IJPHRDSeptember2019ason06 09 2019

Volume 8 Number 49 September 2019 2017
October-December
SCOPUS IJPHRD CITATION SCORE

Indian Journal of Public Health Research and Development
Scopus coverage years: from 2010 to 2016 Publisher:
R.K. Sharma, Institute of Medico-Legal Publications
ISSN:0976-0245E-ISSN: 0976-5506 Subject area: Medicine:
Public Health, Environmental and Occupational Health
CiteScore
Cite Score 2015-
2017-0.02
0.03
SJR
SJR 2017- 0.108
2015- 0.105
SNIP 2017-
SNIP 2015- 0.034
0.047
d b y Sc
re
e
op
Cov
us
EMBASE
Indian Journal of Public Health Research & Development
EXECUTIVE EDITOR
Vidya Surwade
Associate Professor, Dr Baba Saheb Ambedkar,Medical College & Hospital Rohinee, Delhi
INTERNATIONAL EDITORIAL ADVISORY BOARD 3. Dr. Amit K. Singh, Associate Professor, Community Medicine,
VCSG Govt. Medical College, Srinagar – Garhwal, Uttarakhand
1. Dr Abdul Rashid Khan B. Md Jagar Din,
4. Dr R G Viveki, Prof n head,
Associate Professor, Department of Public Health Medicine, Penang
Dept of Community Medicine, BIMS Belgavi
Medical College, Penang , Malaysia
5. Dr. Santosh Kumar Mulage, Assistant Professor, Anatomy,
2. Dr V Kumar, Consulting Physician, Mount View Hospital, Las Vegas, USA Raichur Institute of Medical Sciences Raichur(RIMS) , Karnataka
3. Basheer A. Al-Sum, Botany and Microbiology Deptt, 6. Dr Gouri Ku. Padhy, Associate Professor, Community and Family
College of Science, King Saud University, Riyadh, Saudi Arabia Medicine, AII India Institute of Medical Sciences, Raipur
4. Dr Ch Vijay Kumar, Associate Professor, 7. Dr Ritu Goyal, Associate Professor,Anaesthesia ,
Public Health and Community Medicine, University of Buraimi, Oman Sarswathi Institute of Medical Sciences, Panchsheel Nagar
5. Dr VMC Ramaswamy, Senior Lecturer, Department of Pathology, 8. Dr. Anand Kalaskar, Associate Professor, Microbiology
International Medical University, Bukit Jalil, Kuala Lumpur Prathima Institute of Medical Sciences , AP
6. Kartavya J. Vyas, Clinical Researcher, 9. Dr.Md.Amirul Hassan, Associate Professor, Community Medicine
Department of Deployment Health Research, Government Medical College, Ambedkar nagar, UP
Naval Health Research Center, San Diego, CA (USA)
10. Dr.N.Girish, Associate Professor, Microbiology, VIMS&RC, Bangalore
7. Prof PK Pokharel, Community Medicine,
11. Dr BR Hungund, Associate Professor Pathology, JNMC ,Belgaum.
BP Koirala Institute of Health Sciences, Nepal
12. Dr Sartaj Ahmad, Associate Professor, Medical Sociology,
8. Sajjad Salim Issa AL-Musawi
Department of Community Medicine,
supervisor for student of the Arab board in family medicine Swami Vivekananda Subharti University, Meerut, Uttar Pradesh, India.
9. Prof. Dr. Ayad F. Alkaim, Professor of surface chemistry and 13. Dr Manoj Kumar Tripathi, (Associate Professor),
applications of nano-materials, Babylon University,Iraq Political Science and public administration,
Prof. Dr. Imad Hadi Hameed, Biomedical Science
10. Swami Vivekananda Subharti University, Meerut, Uttar Pradesh, India.
Department,College of Nursing, University of Babylon, Hillah city, Iraq 14. Dr Sumeeta Soni, Associate Professor, Microbiology Department,
11. Prof. Dr. Amean A Yasir, Department of Community, B.J. Medical College, Ahmedabad Gujarat, India
College of Nursing, University of Babylon, Hillah city, Iraq
Print ISSN: 0976-0245, Electronic ISSN: 0976-5506, Frequency:
NATIONAL EDITORIAL ADVISORY BOARD Quarterly (Four issue per volume)
1. Prof. Sushanta Kumar Mishra, Community Medicine, Indian Journal of Public Health Research & Development is a
GSL Medical College – Rajahmundry, Karnataka double blind peer reviewed international journal. The frequency is half yearly going
2. Prof D.K.Srivastava, Medical Biochemistry, to be quarterly by 2012. It deals with all aspects of Public Health including Community
Jamia Hamdard Medical College, New Delhi Medicine, Public Health, Epidemiology, Occupational Health, Environmental Hazards,
3. Dr Sunil Mehra, Paediatrician & Executive Director, Clinical Research, and Public Health Laws and covers all medical specialties concerned
MAMTA Health Institute of Mother & Child, New Delhi with research and development for the masses. The journal strongly encourages
reports of research carried out within Indian continent and South East Asia.
4. Prof M.Sriharibabu, General Medicine,
GSL Medical College, Rajahmundry , Andhra Pradesh The journal has been assigned International Standards Serial Number (ISSN)Print
ISSN: 0976-0245, Online ISSN: 0976-5506 and is indexed with Index Copernicus
5. Prof Pankaj Datta, Principal & Prosthodentist,
Indraprastha Dental College ,Ghaziabad (Poland). It is also brought to notice that the journal is being covered by many
international databases. The journal is covered by EBSCO (USA), Embase, EMCare
6. Prof Samarendra Mahapatro, Pediatrician, & Scopus database. The journal is now part of DST, CSIR, and UGC consortia.
Hi-Tech Medical College, Bhubaneswar, Orissa
Website: www.ijphrd.com
7. Dr Abhiruchi Galhotra, Additional Professor, Community and Family
© All rights reserved. The views and opinions expressed are of the authors and not
Medicine,
of the Indian Journal of Public Health Research & Development. The journal does
AII India Institute of Medical Sciences, Raipur
not guarantee directly or indirectly the quality or efcacy of any product or service
8. Prof Deepti Pruthvi, Pathologist, featured in the advertisement in the journla, which are purely commercial.
SS Institute of Medical Sciences & Research Center. Davangere, Karnataka
9. Prof G S Meena, Director Professor, Editor
Maulana Azad Medical College, New Delhi Dr R K Sharma
10. Prof Pradeep Khanna, Community Medicine, Institute of Medico-Legal Publications
Post Graduate Institute of Medical Sciences, Rohtak , Haryana Logix Office Tower, Unit No. 1704, Logix City Centre Mall
11. Dr Shailendra Handu, Associate Professor, Sector- 32, Noida - 201 301 (Uttar Pradesh)
Phrma , DM (Pharma, PGI Chandigarh)
Printed, Published and Owned by
12. Dr. A.C. Dhariwal, Directorate of National Vector Borne Disease
Control Programme, Institute of Medico-Legal Publications
Dte. DGHS, Ministry of Health Services, Govt. of India, Delhi. Logix Office Tower, Unit No. 1704, Logix City Centre Mall
Sector- 32, Noida - 201 301 (Uttar Pradesh)
NATIONAL SCIENTIFIC COMMITTEE
1. Dr Anju Ade, Professor, Community Medicine Department, Published at
SVIMS, Sri Padamavati Medical College, Tirupati. Andhra Pradesh Institute of Medico-Legal Publications
2. Dr. E. Venkata Rao, Associate Professor, Community Medicine, Logix Office Tower, Unit No. 1704, Logix City Centre Mall
Institute of Medical Sciences & SUM Hospital, Bhubaneswar, Orissa. Sector- 32, Noida - 201 301 (Uttar Pradesh)
I
I
Indian Journal of Public Health Research &

Development
www.ijphrd.com
Contents
Volume 810, Number
Number 4 9 September 2019
October-December 2017
1. Knowledge, Attitude, Practice and Barriers for Self-care among Type 2 Diabetes Mellitus Patients in
Rural Nepotism
1. Detention, Tamil Naduand..........................................................................................................................................
Truancy as Predictors of Workplace Deviance in.....................................................................01 1
Aliya Jasmine, Ramesh Harihara Iyer
Service Organizations: India's Experience
2. Health
Sainath Status
Malisetty, of the Rabha
K Vasanthi Community: A Study in Goalpara District of Assam ........................................ 7
Kumari
Bhargab Das
2. A Comparative Study of Satisfaction of Midwives and Mothers of Adherence to Patient Rights..................................07
3. Acoustic
Maryam Soheily,Analysis of Infant
Akram Peyman, Cry Using
Beheshteh Multidimensional Voice Program―A Preliminary Study ............ 12
Tabarsy
Deepa N Devadiga, Remyasree T, Aiswarya Liz Varghese, Ananthakrishna T
3. Indian Diabetes Risk Score for Screening of Undiagnosed Diabetes...................................................................................13
4. An Analysis of Access to Primary Health Care Services: A Study in Jorhat District of Assam ................. 17
Individuals of Eluru City, Andhra Pradesh, India
Sampurna Khound
Chandrasekhar Vallepalli, K Chandra Sekhar, U Vijaya Kumar, P G Deotale
5. Adaptive Signal Enhancement in Clinical Cardiac Care Systems Using Normalized Median LMS Variants 23
4. Awareness and Predictors
Asiya Sulthana, of PCOD among Undergraduate Students ..............................................................................18
Md. Zia-Ur-Rahman
CAnn Mary Nelson, Lekha Viswanath, Anju Philip T
6. Evaluation of the Baby Friendly Hospital Initiative Programme in Two Hospitals Designated
“Baby-Friendly” in Kirkuk City,
5. The Effectiveness of Mindfulness on theIraq ..........................................................................................................
Reduction of Anxiety...........................................................................................2329
Fakher Abobaker Ahmed
and Depression of Divorced Women Gli, Dale Spence, Linda Johnston, Finoa Lynn, Richard Tubman, Ziad
Mohammad
Yasamin Hojatifar, Sadiq
Mina Hosein Zadeh, Fariborz Dortaj
7. The Combinatory the Effect of Healthy Educational Programs with Kinect Simulation Device on
6. A Study on Clinical Profile and Trend in Suicide Attempters in Psychiatry Consultation...............................................28
Learning some of Basketball Skills ............................................................................................................. 36
D Naveen Kumar
Mohammed Shihab Ahmed, Mayyadah Khalid Jasim
7. A8.
Study
Theof Organo-phosphorous
impact Compound
of Health Awareness Poisoning
Campaigns withSmoking
to Quit Reference(A
to....................................................................33
Case Study in Amman City) ............... 42
BloodRudaina Othman Yousif
Sugar and Pseudocholinesterase Levels
Nithinkumar S Kadakol, Sunilkumar S Biradar, Smitha M, Mallikarjun KBiradar
9. Active Ocular Involvement in Iraqi Patients with Behçet’s Disease ........................................................... 48
Yaser A.R.
8. Prevalence Nasser,Parasitic
of Intestinal Riyam Faihan Rashid,
Infections Dina
in School Shakir
Going Yasiry,
Children Mohammed Hadi Munshed Al-Osami,
in...........................................................................37
Faiq I. Gorial
Rural Areas of Hapur District, UP, India
KamyaVerma,
10. Effect ofKrati
Using R Varshney,
SimulationSanjeev Dimri, SMedia)
(Electronic P Garg in Learning of Some Basic Skills in Technical
Gymnastic for 2nd Grade’s Female Students ................................................................................................ 53
9. Study of Osteoporosis in Women of Malwa Region of Punjab............................................................................................41
Abeer Ali Hussein, Bashaer Hashim Abdul-Wahid, Nidhal Obaid Hamzeh
Veerendra Choudhary
11. Body Image and Physical Perception of Children with Precocious Puberty in Baghdad City ................... 59
10. The Adraa Hussein
Effectiveness Shawq, Eqbal Ghanim
of Mindfulness-Based AliTherapy on Reducing Internet...............................................................44
Group
Addiction and Increasing the General Health of Adolescent Girls
12. Health Workers Roles as Healthy Model: Concept and Instrument Developing ........................................ 63
Nasrin Rahimi Shadbad
Agustina Arundina Triharja Tejoyuwono, Lely Lusmilasari, Toto Sudargo
11. Role of Social Support and Coping Styles in Mental Health of Women Who Apply for Divorce..................................49
13. Assessment of Serum Glucose and its Correlation with the Pregnancy ...................................................... 69
Farhad Asghari, Hajar
Alaa Umran Musa Ramazannia
II
14. Building and Applying the Personal Values Measure for the Administrators of Sports Clubs and
Clubs for People with Disabilities from the Point of View of the Players of Some Games ....................... 74
Amal Adulameer Tuama, Methaaq ghazi
15. Qualitative Study of Family Planning (KB) Village Program’s Implementation in East Java
Province-Indonesia ...................................................................................................................................... 80
Annisa Ullya Rasyida, Iswari Hariastuti, Mardiyono, Iffah Udiana, Kuntoro, Haryono Suyono, Sri Widati
16. Model of Peer Intervention Assessment of Nutritional Educator in the Efforts to Change
Behaviour in Decreasing Overweight in Integrated Islamic Elementary Schools at Makassar .................. 85
Anto J. Hadi, Veni Hadju, Suriah, Rahayu Indriasari, Toto Sudargo, Mappeaty Nyorong, Masni
17. Association between Maternal Iron and Vitamin D with Risky Development of Autistic Children .......... 91
Ashraf M Osman, Hanan M Kamel, Emad A Abdel-Naem, Aliaa M Higazi, Noha Mahmoud Abdullah
18. Incidence and Risk Factors of Hypocalcaemia in Post Thyroidectomy Patients in Tikrit Teaching Hospital 95
Ayoub M. Zedan
19. The correlation between Knowledge and Experience of Nurses toward Triage Decision Making at
Lombok Nusa Tenggara Barat ................................................................................................................... 101
Baiq Fitrihan Rukmana, Ahsan, Kuswantoro Rusca Putra
20. Detection of mecA Gene in Methicillin-Resistant Staphylococcus hemolyticus Isolated from

Blood Cultures of Neonates in Baghdad ................................................................................................... 106
Butheina Mahamed Taha, Nadheema Hammood Hussein, Khetam H. Rasool, Sara Ali Jasem Maliki,
Jumaah Dakel Hussein
21. Oko Mama Culture Betel Nut Consuming Habit in Kupang District and its Effect toward
Salivary Ph and Flow Rate ........................................................................................................................ 110
Christina Ngadilah, Hari Basuki N., Rika Subarniati T.
22. Determination Safe Duration of Exposure to Benzene in Workers of Petrolium Processing Industrial
Laboratory in Indonesia by Using Noael of White Mice (Rattus norvegicus) .......................................... 115
Ermita Isnaeni Putri Susyanti, Abdul Rohim Tualeka, Pudji Rahmawati, Syamsiar S Russeng, Atjo
Wahyu, Ahsan, Dewi Kartikasari
23. Assessment the Relevance of Dental Aesthetic Index, Smile and Desire for Orthodontic
Treatment among Iraqi Teenagers ............................................................................................................. 121
Esraa S. Jasim, Zainab M. Kadhom, Noor F.K. Al Khawaja
24. Effects of BLS Education Using a Bed on the Quality of Chest Compression ......................................... 127
Eun-Kyung Lee, Sun-Young Jung
25. Aerobic and Anaerobic Bacteria in Tonsils of Different Ages with Recurrent Tonsillitis ........................ 132
Gulbahar F. Karim, Siham Sh. AL-Salihi, Qanat Mahmood Atya, Kasim Sakran Abass
26. Estimation of Heritability for Reproductive Traits and Newborn Mortality in Iraqi Buffaloes through the
Relationship of Dams with Daughters ....................................................................................................... 137
Hamza M. AL-Khuzai, Makki K. H. AL-Dulaimi, Zaid E. H. Zaini
27. Effect of Thyroid Hormone Abnormalities on Hemoglobin A1c in Hemodialysis

Patients Taking Erythropoietin .................................................................................................................. 141
Hanan L. Al-Omary, Zainab M. Alawad, Buraq Husseini
III
28. Efficacy of the Health Promotion Model-Based Intervention in Enhancing the Health Responsibility of
Middle School Female Student: A Randomized Controlled Trial ............................................................. 147
Hiba Abdul-Wahid Dawood, Afifa Ridah Aziz
29. Detection of Rotavirus Genotypes with Conventional PCR in a Group of Iraqi Children with
Acute Viral Gastroenteritis ........................................................................................................................ 153
Hiba Sabah Jasim
30. Effect of Adding Medicinal Plant Extracts to The Broiler Diets on Productive Performance .................. 159
Huda Q. Al-Himdany, Fadhil R. Abbas, Ahmed A. Allaw
31. Structural Behavior Analysis of Building Environment Automation System in Pharmaceutical Industries 164
Jacky Chin, Lin Shu-Chiang, Satria Fadil Persada, Ilma Mufidah, Choesnul Jaqin
32. The Impact of Radiation on Total Thrombocyte of Hospital Radiology Workers in Kupang .................. 170
Jannes Bastian Selly, Andreas Umbu Roga, Noorce Christiani Berek, Luh Putu Ruliaty, Jacob M. Ratu
33. Importance of Collaborative Intervention of Preconception Nutrition in Suppressing the
Stunting Case in East Nusa Tenggara, Indonesia ...................................................................................... 175
Jeffrey Jap, Sri Sumarmi, Nyoman Anita Damayanti
34. Evaluation of Folic Acid Content in the Pregnant Women ....................................................................... 180
Jinan Hussein Mutlag
35. Isolation, Identification and Antibiotic Susceptibility Testing of Bacterial Pathogens Causing
Seminal Fluid Infection in Human Males Admitted to the Infertility Centers in Najaf Province ............. 186
Jinan Mohammed Hussein, Anaam Jawad Alabbasy, Suhair Abdulkareem Al-Rammahi, Ahmed
Abdulridha Ameen Shlash
36. Conjecture of TSP Concentration and PM.10 through Measurement Dust Fall
(Study of Dust Dispersion from Special Roads for Coal Transport) ......................................................... 192
Junaidi1, Rahmawati, Muhammad Pahruddin, Agnes T Diana Nerawati
37. Development of Cardiovascular Complications in True Polycythemiavera Patients Influenced by
Increased Blood Viscosity ......................................................................................................................... 196
Kaliberdenko V. B., Kuznetsov E. S., Shanmugaraj K., Keerthanaa B., Al-Nsour J. M., Poleshchuk O. Yu.
38. Determination of Safe Concentration of Benzene Exposure in Workers in a Laboratory of
Oil Processing Industry in Indonesia ......................................................................................................... 201
Kharina Almira Djalali, Abdul Rohim Tualeka, Pudji Rahmawati, Syamsiar S Russeng, Atjo Wahyu,
Ahsan, Dewi Kartikasari
39. Functional Gastrointestinal Disorders in Pediatrics .................................................................................. 207

Khudhair Khalaf Shallal
40. Saponin Maintaining and Dose Determining in Carica Papaya Leaf Cookies as a
Breast Milk Booster (galactogogue) ......................................................................................................... 212
Krisdiana Wijayanti, Hertanto W. Subagio, Martha Irene Kartasurya, Sri Achadi Nugraheni
41. Factors Related to Competence in Prehospital Care ................................................................................. 217

Ns. Kristianto Dwi Nugroho, dr Setyawati Soeharto, Yulian Wiji Utami
42. Empowerment of Coastal Communities Through Systems Approach in the Field of Environmental
Health in Kendari City, Southeast Sulawesi Province, Indonesia ............................................................. 223
La Dupai, Nani Yuniar, Ruslan Majid, Arum Dian Pratiwi, Syawal Kamuluddin Saptaputra, Rahman
IV
43. Study the Level of Interlukin-2 During and after Treatment in Sputum of Iraqi Patients with
Pulmonary Tuberculosis ............................................................................................................................ 228
Liqa K. A. Alzubaidi, Nisreen Sherif Alyasiri, Luma yousif Mehdi
44. Warm Footbath Minimize Ostheo-arthritis Joint Pain on the Elderly in Surabaya’s Public Health Center 234
Muhamad Ibnu Hasan, Elida Ulfiana, Deni Yasmara
45. An Epidemiological Study on Common Types of Tuberculosis in Al-Najaf city ..................................... 240
Murtadha M. Hameed, Alaa S. Alattabi, Hassan M. Abolmaali
46. The Effect of Ammuntuli BijaTianang Na Beja-Beja Model on Knowledge, Motivation, and
Attitude of Pregnant Women’s Health Services in Jeneponto District, Indonesia .................................... 245
Mustamin, Ridwan Amiruddin, Sukri Palutturi, Stang, Risnah
47. A Study on New Frontier of Integrative Medicine on Social Media with Special Reference to Chennai City 251
N. Manivannan, G. Mythili
48. Implementation of Nutrition Education to Knowledge, Behaviour, and Performance of

Junior High School Children ..................................................................................................................... 257
Nanik Suhartatik, Sri Handayani, Agatha Jumiati
49. IL-18 -137G/C (rs187238) Gene Polymorphisms in Pulmonary Tuberculosis Iraqi Arab Patients .......... 263
Nawal Mohammed Utba
50. Risk Factors Related to Diabetes Mellitus ................................................................................................ 269

Noor Diani, Dhian Ririn Lestari
51. Association of Hunting Behavior and Malaria Incidence: A Cross Sectional Study on Nuaulu
Tribe Community in Mesoendemic Area of Malaria ................................................................................ 274
Nur Baharia Marasabessy, Oedojo Soedirham, Yoes Prijatna Dachlan
52. Determination of Ammonia Gas Safe Concentration in Chicken Farm Workers in Lembak Village,
South Sumatra Indonesia ........................................................................................................................... 279
Putri Arianto, Abdul Rohim Tualeka, Desheila Andarini, Pudji Rahmawati, Syamsiar S Russeng, Atjo Wahyu
53. Body Image among Postnatal Primparous Women in Maternity Hospitals in Baghdad City ................... 285
Rafah Raad Abdul-Salam, Suhad Hikmat Khairi
54. Role of Adropin in Women with Polycystic Ovary Syndrome ................................................................. 291
Rana Ali Hamdi, Hanan Naama Abas, Fatin Abdul Aziz Alsaeed
55. The Alcoholic Extract of Carrot (Daucus carota L.) Seeds as Antioxidant in Male Albino
Mice treated with H2O2 .............................................................................................................................. 297
Roaa M. Al-Saadi, Sabah A.R.Al-Obaidi, Waleed H.Yousif
56. The Ethanolic Extract of Ajwa Fruits Inhibits Nephrotoxicity and Deterioration of Some Blood
Biochemical Properties Induced by Gentamicin in Male Rats .................................................................. 302
Saher Mahmood Jwad, Wijdan Kamal Noor, Bushra Abbas ALzubaidi
57. Utilization of Lactobacillus Acidophilus FNCC-0051 Microencapsulation: Potential Benefit of

Giving Combination of Sodium Alginate and Gelatin to Attributes and Role of Probiotic
Against Staphylococcus Aureus ................................................................................................................ 308
Arumentin Diana, Tutiek Purwanti, Isnaeni
V
58. The Correlation of Sleep Quality Factors in Overweight Adolescents in a Developing Country ............. 314
Nur Faizah, Elida Ulfiana, Setho Hadisuyatmana
59. Carbon Emission Disclosure in Manufacturing Companies in Indonesia ................................................. 320

Bangun Tri Saputro, Basuki
60. The Effectivity of Brain Gym and Memory Games Therapy for Improving Cognitive Function in
Elderly People with Dementia ................................................................................................................... 326
Maulana Arif Murtadho, Elida Ulfiana, Setho Hadi Suyatmana
61. Effects of Intensity of Reading Short Stories Activites and Retelling the Story on
Elderly Cognitive Impairment ................................................................................................................... 332
Devi Ayu Kumalasari, Hanik Endang Nihayati, Elida Ulfiana, Rista Fauziningtyas
62. The Influence of Dhakonan Games to Impede Dementia in Elders .......................................................... 338
Mita Nur Lathifah, Joni Haryanto, Rista Fauziningtyas
63. The Effect of Indomethacin and Ambon Banana Stem Extract (Musa paradisiaca var. sapientum) on
Ileum Histopathology of Indomethacin-induced Rats (Rattus novergicus) .............................................. 343
Dian Afikasari, Kadek Rachmawati, Romziah Sidik
64. Attenuation of Eimeria tenella with Immersion Various Concentration of Formaldehyde in

Inducing Protective Immunity after Challenge Test by Featuring Macroscopic and Microscopic Caecum 349
Rizki Rohmah Armiani, Muchammad Yunus, Chairul Anwar Nidom
65. The Potential of Immune Response Improvement through Brucella abortus Outer Membrane Protein and
Whole Brucella abortus S19 Vaccinations on White Pulp Diameter of Lepus nigricollis ....................... 355
Muhammad Ardiansyah, Chairul Anwar, Imam Mustofa
66. The Effect of Adding Moringa Leave (Moringa oleifera) to Male Broiler Feed ...................................... 360
Mien Qurrati A’yuni Muis, Kadek Rachmawati, Mohammad Anam Al Arif
67. The Effect of Vitamin on Wistar Rats’ Testicle s Exposed to Lethal Insecticide ...................................... 365
Gabriella Ayu Pitaloka, Kusnoto, Thomas Valentinus Widiyatno
68. The Potency of Formalin in Atenuation of Pathogenicity in Eimeria Tenella at the Caecum of
Broiler Chicken ......................................................................................................................................... 370
Enik Setyowati, Muchammad Yunus, Dadik Rahardjo
69. Fasciolosis Prevalence on Several Cattle Breeds ...................................................................................... 376

Kurnia Winda Pratiwi, Setiawan Koesdarto, Nenny Harijani
70. BPJS Kesehatan Patients Satisfaction on Pharmaceutical Services in Community

Health Center (PUSKESMAS)―South Surabaya Area ............................................................................ 380
Assyifa Ilmi Auliya, I Nyoman Wijaya, Catur Dian Setiawan, Gesnita Nugraheni
71. The Effect of Lower Extremity Massage with Lavender Essential Oil on Decreasing
Blood Pressure in Elderly with Hypertension in UPTD Griya Werdha Surabaya .................................... 386
Fatih Haris Maulana, Joni Haryanto, Elida Ulfiana
72. Fine Motor Skill and Cognition Development in Children with Autism Using Finger Painting Method 392
Okgi Tiara, Ah Yusuf, Rr. Dian Tristiana
VI
73. The Effectiveness of Afternoon Sunbath in Improving Elderly Sleep Quality ......................................... 398
Zaenal Abidin, Harmayetty, Deni Yasmara
74. Family Burden and Coping in Family Caregivers of Patients with Schizophrenia ................................... 404
Winda Kusumawardani, Ah.Yusuf, Lailatun Ni’mah
75. Antibacterial Activities of Extract n-Butanol-Methanol (1:1) Filtrat of the Fermentation Results of
Streptomyces sp. B10 Against Mycobacterium tuberculosis H37Rv: An Experimental Study ................. 409
Septa Devi Adetya Putri, Isnaeni, M. Faris Adrianto
76. The Correlation between Goat Maintenance Management to the Incidence of

Gastrointestinal Parasite Infections ........................................................................................................... 415
Zahrotul Hurriyyah, Nunuk Dyah Retno Lastuti, Lianny Nangoi
77. Histopathology of Esophagus and Crop of Pigeon (Columbia livia) Infected by Trichomonas gallinae 420
Aprilia Eva Widiawati, Muchamad Yunus, Thomas V Widijatno
78. The Effectiveness of Back Exercise for the Reduction of Low Back Pain Prevalence on the
Emergency Room Nurses .......................................................................................................................... 427
Dinda Nur Fajri Hidayati Bunga, Harmayetty, Candra Panji Asmoro
79. The Effect of Breeding Management on the Prevalence and Trematode Infection Degree in Calves ...... 433
Haris Setiawan, Kusnoto, Mas’ud Hariadi
80. The Effectiveness of Cynodon dactylon Leaf Extract as Hepatoprotector in Liver Damage of
Hyperglycemic Mus musculus ................................................................................................................... 439
Ade Mahendra Putra, Retno Sri Wahjuni, Rahaju Ernawati
81. The Relationship between the Forms of Social Interactions and the Life Quality of the Elderly ............. 445
Muthmainnah, Elida Ulfiana, Setho Hadisuyatmana
82. Educational Game Methods of Attaching Images to Slide Calendar towards School-Age Children’s
Knowledge and Attitudes on Choosing Healthy Snacks ........................................................................... 451
Adzan Fachrurrozi, Tiyas Kusumaningrum, Praba Diyan Rachmawati
83. The Correlation between Dementia Severity and Caregiver Burden Level in Community ...................... 457
Eryin Sulistyani, Joni Haryanto, Makhfudli
84. An Exploratory Study in the Indonesian Archipelago: Are There Influenza B Virus
(B-Victoria Sub-Type) in the Bat’s Respiratory Organs? .......................................................................... 462
Muhammad Anas Wildanu Rahman, Chairul Anwar Nidom, Setya Budhi
VII
Indian Journal of Public Health Research & Development, September 2019, Vol.10, No. 9 1
Knowledge, Attitude, Practice and Barriers for Self-care

among Type 2 Diabetes Mellitus Patients in Rural Tamil Nadu
Aliya Jasmine1, Ramesh Harihara Iyer2

1
Assisstant Professor, 2Associate Professor, Dept. of Community Medicine, Sri Ramachandra Medical
College & Research Institute, Porur, Chennai
Abstract
Objective: To assess the knowledge, attitude, practice and barriers for self-care among type 2 diabetes
mellitus patients attending a rural health centre in Tamil Nadu.
Methodology: This was a part of a quasi-experimental study. Diabetes patients attending the rural health
centre were included. A structured questionnaire was used to assess the knowledge, attitude, practice and
barriers against self-care.
Results: Most of the study participants had good (76.6%) or moderate knowledge (6.5%). Attitude (96.1%)
and practice (85.7%) towards the disease was poor. The most commonly reported barrier for self-care was
either lack of awareness or lack of time.
Conclusion: Improved self-care practices will minimize morbidity and mortality associated with Diabetes.
This study has highlighted lack of awareness as a major barrier for self-care. This has to be addressed by
improving health literacy in the community. Developing Behavioural Change Communication programmes
need to be developed to address poor awareness in both clinical and community settings.
Keywords: attitude, barriers, Diabetes, knowledge, practice, self-care.
Introduction areas. The rising burden of diabetes-related health costs

in a country where most of the health expenditure is out
Diabetes Mellitus is a group of chronic metabolic of pocket expenses is also a concern.
disorder causing hyperglycemia or raised blood sugar,
which eventually leads to serious damage involving Modifiable risk factors associated with the
various parts of the body. 1 It is a major public health complications are unhealthy diet, physical inactivity,
problem of the 21st century. Currently, there are 425 obesity, hypertension, poor medication compliance.
million people with diabetes and by 2045 this number is Complications can be prevented or delayed by improving
predicted to increase to 629 million. The largest increase health literacy regarding these modifiable risk factors.
in prevalence will take place in developing economies.
Awareness in rural population is poor with many
India has around 73 million people living with diabetes.2 misconceptions about the disease. Most of these patients
Indians present with diabetes one or two decades earlier are unaware about the various complications that occur
when compared with their western counterparts. The age in diabetes. Knowledge of Diabetes can play a crucial
of onset in India has been shifting towards ever-younger role in improving self-care practices and reducing the
people within the past decade.3 disease related complications by better care and early
identification.4
Diabetes is responsible for various multi-systemic
complications causing diabetic nephropathy, diabetic The necessity for greater awareness regarding
neuropathy, diabetic retinopathy, foot ulcers and prevention, diagnosis, risk factor control and disease
gangrene leading to amputations, increased risk for management has been supported from previous KAP
cardiovascular disease and stroke. The current healthcare studies. 5 KAP levels among people living with diabetes
system in India faces a major challenge owing to the need to be investigated to aid in future development of
the increasing trend of Diabetes in both urban and rural programs and techniques for effective health education.
2 Indian Journal of Public Health Research & Development, September 2019, Vol.10, No. 9
Methodology Knowledge Assessment: The mean knowledge score of

the study population was 7.4 ± 2.14. The range obtained
This study is a part of a quasi-experimental study. It in this study was 2 to 11, with 14 being the maximum
was done in the Primary Health Centre, Nemam belonging score. Among the 77 participants, 5 (6.5%) had good
to Poonamallee block in the Thiruvallur district, Tamil knowledge, 59 (76.6%) had moderate knowledge and
Nadu. Type 2 Diabetes Mellitus patients who have been 13(16.9%) had poor knowledge.
diagnosed to have the disease for at least 6 months and
have been enrolled in the Non-Communicable Disease Majority of them were aware of the symptoms
register at PHC, Nemam were included in the study. As of DM, need for diet modification and symptoms of
77 subjects fulfilled the inclusion criteria and were ready Hypoglycemia. Only 32.5% of the study subjects
to participate, they were included in the study. were aware of the complications of DM. Only a small
proportion of participants aware of the need for regular
Written informed consent was obtained from all the foot care (16.9%), oral care (11.7%) and eye care (11.7%).
participants. A structured questionnaire was developed Although awareness of foot care was low, 51.9% were
to assess knowledge, attitude, practice and barriers for aware of diabetic foot. Details are given in Table 1.
compliance to self-care among the type 2 DM patients.
KAP scoring: There were a total of 14 items to assess Table 1: Knowledge Assessment of DM patients
knowledge, 7 items to assess attitude and 13 items to attending a rural health centre
assess practice. DM knowledge was scored by assigning
Correct
one point for each correct response (total score=14). We S. Knowledge assessment items
response
considered a score of 10-14 as ‘Good Knowledge’, a No. n = 77
n (%)
score of 6-9 as ‘Moderate Knowledge’ and 0–5 as ‘Poor
1. What is DM? 59 (76.6%)
Knowledge`. Attitude responses were summarized and
a score of 0–3 was considered ‘Negative Attitude’ and a 2. Causes of DM 28 (36.4%)
score of 4-7 as ‘Positive Attitude’. Practice was assessed 3. Risk factors of DM 34 (44.2%)
similarly, each question was given 1 point for correct 4. Symptoms of DM 51 (66.2%)
practice and 0 point in case of incorrect practice. A score 5. Complications of DM 25 (32.5%)
of 0-6 was considered as ‘Poor Practice’ and a score of
6. DM treatment 71 (92.2%)
7–12 was considered as ‘Good Practice’.
7. How can DM be diagnosed? 77 (100%)
Permission was sought from the concerned authorities 8. Symptoms of hypoglycaemia 59 (76.6%)
to conduct the study at the Primary Health Centre. 9. Effect of smoking on DM 38 (49.4%)
10. Foot care in DM 13 (16.9%)
Results 11. Warning signs of diabetic foot 40 (51.9%)
A total of 77 participants were included in the study. 12. Diet control in DM 56 (72.7%)
Among them, 42.3% were male. More than half of the 13. Oral care in DM 9 (11.7%)
patients (55.1%) were more than 55 years. Illiteracy was 14. Eye care in DM 9 (11.7%)
high (47.4%) in the study population. Occupation wise
most of the study subjects were unemployed (32.6%). Attitude Assessment: The mean attitude score was 1.7
Only 21.8% of the participants had family history and 16 ± 1.02. Out of 77 participants, 74 (96.1%) had negative
(20.5%) participants had Diabetes for more than 5 years. attitude and only 3 (3.9%) had positive attitude towards
self-care.More than half of the study participants had
According to the KAP scoring, only 5 (6.5%) had a negative attitude towards diet modification (76.6%),
good knowledge and most (76.6%) of the participants regular check-up (89.6%), medication compliance
had moderate knowledge. Majority (96.1%) of the (79.2%) and exercise (84.4%). Most of the participants
participants had a negative attitude towards the disease had positive attitude towards monitoring weight (44.2%)
and self-care practices. Similarly most of them (85.7%) and avoiding tobacco use and smoking (49.4%). Details
reported poor self-care practices. are given in Table 2.
Table 2: Attitude among DM patients attending a rural health centre (n = 77)
S. No. Attitude Positive n (%) Negative n (%)

