
[2] Arora R, Rowland LJ, Tanino K. Induction and release of bud
dormancy in woody perennials: a science comes of age.
HortScience 2003;38:911–21.
[3] Horvath DP, Anderson JV, Chao WS, Foley ME. Knowing when
to grow: signals regulating bud dormancy. Trends Plant Sci
2003;8:534–40.
[4] Rohde A, Bhalerao RP. Plant dormancy in the perennial
context. Trends Plant Sci 2007;12:217–23.
[5] Saxe H, Cannell MGR, Johnsen Ø, Ryan MG, Vourlitis G. Tree
and forest functioning in response to global warming. New
Phytol 2001;149:369–400.
[6] Mazzitelli L, Hancock RD, Haupt S, Walker PG, Pont SD,
McNicol J, et al. Co-ordinated gene expression during phases
of dormancy release in raspberry (Rubus idaeus L.) buds. J Exp
Bot 2007;58:1035–45.
[7] Mathiason K, He D, Grimplet J, Venkateswari J, Galbraith DW, Or E,
et al. Transcript profiling in Vitis riparia during chilling
requirement fulfillment reveals coordination of gene expression
patterns with optimized bud break. Funct Integr Genomics
2009;9:81–96.
[8] Jimenez S, Li Z, Reighard GL, Bielenberg DG. Identification of
genes associated with growth cessation and bud dormancy
entrance using a dormancy-incapable tree mutant. BMC Plant
Biol 2010;10:25.
[9] Muthalif MM, Rowland LJ. Identification of dehydrin-like
proteins responsive to chilling in floral buds of blueberry
(Vaccinium, section Cyanococcus). Plant Physiol 1994;104:
1439–47.
[10] Renaut J, Lutts S, Hoffmann L, Hausman JF. Responses of
poplar to chilling temperatures: proteomic and physiological
aspects. Plant Βiol 2004;6:81–90.
[11] Bassett CL, Wisniewski ME, Artlip TS, Richart G, Norelli JL,
Farrell Jr RE. Comparative expression and transcript initiation
of three peach dehydrin genes. Planta 2009;230:107–18.
[12] Palonen P, Buszard D, Donnelly D. Changes in carbohydrates
and freezing tolerance during cold acclimation of red
raspberry cultivars grown in vitro and in vivo. Physiol Plant
2000;110:393–401.
[13] Rinne PL, van der Schoot C. Symplasmic fields in the tunica of
the shoot apical meristem coordinate morphogenetic events.
Development 1998;125:1477–85.
[14] Rinne PL, Kaikuranta PM, van der Schoot C. The shoot apical
meristem restores its symplasmic organization during
chilling-induced release from dormancy. Plant J 2001;26:249–64.
[15] Nir G, Shulman Y, Fanberstein L, Lavee S. Changes in the
Activity of Catalase (EC 1.11.1.6) in Relation to the Dormancy of
Grapevine (Vitis vinifera L.) Buds. Plant Physiol 1986;81:1140–2.
[16] Or E, Vilozny I, Fennell A, Eyal Y, Ogrodovitch A. Dormancy in
grape buds: isolation and characterization of catalase cDNA
and analysis of its expression following chemical induction of
bud dormancy release. Plant Sci 2002;162:121–30.
618 J O U RN A L OF P R O TE O MI CS 7 4 (2 0 1 1 ) 6 0 7–6 1 9
[17] Wang SY, Jiao H, Faust M. Changes in ascorbate, glutathione,
and related enzyme activities during thidiazuron-induced
bud break of apple. Physiol Plant 1991;82:231–6.
[18] Halaly T, Pang X, Batikoff T, Crane O, Keren A, Venkateswari J,
et al. Similar mechanisms might be triggered by alternative
external stimuli that induce dormancy release in grape buds.
Planta 2008;228:79–88.
[19] Frewen BE, Chen TH, Howe GT, Davis J, Rohde A, Boerjan W,
et al. Quantitative trait loci and candidate gene mapping
of bud set and bud flush in populus. Genetics 2000;154:
837–45.
[20] Rigby JR, Porporato A. Spring frost risk in a changing climate.
Geophys Res Lett 2008;35:L12703, doi:10.1029/2008GL033955.
[21] Cannell MGR, Smith RI. Climatic warming, spring budburst
and frost damage on trees. J Appl Ecol 1986;23:177–91.
[22] Gu L, Hanson P, Mac Post W, Kaiser D, Yang B, Nemani R, et al.
The 2007 eastern US spring freezes: increased cold damage in
a warming world? Bioscience 2008;58:253–62.