1. Diabetics should watch their weight 34 (44.2%) 43 (55.8%)
2. Diet modification is not required when taking OHA 18 (23.4%) 59 (76.6%)
3. Is it important to check blood sugar regularly? 8 (10.4%) 69 (89.6%)
Is it okay to stop medications without telling the doctor when the
4. 16 (20.8%) 61 (79.2%)
blood sugar is under control?
5. Do you feel bothered to take medications daily 6 (7.8%) 71 (92.2%)
6. Do you think smoking causes poor glycemic control? 38 (49.4%) 39 (50.6%)
7. Do you think regular exercise can help control blood sugar? 12 (15.6%) 65 (84.4%)
Practice Assessment: Similar to the attitude, 11 participants reported good self-care practices (14.3%) and 66
(85.7%) reported poor practices. The mean score was 4.2 ± 1.98. Although attitude towards regular blood sugar
check-up was poor, 88.3% reported monitoring their blood sugars regularly at the primary health centre. Very few
exercised (15.6%) and monitored their weight (24.4%) regularly. Of the 77 individuals, 50 (64.9%) study subjects
reported to have not forgotten to take medication in the last 2 weeks 53(68.8%) participants reported to carrying
medications while travelling. Details are given in Table 3.
Table 3: Practice assessment among DM patients attending a rural health centre (n = 77)
S. No. Practice Good practice n(%) Poor practice n(%)

1. Regular blood sugar checkup 68 (88.3%) 9 (11.7%)
2. Regular physical exercise 12 (15.6%) 65 (84.4%)
3. Check body weight regularly 19 (24.4%) 58 (74.4%)
4. Hypoglycemia management 59 (76.6%) 18 (23.4%)
5. Regular eye checkup 25 (32.5%) 52 (67.5%)
6. Regular dental checkup 3 (3.9%) 74 (96.1%)
7. Self inspection of feet 10 (13%) 67 (87%)
8. Use of footwear 40 (51.9%) 37 (48.1%)
9. Diabetic diet 35 (44.9%) 42 (53.8%)
10. Tobacco use 25 (32.5%) 52 (67.5%)
11. Alcohol 16 (20.7%) 61(79.3%)
12. Compliance to treatment 50 (64.9%) 27 (35.1%)
13. Carry medications while travelling 53 (68.8%) 25 (31.2%)
Barriers for self-care practices: Lack of awareness was reported as the most common barrier for foot care (83.1%),
exercise (45.5%), oral care (89.6%) and eye care (35.1%). Lack of time was most common barrier for dietary
modification (35.1%), blood sugar check-up (48.1%) and second common barrier for exercise (32.5%). Lack of
healthcare facility was reported as a barrier for regular eye and blood sugar check-up.
The details are given in Figure 1 and Figure 2.

Figure 1: Barriers for foot care practice, exercise and diet among DM patients attending a rural health centre
Figure 2: Barriers for oral care, eye care and blood sugar checkup among DM patients
Discussion similar to our study. In addition about 37.2% participants

were over 50 years of age, which is also similar to our
Type 2 diabetes mellitus is a challenging non
study. 6 Similar findings were observed in a study done by
communicable disease requiring judicious care and self
Shah VN et al and similarly, in a study done by Alsous M
management. For this purpose there is a need to create
et al, majority of the participants were beyond 40 years
awareness among the diabetic patients regarding various
of age (25.8%) and females predominantly participated
aspects of clinical care including the consumption of
in this study (69.3%). 7 8
drugs, oral hygiene, foot care, periodical follow up etc.,
This study was carried out among 77 diabetic patients In our study, we elaborately assesed the level of
in the primary health center. Majority of the patients knowledge, attitude and practices towards diabetes and
belonged to the age group of 56 – 75 years (47.4%) and self-care. We observed that majority of the participants
were aware of symptoms of diabetes and the need for diet
were females (56.4%). The educational status of our
modifications. However, only 32.5% of the participants
study participants was 51.3% while majority of them
were aware of complications of diabetes mellitus and
(73.1%) were employed. The duration of type 2 diabetes very negligible percentage of participants were aware
mellitus in our study population was less than 5 years in of foot care (16.9%), oral care (11.7%) and eye care
78.2% of the participants. In a study done by Fatema K (11.7%). Similar findings were observed in the study by
et al, majority of the participants were females (58%) Shah VN et al.2
The assessment of attitude level among the study members regarding the disease and the importance of
participants showed that majority of the participants non medical therapeutic activities like exercises and diet
had negative attitude towards diet modifications, regular plans. Therefore in this context a detail assessment of the
checkups and compliance with medication and exercise. knowledge attitude and practices is necessary.
However, they had a positive attitude towards monitoring
weight and avoiding tobacco and smoking. This reflects Our study demonstrated that although patients had
that the participant’s attitude towards care and self- adequate knowledge, when it comes to attitudes and
practices, they were seen to be lacking in these parameters.
management and diabetes was considerably poor. In a
Moreover the barriers to effective implementation of
study done by Shah VN. et al, 65% of the participants felt
self care practices seemed to be increase in the lack of
that they were responsible while approximately 39.07%
awareness. 11
of the participants felt that doctors were responsible for
diabetic care and management. 7 In another study done Considering the fact that self care practices play a
by Alsous M et al 46.3% of the participants had positive significant impact in effective diabetes management, it is
attitude towards the diabetes care.8 the important for the care providers to consider imparting
adequate education to these patients on the self care
With regards to the prevalence of self care practices
aspects. It is important that they take time in evaluating
among diabetes patients, majority of the participants had
the patient’s level of awareness and their false notions
regular blood checkups and appropriate use of footwear.
and perception, to make specific and realistic targets
Similarly about 44.9% of the participants followed
for effective diabetic control. The health care provider
diabetic diet and 68.8% were compliant to treatment
should make inclusive decision making with a good
and carried medications even while travelling. In our
team of doctors, nutritionist, psychotherapist, podiatrist,
study, we also assessed the barrier for self care practices
and last but not least the patients and their immediate
among these patients on various parameters. It was
care provider. Each patient may be provided with a tailor
observed that majority of the participants felt that lack
made, customized regimen for diet and exercises which
of awareness was a key barrier for inadequate foot care
may result in effective implementation and practically
(83.1%), exercises (45.5%) and diet (14.3%). Moreover,
achievable diabetic care goals. 12 13
when we assessed the barriers for monitoring other
complications, lack of awareness was reported as the Ethics Clearance: Ethical clearance was taken from Sri
important factor for poor oral care (89.6%) while lack Ramachandra University Institutional Ethics Committee.
of health facility was cited as an important reason for (Ref: CSP-MED/12/APR/01/04)
inadequate eye care (45.5%). With regards to periodical
monitoring of blood sugar. lack of time was the most Source of Funding: Self-funded
common reason cited for lack of compliance (48.1%).
Conflicts of Interest: There are no conflicts of interest.
In a study done by Shah VN. et al about 70.2% of the
participants examined sugar level was periodically and
References
56% of the participants underwent foot care examination
periodically, similar to our study. 7 However in a study 1. Tinsley R. Harrison. Harrison’s principle of
done by Alsous M et al 37.7% of the participants did not internal medicine. 16th ed. McGraw-Hill;2005:p
practice periodical exercises, similar to our study.8 2151-80.
Self care of diabetes in essential component 2. IDF Diabetes Atlas, 8th edition. International
management of Type 2 Diabetes mellitus. Self care Diabetes Federation, 2017.
activities consist of a set of behavior which improves 3. Deepa R, Sandeep S, Mohan V. Abdominal
the diabetic status and prevents complications. These obesity, visceral fat 5. and Type 2 diabetes -
activities include following a regular and strict diet “Asian Indian Phenotype”. In: Mohan V, Gundu
plan, regular exercises, self glucose monitoring, foot HR Rao, editors. Type 2 diabetes in South Asians:
care and compliance to medications and checkups. 9 10 Epidemiology, risk factors and prevention. New
In order to achieve effective self care and management, Delhi: Jaypee Brothers Medical Publishers; 2006.
it is important to educate the patients and their family p. 138-52.
4. Fatema K, Hossain S, Natasha K, Chowdhury 8. Alsous M, Jalil MA, Odeh M, Kurdi RA, Alnan
HA, Akter J, Khan T, Ali L. Knowledge attitude M. Public knowledge, attitudes, and practices
and practice regarding diabetes mellitus among towards diabetes mellitus: A cross sectional study
Nondiabetic and diabetic study participants in from Jordan. PLOS one 2019;14(3):e0214479
Bangladesh. BMC Public Health. 2017 Apr
9. Alsous M, Jalil MA, Odeh M, Kurdi RA, Alnan
26;17(1):364. doi: 10.1186/s12889-017-4285-
M. Public knowledge, attitudes, and practices
9. PubMed PMID: 28446194; PubMed Central
towards diabetes mellitus: A cross sectional study
PMCID: PMC5406895.
from Jordan. PLOS one 2019;14(3):e0214479
5.
Norris SL, Engelgau MM, Narayan KV.
10. Mikhael EM, Hassali MA, Hussain SA, Shawky
Effectiveness of self-management training in type
N. Self-Management knowledge and practice of
2 diabetes a systematic review of randomized
type 2 Diabetes Mellitus patients in Baghdad,
controlled trials. Diabetes Care. 2001;24(3):561–
Iraq: a qualitative study. Diabetes Metab Syndr
587. doi: 10.2337/diacare.24.3.561.
Obes 2019;12:1-17
6. Fatema K, Hossain S, Natasha K, Chowdhury
11. Glasgow RE, Strycker LA. Preventive care practices
HA, Akter J, Khan T et al. Knowledge, attitude
for diabetes management in two primary care
and practice regarding diabetes mellitus among
samples. Am J Prev Med. 2000 Jul; 19(1):9-14.
non diabetic study participants in Bangladesh.
BMC Public Health 2017;17:364. 12.
Shrivastava SR, Shrivastava PS, Ramasamy
J. Role of self care in management of Diabetes
7. Shah VN, Kamdar PK, Shah N. Assessing the
Mellitus. J Diabetes Metab Disord 2013;12:14
knowledge, attitudes and practice of type 2
Diabetes among patients of Saurashtra region, 13. Anderson RM. Patient empowerment and the
Gujarat. Int J Diabetes Dev Ctries 2009;29(3):118- traditional medical model. A case of irreconcilable
122 differences? Diabetes Care. 1995; 18(3):412-5.
Health Status of the Rabha Community: A Study in Goalpara

District of Assam
Bhargab Das
MPhil Research Scholar, Dibrugarh University, Assam
Abstract
Health is s state of complete physical, mental and social well being, not simply the absence of diseases
or infirmity (WHO, 1948). On the other hand, health status is a concept with the help of which health can
be measured. Health status in physical sense influencing factors like height, weight, nutrition, agility and
flexibility or ability to move, sanitation and compliance with prescribed medications, treatment, activity
etc. The present paper attempts to analyze the health status of the Rabhas, one of the most backward tribal
communities of Assam. The necessary data to fulfill the objective of the present study have been collected
through a structured household questionnaires prepared for the study. To assess the health status among Rabhas
various standard health indicators like infant mortality rate, Maternal Mortality Rate, Crude Death Rate,
Crude Birth Rate, Morbidity Prevalence Rate etc. are used. The results of the study reveal that status of
health of the Rabhas is not satisfactory. The Infant Mortality Rate of the community is found as 47.17 per
thousand live births which is higher than the state average and national average. The Maternal Mortality
Rate of the community is also found much higher than the national average and state average. Therefore
in order to improve the health status of the Rabhas the health infrastructure, delivery system, manpower,
resources all has to be strengthen enough so that it can be utilized the community people in a proper way.
Keywords: Health Status, Rabhas, Goalpara.
Introduction The health status of Assam is not satisfactory. The

conventional health indicators put Assam in the band
Health is s state of complete physical, mental and of poor-performing states along with the other such
social well being, not simply the absence of diseases states of north and central India2. Assam has not been
or infirmity (WHO, 1948). Health system includes all able to achieve the desired health outcomes with very
activities whose primary purpose is to promote, restore high infant mortality rate and maternal mortality rate.
or maintain individuals physical, mental and social well Poor literacy rate, low per capita income and improper
being (WHO, 2000). On the other hand, health status is a water and sanitation facilities etc. all have contributed to
concept with the help of which health can be measured. some extent in some form to the underdevelopment of
Health status in physical sense influencing factors like the health sector3.
height, weight, nutrition, agility and flexibility or ability
to move, sanitation and compliance with prescribed Profile of the Tribe: One of the scheduled tribes in
medications, treatment, activity etc. Some parameters the plain districts of Assam, the Rabhas belong to the
of health status are sex ratio, density of population, life Indo-Mongoloid group of people and have similarities
expectancy, mortality, morbidity, birth rate, nutrition and with other members of Boro group such as Garo, Mech,
access to health care system1. Kachari and Hajong. The Rabhas are widely concentrated
in the districts of Goalpara, Baksa, Kamrup, Udalguri
and Kokrajhar of Assam. Besides Assam, they are also
Corresponding Author:
found in Meghalaya, Manipur, West Bengal, Bangladesh
Bhargab Das
and Nepal. According to 2011 census the total Rabha
MPhil Research Scholar,
population of Assam is 296,189 which constitute 0.95
Dibrugarh University, Assam
percent of the total population and 7.63 percent of total
Email: bhargabdas.sorbhog@gmail.com
ST population of the state. Among the districts, Goalpara Objective

has the highest number of Rabha population with 35.03
1. To analyze the health status of the Rabhas of
percent (103,757) of total Rabha population of Assam
Goalpara district of Assam.
live there followed by Kamrup (R) and Udalguri districts
with 30.73 percent (91,034) and 10.42 percent (30,873)
Methodology
of total Rabha population live there respectively (Census
of India, 2011). According to the Report of Assam Mahila The methodology to be followed in the study is
Samata Society (AMSS) the superstitious evil practice of outlined below.
witch hunting is very common among the Rabhas. Witch
Sampling Design: The samples for the study have been
hunting is a form of gender violence, much ugly; less
drawn by following multi-stage sampling technique
discussed and largely overlooked 4. Lack of education using both random and purposive methods of sampling.
and lack of availability of access to a standard of health
care facilities perpetuated the presence of witch hunting Selection of District: In the first stage we selected the
practices5. Again a study of Assam Institute of Research appropriate district for the collection of the samples. For
for Tribal and SC reveals that the morbidity rate among the present study Goalpara district of Assam has been
selected purposively as the sample district as it contains
the Rabhas is very high. Thus it is very essential and
the highest numbers of Rabha population of Assam.
important to study the health status of the community According to 2011 census, 35.03 percent of the total
in details. Rabha population of Assam live in Goalpara district.
Profile of the Study Area: The present study is Selection of Revenue Circle: The selected district has
conducted in the Goalpara district of Assam. Goalpara is been further classified into 5 Revenue Circles. They are
one of the oldest districts of Assam which was originally Matia, Rangjuli, Balijana, Lakhipur and Dudhnoi. From
created by the British in 1876. The total geographical these 5 Revenue Circles Balijana, Matia and Dudhnoi
area of the district is 1824 square kilometers. Presently have been selected purposively as sample Revenue
the district shares the common boundaries with Dhubri Circles as these three Revenue Circles contain the
highest number of Rabha villages.
district on the west; Kamrup district on the east;
Brahmaputra River on the North and East Garo Hill Selection of Development Blocks: Balijana Revenue
district, Meghalaya on the south. The district has five Circle has two development blocks namely Kharmuja
revenue circles with eight development blocks. The and Balijana of which Balijana has been selected as it
revenue circles are Balijana, Dudhnoi, Lakhipur, Matia has more Rabha villages than Kharmuja. Again Matia
and Rangjuli. Goalpara district occupies 11 towns and Revenue Circle has two development blocks i.e. Matia
and Krishnai of which Krishnai development block has
829 villages (District Census Handbook, Goalpara).
been selected purposively as it contains more Rabha
According to 2011 census the total population of the villages than Matia development block. Again from
Dudhnoi Revenue Circle Kuchdhowa development
district was 1,008,183 of which 5, 13,292 (50.91 percent)
block has been selected as it is the only development
were male and 4, 94,891(49.09 percent) were female. Out
block of the revenue circle.
of the total population 86 percent population live in rural
areas and only 14 percent live in urban areas. The district Selection of Villages: Next step involves the selection
has 45,094 SC population and 231,570 ST population. of the sample villages from each selected development
The population density of the district is 553 (census of block. Here we selected two Rabha villages from each
development block randomly. Therefore a total of
India, 2011).The main communities living in the district
six Rabha villages are selected for our present study.
are Boro, Rabha, Hajong, Garo and Miri. Among these
Here a village containing more than 50 percent Rabha
communities Rabha is the most dominant one. population is defined as Rabha village.
In 2016, the government of India named Goalpara Selection of Households: Finally from each of the
district of Assam as one of the country’s 250 backward sample villages 20 percent of total Rabha households
districts6. It is one of the 11 districts of Assam currently in each of the villages were selected randomly as the
receiving fund from the Backward Regions Grant Fund sample households for investigation. A total of 276
Programme. households were covered by the study.
Table 1: Design of the Sampling
Sample Sample Total Number of Number of Sample

Name of the
District Revenue Development Households in Sample Households (20% of
sample villages
Circles Blocks Villages total households)
Gendabari 234 46
Balijana Balijana
Saharia 315 62
Kachumari 123 24
Goalpara Matia Krishnai
Rangdam 297 59
Nishangram 201 40
Dudhnoi Kuchdhowa
Rong Rong Para 224 44
Survey Tools: The necessary data to fulfill the objective of D0

IMR = × 1000
the present study have been collected through a structured B
household questionnaires prepared for the study. For the Where, D0 = Number of deaths within one year of
objective primary data relating to the health status of the any reference period
sample households have been collected and analyzed
by using simple statistical technique of percentage and B = Total number of live births during the same
presented in tables and diagrams. To assess the health reference period.
status among Rabhas various standard health indicators
In the present study Infant Mortality Rate of the
like infant mortality rate, Maternal Mortality Rate, Crude community is found as 47.17 per thousand live births
Death Rate, Crude Birth Rate, Morbidity Prevalence which is higher than the state average of 44 and national
Rate etc. are used. average of 34 in 2016 as per the NITI Ayog data. Thus
we can say that IMR of the Rabha tribe is much higher
Results and Discussions than the state and national average.
The WHO defined health as “a state of complete Maternal Mortality Rate: Maternal Mortality or
physical, mental and social well being and merely the death due to cause related to pregnancy and child birth,
absence of disease or infirmity.” Poor health leads is another key heath outcome indicator which has a
to capability deprivation and poverty. Again poverty wider capability implication. Maternal death is defined
leads to low standard of living, malnutrition and lack by WHO as “the death of women while pregnant or
of basic amenities. So good health is very important for within 42 days of termination of pregnancy from any
all round development of the people. Health indicators cause related to or aggravated by the pregnancy or
are quantifiable characteristics which describe the heath its management but not from accidental or incidental
status of a particular population. These indicators are cause.” Mathematically, MMR is defined as
basically used by governments to guide health policy.
M0
In this section an attempt has been made to analysis the MMR = × 100000
B0
achievements in health among the Rabhas with the help
Where, M0 = All maternal deaths occurring within a
of different standard health indicators.
reference period.
Infant Mortality Rate: The Infant Mortality Rate is a very
B0 = Total number of live births during the same
important indicator that represents Human Development.
reference period.
It is also the most important component of mortality that
can represent well being of human beings. It is used as a In the present study, 1 maternal death has been found
proxy to the life expectancy variable when data on life during the period of 5 reference years and hence 0.2
expectancy at birth is not available. According to SRS, maternal deaths per year. Thus the Maternal Mortality
the Infant Mortality Rate is the number of children dying Rate of the community is found 943 per 100000 live births
before their first birthday. Mathematically, the Infant which is much higher than the national average of 130 and
Mortality Rate can be defined as: state average of 237 in 2014-16 as per NITI Ayog.
Crude Death Rate: Crude Death Rate is another changes due to migration of people from one place to
important indicator of mortality. It can indicate the another place. Natural increase in population is defined
present heath achievement of a population. It measures as the difference between Crude Birth Rate and Crude
the number of deaths per 1000 population in a particular Death Rate.
period of time. Mathematically, it is defined as
Natural Increase in Population = CBR – CDR
D
CDR = × 1000 CBR = Crude Birth Rate
P
CDR = Crude Death Rate
Where, CDR = Crude Death Rate
D = Total registered death during a calendar year. In the present study the Growth rate of the
P = Total number of population in a specified year. population is found to be 12.2 which is slightly lower
than the national average of 12.77 and the state average
In the present study it is observed that a total 31 of 13.7 in 2015.
deaths took place during the reference period of 5 years
and hence the average death is 6.2 per year. And the Morbidity Prevalence Rate (MPR): Morbidity
estimated Crude Death Rate of the sample population Prevalence Rate is an important heath indicator.
is 5.01 per thousand population which is lower than the Morbidity affects the normal functioning of the human
state average of 7.01 and Indian average of 6.50 in 2015 beings. Morbidity is a state of affair in which an
(Source: Office of the Registrar General and Census individual is physically and mentally suffering. The
Commissioner, India). MPR is the frequency with which a disease appears in a
Crude Birth Rate (CBR): The Crude Birth Rate is the particular population.
widely used measure of fertility. As the name implies it Number of ailing persons
is the crude measure of public health. The Crude Birth Morbidity Rate = × 1000
Total Population
Rate is the number of live births per year per 1000
The MPR can be studied in terms of acute disease
midyear population. The mathematical formula for
and chronic disease. Ailments of less than 30 days
calculating CBR is
duration are treated as acute and more than 30 days are
CBR =
B
× 1000 treated as Chronic (NSSO 1998). Among the sample
P population, the Morbidity rate is found 97.89.
Where, CBR = Crude Birth Rate
Mode of Treatment of Disease: It is important to study
P = Total midyear population in a particular area
the mode of treatment in order to have idea of the health
B = Total number of births in a particular area
status of a particular community. A primitive backward
In the present study data for live births is calculated society uses more traditionally known medicines and
for a period of last 5 years. So after calculating total traditional way of treatment than modern drugs and
number of live births for the last 5 years, the annual birth modern technologies. The diseases are treated by Kabiraj
has been calculated. In the present study 106 live births or Bej in such societies. However, with development and
are found and hence the average number of births per advancement in science and technology and spread of
year is 21.2. Thus the estimated Crude Birth Rate for education, people started visiting hospitals and doctors
the sample population is 17.15 per thousand population for treatment of diseases. It is found from field survey
which is lower than the state average of 20.8 and national data that 94 respondents i.e. 34.18 percent of the sample
average of 19.27 in 2015 (Source: Office of the Registrar respondents still depend on the Bej or Kabiraj for
General and Census Commissioner, India).
treatment of diseases. On the other hand, the remaining
Growth of Rabha Population: In order to measure the respondents i.e. 181 respondents (65.81 percent) use
population growth among the Rabhas we calculated the to visit doctors for the treatment of diseases. Thus we
Natural Growth of Population. The Natural Growth of can say that a huge proportion of the respondents is
population takes into account only the birth rates and still depended on traditional or primitive methods of
death rates. It does not take into account the population treatment which is not a good sign.
system, manpower, resources all has to be strengthen

enough so that it can be utilized the community people
in a proper way.
Ethical Clearance: It is a review article.
Source of Funding: Self.
Conflict of Interest: Nil.
References
1. Kapoor S, Tyagi R, Saluja K, Chaturvedi A,
Figure 1: Distribution of Respondents by Mode of Kapoor AK. Nutritional profile and socio-
Treatment economic status of Saharia, a primitive Tribe of
India. OAJ. 2009;6:58-63.
Conclusion 2.
Bhattacharyya R. Good governance and
development mandate. Space and Culture, India.
From the above discussion it is found that the status 2014 Jun 29;2(1):1-4.
of health of the Rabhas is not satisfactory. The Infant
Mortality Rate of the community is found as 47.17 3. Dutta I, Bawari S. Health and Healthcare in
per thousand live births which is higher than the state Assam-A Status Report. eSocialSciences; 2010
average and national average. The Maternal Mortality Feb. Available from http://www.cehat.org/go/
Rate of the community is also found much higher than uploads/Hhr/assamreport1.pdf
the national average and state average. However, the 4. Iqbal MT. Witch Hunting: A Case of Gender Violence
estimated Crude Death Rate of the sample population in the Garb of Vigilantism in India. International
is 5.01 per thousand population which is lower than the Journal of Advanced Research in Management and
state average of 7.01 and Indian average of 6.50. In the Social Sciences. 2015;4(11):109-20.
present study the Growth rate of the population is found
5. Kashyap F. and Saikia J. Witch Hunting: Major
12.2 which is slightly lower than the national average of
reasons behind its existence with special reference
12.77 and the state average of 13.7 in 2015. It is found
to Assam, International Journal on Humanities
from field survey data that 34.18 percent of the sample
and Social Science Studies. 2017; 4(3):100-104.
respondents still depend on the Bej or Kabiraj for
treatment of diseases. On the other hand, the remaining 6. Ministry of Panchayati Raj. A Note on the
respondents i.e. 65.81 percent use to visit doctors for the Backward Region Grand Fund Programme,
treatment of diseases. Thus in order to improve the health NIRD. 2012 April 2012.
status of the Rabhas the health infrastructure, delivery
Acoustic Analysis of Infant Cry Using Multidimensional Voice

Program―A Preliminary Study
Deepa N Devadiga1, Remyasree T2, Aiswarya Liz Varghese3, Ananthakrishna T4

1
Associate Professor, Department of Speech and Hearing, School of Allied Health Sciences, 2Post Graduate,
3
Assistant Professor-Selection Grade, Department of Department of Audiology and Speech Language
Pathology, Kasturba Medical College, Mangalore, 4Assistant Professor-Selection Grade, Department of
Electronics and Communication, Engineering, Manipal Institute of Technology, Manipal Academy of Higher
Education, Manipal, Karnataka, India
Abstract
Crying is the only communication means that the baby has in the first month of life. It is expected that some
aspects of the infant cry sound can be directly related to neurological deficits or damage, as well as to genetic
anomalies and respiratory problems. Assessment of infant cry is a powerful screening tool to evaluate the
neurological status of the newborn within its early biosocial context. However, till date it is not clear how
acoustic analysis of cry using the Multi-Dimensional Voice Program (MDVP) will serve as a marker in
differentiating the normal cry from the abnormal cry especially when birth cry is analysed for the purpose.
Keywords: Birth cry, Acoustic Analysis, MDVP, Normal and Abnormal Cry
Introduction dysfunction or deficit of central or peripheral nervous

system [4]. The preterm infant with excessive crying
Crying is referred to as natural, alarm to alert the may reflect the occurrence of behavioural problem and
needs of the infant and motivating the listener to respond the parenting stress even after few years which is in
[1]
. The first cry of the new born is defined as the baby’s accordance with the previous studies [5, 6, 7].
very first exhalations of the first breath within 20 seconds
after birth [2]. During the first cry, metabolic acidosis Earlier studies were mainly based on the auditory
occurs due to hypoxia during birth. The baby experiences analysis alone. The fundamental frequency has been
a feeling of cold due to differences in temperature. This found to be a discriminative feature in severe medical
sudden extensive temperature difference terrifies the problems such as Sudden Infant Death Syndrome [8],
newborns, and thus takes a deep breath and during the hypoglycaemia/hyperglycaemia [9], brain damage [10],
following exhalation starts crying with all its strength [3]. cleft palate [11] and others.
It is postulated that crying originates in the nervous Need of the Study: Assessment of infant cry is a
system, thereby reflecting the neural veracity, which powerful screening tool to evaluate the neurological
may be useful in early identification of infants at risk status of the newborn within its early biosocial context.
Although, there were methods to explore the infant cry
for adverse developmental consequences. Hence,
using several other methods, till date it is not clear how
presence of an abnormal cry could be suggestive of any
acoustic analysis of cry using the Multidimensional
voice program (MDVP), a commonly used software, will
Corresponding Author: serve in differentiating the normal cry from the abnormal
Ms Aiswarya Liz Varghese cry especially for the birth cry. Hence the present study
Assistant Professor-Selection Grade, is an attempt in this direction.
Department of Audiology and Speech Language Pathology,
Aim of the Study
Kasturba Medical College, Mangalore,
Manipal Academy of Higher Education, Karnataka, India zz To analyze the birth cry in normal and high risk
Email: aiswarya.varghese@manipal.edu infants using acoustic measures of voice
Objective of the Study section) < 30 seconds after birth. The microphone was
connected to the lap top with PRAAT -5114 Software.
zz To profile and compare birth cry in normal and high
The microphone was maintained at a distance of 10
risk infants using acoustic measures
cm during the recording. Each cry was recorded for 30
seconds. The recorded data were saved in wave format
Method for further analysis.
A cross sectional research design with convenient Data Analysis: In the recorded data, the noise was
sampling procedure was adopted. The research protocol controlled using Audacity software.
was approved by Institutional Ethical Committee.
Informed consent was obtained. The following steps were carried out in order to
reduce the background noise to a minimum level.
A total of N=40 participants were grouped based on
gestational age into two groups, normal infants as Group zz Spike noise reduction
I and high risk infants as Group II. zz If the sample considered was weak, it was amplified
(here the new peak amplitude was maintained at ‘0’
Group I: Group I consisted of normal infants, with
level)
gestational age from 37-42 weeks with (n=25) [Males
=10, Females=15]. zz Finally, the overall noise level was removed from
the entire signal and all the signals units were
Group II: Group II consisted of high risk infants, with combined
(n=15) [Males = 7, Females=8].
Acoustic Analysis: All the samples were transferred
Inclusion Criteria to MDVP software. The cry was analysed for selected
Group I acoustic parameters.
zz The infants born from 37-42 weeks of gestation Statistical Analysis: The statistical analysis was
period with no complications. performed using the SPSS version 15. Descriptive
statistics was performed. Independent t test was done to
Group II compare the means between the two groups. A p value
zz The infants born before 37 weeks or after 42 weeks less than 0.05 was considered statistically significant.
of gestation period
zz Infants susceptible to events associated with birth Result
and the adjustment to extra uterine survival based Fundamental Frequency Related Measures: The
on the high risk register maintained at hospital. mean value obtained was found to be higher for Average
Exclusion Criteria Fundamental Frequency and Highest Fundamental
Frequency among the normal infants as compared to
zz Infants born to mothers aged over 40 years and high risk infants, except for the Lowest Fundamental
less than 16 years during delivery were excluded Frequency which was higher in high risk infants.
in Group I. However there was no significant difference for Average
Fundamental Frequency, t (38) = 0.267, p = 0.20, Highest
Procedure
Fundamental Frequency, t (38) = 0.801, p = 0.095 and
Questionnaire: A questionnaire was developed in order for Lower Fundamental Frequency, t(38) = -0.175, p =
to collect information pertaining to demographic details, 0.437 between normal and high risk infants.
prenatal, perinatal, and post natal histories.
Frequency and Amplitude Perturbation Measures:
Data Recording: The birth cry was recorded using The mean value for Shimmer in dB was higher in high
the dynamic unidirectional microphone (UTP-30), risk infants. There was significant difference observed
at a frequency response of 100-15,000 Hz in the for shimmer in dB, t (38) = -0.221, (p<0.05) between the
labour room (Normal Delivery) or Labour theatre (C normal and the high risk infants. The mean obtained for
Absolute Jitter was higher in normal infants as compared per second vibration of the vocal fold. The fundamental
to the high risk infants. However there was no significant frequency is influenced by the vibration mode of the
difference observed, t(38) = 0.699, p = 0.263 between vocal fold, the amount of sub glottal pressure and the
normal and high risk infants. co-ordination of the various intrinsic laryngeal muscles.
Because of the anatomical difference of the vocal tract,
The mean value of Shimmer percentage was higher newborn infants have higher fundamental frequency and
in high risk infants compared to normal infants and the resonances than adults. Previous reports indicate that the
mean value obtained for Jitt was higher in normal as high risk infants tend to be physically smaller in size at
compared to the high risk infants. However, they were birth when compared to normal infants and resulting in
not statistically significant with jitter percent, t(38) = high pitch. A higher F0 is reported in infants diagnosed to
0.535, p = 0.117 and Shimmer Percent, t(38) = -0.258, have hyperbilirubenemia as compared to normal infants
p = 0.482. [13]
. In the present study respiratory distress infant showed
Noise Related Measures: The mean value of Noise higher F0 as compared to normal infants. The results
to Harmonic Ratio was higher in high risk infants. are consistent with the other studies which demonstrate
However, No significance was observed for Noise to that the birth cry of an Respiratory Distress Syndrome
Harmonic Ratio, t(38) = -0.247, p = 0.944 between infant have the F0 of higher pitch than the normal full
normal and high risk infants. term infants [14] The meconium aspirated infants have a
reduced pitch in cry when compared to normal infants.
Voice Break related and Sub- Harmonic Measures: In the present study, it was seen that F0 was lower in
The mean of the Degree of Voice Break and Degree meconium aspirated syndrome as compared to normal
of Voiceless was higher in normal infants compared infants. Meconium aspirated syndrome infants breathe
to high risk infants. The mean value of Degree of the meconium content in the amniotic fluid which enters
Sub- Harmonic was higher in high risk infants. No in to the lungs during the delivery and may prevent from
significance was observed for Degree of Voice Break, the normal respiration. Those infants have weak cry
t(38) = 1.609, p = 0.895, Degree of Voiceless, t(38) = because the reduced vital capacity leads to the lower
0.442, p = 0.420 and Degree of Sub- Harmonic, t(38) = pitch and loudness. Intra Uterine Growth Retardation is
-.080, p = 0.611between normal and high risk infants. another condition associated with the risk for developing
respiratory inhibition after birth [15].The immature
Discussion respiratory system leads to increased risk for hypoxia.
Those infants have the restriction in the body growth from
The acoustic analysis was carried out using the the uterus and have an overall reduction in the body size.
most commonly used software, the Multidimensional The smaller vocal fold structures in those infants may
Voice Profile (MDVP). MDVP is advanced software produce low pitch when compared to full term infants,
with which it is possible to analyse 33 quantitative which is in agreement with the present study.
voice parameters, which are subdivided under 8 groups.
However, in the present study, selected parameters were Frequency and Amplitude Perturbation Measures:
analysed for the birth cry signal. In the present study, Jitta was found to be lower in
preterm when compared to normal infants. It was also
Fundamental Frequency related parameters: In the observed to be lower in me conium aspirated syndrome,
present study, the results revealed an overall increase in hyperbilirubenemia, and respiratory distress syndrome
Average Fundamental Frequency, Highest Fundamental compared to the normal full term infants. This Jitta value
Frequency in the normal infants as compared to high depends on the stability of the fundamental frequency, as
risk infants. However, it was observed that mean values the F0 increases the Jitta values will reduce. So the reduced
obtained for F0 particularly in preterm, respiratory jitta value of the pre term infants indicating the higher F0,
distress and hyperbilirubinemia high risk infants was which is similar to the findings of the present study.
higher as compared to the F0 in normal infants which
is in consensus with the previous investigations [12]. The There was significant difference observed for
F0 is as important parameter in the objective assessment Shimmer in dB (p<0.05) between two groups. Shimmer
of the cry signal, and it is defined by number of cycle in dB expresses the average period to period variability of
the peak to peak amplitude. Usually these irregularities cry signal. The Degree of Sub Harmonics value was
in the shimmer measures are associated with breathy or increased in the preterm infants as compared to normal,
weak voice. Human larynx is not fully developed during indicating loose adduction and the escape of the air
birth, the cartilaginous and membranous portion of the through the vocal folds, thereby leading to irregular
vocal fold matures post natal [16]. New born have 60 to vibration of the larynx.
75% of total length in the posterior chink of the glottis.
This will result in an increase in the hoarseness of the Conclusion
voice when compared to adults. Hence, this ShdB was
found to be higher in new born infants. Most of these It suggests that acoustic analysis which is non-
high risk infants were born by caesarean and have the invasive in nature can be used to characterize birth cry
risk of the health complications. Several factors that lead between normal and abnormal birth cry. However a large
to the caesarean delivery include pre-term, meconium sample size is required to come to conclusive findings.
aspiration, mother’s bleeding condition etc. If an infant Thus birth cry analysis could be used as a diagnostic
is delivered as preterm, the respiratory system is not marker in differentiating between normal and high risk
fully developed. Hence this immature airway makes babies and thereby can contribute to early disorder
it difficult for the infant to breath and that can leads to identification and prompt intervention.
weak production of the cry [17]. So this could be one of
Conflict of Interest: There is no conflict of Interest.
the factors that contribute to the irregularity of the short
term amplitude among high risk infants. Source of Funding: This work is not supported by any
funding agency.
Noise Related Measures: The current study results
revealed that high risk infants had slight increase in the
Noise to Harmonic Ratio as compared to the normal References
infants although not statistically significant. The NHR 1. Zeskind PS, Lester BM. Analysis of cry features
values are an index of degree of hoarse voice. Hence, in newborns with differential fetal growth. Child
it is a good indicator of the breathiness of the cry units. Development. 1981 Mar 1:207-12.
The current result is at par with the literature that, pre
term infants have a reduction of energy in the signal 2.
Hassauer W. Die Geburt der Individualität:
with larger spectral tilt over time, indicating the breathy Menschwerdung u. moderne Geburtshilfe. Verlag
voice in preterm infants compared to normal infants [18]. Urachhaus; 1995.
Hence, preterm infants are expected to have a higher 3. Zivković D. Glas i zdravstveno stanje novorođene
NHR values as compared to normal infants. djece(Doctoral dissertation, Diploma thesis).
Faculty of Education and Rehabilitation Sciences,
Voice Break related and Sub- Harmonic Parameters:
University of Zagreb: Zagreb).
In the present study, all parameters were increased
in normal infants as compared to high risk except for 4. Frodi A, Senchak M. Verbal and behavioral
Degree of Sub- Harmonic which was found to be responsiveness to the cries of atypical infants.
higher in high risk as compared to normal infants. Voice Child Development. 1990 Feb;61(1):76-84.
breaks measures indicate the ability to sustain the voice
5. Lauudge W, Rothg auanger H. Early diagnosis
without any interruption, the Sub-Harmonic component
of CNS disturbance from computer analysis
estimates the irregularity of the vocal fold vibration.
of infant cries: A new method of fundamental
The high risk infants have more latency of the cry units
frequency jitter computation with high resolution
compared to normal infants, hence the voice break
in frequency and time. Early Child Development
measure was higher in normal than high risk infants.
and Care. 1990 Jan 1;65(1):83-90.
Pre term infants have an immature laryngeal system
that leads to the irregularity in the vocal fold vibration 6. Korja R, Huhtala M, Maunu J, Rautava P, Haataja
resulting in increased sub harmonic. Hyperbilirubenemia L, Lapinleimu H, Lehtonen L. Preterm infant’s
infants were also found to have increased Degree of early crying associated with child’s behavioral
Sub Harmonics values as compared to normal infants, problems and parents’ stress. Pediatrics. 2014 Feb
indicating that there is variability in the pitch of the 1;133 (2):e339-45.
7. Lind J, Wasz-Höckert O, Vuorenkoski V, Valanne 14.

Kheddache Y, Tadj C. Characterization
E. The vocalization of a newborn, brain-damaged of pathologic cries of newborns based on
child. In Annales paediatriae Fenniae 1965 (Vol. fundamental frequency estimation. Engineering.
11, p. 32). 2013 Oct 16;5(10):272.
9.
Lederman D. Estimation of Infants’ Cry 15. Minowa H, Mima A, Ikeda Y, Yasuhara H,
Fundamental Frequency using a Modified SIFT Ebisu R, Ohgitani A. Asymmetric intrauterine
algorithm. arXiv preprint arXiv:1009.2796. 2010 growth restriction is a risk factor for respiratory
Sep 14. inhibition after crying in infants. The Journal of
Maternal-Fetal & Neonatal Medicine. 2015 Nov
10. Manfredi C, Bocchi L, Orlandi S, Spaccaterra 22;28(17):2121-5.
L, Donzelli GP. High-resolution cry analysis in
preterm newborn infants. Medical engineering & 16. Eckel HE, Sprinzl GM, Sittel C, Koebke J,
physics. 2009 Jun 1;31(5):528-32. Damm M, Stennert E. Anatomy of the glottis and
subglottis in the pediatric larynx. HNO. 2000
11. Lederman D, Cohen A, Zmora E, Wermke Jul;48(7):501-7.
K, Hauschildt S, Stellzig-Eisenhauer A. On
the use of hidden Markov models in infants’ 17. Hansen AK, Wisborg K, Uldbjerg N, Henriksen
cry classification. InThe 22nd Convention on TB. Elective caesarean section and respiratory
Electrical and Electronics Engineers in Israel, morbidity in the term and near‐term neonate. Acta
obstetricia et gynecologica Scandinavica. 2007
2002. 2002 Dec 1 (pp. 350-352). IEEE.
Apr;86(4):389-94.
12.
Robb MP, Crowell DH, Dunn-Rankin
18. Chen LM. Quantitative Assessment of Cry in
P. Sudden infant death syndrome: Cry
Term and Preterm Infants: Long-Time Average
characteristics. International journal of pediatric
Spectrum Analysis. International Journal of
otorhinolaryngology. 2013 Aug 1;77(8):1263-7.
Computational Linguistics & Chinese Language
13. Porter ML, Dennis BL. Hyperbilirubinemia in the Processing, Volume 19, Number 4, December
term newborn. American family physician. 2002 2014-Special Issue on Selected Papers from
Feb 15;65(4). ROCLING XXVI. 2014;19(4).
An Analysis of Access to Primary Health Care Services: A

Study in Jorhat District of Assam
Sampurna Khound
PhD. Research Scholar, Omeo Kumar Das Institute of Social Change and Development, VIP Rd. Upper
Hengrabari, Guwahati, Assam
Abstract
The present study tries to find out the access to primary health care services. Primary health care services
are very important for the health outcomes of the mother and that of the child and in ensuring that both
maternal and child deaths are prevented. These types of services also positively contribute to improve the
health status and also economic development. Study of these services is necessary in developing areas
where infrastructure to deliver these services is minimal or lacking. This study has been done in two
development block of Jorhat district. A cross sectional household survey was conducted for the sample of
242. Accessibility has been studies in three aspects like availability, affordability and acceptability. Study
also tries to cover the disparities in accessibility in different socio-economic groups.
Keywords: Accessibility, Availability, Acceptability, Primary Health Care.
Introduction care services. The concept of primary health care came

into light in 1978 following an international conference
Health is one of the vital indicators of quality of in Alma – Ata USSR which declared that primary health
human life. So it is very essential that health services care was a key to attain health for all. India is a signatory
reached each and every corner of the country. Bhore to the Alma –Ata declaration of 1978 and was committed
committee in 1946 suggested a comprehensive health to attain the goal of “health for all by the year 2000 A.D.,
care service an integration of preventative, promotive through the Universal provision of primary health use
and curative so that every individual able to received service (Government of India, 1983).
it. According to the recommendation of this committee,
Government of India set up three-tier health care With physical existence of expanding, access to
delivery system i.e. primary, Secondary and Tertiary. In health care especially in rural areas is a crucial priority
the three-tier health care system primary care provided for government. In India a large proportion of people
services at the village level, secondary care at a sub- live below the poverty line in rural areas. In those
division and district level and tertiary care at the regional areas since primary health care plays an important role,
level. Health has been declared a fundamental right in critical priority has been given to primary health care by
many countries. National governments all over the government of India. But physical accessibility of public
world are striving to expand and improve their health or private health care facility is a challenge in rural areas.
The access to health care is therefore, rightly defined as
the potential and actual entry of a group of population
into the health and health care delivery system.15
Sampurna Khound The Institutes of Medicine defines access to health
PhD. Research scholar care as “… the timely use of personal health services to
Omeo Kumar Das Institute of achieve the best possible outcomes” 7. Access to health
Social Change and Development care depends on availability, awareness, affordability
VIP Rd. Upper Hengrabari. and accessibility to health care services13. Along with
Guwahati, Assam-781036 availability of physical infrastructure, facilities and
Email: Sampurnakhound123@gmail.com health workers, accessibility is important for good health
outcome. The physical existence is a necessary but not Analytical Tool: Tabulation has been done to present
a sufficient condition for accessibility. There are various the collected information in a systematic way. The study
factors which influence the people attitude towards has been presented using simple statistical tools like
access to health services such as knowledge about percentages, averages.
disease, awareness about medical facility and cost of the
service12. In short, access to health care is a combination Result and Discussion
of affordability, availability and acceptability of the
prevalent health care system10. In this study, access to Access to health services is how people make use
primary health care facility has been looked into in the of or take advantage of the services being provided.
light of availability, affordability and acceptability of However, access cannot be ensured only through
health care facility. expansion of the service, it should be affordable as well
Objectives and Methodology as acceptable also11. The physical access implies the
distance to the service provider, affordability means that
The sole objective of this paper is to examine the the service is economically accessible and acceptability
accessibility of primary health care facility. implies that people have knowledge about the service
and they ready to receive it.
Data Source: Both secondary and primary sources of
information have been used while conducting the study. Expanding access to primary health care is a critical
The primary data is collected through multi-stage sampling
priority of the government of India. Efforts towards it
method with the help of a structured questionnaire which
address numerous issues and much progress has been
has been prepared keeping in mind the objectives of
the study. The secondary data has been collected from reported. The health care system in India, at present has
different sources like the Directorate of Economics and a three tier structure to provide health care services to
Statistics, Directorate of Public Health, Planning Board, its people. The first tier know as primary tier, has been
District Medical Offices, Journals, Books etc. developed to provide health care services to the vast
majority of rural people. The primary tier comprises
Sampling Design: A multi-stage sampling design has three types of health care institutions -sub centre (SC),
been drawn for selection of the sample. From the two
primary health centre (PHC) and community health
sub-divisions in Jorhat district, in the first stage of
centre (CHC). In Assam, at present 975 PHCs, 10 CHCs
sampling, two development blocks viz. Jorhat block and
Titabor block have been purposively selected on the basis and 4604 SCs are working. In Jorhat district, seven Block
of having the highest concentration of rural population. PHCs, six CHCs, 27 mini PHCs and 144 SCs are working
i.e.. In the second stage, two gaon panchayats have been (Joint Director of Health Service, Jorhat). Various
purposively selected on the basis of concentration of types of family welfare programmes, immunization
highest rural population. In the third stage, from the two programmes and family planning measures are being
gaon panchayats, 25% of villages have been selected executed by these primary health care service providers.
which add up to four villages. In the fourth stage, from The Assam government has played a pro-active role in
these four villages, 10% of the households have been creating provisions of health care facilities for the past
randomly selected which is shown in Table below. several decades to all those who are in need of these
Table 1: Sample Households facilities and services.
Total 10% of the total Availability of Primary Health Services: Adequate

Village
households households and equitable distribution of health care facilities in rural
Nawsolia 1183 areas is critical to human capital development. Adequate
HallmileBell 457 number of health institutions should be set up in the rural
No. 1 areas of a particular district so that the villagers need not
344 travel long distances to seek medical facilities.
KakodungaHabi
No. 3 Block 442
Distance to the nearest SC/PHC/CHC: Distance to the
Total 242 health care is an important determinant of health care
Source: Directorate of Economics and Statistics, GoI availability.
Table 2: Distance to the nearest Primary Health Service
Bellow 1 Km 1-3Km 3-8Km Above 8Km

Health Centre
No. % No. % No. % No. %
SC 115 47.52 127 52.48
PHC 85 35.12 157 68.88
CHC 85 35.12 157 68.88
Source: Field survey
From the above Table (2), it is observed that 47.52 percent of the households have a SC at a distance of less
than one km. While only 35.12 percent of the households are located within 3-5 km from the nearest PHC and CHC
respectively. For majority of the households (68.88 per cent), the PHC and CHC are located at a distance of more than
eight km. It is also reported that around95 percent of people are situated at a walk able distance from the SC, a large
proportion of people depend on rented vehicles and other public services to reach these facilities.
Affordability of Health Care Services: Affordability depends on various socio-economic variables, such as income
of the household, occupation, family size and caste etc. Here an attempt has been made to analyse the relation between
health expenditure and the above mentioned socio-economic variables. The following table has been constructed to
depict the relation.
Table-3: Health Care Expenditure among Socio-economic Groups (in percentage)
Selected Below Above

Description Nil 10-20% 20-30% Total
Variable 10% 30%
General 16 30 28 22 4 100
OBC 15.08 18.25 39.68 14.29 12.69 100
Caste SC 28.20 61.54 10.26 100
ST 29.42 52.94 11.76 5.88 100
Others 40 40 20 100
500 and bellow 38.89 35.18 20.37 5.56 100
Monthly
Per Capita 501-1500 15.26 33.89 32.20 14.41 4.24 100
Consumption 1501-2500 7.69 25 40.38 15.38 11.54 100
Expenditure 2501-3500 6.67 15.38 29.08 26.32 22.55 100
(MPCE)
Above3500 7.5 16.32 23.06 26.85 26.27 100
Up to 3 25.58 32.56 30.23 6.98 4.65 100
Size of 4-5 19.66 30.77 27.35 17.09 5.13 100
Households 6-7 14.55 32.73 36.36 7.27 9.90 100
8 and above 3.70 25.93 33.33 18.52 18.52 100
Government Service 10.53 21.05 44.74 23.68 100
Private Service 36.84 10.53 21.05 15.79 15.79 100
Occupation Business 16.25 30 31.25 15 7.5 100
Agriculture 22.41 44.83 32.76 100
Daily Wage Earner 21.28 40.43 38.29 100
Source: Field Survey
From Table 3, it is observed that among the social comparatively low than the other caste. The monthly per
groups, the, the expenditure on health by the backward capita consumption expenditure of the households show
caste like the Scheduled Caste and Scheduled Tribe is that the percentage share of health expenditure increases
as the monthly per capita consumption expenditure of service (Simon, 2007). The acceptability of any health
the sample households increases. 26.27 percent of the care system/medical practice among a given population
households whose MPCE is above 3500, spent more is determined by different elements. It is very crucial to
than 30 percent of their non-food expenditure on health understand the factors that influence the different choice
services. There is a positive relationship between the that people make between different available health care
size of family and health expenditure. As the family size systems as also their very acceptance/willingness to
increases, expenditure on health also tends to increase. avail any medical practice. Here, acceptability is being
Occupation wise data shows that the agriculturists and looked into the process of making a choice for medical
daily wage earners are ready to spend only 10 to 20 care by the different socio-economic groups.
percent of their income on health services.
Choice of Provider: A table has been constructed to
Health Care Acceptability: Acceptability can be defined show the choice of providers among different socio
as willingness of a person to receive or buy a health economic groups.
Table 4: Choice of Providers among Socio-economic Groups (in percentage)
Selected Variable Description Public Private Total

General 31.71 68.29 100
OBC 60.19 39.81 100
Caste SC 78.18 21.82 100
ST 75 25 100
Others 62.5 37.5 100
500 and bellow 90.91 9.09 100
Monthly Per Capita 501-1500 71.87 28.13 100
Consumption Expenditure 1501-2500 63.16 36.84 100
(MPCE) 2501-3500 56.23 43.77 100
Above 3500 27.27 72.73 100
Up to 3 43.6 56.4 100
4-5 49.0 51.0 100
Size of Households
6-7 57.1 42.9 100
8 and above 68.2 31.8 100
Govt. service 21.58 78.42 100
Private service 50.0 50.0 100
Occupation Business 63.13 36.87 100
Agriculture 73.09 26.91 100
Daily wage earner 81.08 18.92 100
Source: Field Survey
The above Table 4 shows that with an increase wage earners opt for government service providers as
in monthly per capita consumption expenditure, the they cannot afford the costly services of the private
preference for private health care providers increase. health care service providers.
Among the social groups, a significantly higher
proportion of the scheduled caste (78.18) is found Type of Institution: Selection of institution depends on
to have opted government sources followed by the type of disease and distance to the facility centre. The
scheduled tribe at 75 percent. Occupation wise, it is sample households reported that the complex cases which
found that people engaged in government services prefer cannot becured in the rural health institutions are referred
to take advantage of the private service providers. On to a higher facility as most of the PHC and CHC are not in
the other hand, people who are agriculturists and daily a position to deliver specialised health care services.
Table 5: Distribution of Morbid Persons seeking Conclusion

Treatment by type of Health Institutions
The primary focus of the present study has been to
No. of look into the accessibility of primary health care facilities.
Type of institutions Percentage
households They are designed to function as important components
PHC/CHC 38 13.38 of the overall economic and social development
District Hospital 136 47.89 programmes. Investments have been made under the
Private Hospital 42 14.78 different government programmes to meet the demand
of the rural people. Although majority of the patients
Private Clinic 68 23.94
belonging to the economically poor households prefer
Total 284 100
rural health institutions, those institutions have failed
Source: Field Survey to become a choice for the economically well to do
households as those who can incur higher health care
It appears from the Table 5 that 47.89 percentages
expenditure often choose urban centric secondary health
of households seek treatment from the district hospital. care services. Though the households at large are aware
Likewise, 13.38 percent of the households seek treatment of the availability of service in the primary health centres
in the PHC and CHC, particularly those belonging to but the motivation for utilisation of the services of the
the Bekajan block as it is located at distance from the PHCs is very poor. It needs an effective and continuous
Jorhat town. However, treatment sought from the private strategy to develop the demand and motivation to avail the
hospitals is relatively lowers (14.79). 23.94 percent of primary health services. The process of current evaluation
the households visit private clinics for treatment. should be strengthened to monitor the performance of the
primary health centres. Further strengthening and capacity
Most of the maternal deaths are attributed to the building of public health facility should be done regularly.
lack of proper care at delivery. To improve the quality of Young doctors should be motivated to work in the rural
human resources a major trust of all welfare programmes area for some time to serve the people. Government
has been directed towards maternal health. In Jorhat should take steps for improvement so that people can
district it seems to have been working good and almost choose a particular health facility rather than forced to go
all the mothers during 5 years in the survey area reported because of lack of money.
that their delivery took place in various health institutions.
The ASHA workers are doing their job in a good manner Ethical Clearance: There is no objection while
collecting data.
which helps to improve the institutional delivery.
Source of Funding: Self.
Opinion on Government Service: The respondents
were enquired as to how much they are satisfied from the Conflict of Interest: No.
services provided by the PHC and CHCs. The respondents
gave a mixed response. Most of the respondents reported References
that waiting room facility, availability of medicines,
provision of operation theatres, ambulance facility and 1. Adam, V. Y., & Awunor, N. S. Perceptions and
factors affecting utilization of health services
testing laboratory in primary health centres are rather
in a rural. JMBR: A Peer-review Journal of
poor. During the ensuing discussions, some major issues
Biomedical Sciences. 2014; 13(2):117-124 p.
came to light. There is lack of basic facilities in the PHCs
Available from https://www.researchgate.net/
and sub-centres like the building, water and electricity,
publication/281374322
proper in-patient facility etc. Moreover, at many places,
there is no laboratory facility and basic medicines are 2. Aday, L., & Andersen, R. A framework for the
also not available. So, very often most of the tests are study of Access to medical care. Health Servies.
done in outside laboratories. Often they work in haste 1974; 9(3):208-220 p
and fail to give a patient hearing to the problems of the 3. Andersen R. M. et. al. Access to medical care for
patient. Lack of cleanliness and heavy rush are also low income persons: How do communities make
reported as the two major reasons for low preference for a difference? Medical care research and review.
government health services. 2002; 59, 381-411.
4. Chauhan RC, Manikandan, Purty AJ, Samuel A, 12. Saikia, D and Das K. K. Access to Public Health–
Singh Z. Determinants of health care seeking care in the Rural North-East India. The NEHU
behavior among rural population of a coastal area Journal. 2014; XII, 77-100p.
in South India. Int J Sci Rep.2015; 118-22.
13. Shukla, V. & Gupta P. Factors affecting health
Deodhar, N. S. Primary Health care in India.
5. care facility utilization in rural areas of Lucknow
Journal of Public Health Policy. 1982; 3 (1), district. International Journal of Community
76-99. Available from https://www.jstor.org/ Medicine and Public Health. 2017; Available
stable/3342068 from http://dx.doi.org/10.18203/2394-6040.
ijcmph20181394
6. Joint Director of Health Service, Jorhat 2018.
14. Uplekar, M. and George, A. Access to Health
7. Hong, T.K. et. al. Factors affecting utilization of
Care in India: Present Situation and Innovative
health care services by mothers of children ill with
Approaches. 1994; Available from http://hdl.
diarrhea in rural Vietnam. SOUTHEAST ASIAN J
handle.net/10625/27567
TROP MED PUBLIC HEALTH. 2003; 34(1).
15. Directorate of Economics and Statistics, GoI
8. Millman, M. L. Access to health care in America.
Institute of Medicine (Ed) Washington. DC: 16. US Congress. The Quality of Medical Care. Office
National Academy Pr. 1993. of the Technology Assessment, Publication No.
OTAH - 386, US Government Printing Office,
9. Osmami, S.R. Delivering Basic Health Services to
Washington D C.1988
the Poor in Bangladesh: A Right to Development
Approach. 2003 17. Report of the International Conference on Primary
Health Care. Alma Ata, USSR, 6-12 September,
10. Patrick, M. Public and Private Heath Care
World Health Organization, Geneva.1978
Institution. Preference and Expenditure. Published
from Centre for Public Policy Research. 2017 18. The World Health Report 2000. Health Systems:
Improving Performance, WHO, Geneva.
11. Simon, T.D. Health care accessibility and socio-
economic groups: A study of Kerala. Department
of Economics. Dr. John Matthai centre, University
of Calicut. 2007
Adaptive Signal Enhancement in Clinical Cardiac Care

Systems Using Normalized Median LMS Variants
Asiya Sulthana1, Md. Zia-Ur-Rahman2

1
Research Scholar, 2Professor, Department of Electronics and Communication Engineering, Koneru
Lakshmaiah Education Foundation, Greend Fileds, Vaddeswaram, Guntur, A.P., India
Abstract
In this paper, a new variant of elimination of adaptive artifact from Electrocardiography (ECG) signals is
presented. ECG is a noninvasive method for indirect assessment of monitoring the stroke volume, cardiac
output and other hemodynamic parameters. But this method is affected by various non-stationary artifacts
such as sinusoidal artifacts (SA), respiration artifacts (RA), muscle artifacts (MA) and electrode artifacts
(EA) while acquiring the ECG signal which leads to ambiguity in diagnosis. Hence these artifacts should be
eliminated for accurate diagnosis. For filtering these artifacts, we proposed several hybride adaptive filtering
techniques based on conventional Least Mean Square (LMS) algorithm. These are Normalized Median
LMS (NMLMS), Sign Regressor NMLMS(SRNMLMS), Sign NMLMS (SNMLMS), Sign Sign NMLMS
(SSNMLMS) are the hybride variants of LMS algorithm. Based on these adaptive algorithms, we developed
several adaptive signal enhancement units (ASEUs) and performance is evaluated on the real ECG signal
components obtained from MIT-BIT database. Among these techniques, SRNMLMS based ASEU performs
better in the filtering process. The signal to noise ratio improvement (SNRI) for this algorithm is calculated
as 21.6985 dBs, 7.9864 dBs, 7.8346 dBs and 10.6857 dBs respectively for SA, RA, MA and EA. Hence, the
SRMLMS based ASEUs are more suitable in ECG signal filtering in real time health care sensing systems.
Keywords: Adaptive Filter, Hemodynamic parameters, Electrocardiography, signal enhancement, stroke volume.
Introduction studies are carried out in the field among noninvasive

ECG and invasive methods like thermodilution that
Electrocardiography (ECG) is a simple, inexpensive shown promising results in favor of ECG4,5. With the
and noninvasive method to monitor the changes technology improvement wearable devices with ECG
of electrical impedance in thorax which is due to sensors are designed to facilitate recordings in long term
the periodic changes of blood volume in aorta. An and offer comfort to the patients6. Since the initiation of
appropriate thorax model can be used to estimate ECG there has been an increased in the improvement of
Stroke Volume (SV), Cardiac Output (CO) and technique reliability and cardiac parameters7-9.
other hemodynamic parameters1,2. In the ECG field
Impedance Plethysmography3 methods are used to study During the extraction the ECG signals are influenced
the fluids flow in the cardiac area. Several comparative by physiological and non-physiological artifacts. The
tiny features of the desired signal components are masked
by the artifacts and causes ambiguities during diagnosis.
The major artifacts contaminated with the desired ECG
Corresponding Author: components are Sinusoidal Artifacts (SA), Respiratory
Asiya Sulthana Artifacts (RA), Muscle Artifacts (MA) and Electrode
Research Scholar, Department of Electronics and Artifacts (EA). These artifacts should be removed to
Communication Engineering, obtain high resolution ECG signal for estimating stroke
Koneru Lakshmaiah Education Foundation, volume and intensity. As the artifacts are not stationery
Greend Fileds, Vaddeswaram, in nature and hence, we can’t predict the characteristics
Guntur-522502, A.P., India of artifacts, so conventional filters with fixed coefficient
Email: asiyasulthana1984@gmail.com are not preferable for filtering. So that adaptive filtering
techniques are preferable to update the filter weights in

according to the statistical nature of the signal and noise
component10.
In [11-12] conventional Least Mean Square (LMS)

and Recursive Least Square (RLS) adaptive algorithms
are used to enhance the ECG signal resolution. But the
drawbacks of these algorithms are high steady state
error, and impulsive noise. To resolve these drawbacks
and to enhance the performance of artifact cancelation
we developed several Adaptive signal enhancement
units (ASEUs) based on some hybrid variants of LMS.
With these hybrid algorithms we can also achieve less
computation complexity. In [13-15] Rahman et al.
proposed some adaptive noise cancellers to enhance the Figure 1: A typical adaptive signal enhancement unit
cardiac signal and brain activity using several variants of
LMS. In this paper, we considered the same framework Here we developed several strategies for weight
for the development of ECG signal filtering techniques. update mechanism. First consider a conventional LMS11
based adaptive filter with tap length N. The input to the
The performance of ASEUs for ECG analysis in a ASEU is raw ECG signal u(n), it contains desired signal
typical health care sensing system can be improved by Z(n) as well as noise components R(n). r(n) is reference
various hybrid techniques. Signal enhancement capability, signal correlated with R(n) generated by the reference
convergence rate, and computational complexity are generator is applied as input to the FIR filter. Let w(n)
the interesting characteristics in any typical health care is the impulse response of the FIR filter, y(n) be the FIR
sensing system. The basic adaptive algorithm is Least filter output, d(n) be the error signal generated in the
Mean Square (LMS) algorithm. High steady state error ASEU. The weight updating mechanism for an LMS
and impulsive noise are the main drawbacks of LMS based ASEU can be mathematically written as,
algorithm. To overcome these drawbacks, we proposed
w(n+1) = w(n)+ α u(n)d(n) …(1)
Median LMS (MLMS) algorithm. In this paper further
to improve convergence rate, filtering capability and to Where, w(n) = [w0(n) w1(n) … wN-1(n)]t is the nth
reduce computational complexity we also implemented tap weight vector, u(n) = [u(n) u(n−1) … u(n−N +1]t is
various sign versions of MLMS algorithms. The various input sequence, d(n) = u(n)-wt(n)r(n) and ‘α’ represents
variants of MLMS algorithms are Sign Regressor a step-size.
MLMS (SRMLMS) algorithm, Sign MLMS (SMLMS)
algorithm and Sign Sign MLMS (SSMLMS) algorithm. Median LMS Algorithm (MLMS): The performance
The algorithms implementation is discussed in the next of the LMS algorithm and its derivatives is significantly
section. Based on the simulation results the SRMLMS degraded when it is subjected to input signals that are
based ASEUs perform well than remaining variants. influenced by impulsive noise, sometimes this leads to
instability. This problem can be overcome by using a
Enhancement of Electrocardiography signals using nonlinear filter to smoothing the noisy gradient components.
Hybrid Techniques: During the extraction, the ECG This modification leads to median LMS [16].
signal is influenced by several artifacts that cause
ambiguity in the diagnosis. Hence the artifacts should be The weight updating mechanism for an MLMS
eliminated in order to estimate accurate hemodynamic based ASEU can be mathematically written as,
parameters of ECG. Adaptive filtering techniques are w(n + 1) = w(n) + α.medL [u(n)d(n), u(n − 1)d(n −
used to remove the non-stationary artifacts. Figure 1 1) ……u(n − L)d(n − L)] …(2)
shows the typical block diagram ASEU. It consists of
FIR filter and weight update mechanism. In this paper This algorithm is normalized with reference to
several signal processing techniques are proposed for data vector results Normalized Median LMS algorithm
developing various ASEUs. (NMLMS) algorithm. In this algorithm the fixed step
size varies with respect to the input data samples, i.e., with SA, RA, MA and EA. Various SEUs for ECG
a is replaced with a(n). The weight update equation for enhancement is developed using the LMS, NMLMS,
NMLMS is given by, SRNMLMS, SNMLMS, SSNMLMS algorithms. In the
evaluation procedure of the proposed techniques, we
w(n + 1) = w(n) + α(n).medL [u(n)d(n), u(n − 1)d considered Signal to Noise Ratio Improvement (SNRI)
(n − 1) ……u(n − L)d(n − L)] …(3) for our experiments, averaged and compared with
conventional LMS based Adaptive Signal Enhancement
Where, the step size parameter is written as, Unit (ASEU). Tables 1 give the characteristics of
proposed implementations. Due to space limitation
a we have shown the experimental results only for two
α(n) = c + || u (n) ||2
artifacts. The experimental results of artifact cancellation
Sign variants of NMLMS: Here, we developed new are shown in Figure 2, Figure 3, Figure 4, Figure 5
algorithms that use signum [17] of either the error signal respectively for SA, RA, MA and EA.
components, the input signal components, or both,
have been derived from the various NMLMS based Filtering of Sinusoidal Artifacts (SA) Using Adaptive
adaptive algorithms for simple implementation. Hence, Algorithms: In this experiment SA components are
computation time will be reduced particularly the time removed from input raw ECG. This is given as input to
required for “multiply and accumulate” (MAC) operations ASEU shown in Figure 1. The reference signal is generated
[86]. The sign-based techniques result in the reduction of from the reference generator which is correlated to SA.
the computational complexity of the filter and, therefore, Based on error value the adaptive algorithm associated
is suitable for biotelemetry applications. In this paper with the ASEU automatically updates the of FIR filter
we developed three sign variants of NMLMS namely coefficients. The performances of these implementations
Sign Regressor NMLMS (SRNMLMS), Sign NMLMS are compared with reference to SNRI. These are averaged
(SNMLMS) and Sign Sign NMLMS (SSNMLMS). The for four experiments for each artifact and are tabulated in
weight updating mechanism for these three variants is as Table 1. Based on these performance measures it may be
follows respectively. concluded that SRNMLMS based ASEU performs better
in SA filtering of ECG signals. Hence, this technique is
w(n + 1) = w(n) + α(n).medL [d(n)Sign{u(n)}, d(n − 1) recommendable for the implementation in real time health
Sign{u(n − 1)} …d(n − L)Sign{u(n − L)}] …(4) care monitoring devices.
w(n + 1) = w(n) + α(n).medL [Sign{d(n)}u(n), Sign