[23] Reinoso H, Luna V, Pharis RP, Bottini R. Dormancy in peach
(Prunus persica) flower buds. V. Anatomy of bud development
in relation to phenological stage. Can J Bot 2002;80:656–63.
[24] Haralampidis K, Milioni D, Sanchez J, Baltrusch M, Heinz E,
Hatzopoulos P. Temporal and transient expression of
stearoyl-ACP carrier protein desaturase gene during olive
fruit development. J Exp Bot 1998;49:1661–9.
[25] Vincent D, Wheatley MD, Cramer GR. Optimization of protein
extraction and solubilization for mature grape berry clusters.
Electrophoresis 2006;27:1853–65.
[26] Makridakis M, Gagos S, Petrolekas A, Roubelakis MG, Bitsika V,
Stravodimos K, et al. Chromosomal and proteome analysis of
a new T24-based cell line model for aggressive bladder cancer.
Proteomics 2009;9:287–98.
[27] Jung S, Staton M, Lee T, Blenda A, Svancara R, Abbott A, et al. GDR
(Genome Database for Rosaceae): integrated web-database for
Rosaceae genomics and genetics data. Nucleic Acids Res 2008;36:
D1034–40.
[28] Götz S, García-Gómez JM, Terol J, Williams TD, Nagaraj SH,
Nueda MJ, et al. High-throughput functional annotation and
data mining with the Blast2GO suite. Nucleic Acids Res
2008;36:3420–35.
[29] Keller A, Nesvizhskii AI, Kolker E, Aebersold R. Empirical
statistical model to estimate the accuracy of peptide
identifications made by MS/MS and database search. Anal
Chem 2002;74:5383–92.
[30] Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical
model for identifying proteins by tandem mass spectrometry.
Anal Chem 2003;75:4646–58.
[31] Gordon D, Damiano C, DeJong TM. Preformation in vegetative
buds of Prunus persica: factors influencing number of leaf
primordia in overwintering buds. Tree Physiol 2006;26:537–44.
[32] Schultz EA, Haughn GW. LEAFY, a Homeotic Gene That
Regulates Inflorescence Development in Arabidopsis. Plant
Cell 1991;3:771–81.
[33] Weigel D, Alvarez J, Smyth DR, Yanofsky MF, Meyerowitz EM.
LEAFY controls floral meristem identity in Arabidopsis. Cell
1992;69:843–59.
[34] Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA,
Meyerowitz EM. The protein encoded by the Arabidopsis
homeotic gene agamous resembles transcription factors.
Nature 1990;346:35–9.
[35] Hu M, Labbé H, Martin T, McHugh S, Svircev A, Miki B. PpAG1,
a homolog of AGAMOUS, expressed in developing peach
flowers and fruit. Can J Bot 2006;84:767–76.
[36] Ahsan N, Komatsu S. Comparative analyses of the proteomes
of leaves and flowers at various stages of development reveal
organ-specific functional differentiation of proteins in
soybean. Proteomics 2009;9:4889–907.
[37] Bi YD, Wei ZG, Shen Z, Lu TC, Cheng YX, Wang BC, et al.
Comparative temporal analyses of the Pinus sylvestris L. var.
mongolica litv. apical bud proteome from dormancy to
growth. Mol Biol Rep 2010, doi:10.1007/s11033-010-0159-2.
[38] Gygi SP, Corthals GL, Zhang Y, Rochon Y, Aebersold R.
Evaluation of two-dimensional gel electrophoresis-based
proteome analysis technology. Proc Natl Acad Sci USA
2000;97:9390–5.
[39] Yakovlev IA, Asante DK, Fossdal CG, Partanen J, Junttila O,
Johnsen O. Dehydrins expression related to timing of bud
burst in Norway spruce. Planta 2008;228:459–72.
[40] Yamane H, Kashiwa Y, Kakehi E, Yonemori K, Mori H,
Hayashi K, et al. Differential expression of dehydrin in flower
buds of two Japanese apricot cultivars requiring different
chilling requirements for bud break. Tree Physiol 2006;26:
1559–63.
[41] Rorat T. Plant dehydrins-tissue location, structure and
function. Cell Mol Biol Lett 2006;11:536–56.
[42] McKersie BD, Chen Y, de Beus M, Bowley SR, Bowler C, Inzé D,
et al. Superoxide dismutase enhances tolerance of freezing
stress in transgenic alfalfa (Medicago sativa L.). Plant Physiol
1993;103:1155–63.