{d(n − 1)} u(n − 1) …Sign {d(n − L)} u(n − L)] …(5)
w(n + 1) = w(n) + α(n).medL [Sign{d(n)}

Sign{u(n)}, Sign{d(n − 1)} Sign{u(n − 1)} …Sign{d(n
− L)} Sign{u(n − L)}] …(6)
Where
{ }
1 : u(n) > 0
Sign{u(n)} = 0 : u(n) = 0 …(7)
−1 : u(n) < 0)
Simulation Results
To demonstrate that the proposed algorithms are Figure 2: Typical ECG enhancement results of SA
cancelation (a) ECG signal contaminated with SA
truly effective in clinical situations, the method has been
(b) ECG filtered with LMS algorithm, (c) ECG
validated using various ECG recordings taken from filtered with NMLMS algorithm, (d) ECG filtered
the MIT-BIH data base. In our simulation experiment with SRNMLMS algorithm, (e) ECG filtered
we have taken four ECG recordings (1,2,3,4, 5) from with SNMLMS algorithm, (f) ECG filtered with
five different persons. These records are contaminated SSNMLMS algorithm.
Filtering of Respiration Artifact (RA) using Adaptive

Algorithms: In this experiment RA components are
removed from input raw ECG. This is given as input
to ASEU shown in Figure 1. The reference signal
is generated from the reference generator which is
correlated to RA. Based on error value the adaptive
algorithm associated with the ASEU automatically
updates the of FIR filter coefficients. Figure 2 shows the
simulation results for removal of RA. The performances
of these implementations are compared with reference
to SNRI and is shown in Tables 1. By comparing the
performance measures among all the algorithms, it seems Figure 4: Typical ECG enhancement results of MA
as SRNMLMS based ASEU is better with reference to cancelation (a) ECG signal contaminated with MA
the filtering ability. Hence, these realizations are well (b) ECG filtered with LMS algorithm, (c) ECG
suited for real time implementations. filtered with NMLMS algorithm, (d) ECG filtered
with SRNMLMS algorithm, (e) ECG filtered
Filtering of Muscle Artifact (MA) using Adaptive with SNMLMS algorithm, (f) ECG filtered with
Algorithms: In this experiment MA components are SSNMLMS algorithm
removed from input raw ECG. This is given as input Filtering of Electrode Artifact (EA) using Adaptive
to ASEU shown in Figure 1. The reference signal Algorithms: In this experiment EA components are
is generated from the reference generator which is removed from input raw ECG. This is given as input
correlated to MA. Based on error value the adaptive to ASEU shown in Figure 1. The reference signal
algorithm associated with the ASEU automatically is generated from the reference generator which is
updates the of FIR filter coefficients. Figure 3 shows the correlated to EA. Based on error value the adaptive
algorithm associated with the ASEU automatically
simulation results for removal of MA. The performances
updates the of FIR filter coefficients. The performances
of these implementations are compared with reference of these implementations are compared with reference
to SNRI and tabulated in Table 1. By comparing the to SNRI. These are averaged for four experiments for
performance measures among all the algorithms, it each artifact and are tabulated in Table 1. By comparing
seems as SRNMLMS based ASEU is found to be better. the performance measures among all the algorithms,
Hence, these realizations are well suited for real time it seems as SRNMLMS based ASEU is better with
implementations. reference to SNRI. Hence, these realizations are well
suited for real time implementations.
Figure 3: Typical ECG enhancement results of RA Figure 5: Typical ECG enhancement results of EA
cancelation (a) ECG signal contaminated with RA cancelation (a) ECG signal contaminated with EA
(b) ECG filtered with LMS algorithm, (c) ECG (b) ECG filtered with LMS algorithm, (c) ECG
filtered with NMLMS algorithm, (d) ECG filtered filtered with NMLMS algorithm, (d) ECG filtered
with SRNMLMS algorithm, (e) ECG filtered with SRNMLMS algorithm, (e) ECG filtered
with SNMLMS algorithm, (f) ECG filtered with with SNMLMS algorithm, (f) ECG filtered with
SSNMLMS algorithm SSNMLMS algorithm
Table 1: SNRI computations for various filtering techniques during ECG enhancement (all values in dBs).
Noise Rec. no LMS MLMS SRMLMS SMLMS SSMLMS

101 7.7763 22.2643 21.7235 18.3720 16.7284
102 9.1878 22.8621 21.9876 18.6982 16.9785
SA 102 8.5084 22.7268 21.8652 18.5685 16.8624
104 9.0063 22.8235 21.9468 18.6548 16.9462
105 7.3824 22.1268 21.6985 18.3265 16.3685
101 4.2598 9.2748 7.9348 6.2749 5.4289
102 4.7682 9.6482 8.2685 6.5692 5.8628
RA 102 4.8275 9.7928 8.3862 6.6785 5.8935
104 4.6124 9.6125 8.1388 6.5246 5.8492
105 4.4523 9.5862 7.9864 6.4862 5.8156
101 3.7605 8.3484 7.3971 6.2393 5.4598
102 3.9652 8.6582 7.6985 6.6289 5.7928
MA 102 4.0395 8.7868 7.8462 6.8625 5.8646
104 4.0008 8.4682 7.8259 6.8262 5.8368
105 4.0137 8.5467 7.8346 6.8426 5.8136
101 4.6511 11.4585 10.4395 9.4586 8.3483
102 4.8438 11.7864 10.6873 9.6875 8.6858
EA 102 4.6617 11.4898 10.6268 9.6426 8.3685
104 4.7782 11.7463 10.6482 9.4732 8.3795
105 4.8083 11.7628 10.6857 9.6782 8.6782
Conclusion References
In this paper several efficient adaptive signal 1. B. H. Brown et al, “Cardiac and respiratory related
enhancement techniques are developed for ECG signal electric impedance changes in the human thorax,”
enhancement. In order to achieve convergence speed IEEE Trans. Biomed. Eng., 41(8), (1994), pp.
and enhancement capability we are used various ASEUs 729-723.
based on LMS, NMLMS, SRNMLMS, SNMLMS and 2. Shyu Liang-Yu, Chiang Chia-Yin, Liu Chun-Peng,
SSNMLMS algorithms. These techniques are tested in Hu Wei-Chih. “Portable Impedance Cardiogra-
real time to eliminate artifacts like SA, RA, MA and EA phy System for Real-Time Noninvasive Cardiac
from desired ECG signals. The experimental results are Output Measurement”., Journal of Medical and
shown in figures 2-5. From the experimental results we Biological Engineering, 20(4), (2000), pp. 193-
can conclude that SRMLMS based ASEU is better with 202.
reference to filtering ability and SNRI. Hence, these
realizations are well suited for real time applications. 3. G. D. Jindal et al, “Corrected formula for
estimating peripheral blood flow by impedance
Conflict of Interest: Nil plethysmography,” Med. Biol. Eng. Comput., 32,
(1994), pp. 625-628.
Source of Funding: Self
4. W. Nechwatal, P. Bier, A. Eversmann, and E.
Ethical Clearance: My research article what we have Knig, The noninvasive determination of cardiac
written is completely self-depended which enrolls output by means of impedance cardiography:
complete research depended on the prototype of each Comparative evaluation with a thermal dilution
individual so it doesn’t match any other research technique. Basic Research in Cardiology 71, 542
proposals/research persons. (1976).
5. J. C. Denniston, J. T. Maher, J. T. Reeves, J. C. Cruz, 12. O. Dromer, O. Alata, and O. Bernard, Impedance
A. Cymerman, and R. F. Grover, Measurement of cardiography filtering using scale fourier linear
cardiac output by electrical impedance at rest and combiner based on RLS algorithm, IEEE EMBS,
during exercise. Journal of Applied Physiology 4, September (2009).
140 (2011).
13. G. V. S. Karthik, S. Y. Fathima, M. Z. U. Rahman,
6. J. Carlos Mrquez Ruiz, Sensor-based garments S. R. Ahamed, and A. Lay- Ekuakille, Efficient
that enable the use of bioimpedance technology: signal conditioning techniques for brain activity in
Towards personalized healthcare monitoring. remote health monitoring network. IEEE Sensors
Doctoral Thesis, Stockholm, Sweden, January Journal 13, 3276 (2013).
(2013), ISBN 978-91-7501-603-0.
14. Md. Zia Ur Rahman, G. V. S. Karthik, S. Y.
7. C. V. Parmar, Divyesh L. Prajapati, P. A. Fathima, and A. Lay-Ekuakille, An efficient
Gokhale, H. B. Mehta, and C. J. Shah, Study of cardiac signal enhancement using time-frequency
cardiac output based on non-invasive impedance realization of leaky adaptive noise cancelers
plethysmography in healthy volunteers. Innovative for remote heath monitoring systems. Elsevier
Journal of Medical and Health Science 2, 104 Measurement 43, 3815 (2013).
(2012).
15. I. Soumya, Md. Zia Ur Rahman, D. V. R. K. Reddy
8. E. Pinheiro, O. Postolache, and P. Giro, Contactless and A. Lay-Ekuakille, Efficient block processing
impedance cardiography using embedded sensors. of long duration biotelemetric brain data for health
Measurement Science Review 13 (2013). care monitoring. Review of Scientific Instruments
86, 035003-1-10 (2015).
9. D. C. Yilmaz, B. Buyukakilli, S. Gurgul, and I.
R. Mersin, Adaptation of heart to training: A 16. K.F. Wan ; P.C. Ching, “A fast response split-
comparative study using echocardiography and path median LMS algorithm”, IEEE Transactions
impedance cardiography in male and female on Circuits and Systems II: Analog and Digital
athletes. The Indian Journal of Medical Research Signal Processing, 43(4), (1996),pp. 344 – 346.
137, 1111 (2013).
17. M. Z. U. Rahman, S. R. Ahamed, and D. V. R.
10. A. N. Ali, Advanced Bio Signal Processing, K. Reddy, “Efficient sign based normalized
Springer Verlag, Berlin, Germany (2009). adaptive filtering techniques for cancellation of
artifacts in ECG signals : Application to wireless
11. Vinod K. Pandey and Prem C. Pandey, Cancellation
biotelemetry,” Signal Process., 91, (2011), pp.
of respiratory artifact in impedance cardiography.
225–239.
EMBS, IEEE (2005).
Evaluation of the Baby Friendly Hospital Initiative

Programme in Two Hospitals Designated “Baby-Friendly” in
Kirkuk City, Iraq
Fakher Abobaker Ahmed Gli1, Dale Spence2, Linda Johnston3, Finoa Lynn4, Richard Tubman5, Ziad
Mohammad Sadiq6
1
College of Nursing, Kirkuk University, Iraq; 2Senior Lecturer, Queen’s University Belfast, UK; 3University
of Toronto, Canada; 4Lecturer, Queen’s University, Belfast, UK; 5Consultant Neonatologist, Belfast Trust,
UK; 6College of Medicine, Kirkuk University, Iraq
Abstract
Background: Although the Baby Friendly Hospital Initiative (BFHI) was implemented in Iraq since 1992, a
remarkable regression in exclusive breastfeeding has been highlighted by UNICEF (2011). Kirkuk province
has experienced the lowest rate of breastfeeding initiation in the first hour of life, with higher neonatal and
under five years mortality rates. International organizations have recommended a focus on breastfeeding
practices and strengthening the implementation and monitoring of BFHI program in Iraqi provinces.
Method: Two-phase study was carried-out in two-designated Baby-Friendly hospitals (Azadi Teaching
Hospital and Kirkuk General Hospital), using a standardized questionnaire. Monitoring BFHI tools utilised to
measure the compliance with BFHI. Carolina B-KAP survey questionnaires were used to assess knowledge,
attitudes, and practices of clinical and non-clinical staff and to measure the components of Organisational
Readiness for Change (ORC) theory through practical and theoretical knowledge of hospitals processes. The
Chi-square test of independence was performed to test for group differences in the responses to the Carolina
B-KAP questionnaire.
Results: There was compliance in both hospitals with step 1,7 and 10 of the Ten Steps to Successful
Breastfeeding, and the International Code of Marketing Breastmilk Substitutes (the Code). However, a
non-compliance with step 3, 4, 5,6,8 and 9 were present. KGH also showed non-compliance with step 2
(training on BFHI). A total of 143 participants (124 clinical and 19 non-clinical) responded to the survey.
ATH were more likely to have greater knowledge of infant feeding, than respondents working in KGH
(p<0.05). Responses indicated that (61.7%) of participants reported that healthy full-term newborns within
their care had started to breastfeed within 60 minutes after birth. In terms of matching infant feeding with
appropriate clinical support plans, the results show that respondents agreed or strongly agreed on the need
for additional guidance and training (78.3%).
Conclusion: Increased compliance with the BFHI programme can have positive impact on breastfeeding
initiation, duration and exclusivty. Maternity departments in Kirkuk hospitals must fully implement Baby
Friendly Hospital Initiative to support an increase in exclusive breastfeeding rates. Also, implimenttion of
Baby Friendly Community Initiative (BFCI) can provide community support for breastfeeding.
Keywords: Baby Friendly Hospital Initiative (BFHI), the Ten Steps to Successful Breastfeeding, International
Code of Marketing Breastmilk Substitutes (the Code), Organisational Readiness for Change (ORC).
Introduction
Corresponding Author: The Baby Friendly Hospital Initiative (BFHI) is
Fakher Abobaker Ahmed Gli evidence-based practice programme initiated in 1991
College of Nursing, Kirkuk University, Iraq by the United Nations Children’s Fund (UNICEF) and
Email: fgli01@qub.ac.uk, gliahmed@uokirkuk.edu.iq World Health Organisation (WHO), and its designated to
increase the rates of initiation, duration and exclusivity 2009. This process was designed based on the BFI quality
of breastfeeding worldwide.1 BFHI consist of the Ten cycle (Figure 1).3 Changing staff attitudes continues to
Steps for Successful Breastfeeding, and the International be the greatest challenge to those hospitals that wish
Code for Marketing of Breastmilk Substitutes which is a to achieve Baby-Friendly certification.4 Organisational
key element of the international standard for promoting, readiness for change (ORC) is key factor in the effective
protecting and supporting breastfeeding.2 The BFH implementation of new strategies, programs and
assessment process, otherwise known as the BFH practices in healthcare facilities.5 ORC embodies two
designation process or accreditation, consists of a set of important principles for the implementation of change,
tools initiated in 1991 and revised and updated in 2006 to collective efficacy and collective commitment.6,7
Figure 1: Baby Friendly Initative quality cycle.3 (p.5)
The BFHI was first implemented in Iraq in 1992, report by the International Baby Food Action Network
including the city of Kirkuk. 8 The Multiple Indicator (IBFAN).10
Cluster Survey (MICS4) conducted by UNICEF 9
indicated a marked regression in breastfeeding since Two main gaps have been identified through the
2004 with record low rates of exclusive breastfeeding literature review. First, there is a dearth of studies which
and duration of breastfeeding at 19.6% (as compared apply Organisation Readiness for Change (ORC) theory
with 30.9% in 2004) and 13.8% (as compared with to assess clinical and non-clinical staffing levels required
15% in 2004), respectively. Kirkuk province had lower to deliver the BFHI programme. Second, few researchers
initiation rate of breastfeeding within one hour (10%) have sought to understand how the organisational
than in any other Iraqi province, while the mortality rate cultures of individual hospitals influence compliance
for children under five (51 per 1,000 live births) was with the Ten Steps to Successful Breastfeeding and the
higher in Kirkuk than in any other Iraqi provinces and the Code. The aims of this paper, therefore, are as follows:
neonatal mortality rate was 32%.9 The evidence-based 1. To determine if the two BFHI designated hospitals
report by the U.S. Agency for International Development in Kirkuk have sustained adherence to the Ten
(USAID)9 stressed the importance of conducting a study Steps to Successful Breastfeeding and the Code.
into breastfeeding practices in health institutions and
2. To assess the levels of support reported by clinical
communities in Iraq, and proposed a further evaluation
and non-clinical staff to successfully deliver the
of the BFHI in Iraq.8 This also recommended by a
BFHI programme.
Material and Method used to assess these aspects in clinical and non-clinical
staff (were 125 employees in ATH and 105 in KGH by
A quantitative approach was carried out in the using self-selecting convenience sample) in relation to the
maternity departments of two public hospital, Azadi BFHI, and to measure the components of Organisational
Teaching Hospital (was accredited as a Baby Friendly Readiness for Change (ORC) theory through practical and
Hospital in June 2014) and Kirkuk General Hospital theoretical knowledge of hospitals processes.
(was in the final stage of accreditation), in the city of
Kirkuk, Iraq. Both hospitals had high birth rates (13,000 Data Analysis: Descriptive statistics were utilised as
and 15,000 births respectively in 2014). per the UNICEF/WHO guidance for data analysis.
Summarising the data and interpretation of the finding
The standardized instrument Monitoring Baby of the Monitoring Baby Friendly Hospital tool,
Friendly Hospitals tools, gathered hospital level data including the questionnaire for breastfeeding mothers,
regarding the implementation of BFHI. This mechanism was undertaken to identify the level of the hospital’s
was used to confirm the hospital’s commitment to adherence with BFHI steps. The data from Carolina
Step 1 (policy) and Step 2 (training) of the Ten Steps B-KAP questionnaires were entered and analysed by the
to Successful Breastfeeding and the Code. The researcher using SPSS program.
questionnaires for breastfeeding mothers [interview of
60 postpartum mothers (experienced vaginal birth or
Findings
caesarean section birth) across the two participating
hospitals through stratified sampling on random basis] The results of Monitoring Baby Friendly Hospitals
were used to confirm the hospital’s commitment to the tool revealed a partial commitment to providing maternal
Steps 3 to 10, of the Ten Steps. and infant health services under the BFHI program in
Azadi Teaching Hospital (ATH), (Table 1) and Kirkuk
A survey utilized Carolina B- knowledge, attitudes and
General Hospital (KGH) (Table 2).
practices (Carolina B-KAP) questionnaires Nickel 11 were
Table 1: Monitoring of the BFHI in Azadi Teaching Hospital
Question Compliance
Steps Minimum Requirement Needed Findings from ATH
Code Statues
1.1 YES YES
S1 1.2 YES YES YES
1.3 YES YES
2.1 At least 80% of the BFHI clinical staff + 3h. clinical 97% (n= 110) +YES
S2 2.2 YES YES YES
2.3 YES Needs Improvement
S3 3.1 70% 0%(n=0) NO
4.1 70%(n=21)
4.2 At least 80% on 3 items and 70% on 2. 73%(n=22)
S4 4.3 The second item can be reduced to 50% in a special 73%(n=22) NO
4.4 circumstance 13%(n=04)
4.5 73%(n=22)
5.1 70%(n=21)
5.2 57%(n=17)
S5 5.3 At least 80% on 3 items and 50% on 2 33%(n=10) NO
5.4 57%(n=17)
5.5 Not Included
S6 6.1 80% 67%(n=20) NO
Conted…
S7 7.1 80% 97%(n=29) YES

8.1 80% 63%(n=19)
S8 NO
8.2 80% 47%(n=14)
9.1 80% 40%(n=12)
S9 NO
9.2 80% 77%(n=23)
10.1 80% 90%(n=27)
S10 YES
10.2 80% 87%(n=26)
The C.1 YES YES
YES
Code C.2 80% 100%(n=30)
Table 2: Monitoring of the BFHI in Kirkuk General Hospital
Question Findings from Compliance

Steps Minimum Requirement Needed
Code KGH statues
1.1 YES YES
S1 1.2 YES YES YES
1.3 YES YES
2.1 At least 80% of the BFHI clinical staff + 3h. clinical 74% (n= 69) +YES
S2 2.2 YES YES NO
2.3 YES Needs Improvement
S3 3.1 70% 0%(n=0) NO
4.1 67%(n=20)
4.2 At least 80% on 3 items and 70% on 2. 70%(n=21)
S4 4.3 The second item can be reduced to 50% in a special 70%(n=21) NO
4.4 circumstance 03%(n=01)
4.5 77%(n=23)
5.1 83%(n=25)
5.2 90%(n=27)
S5 5.3 At least 80% on 3 items and 50% on 2 80%(n=24) NO
5.4 47%(n=14)
5.5 Not Included
S6 6.1 80% 67%(n=20) NO
S7 7.1 80% 97%(n=29) YES
8.1 80% 43%(n=13)
S8 NO
8.2 80% 37%(n=11)
9.1 80% 70%(n=21)
S9 NO
9.2 80% 97%(n=29)
10.1 80% 93%(n=28)
S10 YES
10.2 80% 93%(n=28)
The C.1 YES YES
YES
Code C.2 80% 100%(n=30)
Survey Results Knowledge of infant feeding: The results in (Table

3) show that for items 1-3 and 6, respondents working
The response rate was 62% across both hospitals in ATH were more likely to have greater knowledge
with 143 participants in total (124 clinical and 19 non- of infant feeding, as they responded correctly to these
clinical staff). items, than respondents working in KGH (p<0.05).
Table 3: Group differences in knowledge of infant feeding: ATH versus KGH
Items df P-value
1. Breastfeeding too frequently can cause sore nipples 5.841 1 0.016
2. Maternal body temperature 8.538 1 0.003
3. Hospital policies that interfere with breastfeeding 24.557 4 0.000
4. Latching during breastfeeding 6.664 4 0.155
5. Encouraging successful breastfeeding 11.337 4 0.023
6. Acceptable medical reason to supplement a breastfeeding infant in the hospital 12.372 4 0.015
7. Optimal duration for exclusive breastfeeding 8.826 3 0.032
Practices in mother-baby care: Only clinical staff (n=124) responded to the 11 items relating to practices in
mother-baby care, which included questions about counselling and clinical practice. Most of the respondents (77.4%,
n=96) always recommend breastfeeding to the mothers in their care who have not decided how to feed their babies.
Responses indicated that (61.7%, n=58) of participants (out of 88 participants involved with Labor and delivery care)
reported that healthy full-term newborns within their care had started to breastfeed within 60 minutes after birth.
Attitudes toward commitment and ability in the workplace: The participants responded to 15 questions which
measured the components of Organisation Readiness for Change (ORC) across five categories. The first category
related to their opinion about clinical staff in the maternity facility where they work and whether they needed
additional guidance (Table 4). In terms of matching infant feeding with appropriate clinical support plans, the results
show that respondents agreed or strongly agreed on the need for additional guidance or training (78.3%, n=112).
Table 4: Attitude towards commitment and ability in the workplace (N=143)
Strongly Slightly Slightly Strongly

Disagree Agree
Items Disagree Disagree Agree Agree
N (%) N (%) N (%) N (%) N (%) N (%)
In my opinion, clinical staff in the maternity
facility where I work need additional
guidance/training/skills in:
Matching infant feeding plans with 15
0.0 (0.0) 1 (.7) 12 (8.4) 73 (51.0) 39 (27.3)
appropriate clinical support. (10.5)
Counselling/teaching all pregnant women
about the benefits and practices of 1 (.7) 6 (4.2) 3 (2.1) 13 (9.1) 66 (46.2) 48 (33.6)
breastfeeding.
Referring patients to breastfeeding resources
14 (9.8) 9 (6.3) 8 (5.6) 11 (7.7) 49 (34.3) 44 (30.8)
in the community at discharge.
Discussion non-compliance with many steps of the Ten Steps

to Successful Breastfeeding. Specifically, a non-
Increases in exclusive breastfeeding rates compliance in KGH in relation to step 2 was due to the
are associated with high compliance with BFHI low proportion of clinical staff who had participated in
practices.12 Participated hospitals in this study showed
the training courses, which was below the required rate implementation of the BFHI. Training on BFHI develops
set by the UNICEF and WHO guideline. the knowledge and skills of staff concerned. Community
support of optimal breastfeeding practices in Kirkuk is
There was a non-compliance in both hospitals with needed through implementation of the Baby Friendly
Step 3. Given that the total number of births in both Community Initiative (BFCI) to increase the rates of
hospitals for 2014 exceeded 28000, a small prenatal exclusive breastfeeding at six months.
clinic in both hospitals cannot be expected to cover Step
3. This finding is consistent with the result obtained by Conflict of Interest: Nil
Zakarija-Grkovic 13 as a minimum compliance with the
same step was reported. Source of Funding: This study was funded by the
official representative of the Iraqi Ministry of Higher
The knowledge of participated hospitals staff Education and Scientific Research (MOHESR) in the
was varied according to the hospitals as there is a gap UK and Ireland.
in knowledge to support breastfeeding, respondents
working in ATH were more likely to have greater Ethical Clearance: Ethical approval and permission
knowledge of infant feeding. This can be linked to lack to access participants was obtained from the School of
of training in KGH when that hospital showed non- Nursing and Midwifery Research Ethics Committee,
compliance with step 2 of the BFHI. A study on BFHI Queen’s University Belfast and the Ministry of Health
confirmed that lack of health training affects the rate of in Iraq.
correct answers on breastfeeding knowledge.14
References
The rate of initiation of breastfeeding (within first
hour of birth) in accredited (BFHI) hospitals is greater 1. McKeever J, Fleur R. Overcoming Barriers to
Baby-Friendly Status: One Hospital’s Experience.
than those of non-accredited.15,16 Based on the opinion
Journal of Human Lactation. 2012; 28(3):312-14.
of staff working in labour and delivery care, our findings
showed that up to 61.7% of healthy, full-term newborns 2. Cleminson J, Oddie S, Renfrew M, McGuire, W.
initiate breastfeeding within the first hour of birth. This Being baby friendly: evidence-based breastfeeding
rate is significantly assocciated with respondents from support. Archives Of Disease In Childhood Fetal
KGH (p<0.05). A survey in the District of Shaqlawa, & Neonatal Edition. 2015; 100 (2):F173-78.
Erbil, Iraq, found a statistically significant relationship 3. UNICEF, WHO. Baby Friendly Hospital Initiative.
between delivery in BFHI hospitals and initiation of New Zealand: New Zealand Breastfeeding
breastfeeding.17 Authority (NZBA); 2014. 27 p. Part One.
Readiness in healthcare organisations is required 4. Heads J. The baby friendly hospital initiative: A
before implementing evidence-based interventions.18,19 case study from NSW. New South Wales Public
Changing staff attitudes requires time and remains the Health Bulletin. 2005; 16(3-4):63-6.
greatest challenge for those wishing to attain Baby
5. Shea C, Jacobs S, Esserman D, Bruce K, Weiner J.
Friendly certification.1,4 Our findings indicated that
Organizational readiness for implementing change:
the clinical staff require more guidance, training and a psychometric assessment of a new measure.
skills in terms of matching infant feeding plans with Implementation Science. 2014; 9(7):1-15.
appropriate clinical support plans (78.3%). This result
was significantly associated with the respondents 6. Weiner B J. A theory of organizational readiness
working at KGH, and those in the age group 31-40 years for change. Implementation Science. 2009; 4:1-9.
(p<0.05). 7.
Hannon P, Helfrich C, Chan K, Allen C,
Hammerback K, Kohn M, et al. Development
Conclusion and Pilot Test of the Workplace Readiness
Questionnaire, a Theory-Based Instrument
Maternity departments in kirkuk must fully to Measure Small Workplaces’ Readiness to
implement Baby Friendly Hospital Initiative. Implement Wellness Programs. American Journal
Organisational Readiness for Change is vital in successful of Health Promotion. 2017;31(1):67-75.
8. USAID. Compilation of Available Data on Infant hospitals. Journal of the Pakistan Medical
and Young Child Feeding in Iraq. 2005. 30 p. Association. 2010; 60(10):881–86.
Final report.
15. Hawkins S, Stern A, Baum C, Gillman M.
9.
UNICEF. Multiple Indicator Cluster Survey Evaluating the impact of the Baby-Friendly
(MICS4). 2011. 196 p. Final report. Hospital Initiative on breast-feeding rates: a
multi-state analysis. Public Health Nutrition.
10.
International Baby Food Action Network
2015; 18(2):189-97.
(IBFAN). REPORT ON THE SITUATION OF
INFANT AND YOUNG CHILD FEEDING IN 16. de Carvalho M, Boccolini C, de Oliveira M,
IRAQ.Geneva Infant Feeding Association. 2015. Leal M. The baby-friendly hospital initiative and
10 p. Session 68. breastfeeding at birth in Brazil: a cross sectional
study. Reproductive Health. 2016; 13:208-15.
11. Nickel N. Breastfeeding friendly healthcare: A
mixed methods evaluation of the implementation 17. Shaker N, Hasan S, Ismail Z. Impact of a Baby-
and outcomes of maternity practices to support Friendly hospital on breastfeeding indicators in
breastfeeding. North Carolina. 2011. Shaqlawa district in Erbil governorate, Kurdistan
region of Iraq. Eastern Mediterranean Health
12. Spaeth A, Zemp E, Merten S, Dratva J. Baby-
Journal. 2015; 21(12):885-90.
Friendly Hospital designation has a sustained
impact on continued breastfeeding. Maternal & 18. Hagedorn J, Heideman W. The relationship
Child Nutrition. 2018; 14,1:1-12. between baseline Organizational Readiness
to Change Assessment subscale scores and
13. Zakarija-Grković I, Boban M, Janković S, Ćuže
implementation of hepatitis prevention services in
A, Burmaz T. Compliance With WHO/UNICEF
substance use disorders treatment clinics: A case
BFHI Standards in Croatia After Implementation
study. Implementation Science. 2010; 5(46):2-12.
of the BFHI. Journal of Human Lactation. 2018;
34,1:106-115. 19. Attieh R, Gagnon M, Estabrooks C, Légaré
F, Ouimet M, Vazquez P, et al. Organizational
14. Hanif R., Khalil E., Sheikh A, Harji A, Haris, S,
readiness for knowledge translation in chronic
Rasheed W, et al. Knowledge about breastfeeding
care: a Delphi study. BMC Health Services
in accordance with the national policy among
Research. 2014; 14(1):534.
doctors, paramedics and mothers in baby-friendly
The Combinatory the Effect of Healthy Educational Programs

with Kinect Simulation Device on Learning some of Basketball
Skills
Mohammed Shihab Ahmed1, Mayyadah Khalid Jasim1

1
Department of Physical Education and Sport Sciences, Faculty of Basic Education, Mustansiriyah
University, Baghdad, Iraq
ABSTRACT
The problem that led to this research is derived from neglecting the use of alternative modern methods of
learning that simulate the intellectual capabilities of the ones who learn, which urged the researcher to shade
the light on this dilemma and try to find the optimal solutions. The researcher had used the experimental
approach; as the research sample was represented by the first year students of Physical Education and Sports
Sciences, College of Basic Education- Al-Mustansiriya University for the academic year (2016-2017).
The research’s sample was selected randomly, and the sample divided into three halls, where hall no. (1),
represented the second experimental group, whom were taught by using the educational program made by
the researcher, while hall no. (2) held the research sample that been taught the skills via the educational
program combined with the kinetic simulator device while hall no.(3) held the control group which being
taught using the old routine. After the set of the educational units of each skill that being studied for the
experimental groups according to the specificity of the educational program along with the simulator device.
Each group was examined pre and post testing. The data were collected and analyzed statistically via SPSS
Keywords: Simulator Kinect, Basketball. Health programs.
Introduction game that basketball demands special requirements

depending on a modern alternative educational methods
The world is of a fast development in various fields, that simulate the intellectual capabilities of the learners,
this had built a burden of accumulation of responsibilities one of these effective methods is the kinetic simulator
and duties. Which results in a noticeable increase in the device which is considered as the basics of learning,
numbers of those who participate sport activities, one of therefore the research use the device along with a
those activities is basketball that considered of one of the specially set educational program proposed by the
most popular sport around the globe due to its physical, researcher. As such educational alternative method is
intellectual, and skillful properties, nevertheless the crucial in learning skills, especially those of basketball,
presence of excitement and thrilling elements for the that they are exhibited as fast rhythm characterization
players and the audience as well. and transition between the attacking and defensing
positions, therefore it calls for the use of methods
Accordingly it requires concentration on good produce diversity in performance
planning for educational process hence preparation of
great educational curricula related specified to each As a sum of all the above, came the importance
of proposing this research in preparing an educational
program base on the use of simulator device to learn
some of attacking skills in basketball that is hoped to be
Mayyadah Khalid Jasim1
as an aid in teaching process in the future.
Department of Physical Education and Sport Sciences,
Faculty of Basic Education, The main goal of the kinetic learning theories in
Mustansiriyah University, Baghdad, Iraq every game is to elevate and develop the learning process,
Email: ameada.edbs@uomustansiriyah.edu.iq which in normal cases relay on the alternative modern
methods of learning therefore, an adherence to proper Methodology

scientific methodology in learning process is a necessity
that reflects the improvement level during learning The experimental approach was used to design three
groups suitable for the nature of the research.
process. As long as basketball is one of the most popular
sports and gained a wide world attention including Iraq, Community and Sample Research: The research
it was essential to define the errors associated with the community is represented by students of the first grade/
learning process of its skills and eliminate them Physical Education and Sports Sciences, College of
Basic Education
Objectives:
Al-Mustansiriya University. After excluding of
zz identifying the effect of the educational program,
those who failed or those who are experienced, the
which was made by the researcher, on the learning total number of students was 48 male students. Which
of some types of attacking skills’ in Basketball. divided randomly into three groups, as each of the first
zz identify the effect of combining the educational and second group consists of 10 students while the
program with kinect simulator device in learning control group held 10 students as well, therefore the
some of attacking skills in basketball. search sample was 62.5% of the total community.
zz To identify the effect of the learning technique on Tools and Instruments for the Information Collection:
types of basketball attacking skills. Tools, Devices, Means of Information Collection:
zz To identify the effect of the best educational
Search tools and devices: For the purpose of conducting
programs in learning some of attacking basketball
the research procedures, the following tools and devices
skills. were used:
zz 1-3 Hypotheses: 1. Basketball court
zz There are significant statistical differences between 2. Stop watches (2 watches).
the results of pre and post tests while learning some
3. Basketballs (15 balls) type (Molten).
of the attacking skills for the first experimental
group favoring the post test results 4. Adhesive colored tape (width 5 cm).
zz There are significant statistical differences between 5. Textile measuring tape (15 m).
the results of pre and post tests while learning some 6. Plastic whistles (2 whistles).
of the attacking skills for the second experimental
7. Plastic cone (12 cones).
group favoring the post test results
8. Laptop (Dell).
zz There are significant statistical differences between
the results of pre and post tests while learning some 9. Kinect simulator device
of the attacking skills for the control experimental 10. TV screen
group favoring the post test results
Sources of Information Collection:
zz There are significant statistical differences between
the results of post tests result for the research groups 1. Arabic and English resources.
2. Performance tests.
Research Domains:
3. Registration forms to confirm test scores.
Human Field: Students of Physical Education and
4. International Information Network (Internet).
Sports Sciences-College of Basic Education- Al-
Mustansiriya University. The Research Tests (7: 95)
Place Domain: Closed Sports Hall - College of Basic Selection of passing ball using one hand over the
Education-Al-Mustansiriya University. shoulder (long passing)
Time Domain: 12/2/2017 to 12/4/2017 Purpose of selection: Measure the accuracy of the
bassing with one hand above the shoulder on target.
Accuracy Test of layup shot post drippling C. The Objectivity: Objectivity, refers to non bias
condition as being referred by (WajihMahjoub),
Objective of the test: As this test is one of the tests that whom defined it as “the subjective judgments
show the motor and skillful coordination between the are not affected by the experimenter and that
work of arms and legs, therefore it aims to assess the objectivity is available without bias and self-
level of accuracy of layup shooting. intervention by the experimenter) (5: 64). Experts
had proven that each skill requires certain selection
The scientific basis for the technical tests: of proper tests therefore there is no difference in
judgment by the experts on certain experiment or
A. The Truth: It is the order by which the object of
on a particular subject) (2: 64), accordingly the
test is being measured (4: 64);one of the methods tests being used in this research were selected to
of proofing truth is via self- honesty, as mentioned be known, clear, understandable and easy. And
in table (1) that shows the honesty of varies tests each aspect of each test was clarified including the
tasks to accomplish.
B. Stability: (it means the reproducing of the results
over the repletion of the test on the same group of In order to identify the objectivity of the selected
participants), (1: 70). tests, (Pearson) correlation coefficient was being
used on data of the first and second judgment,
Retesting method was conducted to measure the to gain a value of highly objectivity hence the
stability coefficient of the test on a group of first tests are considered highly objective. Table (1)
grade students other than the research sample. summarizes that:
Table 1: Show the Scientific bases of the tests
Tests Stability Self honesty Objectivity

Ball passing above the shoulder (long passing) 0.85 0.92 0.87
Lay up shot 0.8 0.89 0.83
Preliminary Testing: It is a preliminary empirical study familiar with these skills before, as the lecture included
intended to select research methods and tools) (6:79). a demonstration of ball passing above the shoulder and
lay up shooting skills.
Therefore, the researcher conducted two surveys
in 8/2/2017 on Sunday on a group of students of the Pre Tests: The researcher carried out the pretests in
first year Department of Physical Education and Sports 12/2/2017 on the three research groups of the above-the-
Sciences/College of Basic Education (6 students), whom shoulder ball passing skill and the skill of layup shooting.
were excluded from the research sample. The purpose of In the court of Physical Education and sport Sciences
the experiments was:
at the Faculty of Basic Education, Al-Mustansiriya
1. Demonstration of tests and explain them to the University.
students.
Educational Program: The researcher designed a
2. Identifying the time required for testing.
special educational program for the exercises associated
3. Identifying the time required for each exercise with the use of Kinect simulator device and was carried
within the program used in the search. out on the first experimental group. While the second
4. Identifying the obstacles that may hinder tests or experimental group carried out the same educational
educational processes. program without using the simulator device.
Research Field Procedures: This program was employed in the process of

Preliminary Lectures: The researcher presented a learning the long ball passing from above the shoulder
lecture for the three groups of research whom were not and lay up shooting skills as shown in the table below:
The Research groups Skill Variables

The first Exp. long passing + Lay up shooting Program + device
Second Experiment long passing + Lay up shooting The educational program
Control group long passing + Lay up shooting Traditional methodology
The educational program consist of eight units, the simulator device with certain routines, later on the
as one educational unit was given per week, (90Min.) learner will practice those exercises on field. On the
divided into preparation part (20 Min.); the sum of all other hand the second experimental group the learning
units was (160 Min.), and the main part time (60 Min.) process was maintained via the performances of the
per each unit. And the sum of them was (480 Min.), the same exercises being taught in the educational program
final part (10 Min.) per unit and (80Min.) as sum of the with increasing the number of repetitions yet without the
units. simulator device, as the repetitions will compensate the
time and the device
The mechanism of applying those skills was
through the practical part as the researcher prepared set Post-Tests: Post-tests results for the skills being studied
of skilling exercises concentrating on the skills being were conducted in 12/4/2017 under the same conditions
studied, for the first experimental group as the early of performance as the pre tests were established.
repetition, especially in the first and second educational
units, on the skill performances in constant distances Statistical Analysis
and angles to provide the focusing element to the learner
thereafter through the late educational units there was a The researcher relied on the processing of statistical
diversity in the motor behavior by using different angles data using (SPSS)
and distances besides using exercises similar to those
Chapter Three: Presentation, Analysis, and
being practiced by learners with simulator device that
Discussion of Results
being used during the educational units, as the learner
was practicing some repetitions of those exercises on Presentation and Analysis of the Results of pre and
the playground, then switch to practice those exercises post Tests of the Three Groups:
Table 2: Show the means and std. deviation, T test for the pre and post-test of long ball passing above the
shoulder skills among groups
Process Students Measuring Pre Test Post Test Calculated Reference

Significance
Group NO Unit Mean STD Mean STD T test T values
1st group. 10 Point 15.9 2.28 22.1 2.13 14.02 Significant.
2nd group 10 Point 15.5 1.9 19.6 1.35 10.83 2.262 Significant
Control. 10 Point 15.3 2.21 15.6 2,07 1.406 Non-significant
Table 3: The means, std. deviation and T test for the pre and post-test of layup shooting skills among three
groups
Process Students Measuring Pre Test Post Test Calculated Reference

Significance
Group NO Unit Mean STD Mean STD T test T values
1st group 10 2.1 15.9 0.88 5.5 1.08 6.053 Significant
2 group
nd
10 1.4 15.5 0.52 3.8 1.48 5.041 2.262 Significant
Control 10 1.5 15.3 0.53 2.1 0.57 3.674 significant
The results and discussions of the post tests of the three Groups:
Table 4: Demonstration of mean squares among the groups and with each one using calculated and reference
F values for post tests of the long ball passing over the shoulders
Variance Sum of Freedom Mean Calculated Reference Significance Statistical

Sources squares score squares (F) value (F) value degree significance
Among groups 215 2 107.5
30.329 3.35 0.05 significant
within the groups 95.7 27 3.544
Table 5: Shows the result of (L.S.D.) in know the least difference between three groups of long ball passing
above the shoulder skills
Groups Difference of means Results of differences L.S.D Statistic conference

G1-G2 22.1 – 19.6 2.5
G1-G3 22.1 – 15.6 6.5 1.73 Significant
G2-G3 19.6 – 15.6 4
Discussion (4, 6) showed that there is a significant difference in

the learning of the attacking skills in the basket among
Discussion of the pre and post tests results for three the three groups. Which is mainly due to the use of
groups concerning the long ball passing above the the educational program accompanying the Kinect
errand layup shooting skills in the Basketball: The simulation for the first experimental group while
results presented in Tables (2, 3), Show the existence of for members of the second experimental group, the
significant statistical differences for the two experimental educational program was used solely
groups.
The results of the LSD test had showed that
This is due to the harmonization of the given exercise experimental group 1 has the least significant difference
with the research sample, as the set educational program
while learning those skills, due to the nature of the
and the given exercises had given enough space to the
exercises that were efficient under changing the
learner that fit with his ability to adapt and learn while
environment which create an applicable kinetic program
changing the environment of exercise, which is essential
can be used in different circumstances of practicing,
for better learning of skills for beginners
nevertheless the kinetic simulating device had a major
Nevertheless the results had shown that there is no role in learning those skills by combination effect
significant statistical differences for the control group between the virtual and practical worlds, by adding the
while practicing the long ball pass over the shoulder, thrilling and excitation effects to the learning process
due to insufficient practicing style for such skill as it is which made the learner enthusiastic to learn and practice
not harmonized with their abilities, on the other hand
the control group had shown a significant statistical Conclusions
difference with the other skill due to the suffice learning
process gained from the educational program and the The results showed the effectiveness of the
over repetitions of that skill educational program prepared by researcher combined
with the use of Kinect simulator device for learning
Therefore the educational program had proven to be
long passing from above the shoulder and lay up
harmonized with the capabilities of learning and produce
shooting skills. The results showed the effectiveness of
great results
the educational program prepared by the researcher to
Posttests results of the three research groups of the learn long passing from above the shoulder and lay up
long ball passing above the shoulder and the layup shooting skills. The results showed the effectiveness of
shooting skills in basketball: The results of the tables the method used in learning my skills (long handling
from the shoulder, peaceful correction). The results References

showed the preference of the educational program
1. Cacioppo JT, Petty RE. The need for cognition.
prepared by the researcher when accompanied by the
Journal of Personality and Social Psychology.
Kinect simulator in learning long passing above the
1982; 42, 116–131.
shoulder and lay up shooting skills on the educational
program prepared and the approach used. 2. Lawshe CH. A quantitative approach to content
validity. Personnel Psychology. 1975; 28,563–
Recommendations 575. doi:10.1111/j.17446570.1975.tb01393.x
3. Lawshe’s content validity ratio. Measurement and
The need to connect the virtual and the practical
Evaluation in Counseling and Development,45(3),
world in the preparation of the educational curricula
197-210. doi:10.1177/0748175612440286
of learning the skills of basketball. Provide substantial
and moral support for teachers and trainers in order to 4. MARK LM and JANINA MJ. RESEARCH
provide such devices to serve the educational process. DESIGN EXPLAINED, Eighth Edition. 2012; (p.
The researcher recommends conducting similar studies 77) New York
on a different sample from the research sample as well 5.
Pennington, Donald. Essential Personality.
as other skills of basketball and other sports games. Arnold. 2003; p. 37. ISBN 0-340-76118.
The researcher recommends all the specialists in the
educational process to keep up dated with what is the 6. Strand n. Bradford and roly newilsonassessing
latest in the field of simulators and try to employ it in sport –skillis Usahumankentics publishers 1993.
learning sports skills. 7. Schmidt. A. Richard. Motor control and learning
Human,Kinticspubilshers: ChmenPein., III inos,
Conflict of Interest: Nil
1982.
Ethical Clearance: Not required

The impact of Health Awareness Campaigns to Quit Smoking

(A Case Study in Amman City)
Rudaina Othman Yousif

Department of Marketing, Faculty of Economics and Administrative Sciences, Zarqa University, Jordan
ABSTRACT
Smoking considered as bad habit that has negative reflection on person’s health, society and economic.
Civil society organizations and governments were aware about the risk of smoking phenomenon, in Jordan
which motivates the government to issue regulations and laws that contribute to put limitations for smoking
in public places and sites.Also, it generates many health awareness campaigns to put limit for smoking
phenomenon in cooperation with education institutes and civil society organizationsin order to urge people
to quit smoking. In spite of that, Jordan is still suffering from increasing number of smokers, Because of that,
the objective of this study is to investigate the effect of health awareness campaigns in influencing people
behavior to stop smoking. Sample of 369 smokers were selected, and the questionnaire composed of the
following five dimensions:
Awareness campaigns through media; factors that motivated smoking quit; frustrating factors to quit
smoking; Referencegroups and smokers response to awareness campaigns.
Study results show that there are motivation factors in the environment that smokers live in, and there is
strong relation between antismoking factors and smokers’ response to health awareness campaigns; where
the connection factor between them is 0.634. Awareness campaigns could not face the abortive factors to
stop smoking and to influence on smokers in spite of the fact that 33% of the sample individuals are planning
to quit smoking in the future and the fact that there are three clinics in Amman for assistance to quit smoking
and a specialized pharmacy, but the problem is that most people do not have any information about it. It
shows, clearly, the failure of health awareness campaigns related to quit smoking. The sponsors must draw
suitable strategy that coincides with Jordan reality and suitable to effective factors of smoker behavior.
Keywords: Awareness Campaigns; Smoking: Media tools; Health; Amman
Introduction less developed) countries and up to 17.7% in the more

developed (Industrial) countries [2].
Tobacco products, nowadays, are responsible for the
death of more than threemillion yearly around the world; This is a major indicator that smoking causes death
which represents about 6 % of the total deaths [1]. more than any other single disease. Smokers in growing
countries are about 800 million or more than 70% of
However, it is expected that this percentage will populations [3].
increase to 10.9% by the year 2020 or early 2030,
related to all deaths of the growing (developing or The age average, that people start smoking, is
between the age 12 and 15 years and 90% of the smokers
smoke regularly before the age of 21. For that, health
Corresponding Author: awareness campaigns (toquit smoking) must focus on
Rudaina Othman Yousif people of age 11, in schools, and these campaigns should
Department of Marketing, continue in universities [4-6].
Faculty of Economics and Administrative Sciences,
Zarqa University, Jordan The workers in awareness campaigns, to quit
Phone: 00962788106069 smoking, work on identification of damages, harms,
Email: dr.rudaina_othman@yahoo.com hurts and disadvantages of smoking to the smokers
. The workers must increase awareness about these

[7]
Previous Studies: Nurulfarahin et al, mention that
risks and to work on performing negative attitudes quitting smoking is hard as people who stop smoking
towards smoking and push smokers to quit smoking often start again because of weight gain, stress and
by publishing and broadcasting information, conduct withdrawal symptoms. So it is imperative to strengthen
seminars, conferences and urge governments to put laws the enforcement on regulations advertisement, and
and regulations that stop or reduce smoking process [8]. develop more activities on motivation among smokers
Jordan is located in advanced position concerning and their families, which may be organized by
the number of smoker because smokers, in Jordan, government or non-government organizations [11]. Unal
represent 65% of the population in a middle of scaring E., M.E. et al, they mentioned that all the advertisements
expectation that it will raise up to 88% among males. were more effective for adolescents who had never
Specialized authorities are working to apply the national smoked compared to ex-smokers and current smokers[12].
strategy to control smoking through implementation of
forbidden smoking in public places. Their efforts were Bednarski et al, explains that smoking tobacco
clear in issuing the modified health law (47), 2017, decreased in many countries due public health campaigns,
forbidding smoking in public and closed places, where anti-smoking programs, anti-smoking policies and
fines are determined and jail penalty to people who banding smoking advertisements [13]. Chandra, A., et al,
break the law [9]. says that health awareness campaign can be implemented
through distributing booklets, handbooks, presentation
The reason behind that is the fact that smoking
of posters, provide door to door information and the
becomes a very dangerous phenomenon in Jordan, and
the late statistics indicate that tobacco is behind the public reacting with the team assigned to awareness
cause of death for 12% of the total deaths in Jordan campaign [14].
between people whom their ages are above thirty years
The objective from health awareness campaigns is
old. Jordan suffers from 29 death cases, weekly, caused
to educate smokers and non-smokers against smoking
by smoking [10].
by broadcasting and spreading awareness, knowledge
and make changes in their beliefs and attitudes, in
Objectives
order to affect their behavior [15]. Also to continue their
The wide spread of smoking phenomenon pushes work spreading awareness to control smoking because
us to prepare this study and to investigate the effect of continuous awareness campaigns gain and bring more
health smoking campaigns on quit smoking through results than short ones or through occurrences separated
media,reference groups, effect of motivated factors by long periods. In fact there is a big direction from
on smoker behavior to quit smoking,and frustrating governments, in the whole world, to support awareness
(abortive) factors to quit smoking. about smoking health warnings [16].
Study Problem: The indication of Faris Alhawari, Health awareness campaigns that are anti-smoking
Cancer disputing office manager, Al Hussien Center, that
must concentrate on all people, where smokers’ friends,
number of smokers in Jordan represents 65% from the
their families and attitudes that support smoking have
countrypopulation, among expectations that it will increase
role in encouraging smoking [17].
between males, within few years, to reach 88%. Also,
50% of death cases, in Jordan, are related tosmoking. He Workers with anti-smoking health awareness
pointed, as well, to the importance of the implementation
campaigns must stress on smoking damages and harms
of Smokingdisputing national strategy, because forbidding
where smokers suffer for many years from bad health
of smoking in public placesreduces smokers percentages
beside the early death [18].
in the Kingdom by 4% within a year [10].
For all of that, the problem that faces the society Study Objectives: The study objective is to know
needs more and more studies to determine and identify how far smokers are responding tohealth awareness
reasons for smoking, the proper treatments and campaigns to quit smoking; through media tools,
medications to reduce number of smokers in Jordan. reference groups and price effect.
Hypotheses of This Study Study Population is Young smokers.
Ho: There is statistical, not significance (α ≤ 0.05), of Research Sample: The researcher will select a sample
the health awareness campaigns, motivated factors, of the study population(smokers).
frustrating factors that they play an effective role in
driving smokers to quit smoking, and reference groups Data Collection
through media tools
Data collection, manners of analysis and programs
Methodology used in the current study are based on two sources:
1. Primary Source: the questionnaire that was
This study is implemented on the youth faction
designed to reflect study objectives and questions.
(sector) and includes sevenindependent factors
The selected sample was, from youth age, 480
(variables): Television, radio, posters, and seminars,
youths. The valid returned questionnaires for the
quit smoking Clinics, reference groups and price. The
statistical analysis were only 369, which is 77%.
dependent variable is quit smoking.
2. Secondary Sources: books, journals, articles and
The questionnaire is designed, formulated and previous theses to write the theoretical framework
consists of 28 questions in order to gather, analyze data of the study
and to reach the conclusions and recommendations
based on results of this study. Study Model: The following diagram (Figure 1)
represents the study model which is based on the study
The study is an experimental research, using a problem, objectives and hypotheses [19-25].
descriptive and analytical approach.
Results
Table 1: Number of respondents who have information on the clinic for quit smoking and pharmacy
Clinic/Pharmacy Frequency Percent to Sample Size

Clinic 1 32 8.7
Clinic 2 34 9.2
Clinic 3 35 9.5
pharmacy 45 12.2
Number of individual sample visited the clinics and pharmacy 63 individuals 17.1%
Table 2: Dimensions results
Mean Std. Deviation t Sig (2 tailed)

First Dimension: Health awareness campaigns through media tools
H1: Health awareness campaigns through media tools 2.81 .80 67.25 .00
Second Dimension: Motivated factors to quit smoking
H2: Motivated factors to quit smoking 3.38 .086 75.51 .00
Third Dimension: frustrating factors to quit smoking
H3: frustrating factors to quit smoking 4.14 .63 124.79 .00
Fourth Dimension: Reference Groups
H4: Reference Groups 3.02 .92 62.74 .00
Fifth Dimension: Smokers response (The dependent factor)
H5: Smokers response (The dependent factor) 3.34 .77 82.75
The results show that Individuals of the sample do treatment with the proper costs and make space for the
not, proceed to follow-up advertisements that encourage opportunity to quit smoking [26-27].
quit smoking on radio, see advertisements that encourage
quit smoking in local newspapers, and participated in The study reveals that there are about (125) smokers
seminar that encourages to quit smoking, this indicates who are planning to quit smoking in the future with
the ineffectiveness of health awareness campaigns percentage of (33.88%) against (244) smokers who are
against smoking in this area. not planning to quit smoking in the future with percentage
of (66.12%), which is very high percentage and an
Also the results indicate that the mean for all the indicator to the failure of health awareness campaigns
second dimension questions was greater than the to quit smoking and to affect in smokers behavior; at the
average unit of measurement (3), except the Health same time,
awareness campaigns, for quit smoking, contribute to
aware smoker that his productivity will be greater when The frustrating (abortive) factors to quit smoking
he quit smoking have great effect on the failure of awareness campaigns
where the correlation factor represents the highest
On the same hand, results indicate that the factors
value which is (0.63). This indicates that there is strong
frustrating to quit smoking took the highest averages,
relation between these factors and the case that smokers
encouraging them to continue smoking, especially
do not quit smoking.
question 15,”You feel that seeing a person smoking will
make you wish to smoke”; where the value of the mean
is the largest value among all questionnaire questions. Recommendations
Based on the results, we reject the null hypothesis.
Health awareness campaigns must be efficient
The results indicate that the health awareness and effective. They have to concentrate on increasing
campaigns to quit smoking, affected family members to awareness about health, psychological damages and
urge smokers to quit smoking, but did not affect behavior harms caused by smoking and work to change people
of their co-workers, which push them to encourage him motives and attitudes towards smoking by providing
to quit smoking. them with information, present films and arrange
awareness seminars.
Summary and Conclusions Also, they must help smokers to put their own plans
The results indicate that (234) respondents tried and provide psychological support for them that will
to quit smoking by (63.41%), but they had failed to help them to quit smoking.
continue quit smoking. Such campaigns must be condensed and continuous
The failure of many attempts to quit smoking and all related authorities have to take part in them, like
needs to provide psychological support, medication and organization of civil society, education organizations,
health departments and work on issuing laws and 5. Dasenbrock, H.H., Rudy, R.F., Lai, P.M.R., Smith,
regulations that push and motivate people to quit T.R., Frerichs, K.U., Gormley, W.B., Aziz-Sultan,
smoking. M.A. and Du, R., Cigarette smoking and outcomes
after aneurysmal subarachnoid hemorrhage: a
The work must be on producing awareness
nationwide analysis. Journal of neurosurgery,
campaigns with clear targets, through media tools, and
2018, 129(2), pp.446-457.
must have an impact on smokers and non-smokers
behavior, taking in their consideration to deepen the 6. Lai, S.W., Smoking and nonalcoholic fatty liver
people awareness about smoking risks that include disease. American Journal of Gastroenterology,
health, social and economic risks. 2019, 114(6), p.998.
For that, specialized authorities, concerned with 7. Thompson, L.E., Barnett, J.R. and Pearce, J.R.,
health awareness campaigns, must put successful plan Scared straight? Fear-appeal anti-smoking
based on study of environmental factors that smokers campaigns, risk, self-efficacy and addiction.
live in and the factors that affect their behavior so that Health, risk & society, 2009, 11(2), pp.181-196.
they can put efficient programs to help smokers to quit 8. Ebrahimi, H., Sahebihagh, M.H., Ghofranipour,
smoking. F. and Tabrizi, J., Experiences of adult smokers
from the concepts of smoking: A content analysis.
Acknowledgments Iranian journal of nursing and midwifery research,
2014. 19(6), p.550.
The author acknowledges Deanship of Scientific
Research in Al- Zarqa University/Jordan for support of 9. Roya news. Jordan one of the countries to have
this research. highest smoking rate in the world. [ONLINE]
Available at: https://en.royanews.tv/news/18016/
Ethical Clearance: Not required
Jordan-one-of-the-countries-to-have-highest-
Source of Funding: Deanship of Scientific Research in smoking-rate-in-the-world. [Accessed 17 July
Al- Zarqa University/Jordan. 2019]. 2019.
10. Ammon news. 50% of Jordan deaths due to
Conflict of Interest: Nil
smoking. [ONLINE] Available at: http://www.
ammonnews.net/article/333980. [Accessed 7
REFERENCES
August 2019]. 2019.
1. World Health Organization, WHO report on
11. Nurulfarahin K.A.1, Nina S.A.2, Lailati S.3,
the global tobacco epidemic, 2017: monitoring
Raisah Z.4, Izzuddin A.5, Sabariah A.H.
tobacco use and prevention policies. World Health
Challenges to Quit Smoking among Smokers in
Organization. 2017.
Bandar Baru Salak Tinggi, Sepang, Selangor,
2. World Health Organization: WHO. Tobacco. Malaysia.International Journal ofPublic Health
[ONLINE] Available at: https://www.who.int/ Science (IJPHS). 2018. Vol.7, No.1,pp.
news-room/fact-sheets/detail/tobacco. [Accessed
31 July 2019]. 2019. 12. Unal, E., Gokler, M.E., Metintas, S. and Kalyoncu,
C., Effect of anti-smoking advertisements
3. WHO. Management of substance abuse (Tobacco).
on Turkish adolescents. EMHJ-Eastern
[ONLINE] Available at: https://www.who.int/
Mediterranean Health Journal, 2016. 22(9),
substance_abuse/facts/tobacco/en/. [Accessed 1
pp.654-661.
July 2019]. 2019.
13.
Bednarski, B., Gorynski, P., Lata, E.,
4. Hu, P., Huang, L., Zhou, S., Shi, Q., Xiao, D.
and Wang, C., Smoking status and cognitive Parchimowicz, T., Przewozniak, K. and
performance among vocational school students in Wojtyniak, B., The current status of the tobacco
Beijing, China. Respiratory medicine, 2018, 135, epidemic in Poland. World Health Organization
pp.8-11. regional office for Europe. 2009.
14. Chandra, A., Sarkar, S., Adinarayanan, S. and International Journal of Business Management &
Balajee, K.L., Impact of health awareness Research. 2014. Vol. 4, Issue 6, Dec, 63-72.
campaign in improving the perception of the
22. Alsamydai, A. M. J., & Baqer, A. B. M.
community about palliative care: A pre-and post-
Measuring patient satisfaction regarding the
intervention study in rural Tamil Nadu. Indian
quality of healthcare service provided by
journal of palliative care, 2016. 22(4), p.467.
pharmacists. International Journal of Medicine
15. Wilde, G.J., Effects of mass media communications and Pharmaceutical Science. 2015. Vol. 5, Issue
on health and safety habits: an overview of issues 6, Dec, 71-84.
and evidence. Addiction, 1993. 88(7), pp.983-
23. Ali AL-Samydai, Lena A. Al-Elaime, Sundos
996.
H. Abbadi, Lubna Al-Khareisha, Measuring
16. Morrow, M. and Barraclough, S., Tobacco control Awareness of Over the Counter Analgesics Use
and gender in Southeast Asia. Part I: Malaysia and and Risks Associated With It Among Jordanian
the Philippines. Health Promotion International, Population In Amman, Asian Journal of
2003. 18(3), pp.255-264. Pharmaceutical research and Development; 2018.
6 (5):9- 15 DOI: http://dx.doi.org/10.22270/
17. Durkin, S., Brennan, E. and Wakefield, M., Mass
ajprd.v6i5.429
media campaigns to promote smoking cessation
among adults: an integrative review. Tobacco 24. Ali Alsamydai, Ghaida’ Baqa’in, Ibrahim Al-
control, 2012. 21(2), pp.127-138. Helli, Hala Aladwan, Karim Salman, Rola Herimi,
and Prof. Talal Aburjai. The Role of Information
18. NHS Digital. Statistics on Smoking, England -
Resources on Building Health Awareness -
2017. [ONLINE] Available at: https://digital.nhs.
Study Conduct in Amman Jordan,‖ International
uk/data-and-information/publications/statistical/
Research Journal of Pharmacy and Medical
statistics-on-smoking/statistics-on-smoking-
Sciences (IRJPMS), 2018. Volume 1, Issue 6, pp.
england-2017-pas. [Accessed 7 August 2019].
44-49.
2017.
25. Alsamydai, Ali & Alsamydai, Mahmood &
19. Alsamydai, Mahmood & Yousif, Rudaina. Factors
Yousif, Rudaina & Aburjai, Talal & Al-Mamoori,
Influencing Woman Behavior to Visit Dental
Farah & Azzam, Hanan. Protein supplements
Clinic to Improve their Smile. Indian Journal of
between consumer’s opinion and quality control:
Public Health Research and Development. 2019.
an applied study in Jordan. International Journal
10. 504-409.
of Research in Pharmaceutical Sciences. 2019.10.
20. AL-SAMYDAI, Mahmood; AL-KHOLAIFEH, 1961-1969. 10.26452/ijrps.v10i3.1402.
Ali; AL-SAMYDAI, Ali. The Impact of Social
26. Chaiton, M., Diemert, L., Cohen, J.E., Bondy,
Media in Improving Patient’s Mental Image
S.J., Selby, P., Philipneri, A. and Schwartz, R.,
Towards Healthcare Provided by Private
Estimating the number of quit attempts it takes to
Hospitals’ in Amman/Jordan. Indian Journal of
quit smoking successfully in a longitudinal cohort
Public Health Research & Development, 2019.
of smokers. BMJ open, 2016. 6(6), p.e011045.
10.2.
27. Shahab, L., Effectiveness and cost-effectiveness of
21. Alsamydai, A. M. J. the opinions of pharmacists
programmes to help smokers to stop and prevent
about the possibility of using electronic means
smoking uptake at local level. https://www.ncsct.
of communication by pharmaceutical companies
co.uk/.2015.
to facilitate the process of trade exchange.
Active Ocular Involvement in Iraqi Patients with Behçet’s Disease
Yaser A.R. Nasser1, Riyam Faihan Rashid2, Dina Shakir Yasiry3, Mohammed Hadi Munshed Al-Osami4,
Faiq I. Gorial4
Senior Lecturer (Ophthalmologist), College of Medicine, Al-Mustansiriyah University; 2Senior Lecturer
1
(Ophthalmologist), Medical and Pharmaceutical Sciences, College of Medicine, Ibn Sina University;
3
Rheumatology Specialist, Baghdad Teaching Hospital, Medical City, Baghdad, Iraq; 4Rheumatology Unit,
Department of Medicine, College of Medicine, University of Baghdad, Baghdad, Iraq
Abstract
Aim of the Study: to assess the prevalence of active eye involvement in Iraqi patients with BD and to evaluate
the potential relationship between active eye disease with sociodemographic and clinical characteristics.
Method: A cross-sectional descriptive study was conducted at 64 patients with Behçet’s disease diagnosed
according to the International Study Group for Behçet’s disease. Sociodemographic and clinical characteristics
were recorded. Comprehensive ophthalmological examination was to assess ocular involvement.
Results: Mean age of patients was 32.3(8.9) years. Males were 81.3%. Active ocular involvement by
Behçet’s disease was 27 patients (54%). The risk of having active ocular BD was significantly increased
29,265 folds in male patients, (p= 0.033). genital ulcers increased risk of having active ocular involvement
by 19.971 folds (p=0.05). Smoking increases the chance of having active eye involvement in BD by about
3.438 folds (p>0.05).
No significant association between active ocular BD and age of the patient, HLA-B51 status, BMI score,
family history of BD, duration of the disease, presence of oral ulcers, headache, joint involvement, skin rash,
erythrocyte sedimentation rate(P>0.05).
Conclusion: Active ocular involvement by Behçet’s disease was relatively common and correlated directly
and significantly with male gender. This indicate that late diagnosis and treatment might cause these active
eye manifestations.
Keywords: Behçet’s disease, active ocular involvement, eye manifestation.
Introduction a bilateral non-granulomatous panuveitis and a retinal