[43] McKersie BD, Murnaghan J, Jones KS, Bowley SR. Iron-
superoxide dismutase expression in transgenic alfalfa
increases winter survival without a detectable increase in
photosynthetic oxidative stress tolerance. Plant Physiol
2000;122:1427–37.
[44] Hoshino T, Odaira M, Yoshida M, Tsuda S. Physiological and
biochemical significance of antifreeze substances in plants.
J Plant Res 1999;112:255–61.
[45] Plaxton WC. The organization and regulation of plant glycolysis.
Annu Rev Plant Physiol Plant Mol Biol 1996;47:185–214.
[46] Blöchl A, Peterbauer T, Hofmann J, Richter A. Enzymatic
breakdown of raffinose oligosaccharides in pea seeds. Planta
2008;228:99–110.
[47] Wisniewski M, Bassett C, Arora R. Distribution and partial
characterization of seasonally expressed proteins in different
aged shoots and roots of ‘Loring’ peach (Prunus persica). Tree
Physiol 2004;24:339–45.
[48] Miyashita Y, Dolferus R, Ismond KP, Good AG. Alanine
aminotransferase catalyses the breakdown of alanine after
hypoxia in Arabidopsis thaliana. Plant J 2007;49:1108–21.
[49] Williams P, Hardeman K, Fowler J, Rivin C. Divergence of
duplicated genes in maize: evolution of contrasting targeting
information for enzymes in the porphyrin pathway. Plant J
2006;45:727–39.
[50] Feiler HS, Desprez T, Santoni V, Kronenberger J, Caboche M,
Traas J. The higher plant Arabidopsis thaliana encodes a
functional CDC48 homologue which is highly expressed in
dividing and expanding cells. EMBO J 1995;14:5626–37.
[51] Park S, Rancour DM, Bednarek SY. In planta analysis of the
cell cycle-dependent localization of AtCDC48A and its critical
roles in cell division, expansion, and differentiation. Plant
Physiol 2008;148:246–58.
[52] Gong Z, Dong CH, Lee H, Zhu J, Xiong L, Gong D, et al. A DEAD
box RNA helicase is essential for mRNA export and important
for development and stress responses in Arabidopsis. Plant
Cell 2005;17:256–67.
[53] Pérez FJ, Lira W. Possible role of catalase in post-dormancy
bud break in grapevines. J Plant Physiol 2005;162:301–8.
[54] Pacey-Miller T, Scott K, Ablett E, Tingey S, Ching A, Henry R.
Genes associated with the end of dormancy in grapes. Funct
Integr Genomics 2003;3:144–52.
[55] Hasunuma K, Yabe N, Yoshida Y, Ogura Y, Hamada T.
Putative functions of nucleoside diphosphate kinase in plants
and fungi. J Bioenerg Biomembr 2003;35:57–65.
[56] Dorion S, Matton DP, Rivoal J. Characterization of a cytosolic
nucleoside diphosphate kinase associated with cell division
and growth in potato. Planta 2006;224:108–24.
[57] Moon H, Lee B, Choi G, Shin D, Prasad DT, Lee O, et al. NDP
kinase 2 interacts with two oxidative stress-activated MAPKs
 J O U RN A L OF P R O TE O MI CS 74 ( 20 1 1 ) 6 0 7–6 1 9
to regulate cellular redox state and enhances multiple stress
tolerance in transgenic plants. Proc Natl Acad Sci USA
2003;100:358–63.
[58] Fukamatsu Y, Yabe N, Hasunuma K. Arabidopsis NDK1 is a
component of ROS signaling by interacting with three
catalases. Plant Cell Physiol 2003;44:982–9.
[59] Johansson M, Mackenzie-Hose A, Andersson I, Knorpp C.
Structure and mutational analysis of a plant mitochondrial
nucleoside diphosphate kinase. Identification of residues
involved in serine phosphorylation and oligomerization.
Plant Physiol 2004;136:3034–42.
619
[60] Shen Y, Kim JI, Song PS. Autophosphorylation of Arabidopsis
nucleoside diphosphate kinase 2 occurs only on its active
histidine residue. Biochemistry 2006;45:1946–9.
[61] Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS,
Folta KM, et al. Multiple models for Rosaceae genomics. Plant
Physiol 2008;147:985–1003.
[62] Møller IM, Sweetlove LJ. ROS signalling—specificity is required.
Trends Plant Sci 2010;15:370–4.
[63] Kuroda H, Sugiura T, Ito D. Changes in hydrogen peroxide content
in flower buds of japanese pear (Pyrus pyrifolia Nakai) in relation
to breaking endodormancy. J Japan Soc Hort Sci 2002;71:610–6.