vasculitis. However, uveitis may remain unilateral for
Behçet’s disease (BD) is a chronic, relapsing, many years in some patients (5). Uveitis can be anterior,
inflammatory vasculopathy of unknown etiology. (1,2). intermediate, posterior, or panuveitis(6).
The key clinical manifestations are oral and genital
aphthosis as well as ocular inflammation (3). Although Ocular involvement occurs in 60–80% of patients
ocular involvement is not commonly the presenting with Behçet’s disease and it is sight threatening (7,8).
feature of Behçet’s disease, it is a major source of serious Vision loss in Behçet’s disease usually results from
morbidity (4). Ocular Behçet’s is classically manifested as long-standing inflammation and consequent sequelae
in the posterior segment, macular lesions, vitreous
hemorrhage, and neovascular glaucoma (19). Visual loss
Corresponding Author: also can be due to optic nerve and chorioretinal atrophy,
Faiq I. Gorial ghosting and attenuation of retinal vessels and those are
Rheumatology Unit, Department of Medicine, considered end-stage ocular disease (10)
College of Medicine, University of Baghdad,
Baghdad, Iraq Anterior uveitis occurs with or without hypopyon.
Email: faiqig@gmail.com A transient, facile hypopyon can be seen by the patient
himself or his family. Hypopyon is explosive in nature, of hypopyon, or other possible sequelae like synechiae
onset occurs within hours and can resolve with or without or cataract.
treatment (3). Posterior uveitis is the most common form
A detailed fundus examination using indirect
of uveitis across age groups. It includes an obliterative
ophthalmoscopy and slit lamp with aiding lenses
necrotizing retinal vasculitis of both arteries and veins.
(condensing lenses Volk 90, 78) was done to determine
Vascular sheathing with Cystoid Macular Edema (CME)
vitritis, retinitis and/or retinal vasculitis, these findings
(9)
is one of the manifestations of posterior uveitis.
defined active uveitis in the posterior segment of the eye.
Retinal ischemia with Neovascularization of the iris
can also occur (10). Acute vasculitis may be associated The definition of retinal vasculitis was based on
with multifocal areas of chalky white retinitis. With the observation of inflammatory or gliotic sheathing of
repeated episodes of vasculitis, vessels can become the vessels or on the fluorescein angiographic findings
white and necrotic. Vasculitis affecting the arterioles of of staining, leakage, and/or occlusion of the retinal
optic nerve leads to progressive optic neuropathy (11). vasculature.
This study aimed to assess the prevalence of active eye
involvement in Iraqi patients with BD and to explore The intraocular pressure (IOP) was measured using an
the possible relationship between active eye disease and applanation tonometer. Patients who develop optic atrophy,
socio demographic and clinical characteristics. occluded vessels that look like white cords, and diffuse
retinal atrophy with variable scarring and pigmentation
were defined as having end-stage eye disease.
Patients and Method
Erythrocyte sedimentation rate (ESR) and HLA-B51
Study Design: A cross-sectional, descriptive study was were measured. ESR was found using a traditional
conducted at Rheumatology Unit in Baghdad Teaching Westergren method in the hospital laboratory.
Hospital from July 2015 to July 2017. Ethical approval
was taken from College of Medicine, Department of Statistical Analysis: Statistical analysis was done using
Medicine and patients consent was recorded. statistical software SPSS 23. Descriptive statistics were
reported as numbers(percentiles) for categorical variables
Participants: Sixty-four Iraqi patients enrolled in this and mean(SD) for normally distributed continuous
study. All were classified as Behçet’s disease by fulfilling variables. Multiple logistic regression analysis was used
criteria of the International Study Group for Behçet’s to assess predictors of active eye involvement. P<0.05
disease (12). All included patients agreed to participate in was considered statistically significant.
the study. Patients were excluded from the study if they
did not fulfill the inclusion criteria, if they had a history
Results
of an ocular disease other than Behçet’s or if they had
undergone ocular surgery other than cataract or if they Table 1 shows that the mean age of the studied group
suffer from proved inflammatory bowel disease. was (32.3 ± 8.9) years. Males constituted 81.3% of
patients. Positive family history was reported in only 2
Data Entry, Collection, and Measurements: We used patients (3.1%). The age of onset ranged between 13 and
a pre-constructed questionnaire sheet. The questionnaire 43 years with a mean of (28.3 ± 8.4) years. The duration
included age, gender, body mass index, smoking history, of disease was ≤ 5 years in 49 patients (76.6%), and
family history of BD, age of onset and disease duration more than 5 years in the remaining 15 patients, (23.4%).
were reported. We defined the onset of BD as the age More than half (53.1%) were current smokers, and
of the patient when the initial manifestation of BD 43.8% were non smokers, two patients had a previous
presented. The duration of BD was calculated as the time history of smoking.Body mass index was normal in
interval between the onset of BD and the age at the last (42.2%), while (39.1%) were overweight and (18.8%)
visit of the patient to the hospital. were obese. Within the last four weeks of the assessment,
oral ulcers were present in 50 patients (78.1%), while
Patients were examined by an expert same (76.6%) of patients had joint involvement in the form
ophthalmologist including external ocular examination, of arthralgia &/or arthritis. Forty-seven patients (73.4%)
slit lamp biomicroscopy for anterior uveitis, defined as had headaches. Skin rashes, genital ulcers were reported
an Anterior Chamber (AC) reaction and/or the presence in (48.4%) and (70.3%), respectively.
Fifty patients out of the total 64 had ocular Conted…

involvement. Out of these fifty patients, active ocular
Family history Positive 2(3.1)
Behçet’s disease was reported in 27 patients (54%) at
the time of the assessment as shown in figure (1), Non-smoker 28(43.8)
Smoking Ex-smoker 2(3.1)
Table 2 shows that out of the 27 patients with active Current smoker 34(53.1)
ocular BD, nine patients (33.7%) had anterior uveitis, Mean (SD) 28.3 (8.4)
11 patients (40.7%) had posterior uveitis and 7 patients Age of onset (year)
Range 13-43
(25.9%) had panuveitis.
Duration of disease ≤5 49 (76.6)
Raised intraocular pressure was increased in 86 of (year) >5 15(23.4)
the total 128 examined eyes (67.2%), Anterior chamber Extraocular manifestation
50(78.1)
reaction was present in 27 (21%) of the total examined Oral ulcers n(%)
eyes. Hypopyon was seen in only eight examined Joint involvement n(%) 49(76.6)
eyes, (7.8%) of the total. Cataract and synechiae were Headache n(%) 47(73.4)
seen in 42(32.8%), 43(33.6%) respectively of the total Genital ulcers n(%) 45(70.3)
examined eyes as shown in (table 2). Vitritis, retinitis,
Skin rash n(%) 31(48.4)
retinal vasculitis were seen in 36 (28.1%), 18 (14.1%),
18 (14.1%) of the total 128 examined eyes, respectively. BMI mean Body Mass Index, SD Standard
Optic atrophy is seen in (8.5%) of the total examined eyes. Deviation. HLA Human Leucocyte Antigen. ESR
Erythrocyte Sedimentation Rate.
In Table 3, the risk of having an active ocular
BD was significantly increased 29,265 folds in male
patients, (p value 0.033). Active ocular involvement
also correlated significantly with the presence of genital
ulcers within the last four weeks prior to assessment,
with a p value of 0.05 and an increased risk of 19.971
folds. Current smoking increases the chance of having
an active eye involvement in BD by about 3.438 folds,
however this was not statistically significant, (P value =
0.226, non-significant)
Figure 1: Privalence of active and inactive eye
No statistically significant association was found
disease in BehÇet's disease
between active ocular BD and age of the patient, HLA-
B51status, BMI score, family history of BD, duration
of the disease or mean ESR value (P>0.05). Also the Table 2: Ocular manifestations of Behçet’s disease
presence of oral ulcers, headache, joint involvement, (N = 128)
skin rash during the prior four weeks of assessment Variables Status N (%)
did not significantly raise the risk of having active eye
IOP increased 86 (67.2)
involvement, (P>0.05).
AC reaction present 27(21.9)
hypopyon present 8 (7.8)
Table 1: Demographic characteristics of the studied
synechiae present 43(33.6)
group (N = 64)
catarct present 42(32.8)
Variable Value vitritis present 36(28.1)
Age (years), Mean (SD) Mean (SD) 32.3 (8.9) Retinitis present 18 (14.1)
Gender Male 52(81.3) vasculitis present 18 (14.1)
Normal 27(42.2) Optic atrophy present 11(8.5)
BMI (kg/m2) Overweight 25(39.1)
IOP intra ocular pressure, AC Anterior Chamber
Obese 12(18.8)
Table 3: Multiple logistic regression to predict risk disease severity, management approach, follow up and
of having active ocular disease compliance to a better treatment.
Variables P-value OR In the current study only males increased the risk of
Age 0.526 1.042 an active eye involvement by (29.265) folds (p = 0.033).
Male gender 0.033 29.265 As shown in previous literature, male has a worse ocular
BMI score 0.294 1.137 outcome and its associated with a worse course of the
disease (4).
Family hx 0.856 0.589
Smoking 0.226 3.438 This study has some Limitations: Shortage of
Duration 0.420 2.479 resources and time led to a small sample size included
HLAB51 0.124 0.215 in our study, additionally the lack of some investigations
ESR 0.160 1.037 (like C-Reactive Protein) that would provide an insight
about a more thorough laboratory findings association
Oral ulcers 0.487 2.459
with active ocular Behçet’s. The temporary unavailability
Genital ulcers 0.05 19.971 of tissue typing HLA-B51 for few months during the
Headache 0.554 1.835 period of the study led to limiting the number of selected
Joint involvement 0.995 0.991 patients
Skin rash 0.066 0.144
In conclusion, Active eye involvement were
BMI mean Body Mass Index. HLA Human relatively common in Iraqi patients with BD and
Leucocyte Antigen. ESR Erythrocyte Sedimentation correlated with male gender. This suggest the need
Rate. for high index of suspicion for ealty diagnosis and,
prevention, and treatment. Further larger sample size
studies with longer duration are recommended.
Discussion
Conflict of Interest: The authors declare that there is no
This study revealed active ocular involvement
conflict of interests among them.
was relatively common in Iraqi patients with BD and
significantly directly correlated with males. Source of Funding: The source of funding was by
authors.
Active eye inflammation was 54% of patients at time
of the assessment. Anterior chamber (AC) reaction was
21.9% and Hypopyon 7.8%. Al-Rawi et al (1) reported References
hypopyon was found in 12%. This difference may be 1. Evereklioglu C. Current concepts in the etiology
related to change in disease severity in the three decades and treatment of Behçet disease. Survey of
with a better awareness and advances in treatment ophthalmology. 2005 Aug 31;50(4):297-350.
In the posterior segment, Vitritis was 28.1 % in 2. Alpsoy E, Donmez L, Onder M et al. Clinical
contrast to a previous study in Tunisia was 84.7% (2) features and natural course of Behçet’s disease in
and Jorden about 50% had uveitis (3) and this may be 661 cases: a multicentre study. British Journal of
explained by different study design and inclusion criteria. Dermatology. 2007 Nov 1;157(5):901-6.
In this study, each of retinitis and Retinal vasculitis 3. Nussenblatt RB. Uveitis in Behçet’s disease.
were 14.1 %. while Al-Rawi et al. reported only 3% International reviews of immunology. 1997 Jan
patients (1). This may be due to different sample size and 1;14(1):67-79.
treatment. 4. Barra C, Belfort JR, Abreu MT. Behcet’s disease
in Brazil--a review of 49 cases with emphasis on
The increased IOP was 67.2 %. Cataract 32.8%.
ophthalmic manifestations. Japanese journal of
Synechiae 33.6%. Optic atrophy 8.5% this differ from
ophthalmology. 1991;35(3):339-46.
another study in which IOP 8%m cataract 31.5%,
synechiae 32.4%, optic atrophy 13.5% (2). This difference 5. Davatchi F, Shahram F, Chams C, Chams H, Nadji
possibly due to difference in time of assessment, A. Bahcet Disease. Acta Med Iran 2005;43(4).
6. Zierhut M, Stübiger N, Deuter C, Kötter I. 12. O’neill TW, Rigby AS,Silman AJ, Barnes C.
Behcet’s disease. InUveitis and Immunological Validation of the International Study Group
Disorders 2005 (pp. 173-200). Springer Berlin criteria for Behçet’s disease. Rheumatology. 1994
Heidelberg. Feb 1;33(2):115-7.
7. Atmaca LS. Fundus changes associated with 13. Al-Rawi ZS, Sharquie KE, Khalifa SJ, Al-Hadithi
Behçet’s disease. Graefe’s archive for clinical FM, Munir JJ. Behçet’s disease in Iraqi patients.
and experimental ophthalmology. 1989 Jul Annals of the rheumatic diseases. 1986 Dec
1;227(4):340-4. 1;45(12):987-90.
8. Garcher C, Bielefeld P, Desvaux C et al. 14. Khairallah M, Attia S, Yahia SB, Jenzeri S,
Bilateral loss of vision and macular ischemia Ghrissi R, Jelliti B, Zaouali S, Messaoud R.
related to Behçet disease. American journal of Pattern of uveitis in Behçet’s disease in a referral
ophthalmology. 1997 Jul 1;124(1):116-7. center in Tunisia, North Africa. International
ophthalmology. 2009 Jun 1;29(3):135-41.
9. Angioi-Duprez K, Maalouf T, Gerin M et al.
A full thickness macular hole as an uncommon 15. Abu-Ameerh MA, Mohammed SF, Mohammad
complication of Behcet disease. Journal francais MT, Ababneh OH, Al-Bdour MD. Ocular
d’ophtalmologie. 2001 Feb;24(2):172-4. manifestations of Behçet’s disease in Jordanian
patients. Saudi Journal of Ophthalmology. 2013
10. Taylor SR, Singh J, Menezo Vet al. Behçet
Dec 31;27(4):247-51.
disease: visual prognosis and factors influencing
the development of visual loss. American journal 16. Choudhary MM, Hajj-Ali RA, Lowder CY.
of ophthalmology. 2011 Dec 31;152(6):1059-66. Gender and ocular manifestations of connective
tissue diseases and systemic vasculitides. Journal
11. Baer JC, Raizman MB, Foster CS. Ocular Behçet’s
of ophthalmology. 2014 Mar 17;2014.
disease in the United States: clinical presentation
and visual outcome in 29 patients. Ocul Immunol
Today. 1990 Mar 13;918:383-6.
Effect of Using Simulation (Electronic Media) in Learning

of Some Basic Skills in Technical Gymnastic for 2nd Grade’s
Female Students
Abeer Ali Hussein1, Bashaer Hashim Abdul-Wahid1, Nidhal Obaid Hamzeh1

1
The College of Physical Education And Sport Sciences, University of Karbala, Iraq
Abstract
The research aims to know the effect of using simulation (electronic media) in learning some basic skills
in technical gymnastic for the 2nd grade female students and knowing the best group from the two groups
(Experimental and controlling) for the skills of research. Research sample was divided into two equaled
groups randomly, (16) female student as controlling group and (16) female students as experimental group,
controlling group took learning lessons by the classic method of teaching while the experimental group
took that by simulation (electronic media). Harmonizing the sample and equalizing the two groups of
research that influence the accuracy of results of research and to restricting the differences of influence to
the independent variable only. In order to start the research, the two researchers divided the research sample
which is (32) female students, controlling group practiced learning exercises according to the curriculum of
2nd grade female students, college of physical education and sport sciences of University of Karbala, for (12)
educational unit, while experimental group was divided into two equaled sub-group as (8) female student
per each, in order to organize the educational curriculum, female students of the two groups learnt the new
skill (front hand jump on mat of ground movements) then practicing on it using and developing using lap top
computer and data show screen a skill that they have already learnt it (standing by hand on balance beam),
the two groups compose the main experimental finally, educational curriculum lasts for (12) educational unit,
each lasts for (90) minutes as two units a week due to the differences of learning environment, decreasing
time of learning and exciting female students enthusiasm. One of the most conclusions of the research is
the preference of using the technology of electronic simulation in developing and improving the level of
learning of some skills in gymnastic devices for female students.
Keywords: Simulation, Basic Skills and Technical.
Introduction and job fields. Hence computer becomes so important,

and learning how to use it’s diverse programs in all fields
Using computer becomes necessary in our life, including teaching, our educational system is a developed
what we have witnessed of such tremendous and fast one and keep up with development that our world
development in technology of computer urges us to confronts in field of using computer, this system has been
activate it in the field of teaching by innovative way, updated and enhanced by technology of information and
as there is no field that doesn’t include important role electronic media to become a main element in this system
of computer. Computer is the backbone of educational, to improve and develop it, directing it to be compatible
economic and social process..etc, and it is the main and with new orientations, hence the two researcher decided to
fast tool in processing data, not only spectacular scientific use the electronic simulation in explaining main concepts
and technical developments are the most discriminative for some gymnastic skills and explanation of them in a
characteristics of our time but furthermore the accelerating best way.1
in average of that development, and extent of effect upon
the educational process. Therefore, the student can’t ignore Because of that the two researchers are working in
effect of technical and scientific development especially college of physical education and sport sciences, they
those that relate with technology of information in all observed that there is a difficulty in practicing some
fields of life. Computer is employed in all specializations basic skills in technical gymnastic for female students
(front hand jump on mat of ground movements, standing Subjects: Post exclusion (10) female students from the
on balance beam) as they need more physical potential population to achieve harmony condition in the sample
by female students, and take longer time as they required of learners, sample individuals become (32) student, the
muscular power, gracefulness and flexibility for female sample was divided into two equaled randomly groups,
students. In spite of that it is a practical method for
(16) female students as a controlling group, (16) female
teaching these skills but we have faced a difficulty in
students as experimental group, controlling group takes
teaching these skills due to the difficulty of performing
these searched skills by female students due to relying on lessons by the followed teaching method while the
applying the practical, students confronted a difficulty, experimental group takes lessons by using simulation
that urges the two researchers to tackle with this study.2 (electronic media). Groups have the same teaching
sessions specialized to learn (Skills which are in
Material and Method process or researching in technical gymnastic for female
students). It has been harmonizing the sample with the
Population: The two researchers used the experimental
equivalence of two groups of research that influence the
method with equivalence groups style because this
accuracy of results and to return differences of influence
type is adequate with nature of the research’s problem
to the independent variable only, that is using simulation,
that requires a solution, population was represented by
female students of 2nd grade (day time study), college therefore it is important to verify the harmony and
of physical education and sport sciences – Karbala equivalence of research sample in the variables that are
University, year of (2017-2018) who are (42) students. similar to the skills of research as shown in table (1).
Table 1: Showing the homogeneity of the sample of the research
Variables Mean SD Criteria mistake Skewness

Front rolling over ground movement mat 2.86 0.74 0.19 0.22
Standing by hand over balancing beam 3.13 0.74 0.19 0.22
Table 2: Shows the equivalence of the two groups of research in the variables under study for the
experimental and control groups
Experimental group Controlling group Calculated (t) Evidence

Variables
Mean SD Mean SD values of (t) tabulated level
Front hands jump over
2.81 0.83 2.44 0.73 0.47 Insignificant
ground movement mat
2.04
Standing by hand over
7.00 2.94 6.44 2.39 0.21 Insignificant
balancing beam
Tools and devices used in the research. Means of collecting information.
Tools and devices: 1. Internet.

2. Arabian and foreign references.
The two researchers used the following tools and
devices: 3. Observation and experiment.
1. Personal computer. Field research procedures:
2. Ground movement mat. Specifying the two skills of research: The two skills
3. Data show. were specified according to technical gymnastic method
for 2nd grade in college of physical education and sport
4. Wooden boxes. sciences to be adapted with the research subject and
educational method prepared for it.
Surveillance experiment: Surveillance experiment was independency, we noticed that the goal is the harmony,
implemented on (28/2/2017) on the sample of population regulation, accuracy, response and controlling in
who were (8) female students from those who didn’t warming-up part of the lesson and concentrating
take part in the main experiment, for many aims some education, that is the reason behind using electronic
of them are: means.
1. Organizing the work and adjusting time of In order to startup of research procedures, the
educational unit’s procedures with all divisions. researcher organized the work of two groups (controlling
2. Knowing how much the tests are adequate with and experimental) as follow:
the sample. zz Dividing the research sample which is (32)
3. Knowing the obstacles that may emerge during students by lottery into two groups (controlling and
implementing the tests and educational method experimental), (16) students per group.
and finding solutions for them. zz Controlling group : practicing learning exercises
4. Adjusting timings and required recurrent. up to the followed educational method for the 2nd
grade students in college of physical education and
Pretests: Pretests were implemented for the both sport sciences of Karbala University base on (12)
groups controlling and experimental on (9-10/3/2017) educational unit.
post finishing two identifying educational units (**),
by giving an educational unit for the skill of hand front Experimental group: This group has been divided into
jump on ground movement mat on (9/3/2017) including two equaled sub-groups as (8) students to manage the
explanation of the skill with assistance by pictures and educational method, female students of both groups
related drawings of such skill, then showing that on a trained on learning a new skill of hand front jump on
lap top by a special program, then research sample have ground movement mat, practicing on it, develop an
applied that, at the end of the educational unit, it has been electronic device (Lap Top), data show and a previous
implementing the post test for the sample to assess the learnt skill of standing by hand on balance beam, these
technical performance and accuracy of the skill itself. two group compose the main experimental group.
In the next day on (10.03.2017), giving another Educational method takes (12) education unit
educational unit of the skill of standing on hands on as each one lasts for (90) minutes based on two units
balance beam includes same steps of the unit belong per week due to the change of education environment,
to the first skill in term of explanation, showing and shortening the learning time and exciting the endeavor
application. of female students.
Using an accredited skill in assessment of these Post Tests: Post finishing applying of educational units
skills (*) by giving (10) marks per each skill, this degree experimental and controlling groups, posttest has been
is donated by a three -referee committee, then choosing implemented to assess the technical performance for the
the best degree for each referee via determining the skill of standing by hands on Tuesday (27.04.2018).
arithmetic mean for the best three degrees to calculate
On Wednesday (28.04.2018), posttest has been
final degree per female student.
implemented to assess the technical performance of
Educational method: Pre starting implementing the human wheel. Researcher concerned about circumstances
educational method we must illustrate the relation to be similar for Pretests in term of (place, time and
between the styles that aim to find a bunch of aims and referees).
make use of electronic simulation in learning some skills
of technical gymnastic of students. Results
Aims of using electronic means are: developing Showing, analyzing and discussion the results:
relation between the teacher and student notably Showing the results for research groups, analyzing and
developing the student and increasing his personal discussion them.
Table 3: Showing results of post and Pretests for controlling group’s individuals for the searched skills
Pretest Posttest
differences
Statistical
(t) values
evidence
Mean
Variables N Criteria Criteria
Mean SD Mean SD
mistake mistake
Front hands jump on

15 3.26 0.70 0.18 5.13 0.91 0.23 1.87 9.72 Sig.
ground movement mat.
Standing on balance
15 3.33 0.61 0.15 5.53 0.83 0.21 2.2 12.60 Sig.
beam.
Table 4: Showing results of post and Pre tests for experimental group (simulation by electronic means) for
the skills
Pretest Posttest
differences
Statistical
(t) values
evidence
Mean
Variables N Criteria Criteria
Mean SD Mean SD
mistake mistake
Front hands jump on ground

15 3.26 0.79 0.20 7.13 0.74 0.19 3.87 42.56 Sig.
movement mat
Standing on balance beam 15 3.13 0.74 0.19 7.20 0.77 0.20 4.07 61 Sig.
Shows difference of post and Pre measurement for experimental group (Simulation by electronic means).
Tabular value of testing (t) at evidence level of (0.05) and freedom degree of (14) equals to (2.14).
Table 5: Shows statistics for variables in post measurement
Criterion Mini. Max.

Variables Groups N Mean SD
mistake value value
Controlling group 15 5.13 0.91 0.23 4 7
Front hand jump Pending group 15 7.13 0.74 0.19 6 8
over ground
movement mat Monitor group 15 6.26 1.03 0.26 5 8
Total 45 6.17 1.21 0.18 4 8
Controlling group 15 5.53 0.83 0.21 4 7
Standing by hands Pending group 15 7.20 0.77 0.20 6 8
over balance beam Monitor group 15 6.53 0.83 0.21 5 8
Total 45 6.42 1.05 0.15 4 8
Discussion of Results considering its adaption to abilities and capabilities of

students in addition to the graduation in difficulty level
The two researchers confirm, through statistic for movements and skills that ensure performance by
results, that the followed educational method by all participants, that goes with what was mentioned
the teacher of material has influence upon students’ by (Najah Mahdi Shalash and Akram Mohammed,
learning of basic skills over ground movement mat 2000), as they wrote “ Practicing and paying efforts in
and balance beam in technical gymnastic that depends training and frequent recurrences are so important in
the educational style relied by material’s teacher to the process of learning and earning skills, also training is
appropriate recurrences that accompanied educational a main factor in process of individual interaction with
units,3 plus to performing the continuous exercises skill and controlling his movements and achieving
harmony between movements that compose the skill in and help him to concentrate his learning also to update
an intact consecutive performance and appropriate time with nowadays development and increasing thrill and
beside it increases learning of a skill and profession of exciting for student to break the routine during practicing
it”,4 In order to enable the two researchers to discover exercises in lecture.
the differences between post and Pre differences to
the individuals of experimental group, they apply Education units included a bunch of different
processing data statistically and determining values of movements for back, arms, legs and head in addition to
arithmetic mean, criterion deviation for all variables of different movement fast and slow up to the movement
the research as shown in table(4), that confirms that there time, recurrence and distance besides using virtual
is a significant effect of educational method in learning reality technology via data show screen, all of that help
some basic skills over ground movement mat and in learn and earn the searched skills.
balance beam in technical gymnastic which is applied
by the two researchers because the training units include That ensures the used exercises in education units
a group of different movements for the back, arms, legs with window of virtual reality have participated in
and head, also fast and slow diverse movements up to learning and earning basic skills (On the movement
the time of movement,5 recurrence and the distance, in ground mat, jumping beam, parallel beams and hinge
addition to using a technology by electronic simulation devices) for students, researcher attributed that for
represented by using a monitor (Data Show) and lap top, the response of students for all learning requirements
all of that helps in learning and earning a good level of via educational units considered as one of the most
legal and scientific knowledge for the material technical
active means to show powers, keeping good levels
gymnastic of the students in addition to the skills of
and achieving goals, researcher sees that showing the
(front hand jumping over ground movement mat and
skill through screen is a keeping up with the modern
standing by hands over balance beam).
development that happens in all fields of science, many
The reason behind this learning and earning skills universities lack this modern method.8
is the response of students for all learning requirements
Achieving to the aim of the study including
via educational units considered as the most prominent
knowing the excellence of differences between using
active means to show the powers, keeping best levels environments of electronic simulation and used method
and achieving aims, (Nazar Altalib and Kamil Louis, by the teacher in improving performance level for some
2000) referred to that “The athletic who endeavor toward skills in devices technical gymnastic for female students.
a specific aim will be a motive for him in his work,
work without an aim is a fruitless and neglected job so Conclusions
the sport instructor should help the athletic to apply an
1. Using electronic simulation technology has an
appropriate goal for him to be able to achieve to create a
active effect in developing and improvement
value for the exercise and to let the athletic knows how of learning level of some skills on gymnastic’s
much he progress”.6 devices for female students.
Also (Ed.Lisa Yount) refers that “ Using learning 2. Results showed that there is an excellence in using
technology in training is better because it diminish risks electronic simulation technology in developing
of injury and help hearing-problems student to focus and improving learning level of some skills on
and learn the main skills then study materials more gymnastic’s devices for female students
exciting, hence students will become more subjected
Ethical Clearance: Taken from University of Karbala
to remember what they have learnt, economically, VR
committee
technology will be cheaper than other means”.7The two
researchers see that using electronic simulation create Source of Funding: Self
an ideal environment for learning notably in gymnastic
whereas isolating all external influences on the student Conflict of Interest: None
References 5. Hayder M. A. Effect of the method of oriented

exploring and computer in learning some skills on
1. Ibtihal H. A. Effect of special excercises according
the ground movement mat for technical gymnastic
to sensual preferences in learning of some skills
for men. College of physical education and sport
on ground movement mat and jumping stage in
sciences/University of Babylon.2010
technical gymnastic 2016 for students, MSc.
Thesis, college of physical education and sport 6. Nazar A. & Kamil L.Sport Psychology, Mosel
sciences/University of Karbala. university, Dar Alkutub press.2000
2. Ahmed J.Gymnastic is the guide for coach and 7. Hydi M. Design and Development for the virtual
athletic, 1st print, Syria, Edlib, Shuaa press.2000 world (Analyzing of challenges that breeders face)
, MSc., college of education, section of learning
3. Ahmed M. S. Technology and education means,
technology, Iskandariyah University.2009
2nd print, Alriyadh, Alrushd Library.2006
8. Siclovan. Conculul national De-edicatia Fizica Si
4. Ahmed M. A. Individual differences psychology
Sporti. (Bucureti –Romania, Editera.2001
and its educational application, 1st print,
Damascus, Alfikr press.2007
Body Image and Physical Perception of Children with

Precocious Puberty in Baghdad City
Adraa Hussein Shawq1, Eqbal Ghanim Ali2

1
Instructor, 2Professor, Pediatric Nursing Department, College of Nursing, University of Baghdad, Iraq
Abstract
Study Aim: To valuate children physical perception toward their early body maturation and their body
satisfaction.
Methodology: A cross-sectional study, of (63) children from both genders, > 7 years diagnosed with
precocious puberty, attending endocrine clinics in Baghdad city. Consent form taken from children and
their guardians to participate in the study. Tanner scale image and Child Body Image Scale CBIS were used,
the discrepancy between children selection reflect their physical perception and body satisfaction. SPSS
programme version 23 used for data analyses.
Result: children with precocious puberty were occupied in their earlier body maturation; they showed
physical awareness toward these changes, and this earlier maturation caused unaccepted body image for
them.
The researchers recommended details psychological assessment for children with precocious puberty during
their routine physical examination and provide suitable psychological support for them and their parent.
Keywords: physical perception, body image, precocious puberty
Introduction esteem, social relations, and academic performance

positively (8, 7, 4). Evaluate children psychosocial condition
Normal onset of puberty characterized usually is helpful to prevent children psychological trauma and
by development of secondary sexual characteristics faced their challenges positively (9, 8, 1).
between (8-14) years for girls and (9-15) years for boys,
while earlier onset of puberty than expected described
Method and Materials
as precocious puberty (1-2). Precocious puberty is more
common in girls than boys, approximate 10:1 with no Method
explanation (3&4), attention needed for diagnosis with
precocious puberty that result from tumor or other Research design: A cross-sectional study used,
disorder (5), it is consider stressful period for those children data were collected from first of May tile the first of
(6)
. Early physical changes and growth spurt caused by November 2018.
premature activation of hypothalamus- pituitary axis,
Setting: study was carried out in outpatient endocrine
lead to mismatch between their physical maturation and
clinics at pediatric teaching hospitals and specialized
psychosocial immaturation can cause peer differences,
centres in Baghdad city.
behavioral problems, and unaccepted body changes (7, 2,
1)
. Accepted body image is affected on children`s self- Instrument of the study and procedure: Tanner scale
image and Child Body Image Scale were widely used in
previous children studies and showed highly validity and
Corresponding Author: reliability. Tanner scale with five pubertal developmental
Adraa H. Shawq images, gender specific, developed by Marshal and
College of Nursing, University of Baghdad Tanner (1973) used to assess puberty stage, represent
Email: adraa.hussein@gmail.com the secondary sexual characteristics development during
period of maturation. Children were asked to select one In these figures, mean age of children diagnosed with
that closest to their early body changes as they percept. precocious puberty is (8.41 ± 2.7), most of the sample
Children assessment compare with physician assessment (88.5%) at school age (6-12) years, (85.0%) are girls.
regarding their puberty stage, the similarity between
children and physician assessment reflect children Table 1: Comparison between children and
awareness toward their early physical maturation. physician regarding stages of assessment
Child Body Image Scale is a pictorial scale, with Children Physician

Puberty assessment assessment assessment
seven image (1= scrawny, 2 & 3= typical image, 4 &
Puberty Stages
5= overweight, 6 & 7= obese), used to assess children F % F %
body satisfaction, the approval taken directly from the Stage 1 0 0 0 0
ownership. Children asked also to select one image that Stage 2 21 33.4 17 27
represent their actual body image and select another Stage 3 21 33.4 31 49.2
image that they desire to be. The discrepancy between Stage 4 12 19 12 19
children actual and desire body image; reflect their body
Stage 5 5 7.9 3 4.8
dissatisfaction.
Do not know 4 6.3 0 0
Statistical Analysis: The statistical package for social Total 63 100 63 100
science (SPSS) version 23 was used for data analysis. The
descriptive statistical measures of frequency, percentage, In this table. (33.3 %) of children assessed their
mean, and standard deviation were used. T-test was used puberty stage in stage (2 and 3) for both of them
to investigate the differences among groups. respectively, compare to (27%, 49.2%) of pubertal
physician assessment in stage (2 and 3) respectively.
Results

Figure 1: Child’s age and gender distribution (study In this figure 60.3% of children puberty assessment
group) was identical to physician assessment.
Table 2: Paired Samples Test for puberty assessment scale and child body image scale
Paired Sample Test

Sig.
Std. Std. Error 95% Confidence Interval T0 Df
Scale Mean (2-tailed)
Deviation Mean Lower Upper
Puberty 3.1 ± 0.9 2.43412 1.23453 1.23212 5.23563 6.573 6 .000
Body image 3.3 ± 0.1 1.46641 2.11043 1.53661 5.54333 4.251 9 .955
In this table there is significant association between

children and physician puberty assessment by Tanner
scale (p = .000), while no association between children
actual and desire body image (p > 0.005).
Figure 3: Comparison between children actual and

desired body image
In this figure, (38.15, 23.8%) of children actually body image disturbance, low self-esteem, and negative
select obese and overweight image respectively, while expressive outcomes about their bodies than normal
(61.9%) of children desire typical image. developing children (12).
Choi & Kim (2016) coincide with the present finding

Discussion in their study about body image and depression of (82)
The result of the study support previous finding girls diagnosed with pp that, early puberty mostly lead
that, (85%) of children was girls, (88.5%) at school age to negative body image, low self-esteem and usually
correlated with negative feeling and behaviours about
(figure, 1). This result supported by Al-Shuwailli (2017)
themselves (13). In addition, their awareness about the
and Hammed (2015) in their study in Baghdad about
degree of sexual maturation body was correlated with
precocious puberty that majority of children was girls
body dissatisfaction and depression signs, especially late
and mostly were > 6 years (6, 9).
pubertal stage (3- 5) (13).
The finding showed higher percentages of children
Michigan Medicine school (2011) reported in their
and physician assess puberty development at stage 2 and study about children with precocious puberty that,
3 according to Tanner scale. In addition, figure (2) showed being different from peers especially in body shape
(60.3%) of children assessment similar to physician make children in stressful situation, children with early
assessment regarding puberty changes, and in table (2) maturing body experience teasing, negative body image,
a significant association between children and physician and low self-esteem (14).
means was at (p. = .000). This finding concerned that
children aware toward their body changes; majority
Conclusion
of children at school age, their identity and cognitive
development was developed. Children with precocious puberty were occupied
with their body changes and showed awareness toward
Different researcher used Tanner scale to assess their early sexual characteristics development. These
children puberty development such, a study by Ernst et earlier body changes affects negatively on their body
al. (2018) about self-assessment of pubertal development satisfaction.
with 715 child aged 8-16 years showed that children
with late stage of puberty can assess their development
Recommendations
correctly (10). Another study by Chan et al. (2008)
about reliability of pubertal self-assessment in Hong Assess children psychosocial profile during routine
Kong children that with 354 children aged 8-18 years physical examination. Provide emotional and social
documented that, Tanner pubertal self-assessment scale support for those children and their parent to avoid
can reliably estimate for sexual maturation status (11). psychological trauma.
Those children experience also body dissatisfaction; Conflict of Interest: The researchers report no conflict
figure (3) revealed most of children selection for actual of interest.
body image was different to their desired one, and table
Source of Funding: This study did not receive any
(2) showed no association between children selection (p
funding from any agency.
> 0.005). Because majority of the sample was girls and
their body mass index and sexual characteristics was Ethical Clearance: A permission to conduct this study
different and developed earlier than peers; mostly lead to was obtained from the ethical committee in the College
unaccepted body image. This may affects negatively on of Nursing, University of Baghdad
children well-being later, also low educational level and
early marriage and may be associated, especially for girls. References
This consistent with a study by Williams et al. Avery M, Williams F. The importance of pharmacist
(2018) about reviewing and evaluation psychosocial providing patient education in oncology. J Pharm
studies concerning children with precocious puberty (pp) Pract [Internet]. 2015 [cited 2016 Jan 27];28(1):26-30.
that, most studies revealed those children experience doi:10.1177/0897190014562382
1. Alaniz V, Huguelet P, and Scott S. Precocious 9. Al-Shuwailii SH. Effects of gonadotropin-

Puberty. Postgraduate Obstetrics & Gynecology. releasing hormone agonist therapy on clinical
2013; l(23). and laboratory aspects of patients with central
precocious puberty. (Unpublished thesis) College
2. Patel P. Identifying areas of needed support for
of Medicine, University of Baghdad, 2017.
young girls with central precocious puberty
(CPP). (Published dissertation). University of 10. Ernsta A, Lauridsena LB, Brix N, Kjersgaard
Washington, 2016. C, Olsen J, Parner ET, Clausen N, Olsen LH, &
Ramlau-Hansen CH. Self-assessment of pubertal
3. Kirk A. Are you ready for puberty? Are parents
development in a puberty cohort. Journal of Pediatric
having the puberty talk with their children early
Endocrinology and Metabolism, 2018, 31(7).
enough? 2017. www. puberty_.html.
11. Chan NP, Sung RY, Kong AP, Goggins WB, So
4. Clarkson LM. Psychology, behavior, and the
HK, & Nelson AS. Reliability of pubertal self-
family environment in children with diagnoses
assessment in hong kong chinese children. Journal
of precocious pubertal development. (Published
of Paediatrics and Child Health, 2008, (44).
thesis). University of Birmingham. College of
Life and Environmental Sciences, 2013. 12. Williams VS, Soliman AM, Barrett AM, & Klein
KO. Review and evaluation of patient-centered
5.
Kletter GB, Klein OK, & Wong YY. A
psychosocial assessments for children with
Pediatrician’s guide to central precocious puberty.
central precocious puberty. Journal of Pediatric
Journal of Clinical Pediatrics, 2015, 54(5).
Endocrinology and Metabolism, 2018, (7).
6. Hammed FA. Central precocious puberty of
13. Choi MS, & Kim EY. Body image and depression
patients attending welfare teaching hospital.
in girls with idiopathic precocious puberty treated
(Unpublished thesis), College of Medicine,
with gonadotropin-releasing hormone analogue.
University of Baghdad, 2015.
Annals of Pediatric Endocrinology & Metabolism,
7. Neely EK, &d Crossen SS. Precocious puberty. 2016, 21(3).
Journal of Obstetrics and Gynecology, 2014,
14. Michigan Medicine study. Precocious puberty
26(5).
(Early Puberty). 2011, http://www.med.umich.
8. Ning C, Green-Golan L, Stratakis AC, Leschek edu.
E, Sinaii N, Schroth E, Ernst M, & Merke DP.
Body image in adolescents with disorders of
steroidogenesis. London Journal of Pediatric
Endocrinology & Metabolism, 2008, (21).
Health Workers Roles as Healthy Model: Concept and

Instrument Developing
Agustina Arundina Triharja Tejoyuwono1,2, Lely Lusmilasari3, Toto Sudargo4

Department of Community Medicine, Faculty of Medicine Tanjungpura University, Jl. Prof Hadari
1
Nawawi No. 01, Pontianak, West Kalimantan, Indonesia; 2Doctoral Program, 3Department of Nursing,
4
Department of Nutrition and Health, Faculty of Medicine, Public Health and Nursing, Universitas
Gadjah Mada, Jl. Farmako Sekip Utara, Yogyakarta, Indonesia
Abstract
Health workers are expected to be a role model, especially in healthy behavior, but the concepts and
instruments to assess these roles are still few and not specific. This research purposed to describe the concept
and develop an instrument of roles as healthy model. The study was conducted for 22 months in Pontianak
and Yogyakarta, Indonesia with two stages of research.The four concepts of health workers roles as healthy
models are to have a good knowledge, attitudes and behaviors regarding healthy behavior and have an ideal
physical appearance. The results of the construct validity was obtained 60 valid items with Cronbach’s alpha
was 0.89. The roles as healthy models have gone through the stages of validity and reliability needed in
making instruments.
Keywords: Health Workers, Roles, Healthy Model, Concept, Instument
Introduction groups specifically regarding the role of health workers

as role models for healthy living behaviors.
The role as a role model is considered to be a person’s
needs at the highest level, to actualize themselves and
Method
self-esteem as health workers. Professionalism behavior
will be created on health workers who can become a role The research process is carried out in two stages
model that will ultimately affect the patient’s trust in starting from May 2017 until March 2019 in Pontianak
medical action, adherence and satisfaction with health City, West Kalimantan. This research had received
services 1. Confidence in providing therapy to patients is ethical approvalal from the Medical and Health Research
also affected 2. Based on the health professional code of Ethics Committee Faculty of Medicine, Public Health
ethics there are four areas that health workers must have and Nursing Universitas Gadjah Mada number KE/
to apply their role as role models of health educators, FK/0528/EC/2017 with continuing review approval KE/
becoming a mentor, becoming role models in responding FK/0435/EC/2018.
to differences, showing performance as a teacher, and
gaining trust from society3. Stage 1. Concept development: The first phase of this
research was conducted to develop the concept of the
Several studies that assessed the role model of role of health workers as a role model for healthy living
the health workers in their area had used assessment behavior, carried out from May 16, 2017 to August
instruments. Based on the literature search found an 14, 2018, in Pontianak, West Kalimantan, Indonesia.
instrument that has been developed to assess nurses as The study was conducted with exploratory qualitative
role models for health promotion 4, other role model methods, data collection using in-depth interviews with
instrument is on the physical therapist 5. Nonetheless, 26 informants with the background of health personnel
from these literature have never been found that from six stakeholders with criterion sampling method.
developed instruments for evaluating the role of health Table 1 shows the criteria for informants used in the
workers in several health professions and informant study and the number involved in the study.
Data collection was carried out in various places and times agreed upon between informants and data collectors,
explanations of research and objectives were carried out from the beginning of the introduction and requests as
informants accompanied by the signing of informed consent. Interviews were carried out in only one meeting,
with an average time of 60 minutes/informant, data analysis was carried out by transcribing the results of sound
recordings, making coding, categories and themes. This process is carried out 2 times for quality control by all
authors, in addition to increasing the validity of the results, the expert test is conducted
Table 1: Informan Groups
Experts have a doctoral education background in making instruments is carried out from September 2018
nursing with experience conducting qualitative research to March 2019, starting from setting the type of answer
and qualitative training, meeting with experts is done choices with a 5-point-likert scale-strongly disagree,
twice face to face and once via email. To maintain disagree, neutral, agree, strongly agree, determining
the confidentiality, each informant will be given a closed question types, compiling answer instructions
code namely PHO (O1-O3), head of PHC (H1-H3), and instrument formats.
community (P1-P3), medical student (S1-S5), clinical
In the initial stage, 172 pool of items were made
practitioner (L1- L6) and health lecture (L1-L6).
where in the first variable to third each was 50 items and
Stage 2. Instrumen development: Research in the the last variable was 22 items, the next stage is content
second phase was carried out to make the instruments validity with five experts, consisting of three experts
roles as healthy model, from four variables based on representing each health professional organization
the results of the theme in stage one. The process of in Yogyakarta and understand the code of ethics of
the role of health workers as role models for healthy healthy living behavior, has an attitude as a role model
behaviors. Others experts expertised in the qualitative for healthy living behavior, has a healthy lifestyle and
field and making instruments with educational doctoral has an ideal physical appearance.
backgrounds in the nursing. The experts were asked to
provide an assessment of representativeness and clarity These criteria means health workers have to a
on each item using a 4-point Likert scale-not represent/ good abilities and expertise in applying healthy living
clear, major revision, minor revision, represent/clear behavior as an initiator, promoter and informer of health
6
. Analysis with Aiken’s V for each item based on the in the community. Doing physical activity, increasing
responses of experts 7. vegetables and fruits consumption, no-smoking
behaviour and having an attractive appearance, fit,
The 105 represent questions are proceed to the trial
energic and rarely ill was a trends,desire and readiness
phase 1, validity criterion test. This stage was carried
as health workers to increase public trust and behavior
out on 44 health workers in the hospital of Tanjungpura
and implementation of health programs.
University Pontianak, RS. Abdul Azis Singkawang
and the Faculty of Medicine, Tanjungpura University. Stage 2. Instrumen development of Roles as Healthy
Analysis with Pearson product-moment (r >0.2973) and Model: At the content validity test stage, expert
alpha reliability >0.7. Phase 2 trials were conducted qualifications determine the results of the instrument
on 140 respondent’s postgraduate students of Medical, assessment, so the selection of experts is also important.
Public Health And Nursing Universitas Gadjah Mada Based on the results of the expert assessment with the
(FKKMK-UGM). At this stage using the confirmatory Aiken’s V test of 172 items tested, 67 questions were
factor analysis (CFA) test with the aim of testing construct not representative and 82 unclear questions, this was
validity by assessing convergence and discriminant of because the item had ratings of less than 0.87. Unclear
each item. Analysis using Lisrel 8.80 software results but representative questions have been corrected
according to expert input and used at the trial stage.
from the evaluation was seen from the evaluation of
goodness of fit (GOF), namely chi-square (p-value The sample at the first trial stage was 14 respondents
>0.05), root mean square of approximation (RMSEA) work as doctors, 16 nurses and 14 nutritionists, respondents
<0.08, standardized root mean square residual (SRMR) have worked for approximately 7 years, with education
<0.08, comparative fit index (CFI) >0.90, in addition to between diplomas to doctoral degrees. At this stage, 74
testing between items received by looking at the number valid questions were obtained from 105 questions with
of factor loading >0.5 and alpha value >0.75 8,9. coefficient alpha 0.933, questions that were invalid and did
not affect the objectives of the variables to be measured,
Findings omitted and not used at a later stage.
Stage 1. Roles as Healthy Model Theme: Exploration At the second trial stage, 330 questionnaires were
of the opinion of health workers regarding their role as distributed to potential respondents divided into five
a role model for healthy living is done by involving 2 postgraduate study programs at FKKMK-UGM, but
health education institutions and 5 PHCs in the Pontianak only 140 questionnaires (42.4%) were returned and
City area. Based on the results of qualitative analysis it complete. 66 respondents work as doctors, 59 nurses
was found that the role of health workers as role models and 15 nutritionists, besides, 73.6% of respondents are
of healthy behavior was defined as behavior patterns, women, aged less than 40 years. In table 2, it can be
values, attitudes, knowledge that must be possessed seen the results of construct analysis where 60 questions
by health workers as an example for themselves, the have a loading factor >0.5 with the reliability level of
community and other colleagues in applying physical each criterion >0.75. 14 Invalid items in each criterion
activity, patterns balanced eating, smoking behavior and are considered inappropriate because they have a small
having an ideal physical appearance, which are grouped loading factor of <0.5, which in the end the item is
into 4 criteria: someone who has good knowledge of discarded.
Table 2: Loading factor Analysis Roles as Healthy Model Items
*: invalid items; italic: unfavorable item.
At the beginning 172 items was developed from 4 Discussions

variables roles as healty model, after evaluating content The roles as healthy model are the results of the
by expert, there were 105 items that had a high rating. In development of themes from qualitative exploratory
the test phase of the validity criteria 31 questions were results, which as far as it is known researchers have
invalid and eliminate at the next test phase, so that the never made an instrument to assess the role of health
remaining 74 questions to be tested at the content validity
workers as a role model for healthy behavior in the
test stage. The final result of the instruments roles as
community before. This instrument has gone through
healthy model is 60 questions with alpha coefficient
0.89. The standard GOF measurement model is obtained several stages of testing to produce a valid and reliable
in the roles as healthy model variable, namely the chi- instrument to be used in a diverse healthcare profession,
square value = 0.25, df = 2, p-value = 0.88348, RMSEA especially doctors, nurses and nutritionists. Furthermore
= 0,000, so it can be concluded that the measurement this instrument was also developed based on information
model on the role model variable has been designed from informants with different workplaces, namely in
based on theory fit with data in the field. Roles as healthy hospitals, health centers, and educational institutions, in
model instrument available on request addition to the different fields of work, namely at the
head of the PHC, administrators of health organizations, life in the community 20. Positive appearance is an
practitioners in health centers, user communities health attribute that must be possessed by health personnel in
services and teaching and medical students. addition to interpersonal skills, ability to be a leader and
commitment to the right actions 21,22.
Health workers are considered as a role model for
the community in a healthy lifestyle because they are
Conclusion
considered to have extensive knowledge about health,
so the role as a role model is attached to health workers Health workers must have behavior, values and
as health educators in the community 3,10. “Practice what attitudes and knowledge as a role model for themselves,
they preach” is one of the responsibilities of a health society and collegues in healthy behaviors such as
worker who in this study not only in the community applying physical activity, balanced diet and no smoking
but also in themselves and health colleagues 11,12. The behavior also having an ideal physical appearance. 60
responsibility as a role model is a competence and items Instruments roles as healthy model are developed,
an unwritten contract with the community, besides namely knowledgeable about good health behavior,
that it is considered as the most powerful learning have good health behaviors, have healthy life behaviors,
model to share knowledge and skills with others. So and have an ideal physical appearance. This instrument
that the role as an example must be realized by health still has weaknesses because the number of samples was
personnel, maintaining behavior at all times and places to small to assess instruments, besides this research is
13
. Awareness of behavior as a role model will increase carried out only in 2 regions in Indonesia so that it still
trust, perception and closeness of relationships with has the opportunity to be developed in other regions.
patients, besides that health workers will find it difficult
to provide health promotion if they never apply and have
Acknowledgements
experience doing healthy behaviors 14,15. As a health
promoter, implementing a healthy lifestyle will increase The authors would like to thank the Ministry of
his credibility, which will affect the compliance of the Research, Technology and Higher Education Republic
treatment and the patient’s beliefs when consulting. In of Indonesia (KEMENRISTEK DIKTI) as a scholar
the end, this increased credibility will also increase self- funder, all expert,informants and respondents who
confidence as a health worker who is considered to have participated in this research and Staffs of Klinik Bahasa
good knowledge and abilities 15,16. FKKMK-UGM
When compared with the concept and role model Conflicts of Interest: The authors declare that there is
instruments on health workers that have been formed no conflict of interest that may influence them in writing
before, several similarities were found such as the concept this article.
of responsibility, practice what they preach and accepting
themselves as an agent of change. Another concept that is
References
almost the same is that health workers are also a human
being who in acting is not always perfect, as well as being 1. Howe M, Leidel A, Krishnan SM, Weber A,
a role model of living behavior, even if seen from the Rubenfire M, Jackson EA. Patient-related diet and
social norms, health workers must adopt healthy behaviors exercise counseling: do providers’ own lifestyle
as an example and become an example for yourself, the habits matter? Prev Cardiol. 2010;13:180-85.
community and colleagues 4,17. Being a role model is also 2.
Webb H. Doctor-patient interactions during
considered to affect the trust of health workers, patients medical consultations about obesity: University
will pay more attention to the advice given 14,18,19. of Nottingham; 2009.
The difference in variables formed by concepts 3. Bruess CE. The importance of health educators as
and other instruments is the assessment of the ideal role models. Am J Health Educ. 2003;34(4):237-9.
physical appearance of health workers. Physical 4. Rush KL, Kee CC, Rice M. The self as role
appearance is considered to affect the first impression model in health promotion scale: development
of the community on health workers, besides that it will and testing. Western journal of nursing research.
also affect self-confidence in doing work and in social 2010;32(6):814-32.
5. Black B, Marcoux BC, Stiller C, Qu X, Gellish and weight influences their perceptions of
R. Personal Health Behaviors and Role-Modeling nutrition and exercise advice received. JPHC.
Attitudes of Physical Therapists and Physical 2013;5(4):301-7.
Therapist Students: A Cross-Sectional Study.
16.
Zhu DQ, Norman IJ, While AE. Nurses’
Physical Therapy. 2012;92(11):1419-36.
self-efficacy and practices relating to weight
6. Yaghmale F. Content validity and its estimation. management of adult patients: a path analysis. Int
Journal of Medical Education. 2003;3(1):25-7. J Behav Nutr Phys Act. 2013;10(131):1-11.
7. Aiken LR. Three Coefficients for Analyzing the 17. Kelly M, Wills J, Jester R, Speller V. Should
Reliability and Validity of Ratings. Educational and nurses be role models for healthy lifestyles?:
Psychological Measurement,. 1985;45(1):131-42. results from a modified Delphi study. Journal of
advanced nursing. 2016;00(0):1-14.
8. Hair Jr JF, Black WC, Babin BJ, Anderson RE.
Multivariate Data Analysis-Seventh Edition- 18. Blake H, Malik S, Mo PKH, Pisano C. ‘Do as I
Pearson New International Edition. Essex- say, but not as I do’: Are next generation nurses
England: Pearson; 2014. role models for health? Perspectives in Public
Health. 2011;131(5):231-9.
9. Bolarinwa OA. Principles and methods of validity
and reliability testing of questionnaires used in 19.
Biernat E, Poznanska A, Gajewski AK. Is
social and health science researches. Nigerian physical activity of medical personnel a role
Postgraduate Medical Journal. 2015;22:195-201. model for their patients. Ann Agric Environ Med.
2012;19(4):707-10.
10. Rush KL, Kee CC, Rice M. Nurses as imperfect
role models for health promotion. West J Nurs 20. Cant RP, Aroni RA. Exploring dietitians’ verbal
Res. 2005;27(2):166-83; discussion 84-7. and nonverbal communication skills for effective
dietitian–patient communication. J Hum Nutr
11. Helfand BKI, Mukamal KJ. Healthcare and
Diet. 2008;21:502–11.
lifestyle practices of healthcare workers: do
healthcare workers practice what they preach? 21. Petrili CM, Mack M, Petrili JJ, Hickner A, Saint
Jama Intern Med. 2013;173(3):242-4. S, Chopra V. Understanding the role of physician
attire on patient perceptions: a systematic review
12. While AE. Promoting healthy behaviours – do we
of the literature—targeting attire to improve
need to practice what we preach? London J Prim
likelihood of rapport (TAILOR) investigators.
Care (Abingdon). 2015;7(6):112–4.
BMJ Open. 2015;5:e006578.
13. Cruess SR, Cruess RL, Steinert Y. Role modelling-
22. Cant RP. Communication competence within
-making the most of a powerful teaching strategy.
dietetics: dietitians’ and clients’ views about
BMJ. 2008;336(7646):718-21.
the unspoken dialogue – the impact of personal
14. Blake H, Harrison C. Health behaviours and presentation. Journal of Human Nutrition and
attitudes towards being role models. Br J Nurs. Dietetics. 2009;22:504-10.
2013;22(2):86-94.
15. Fraser SE, Leveritt MD, Ball LE. Patients’
perceptions of their general practitioner’s health
Assessment of Serum Glucose and its Correlation with the

Pregnancy
Alaa Umran Musa

Karbala maternity teaching hospital, Karbala, Iraq
Abstract
Gestational diabetes is a temporary (in most cases) form of diabetes in which the body does not produce
adequate amounts of insulin to regulate sugar during pregnancy. The aim of the present study, to evaluate the
correlation between the serum glucose levels and pregnancy complications in gestational Diabetes Mellitus
(GDM) and healthy individuals. In this case control study, pregnant women with GDM (n=30) and healthy
(n=30) visited in the Karbala maternity teaching hospital were enrolled in the study. The women showing a
fasting blood glucose (FBG) ≥105mg/dl were considered in the group of gestational diabetes (GDM). The
GDM women showed significantly (p≤0. 0001) higher area under the curve and the fetus birth weight as
compared to the healthy women. This increase in the fetus birth weight results in the C-section delivery.
About 83.34% GDM women undergone C-section delivery, while only16.66% normal delivery occurs.
The fetus birth weight is positively correlated with the presence of GDM i.e. insulin resistance. Serum
high glucose level was positively correlated with the pregnancy complications such as C-section delivery,
premature birth, increased in fetus weight etc.
Keywords: Gestational diabetes, C-section delivery, fasting blood glucose, fetus weight
Introduction of the fetus. When glucose is transported across placenta

it stimulates pancreatic insulin secretion. Insulin is also
Gestational diabetes is a temporary (in most cases) an important hormone required for growth apart from
form of diabetes in which the body does not produce its role of just maintains glucose homeostasis6. In GDM
adequate amounts of insulin to regulate sugar during there is increased risk of macrosomia which is increasing
pregnancy. It may also be called glucose intolerance birth weight of infant >4kg or >4.5kg, induction of labor
or carbohydrate intolerance1. The thrifty phenotype and cesarean section. GDM is associated with long term
hypothesis state that the low neonatal weight is correlated adverse outcomes for mother and also for offspring
to an increased level of blood sugar or higher peripheral like obesity and cardiometabolic risk7. Carbohydrate
insulin resistance2-4. This low birth weight may leads to intolerance often results in high serum glucose levels
an intrauterine programming process retardation which i.e hyperglycemia during pregnancy7. Hyperglycemia
in turn negatively affect organ maturation2,5. during pregnancy is less severe than in type 2 diabetes.
In normal pregnancy, insulin resistance is similar But still, it can lead to adverse pregnancy outcome.
to type 2 diabetes. This syndrome worsens in the third Carbohydrate intolerance in pregnancy who are without
trimester and leads to gestational Diabetes Mellitus Gestational Diabetes, also leads to adverse maternal
(GDM). Changes in insulin resistance occur to transport and even fatal outcomes. Thus, fetal morbidity is
glucose across placenta that is needed for normal growth prone at a very lower glucose level in pregnancy, i.e.
<140mg/dl8. The American College of Obstetrics and
Gynecology (ACOG) had laid a few recommendations
Corresponding Author: for GDM patients. The cutoff capillary glucose value
Alaa umran Musa must be, Preprandial glucose <95 mg/dL (5.3 mmol/L),
Karbala maternity teaching hospital, Karbala, Iraq 1-h postprandial glucose 130–140 mg/dL (7.8 mmol/L)
Phone: 009647700827608 and 2-h postprandial glucose <120 mg/dL (6.7 mmol/L)9.
Email: alaaumran2015@yahoo.com Hyperglycemia during pregnancy is generally detected
between 24 to 28 weeks. It results in poor pregnancy the age group between 19-40 years with fasting plasma
outcome and must be managed properly. Obesity, glucose (FPG) ≥ 110mg/dl) (As per the ADA guidelines).
pregnancy at old age, multi-parity, weight gain during The parameters like child birth weight, type of delivery
pregnancy, short stature, family history of diabetes, and duration of pregnancy was recorded.
polycystic ovarian syndrome (PCOS) are a few of
the risk factors for hyperglycemia during pregnancy. The fasting blood was collected (2ml) in the plain
Therefore, diagnostic criteria were conventionalized vacutainers from the vein after getting participant oral
for 24–28 weeks of gestation including glucose values consent. The samples were kept at room temperature
during an oral glucose tolerance test (OGTT)10. With this for 30min. Followed by the centrifugation at 3000rpm
background, we aim to study the correlation between the for 15min. The serum was separated and kept at 20°C
serum glucose and its pregnancy in Iraqi women. for further study. The post prandial blood sugar was
estimated after 1 and 2hr.
Material and Method Serum sample was used to evaluate serum glucose
by using commercially available kits (Coral Clinical
This study included 60 pregnant women enrolled
Systems, Goa, India).
to the Karbala maternity teaching hospital in January
2019 to April 2019. They were successively performed a Statistical Analysis: The data were subjected to
100g/3hr oral glucose tolerance test (OGTT) between the statistical analysis using GraphPad Instat (3.0, Trial
24th and 26th gestational week. The test was performed Version). Results were presented as Mean ± Standard
at Karbala maternity teaching hospital according to Error (SE). Dunnett Multiple Comparison Test and
recommended guidelines of the American Diabetes one way Analysis of Variance (ANOVA) was done to
Association11. According to this protocol, a full 100-g estimate the statistical significance.
3-h OGTT should be performed in all women and their
glucose clearance as measured. In the present study, Results
pregnant women with reported diabetes were screened
for their further complications. The women showing a fasting blood glucose (FBG)
≥105mg/dl were considered in the group of gestational
Fasting blood (n=30) was collected by a single diabetes (GDM). Other, women were included in the
puncture form the diabetic patients and healthy normal group (FBG ≤105mg/dl). The OGTT was
participants after obtaining informed consent. performed for all women. The fasting and postpradial
Gestational diabetes mellitus (GDM) patients consider glucose levels are depicted in the Table 1.
Table 1: Blood glucose (mg/dl) levels of women enrolled in the study
Fasting Postprandial 1hr Postprandial 2hr

GDM group 116.64 ± 0.91 172.09 ± 2.00 148.48 ± 1.56
Healthy group 101.5 ± 0.93 141.09 ± 2.24 112.51 ± 1.22
Area under curve (AUC) for the OGTT: The GDM GDM women showed increased in the fetus weight:
women showed significantly (p≤0.0001) higher area GDM women showed significant (p≤0.0001) increased
under the curve as compared to the healthy women. The in the fetus weight as compared to the healthy women.
AUC of GDM and healthy women were found to be The birth weight of the fetus is shown in the Figure
1094520 ± 8418.0 and 885300 ± 4956.3, respectively. 1. This increase in the fetus birth weight results in
The value reflects the significantly higher insulin the C-section delivery. About 83.34% GDM women
resistance in the GDM women as compared to healthy undergone C-section delivery, while only16.66% normal
women. delivery occurs.
for gestational diabetes diagnosis. But, there are many

women whose glucose values are within therapeutic
range but still deliver macrosomic infants12.
Previous reports have documented that serum glucose

influence amniotic fluid glucose concentration14,15. A
positive correlation exists between maternal serum
glucose and amniotic fluid glucose level14-16. Maternal
hyperglycemia affects amniotic fluid glucose and results
in elevated glucose levels15. Negative correlation is
reported between glycemic control and vitamin D levels
Figure 1: The birth weight of the fetus delivered by in serum of gestational diabetes patients17. It is speculated
GDM and healthy women that high blood glucose level in pregnancy raises the risk
of baby’s congenital heart defect. According to a study
Average weeks of child delivery were found to led by researchers at the Stanford University School of
be about 36.65 and 39.34 weeks in GDM and healthy Medicine it is reported that women with diabetes are
women, respectively. The presence of GDM leads to the likely to give birth to babies having heart problems18.
premature delivery. Significant correlation was also found between glucose
and sonographic parameter which were estimated
The fetus birth weight is positively correlated with during gestation19. In our study, we found the correlation
the presence of GDM i.e. insulin resistance. Serum between the glucose and child birth weight.
high glucose level was positively correlated with the
pregnancy complications such as C-section delivery, In gestational diabetes, blood glucose level becomes
premature birth, increased in fetus weight etc. high and is associated with increased fetal insulin and
fetal size19. It results in adverse obstetric outcome.
In the pregnancy volume of blood volume, plasma is
Discussion increased. During the third trimester the female suffers
Sugar is released into serum quickly and causes the from anemia due to increase in demand of nutrition
blood sugar level to rise. In response to this there is a for the baby. Hemoglobin levels become lower during
rapid release of insulin, which is required to normalize the third trimester as compared to first trimester in
pregnant women20. Also, the hematocrit decreases
blood glucose. But instead of maintaining a steady state
with increase with advancement in gestation. It is well
of energy throughout the day, it results in tiredness. The
reported that serum glucose concentration increases
low level of sugar maintains a constant energy level.
from first trimester to third trimester. In later stages
High glucose level in pregnancy leads to weight gain in
of pregnancy insulin secretion is is increased by 2-3
pregnancy, causes gestational diabetes, pre-eclampsia
folds by the nutrients. This effect is due to binding
and baby being overweight in later life. Serum glucose of receptors to insulin which is altered by hormones
plays a major role in fetal growth. But the normal levels released by placenta mainly, human placental lactogen
of glucose must be clearly defined in pregnancy and its (HPL), estradiol, progesterones, and free cortisol. In
effect on fetal growth must be evaluated12. pregnancy serum glucose is elevated by appears more
prolong in the post prandial state21. Hyperglycemia and
Perinatal morbidity and mortality is often affected by
Adverse Pregnancy Outcomes (HAPO), was important
blood glucose levels during pregnancy13. Serum glucose
study that highlighted the association between maternal
level during pregnancy affects the infant birth weight.
serum glucose level and its prenatal complications. The
Hyperglycemia and Adverse Pregnancy Outcomes
study reported significant and increasing association
(HAPO) study reported that previous diagnostic cut
between fetal macrosomia, need of caesarean section
offs for diabetes in gestation has predictive value for for delivery, neonatal hypoglycemia, etc.22. One more
fetal hyperinsulinemia and LGA. Thus, International study by Riskin-Mashiah et al23 demonstrated the similar
Association of Diabetes in Pregnancy Study Group association of fasting glucose in the first trimester and
and the American Diabetes Association (ADA) revised the occurrence of complications in pregnancy. Our
these cutoffs and later recommended new lower criteria finding are accordance with these reports21-23.
Conclusion 7.
Farrar D. Hyperglycemia in pregnancy:
prevalence, impact, and management challenges.
From the above study, we can conclude that the fetus Int. J. Women’s Health, 2016, 8:519-527.
birth weight is positively correlated with the presence
of GDM i.e. insulin resistance. Serum high glucose 8. Seshiah V, Kalra S, Gupte S, Divakar H,
level was positively correlated with the pregnancy Murugananthan A, Banerjee S, Gupta S, Balaji V,
complications such as C-section delivery, premature Zargar A H, Das A K, Sahay R, Singh J, Sadikot S,
birth, increased in fetus weight etc. The serum glucose Khadgawat R. Classification of hyperglycemia in
should be monitored strictly so that it will leads to the pregnancy. Indian J Endocr Metab 2014;18:445-8
healthy or normal delivery. 9.
Saleh HS, Abdelsalam WA, Mowafy HE,
Abd ElHameid AA. Could metformin manage
Ethical Clearance: The blood was collected from
the Karbala maternity teaching hospital after their gestational diabetes mellitus instead of insulin?
investigation. Oral consent was taken before enrolled the Int. J. Reprod. Med., 2016.
patients in the study. 10.
International Association of Diabetes and
Pregnancy Study Groups Consensus Panel.,
Metzger BE, Gabbe SG, Persson B, Buchanan
Conflict of Interest: Nil TA, Catalano PA, Damm P, Dyer AR, Leiva Ad,
Hod M, Kitzmiler JL, Lowe LP, McIntyre HD,
Oats JJ, Omori Y, Schmidt MI. International
References
association of diabetes and pregnancy study
1. American Diabetes Association. Clinical Practice groups recommendations on the diagnosis and
Recommendations. Diabetes Care. 2011;34 classification of hyperglycemia in pregnancy.
(Suppl 1) Diabetes Care. 2010; 33(3):676-682.
2. Barker DJ, Hales CN, Fall CH, Osmond C, 11.
American Diabetes Association: Gestational
Phipps K, Clark PM. Type 2 (non-insulin diabetes mellitus (Position Statement). Diabetes
dependent) diabetes mellitus, hypertension and Care 1999, 22(Suppl. 1):S74–S76.
hyperlipidaemia (syndrome X): relation to reduced
fetal growth. Diabetologia 1993, 36:62–67. 12. Hernandez TL, Friedman JE, Van Pelt RE,
Barbour LA. Patterns of glycemia in normal
3. Clausen JO, Borch-Johnsen K, Ibsen H, Pedersen pregnancy: Should the current therapeutic targets
O. Relation between birth weight and the insulin be challenged? Diabetes care, 2011, 34(7):1660-
sensitivity index in a population sample of 331 1668.
young healthy Caucasians. Am J Epidemiol 1997,
146:23–31. 13. Negrato CA, Zajdenverg L. Self-monitoring of
blood glucose during pregnancy: indications and
4. Rich-Edwards JW, Colditz GA, Stampfer MJ, limitations. Diabetol Metab Syndr, 2012, 4(1):54.
Willett WC, Gillman MW, Hennekens CH,
Speizer FE, Manson JAE. Birthweight and risk 14. Silverman BL, Rizzo T, Green OC, Cho NH,
for type 2 diabetes mellitus in adult women. Ann Winter RJ, Ogata ES, Richards GE, Metzger BE.
Intern Med 1999, 130:278–284. Long-term prospective evaluation of offspring of
diabetic mothers. Diabetes.1991;40 :121– 125
5. Godfrey KM, Barker DJP. Fetal malnutrition
and adult disease. Am J Clin Nutr 2000, 15. Rinala SG, Dryfhout VL, Lambers DS. Correlation
71:1344S–1352S. of glucose concentrations in maternal serum and
amniotic fluid in high-risk pregnancies. Am J
6. Mandave P, Khadke S, Karandikar M, Pandit V, Obstet Gynecol, 2009, 200(5):e43-e44.
Ranjekar P, Kuvalekar A, Mantri N. Antidiabetic,
Lipid Normalizing, and Nephroprotective Actions 16. Silverman BL, Cho NH, Rizzo TA, Metzger BE.
of the Strawberry: A Potent Supplementary Fruit. Long-term effects of the intrauterine environment.
Int J Mol Sci. 2017;18(1):124. Diabetes Care, 1998, 21:B142– B148.
17. Lithy EA, Abdella RM, El-Faissal YM, Sayed 20. Moghaddam Tabrizi F, Barjasteh S. Maternal
AM, Samie RMA. The relationship between low Hemoglobin Levels during Pregnancy and their
maternal serum vitamin D levels and glycemic Association with Birth Weight of Neonates. Iran
control in gestational diabetes assessed by HbA1c J Ped Hematol Oncol. 2015;5(4):211-217.
levels: an observational cross-sectional study. 21. Sufrin S, Nessa A, Islam MT. Serum glucose level
BMC Pregnancy Childbirth, 2014, 14(1), 362. and hemoglobin concentration in third trimester
18. Helle EIT, Biegley P, Knowles JW, Leader JB, of pregnancy. Journal of Bangladesh Society of
Pendergrass S, Yang W, Reaven GR, Shaw GM, Physiologist, 2015, 10(2), 67-70.
Ritchie M, Priest JR. First trimester plasma 22. Seabra G, Saunders C, de Carvalho Padilha P,
glucose values in women without diabetes are Zajdenverg L, da Silva LBG., de Souza Santos
associated with risk for congenital heart disease MMA. Association between maternal glucose
in offspring. J. Pediatr. 2017; 195, p275–278. levels during pregnancy and gestational diabetes
19. Parretti E, Mecacci F, Papini M, Cioni R, mellitus: an analytical cross-sectional study.
Carignani L, Mignosa M, La Torre P, Mello G. Diabetol Metab Syndr, 2015, 7(1), 17.
Third-trimester maternal glucose levels from 23. Riskin-Mashiah S, Younes G, Damti A, Auslender
diurnal profiles in nondiabetic pregnancies: R. First-trimester fasting hyperglycemia and
correlation with sonographic parameters of fetal adverse pregnancy outcomes. Diabetes Care.
growth. Diabetes Care. 2001;24(8):1319-23. 2009; 32(9):1639-43.
Building and Applying the Personal Values Measure for the

Administrators of Sports Clubs and Clubs for People with
Disabilities from the Point of View of the Players of Some Games
Amal Adulameer Tuama1, Methaaq ghazi1

1
Faculty of Physical Education and Sports Sciences, University of Thi-Qar, Iraq
Abstract
The research community was identified with disabled players of some games in the provinces of southern
and Middle Euphrates Iraq. There were 228 disabled players who constituted 97.36 % of the research
community.
The researcher built and applied a measure of personal values to (110) players and the scale was applied
to (100) players. The sample was divided into six levels. The highest proportion focused on the levels;
excellent and good and good
The scale entertained some validity, construct and reliability coefficients (0.89). The researcher concluded:
1. The scale designed by the researcher is able to reveal the level of personal values for administrators of
sports committees and clubs for people with disabilities.
2. The creation of standard scores and levels of the personal value scale as the objective evidence for the
administrators of sports committees and clubs in assessing the level of the player for the group to which
he/she belongs.
Keywords: personal values, administrators, disabilities and players.
Introduction required to go through the value system through which

the theory of value-based system will be developed,
Values are considered an important axis for and the nature of values diagnosed in the way that it
personality and a criterion for judging the normality and can effect on personnel, and determine to how far these
abnormality of behavior for values determine the scope values can improve administrative work in general.1
of success obtained by individual and organizations
in the achievement of objectives. Many organizations Among the important areas of the sports institution
underwent a lot of problems that needed new working is the sport of those who need special care for they
techniques to overcome such problems. It is to be make the pillars of society building and an active part
noted that organizations and governments can coexist in the process of its development. The building of
with renewing and increasing financial, economic and such community requires concerted efforts, including
political crises, that is why management has to look for individuals who suffer from physical disabilities. The
new and modern techniques to address such problems for states of the world have recently given serious interest to
it is impossible to deal future difficulties with outdated the disables’ sports as considered a vital part of society
methods for applying old pattern of management would which needs to be provided with an opportunity to play
lead to the extinction and disappearance of organizations an active role in various walks of life, including the sports
due to their inability to adaption. Studies and researches field represented by the investment and development of
introduced a new management pattern, which in turn their remaining abilities and talents. The selection has
limits the problems of the management. The value-based to be performed according to special disciplines taking
system was introduced as a contemporary introduction into account the voluntary aspect that stems from the
of management. Therefore, authors and researchers were faith in certain values that take
care of the society and
its interaction with the individual subjective values and

collection of accurate information on the personal values
this is not enough if the privacy of the administrative of the administrators of disables› sports committees and
work and method of modern scientific management are clubs from the point of view of players of some games.3
considered. There should be personal and administrative
values to constitute a successful basis for the work, Methodology of the Research
similarly as other organizations do in the society.2
The researchers adopted the descriptive
Personal values express the individual›s self-beliefs, methodology, which is an accurate description of the
as seen from his point of view considered as a fundamental mutual relations between society, trends, desires and
element of the culture of the organizations constituting development in a way that the research reflects the
individual personality and contributing to the defining living reality and devises parameters, and builds future
of his goals within a proper normative framework. The expectations.
personal values provide individuals with diverse options
that determine their behavior and modify it and help The community and sample of the research: The
in the prediction of the individual›s behavior. Personal research community was determined by the disabled
values greatly affect the individuals› private and practical sports players in some gaming teams in the southern
lives as considered one of the basic components of the and middle provinces of Iraq; they are 228 in number at
personality. The impact covers individuals› behaviors, 97.36% of the research community. The sample included
trends, attitudes and relationships, and thus provide 110 disabled players for the building sample and 100
an important framework to direct individual›s and disabled players for the sample of application. Six of the
groups› behavior and organize it within and without the total number of the players were excluded for the forms
organizations. The importance of the research lies in the were not filled and Table (1).
Table 1: States the Distribution of the Research Sample
Exploration
Application
Sports Gaming
Building
sample
sample
sample
No. Governorate
Volley Basket Goal
Excluded Excluded Football
ball ball ball
1. Nasiriyah 12 - 9 - - -
2. Thi-qar club 10 - - - - -
3. Misan 6 - 7 - 16 -
4. Kut 10 2 - - - -
5. Basra club - - - - - 6
Paralympics Iraqi
6. - - - - - - 110 100 12
committee
7. Hilla 10 1 10 2 16 6
8. Najaf 10 - 10 1 16 6
9. Diywaniah - - - - 16 6
10. Simawah 8 - - - 16 -
Total 66 - 36 - 96 30
Means, tools & appliances used in the Research: zz International electronic information.
Means of collating data: Tools and Appliances:

zz Arabic & foreign sources. zz Hp computer (2).
zz Personal interviews. zz Manual electronic calculator (Casio) stationary and
zz Questionnaires. office tools.
Field procedures of the Research: For the purpose 3. The researcher conducted a series of personal
of conducting of the research, the researcher had to interviews with some of specialists in general, and
build a scale for measuring the personal values of the sports psychologies, in international economics,
administrative staff of the sports committees and clubs management and organization, business
of the disabled athletes from the viewpoint of the players management and administrative systems so as to
of certain games in the southern and middle provinces of obtain larger amount of information which helps
Iraq as per the following steps: the process of determination of the measurement
values and its norms.
Measures of building of the measure scale of the
The primary scale of measurement consists of 35
personal value:4
formulated paragraphs. There were also a set of methods
Drafting of the primary formula of the measure: pursued by the researcher to form the paragraphs of the
measure in a way that each paragraph shall have one
1. Reviewing the literatures related to the personal idea and its language shall be simple and direct with
values and identifying articles and schemas of the avoidance of using negation which may embarrass the
measurement values. respondent. The researcher used every day language in
the paragraph formulation.5
2. The researcher worked out a questionnaire and
distributed it to the experts and specialists in the The final analysis about the validity of the domains
field of general psychology, cognitive psychology, (values) of measuring personal values resulted in the
sport psychology, administration, organization, acceptance of 5 domains out of 6 domains with the
tests and valuation. exclusion of religious values as shown in Table (2).
Table 2: Shows the percentages and values of (Chi square) of the experts’ views about the validity of the
domain (personal values)
No. Domains valid Chi Square Percentage Not Valid Chi Square percentage
1. Intellectual values 21 21 100% zero - ----
2. Aesthetic values 20 17.18 95.23% 1 17.18 4.76%
3. Economic values 21 21 100% zero - --
4. Political values 18 10.7 85.71 3 - --
5. Sociological value 21 21 100% zero - ----
6. Religious values 6 3.86 28.57 15 3.86 71.428
Application of the scale to the building and standardization sample: The scale was applied to the building sample
from 19/7/2018 to 10/8/2018. The sample of the building included (110) players representing (22) teams from (8)
provinces of Iraq situated in the south and the Middle Euphrates. After answering was completed, the forms were
checked to ensure that all paragraphs were answered.
Correction of paragraphs of the measuring scale: The scale of measuring personal values of the administrative personnel
from the disabled players’ viewpoint consisted of (29) paragraphs distributed into 5 domains as shown in table (3).
Table 3: Shows domains and paragraphs of the personal values scale
No. Domains Paragraphs Number

1. Intellectual values 6
2. Aesthetic values 5
3. Economical values 6
4. Political values 6
5. Sociological values 6
Total 29
The paragraphs were corrected after the player’s total score was known, the mark is calculated according to the
grades the player collected by ticking the paragraphs on the stepladder and assigning it the appropriate weight as
shown in table (4).
Table 4: It shows the weight values of the paragraphs
Significance Entirely do not agree Do not agree Not sure Agree Totally agree
Weight value of positive 1 2 3 4 6
Negative values 5 4 3 2 1
The researcher adopted the pentatonic stepladder after being observed by the experts.
Internal consistency coefficient for scale paragraphs: The internal consistency value of this index was extracted
by using the simple correlation coefficient (Pearson) between the score of each paragraph and the total score of the
scale, which resulted in the acceptance of all the paragraphs.
Table 5: Shows the values of correlation coefficient of the internal consistency of the paragraphs of the
personal value scale
No. R calculated value No. R calculated value No. R calculated Valued

1. **0.469 11 **0.363 21
2. **0.342 12 **0.439 22 **0.382
3. **0.392 13 **0.407 23 **0.463
4. **0.312 14 **0.412 24 **0.453
5. **0.409 15 **0.276 25 **0.281
6. **0.452 16 **0.347 26 **0.434
7. **0.423 17 **0.454 27 **0.292
8. 18 **0.321 28 **0.462
9. **0.388 19
29 **0,311
10. **0.379 20
*The asterisk refers to meaningful correlation at significance level (0.05).
** The double asterisks refer to meaningful correlation at significance level (0.01).
Results and Discussions
Presentation and discussion of the standard levels and their proportions on the normal distribution curve, the raw
grades, the standard grades, the number of players and the percentages of each level of the personal values scale:
Table 6: Shows the standard levels and their ratios on the normal distribution curve, the raw grades, the
standard grades, and the number of players and the percentages of each level of the personal value scale
Levels and their ratios on the Standard Number of

Raw grades Percentages
normal distribution curve grades players
Excellent 3.14 109.34 on 81-100 27 27%
Very good 13.59 109.33-92.67 61-80 58 58%
Good 34.13 92.66-76 60-41 11 11%
average34.13 75-58.34 40-31 4 4%
Fair 13.59 58.33-41,67 30-21 zero zero
Poor 3.14 41.66 down 20-1 zero zero
Table (6) shows that the excellent level was Conclusions

represented by the raw grades (109.34 and on), which
Based on the presentation, analysis and discussion
corresponds to the standard grades (81-100) and 27
of the results, the researcher reached the following
players with percentage of (27%). The level very good
was represented by the raw grades (67, 109.33-92) 1.
The scale designed by the researcher was
corresponding to the standard grades (61-80) with 58 able to reveal the level of personal values for

players and having the percentage 58%, which corresponds administrators of sports committees and clubs for
to 13.59%, which is higher than the normal value. While disabled people.
the level good was represented by the raw grades (76- 2. The founding of standards and levels of the
92.66), which corresponds to the standard scores (41-60), standard measure of personal values that serve as
where the number of players was (11) player obtaining objective evidence for the administrators of sports
the percentage of (11%), which corresponds to (34.13%) committees and clubs in assessing the level of the
which is less than the normal value. The level average player for the group to which he belonged.
was determined by the raw grades (58.34-75), which
3. The sample was distributed naturally in the level
corresponds to the standard grades (31-40) where the of personal values for administrators of sports
number of players was (4) with percentage of (4%), which committees and clubs for disabled people, and the
was less than the normal value (34.13%), whereas the fair personal values scale was divided into six levels
level was represented by the raw grades (41.67-58.33), ranging from poor to excellent.
which corresponds to the standard scores (21-30), where
4. The variation of the sample members in their
the number of players and the percentage were zero, and
obtaining different grades, levels and percentages
the poor level was determined by the raw grades (41.66
through the application of the measure of personal
and down), which corresponds to the standard grades (1 -
values, the highest level of proportion was at the
20) where the number of players and the percentage were
level excellent followed by the very good and
zero. Based on table (6) it was observed that the highest
good levels.
percentage of the research sample was concentrated on
the level (excellent), followed by (very good), (good), and Ethical Clearance: Taken from University of Thi-Qar
(average).6 committee
The researchers attributed that to the administrators Source of Funding: Self

of sports committees and clubs due to importance of
Conflict of Interest: None
personal values and beliefs adopted by the manager
or administrator in the organization and its role in
activating the administrative process,7 and found that References
the more positive values of the administrative leaders 1. Bahia S. A.: Behavioral Sciences in Administrative
increase, the more they impact on the efficiency of
8
Applications, Zahran for Publishing, Jordan,
administrative procedures, through the understanding by 2003.
the leaders of their subordinates values and thus taking
2. Saleh T.: The reality of organizational values
care of their feelings and concerns in a way that reflect
in the hospitals of public and private sectors,
the best impact on their psyche and vice versa as well
unpublished master thesis, King Saud University,
as the employee who contrasts with his group values or
Riyadh, Saudi Arabia, 2001.
with his superiors’ or with the values of the organization
in which he works, he would act differently,9 creating a 3. Tahtawi: Educational Values in Quranic Stories,
conflict that generates divisions and separation among Dar Al-Fikr Al-Arabi, Cairo, 1996
the working individuals of the institution.10 The levels
4. Abdul H. M.: Advisor in Social Psychology,
(fair) and (poor) did not score any proportion on the
Jeddah, Dar Al-Sharq for Publishing, 1984.
scale of personal values and
the researcher believed that
this was attributable to the degree of awareness of the 5. Ali S. J. and Mazin H.: scientific research, the
sample which placed them at the fair and poor levels, basics and methods of tests of hypotheses, design
mainly they did not score any proportion in the levels. 11 experiments
6. Qais N. and Bastoise A.: Tests and Principles of Hassanein, Arab Organization for Administrative
Statistics in the Field of Sports, Baghdad, Press of Sciences, Amman, 1981.
Higher Education, 1987
10. Nizar A., Mahmoud A.: Principles of Statistics
7. Marwan A. I.: Tests, Measurement and Evaluation and Physical and Mathematical Tests, Mosul, Dar
in Physical Education, Amman, Dar Al-Fikr Al- al-Kitab for Printing and Publishing, 1981.
Arabi for Printing and Publishing, 1999.
11. Wadih Y. A. and Hassan A.: Statistical Applications
8. Marwan A. M. I.; The Sports Encyclopedia of the in Physical Education Research, Ministry of
Challenger of Disability, Amman: Dar Al-Salya Higher Education and Scientific Research, Mosul
for Publishing and Distribution, 2002. University, 1996.
9. Mendel M. and Jordan W., Values of Employees
in a Changing Society, translated by Mohamed
Qualitative Study of Family Planning (KB) Village Program’s

Implementation in East Java Province-Indonesia
Annisa Ullya Rasyida1, Iswari Hariastuti2, Mardiyono2, Iffah Udiana2, Kuntoro3, Haryono Suyono4, Sri Widati5
1
Department of Public Health, Hang Tuah University, Surabaya, East Java and Doctoral Student of Public
Health Faculty, Airlangga University, Surabaya, East Java, Indonesia; 2Department of Research and
Development, Representative of National Population and Family Planning Board, East Java, Indonesia;
3
Professor of Department of Population and Biostatistic, Public Health Faculty, 4Professor of Medical
Faculty, 5Department of Health Promotion, Public Health Faculty, Airlangga University, Surabaya, East
Java, Indonesia
ABSTRACT
In order to control population growth, Indonesian National Family Planning develop Family Planning
(KB) Village Program. The implementation has found some obstacles, in terms of cross-sector/partnership
integration reached around 25%. Especially in formal legal aspects and funding which are suboptimal. It
is qualitative research with explorative studies. Data collected from in-depth interviews, field observations
and analysis. It was conducted in October - November 2017 in KB Village of Bulu Meduro Village, Banjar
District, Tuban Region and KB Village of Kota Lama Sub-District, Kedung Kandang District, Malang City.
There were 55 participants recruited. The results showed that the implementation of the KB Village Program
in Tuban Region had formal legal aspects from the Regional, District and Village Governments, cross-
sector partnership had been going well, the Regional Government to the Village Government have allocated
budget to support it although limited. Whereas the Implementation of the KB Village Program in Malang
City has not received the support of a comprehensive formal legal aspect yet from the level of the City,
District and Subdistrict Governments, so that cross-sector integration and financial support still encounter
many obstacles. The conclusion is the implementation of the KB Village program needs improvement with
the stronger commitment or political will of policy makers at various levels ranging from the Regional
Government to the Village Government to provide total support for each planned program.
Keywords: family planning village, cross-sector partnership, local government, formal legal aspects
Introduction
Increased population is a prominent problem
experienced by many developing countries, including
Indonesia. The total amount and rate of population
growth that is not matched by good welfare conditions
are still the main problems in Indonesia.1 The current
Corresponding Author: population of Indonesia is rapidly growing and causing
Annisa Ullya Rasyida high unemployment and poverty. Based on that situation,
Department of Public Health, family planning programs were created to develop the
Hang Tuah University, Surabaya, community. Maximizing the implementation of family
East Java and Doctoral Student of Public Health Faculty, planning programs are certainly an absolute choice for
Airlangga University, Surabaya, East Java, Indonesia the current government. According to the regulation
Phone: +62 81235000670 number 52, year 2009 about population growth and
Email: annisa.ullya@hangtuah.ac.id family development as the basis for implementing
annisa.ullya.rasyida-2015@fkm.unair.ac.id Family Planning Population and Family Development
annisa.annisa76@gmail.com Program.2
One of the mandates of the law, specifically in Method

family development is to establish Family Planning
This study uses a qualitative approach with
(KB) Village which strengthen The Family Planning
exploratory research methods. Researchers use the
Population and Family Development Program (KKBPK)
in-depth interview method and field observation to
that carried out by compiling activities that directly effect
obtain information. The research was conducted in
the community by providing beneficial activities for the
Oktober-November 2017 in KB Village Bulu Meduro
community and also achieving the targeted objectives.
Village, Banjar District, Tuban Region and KB Village
KB Village requires the support from government and
of Kota Lama Sub-District, Kedung Kandang District,
private group to work in accordance with the needs and
Malang City. 55 participants including midwife from
conditions of the local, and also implemented at the
puskesmas, head of the sub-district, head of district,
lowest level which is neighborhood.2 head of the Prevention of Narcotics Abuse in National
KB villages are expected to be one of the Narcotics Agency (BNN), head of Sub-National Level
strategic innovations to be able to implement the Development Planning Agency (Bappeda), Head of
Health office, Head of Education office, Leader of the
KKBPK program’s priority activities in full in the
village, head of the KB Village program, and Head
field in realizing the Priority Agenda 5 (five) of the 9
of Population and Family Planning Control were
government priority agendas for 2015 - 2019 namely
interviewed.
“Improving the Quality of Indonesian Human Life”
through Family Planning Population and Family Data collection techniques that is used are primary
Development Program. Moreover, BKKBN itself has data collecting with questionnaires, in-depth interviews,
compiled the 2015-2019 Strategic Plan with 6 (six) and direct observation. The validity of the data in this
predetermined strategic targets, namely: (1) reducing the study uses source triangulation. Analysis of the data
average Population Growth Rate (LPP) from 1.38% per used in this study are data collection, data reduction,
year in 2015 to 1.21% per year in 2019, (2) the decrease data presentation, data analysis and conclusion drawing.
in the Total Fertility Rate (TFR) from 2.37 per woman
of childbearing age (WUS) in 2015 to 2.28 in 2019, (3) Result
the increase of Contraceptiive Prevalence Rate (CPR) Results of interviews with Sub-District Head,
of all methods from 65.2% of total fertile age couples Village Head, Village Midwife, Head of the Prevention
(PUS) in 2015 became 66% in 2019, (4) the decline in of Narcotics Abuse in BNN, Education Agency and
family planning needs was not served by unmet need National Population and Family Planning Board
from 10.6% in 2015 to 9.91% in 2019, (5) the decrease (BKKBN) related to KB village program implementation
in the Age Specific Fertility Rate (ASFR) of 46 per in Malang City and Tuban Region are as follows:
1000 women in the age group 15-19 years in 2015 to
28 per 100 women in the same age group in 2019, (6) There is no Camat Decree for KB Village.
the decrease in the percentage of unwanted pregnancies Partnerships that have been cooperated through Branch
from WUS from 7.1% in 2015 to 6.6% in 2019.2 Leadership Deliberation (muspimcab): Military District
Command (Danramil), sectoral police (Kapolsek),
The indicator of the success of the KB Village Islamic teachings and pre-marital directives (KUA),
towards the KKBPK program is the increasing acceptor Family Welfare Development (PKK), Cadres, Health
of family planning program, the health of pregnant and Office (for Health), Department of Population and Civil
lactating mothers, active adolescents in Build of Teen Registration (Dispendukcapil) that giving services in
Family (BKR) and Youth Counseling Information sub-districts. KB Village funds is taken from the District
Center (PIK-R) activities, a reduction in illiteracy rates, PKK. Data collection in sub-districts is not available,
increased participation of Pre-Prosperous Families and but available in each village. The KB Village specific
Prosperous Families (KS)-1 in the Business Program meeting did not yet exist at the sub-district level.
for Increasing Prosperous Family Income (UPPKS) However, there are cross-sectoral meetings every 3
program. The purpose of the study was to evaluate the months attended by the head of sub-district, police chief,
implementation of the KB village program in East Java. military command, all the village heads, PKK, and BNN
Activities such as the Elderly Posyandu, twice a After there KB village is established, the residents
month in coordination with the Social Service, and slowly leaving their habits to defecate in the sea, then
Health Office. Youth activities are actively carried out. build and use their own latrines. KB Village meetings
Then there is the marriage dispensation (related to the often use a newly constructed building. The Village KB
time-consuming marriage management), especially the Team Decree was signed by the Head of the Village,
Madurese. but for the KB Village Team decree it still involved its
Regent District Head.
Whereas in Tuban City the implementation of the
KB village is as follows: Differences before and after the KB village is that
after a family planning village has a family planning
The establishment of the KB Village is legal
participation increased, activities about family planning
formal, an Instruction letter from the Head of the
and health care have increased, community awareness
village, followed by instructions to the village. So the
about family planning has increased. Physically a
eagerness to enter its budget through the village income
special room has been built for KB Field Officer (PLKB)
and expenditure budget plan (APBDes) could arise.
activities, Posyandu rooms, meeting/extension rooms,
Not merely support through the budget. However, the
construction of the gate at the time of launching. There
situation and conditions in the institution often change,
is also a building, accompanied by BKKBN activities.
for example the Family Planning Field Officer (PLKB)
staff from the BKKBN joins the Health Office and then How is the Budgeting for the KB Village Program
joins Bapemeas, then joins the Center, the numbers Implementation:
are less so weakening. But what strengthens is that the
support of the regional head is very strong. Coordination There is no special budget for the implementation
and advocacy from the district level to the lower level of KB village programs in each village. However, the
must be strengthened. budget that has been used so far is Village Budget.
During this time the main obstacle in implementing KB
In Malang City: Frequent activities with KB villages, villages in each village was the lack of a budget. This is
namely being invited to community groups is the next because not all villages have made KB villages a priority
plan. If there is a meeting, in the sub-district by inviting for the program.
youth, cadres, KB Field Officer (PLKB), Bhayangkara
Fostering Community Security and Order. The status The obstacles of the implementation of the KB
of the working group in Malang City is still needs to village program:
be known and should inviting the head of the Technical
The obstacle in the implementation of KB Village
Implementation Unit (UPT)s to jointly carry out the
activities is funding or the budget for KB. The biggest
activities. Especially through Planned Generation
challenge is the community. Do they realize that these
(GenRe) activities. The budget provided for activities is
drugs damage intelligence. there is no crossing between
usually described in the work plan.
sector and everything depends on the leader. The
The benefits of the KB Village Program challenge is the unique community, because the majority
implementation: of people are Madurese and difficult to regulate. The
According to Puskesmas Midwives in Malang City and strategy that needs to be done is to continue to intensify
Tuban; the KB Village program with other sectors.
After the KB village program is implemented, there Suggestions for implementing the KB village for the
are two KB safari services. For acceptors with low future:
income may be served more through KB cadres. The
form of family planning (KB) Safari that conducted in Shared commitment that village KB activities must
Community Health Centre (Puskesmas) is collaboration be frequent (because frequency become obstacles) and
with PLKB, especially for Intra Uterine Device (IUD)s need mutual care from all parties, especially funding
and Implants. for frequent activities. It is hoped that the Regional
Device Organization (OPD)s can open themselves to
In Tuban Regency, about the benefits of the KB KB villages. For the majority, KB activities should be
Village : promote even more.
The expected results from this study are the increasing prosperous small family by implementing eight
use of MKJP, the majority of the community already has family functions. Cross-sector development and
latrines, the creativity of adolescents increases, there partnerships involve the role of various parties
is no early marriage, and toddlers and the elderly are such as the private sector, providers, and other
getting healthier. The challenge of implementing the KB stakeholders.6 Cross-sector integration is in the
village is the funds that goes for KB village activities form of integrated services between sectors that are
that have not been given perfectly. community needs, such as family planning services,
deed-making services, road and bridge construction,
ID card making, reading books, posyandu, Early
Discussion
Childhood Education Programs (PAUD), Program
To achieve the success of KB village program, there for Increasing the Role of Women Towards Healthy
are at least 6 main factors that need to be improved, Families (P2WKSS) and others.
those main factors as follows: 5. Enthusiasm and dedication of the KKBPK
1. Strong commitment from stakeholders at all program managers in field: Family planning is
levels (City, Sub-District, village): Support a program that has the most simple yet practical
from partners at the provincial level with strong meaningful quantity in improving the family’s
advocacy. One of the most basic things from social and economic welfare.7 The success of the
the success of the KB village is political will important KB Village Program is supported by an
or commitment from the head of the region or increase in public awareness and participation in
stakeholders at all levels. This commitment must managing family planning programs carried out
be clear so that each program in KB Village can by Rural Community Instituations, NGOs, private
run well with budget support.3 In addition, this sector, community leaders and other relevant
commitment is needed to bridge various sectors government institutions.
that must take part in implementing the KB Village
6.
Active Community Participation: Active
program. The reason is that the implementation of
the KB Village program was not carried out by participation from community leaders, religious
the OPD related to family planning but instead leaders and traditional and community leaders
required synergy from various existing OPDs. in the management and implementation of all
activities that will be carried out in KB villages
2. Gather partners donors to help those who have is a basis prerequisite for the establishment of
not been able to immediately make latrines: KB villages to improve the standard of living of
The factors that influence empowerment in human all communities in the region.6 In addition, the
resource development among them are the existence
involvement of the private sector in developing
of self-resources and self-abilities in the form of
the Development Program in KB Village was very
modeling, motivation, and support.4 There needs to
important as a form of mutual cooperation from
be support and model for village level community
all parties.
members in the provision of healthy latrines.
3. Establish standard procedures at the district Conclusion
level for a grace period for disbursing funds
and donors: The family planning program has KB village is a strategic innovative program
been recognized as the most effective factor in in supporting The Family Planning Population and
intervening health problems globally.5 The need Family Development Program (KKBPK). Because
for clear collaboration between the Government KB Village is a model or miniature development that
and the relevant BKKBN establishes standard involves all sectors in the community. Based on results
procedures at the district level for a grace period of the study conducted in 2 locations of KB villages
for disbursing funds and donors. it can be concluded that the existence of KB villages
4.
Integration of the KKBPK program and since its inception in 2016 contributed to a number of
cross-sector integration: Principle of the indicators. The weakness of implementation of the KB
KKBPK Program is to embodies a happy and Village program needs improvement with commitment
or political will of policy makers at various levels 2. National Population and Family Planning Agency.
ranging from the Regional Government to the Village Technical Guidelines for Family Planning
Government to provide total support for each planned Villages. BKKBN; 2017.
program. In addition, eliminating sector ego is an
3. Raikhani, A. Analysis Of Contribution Of KB
important key to the success of the KB Village program.
Village Program In Efforts To Improve The Family
Conflict of Interest: Authors declare that the information Planning Population and Family Development
above is correct and the manuscript submitted by us is Program (KKBPK) In Jombang, East Java
original. We have no conflict of interest to declare and Province. Scientific Journal of Midwifery. 2018;
certify that no funding has been received for the conduct 4(2):101-113.
of this study and preparation of this manuscript. 4. Lahijani, P. Human Resoures Empowerment
Strategies in Development Projects. International
Source of Funding: This research is self-supporting and
Journal of Engineering Research and Apliations
BKKBN founding
(IJERA). 2012; 2(3): 2760-2761
Ethical Clearance: We would like to thank the Ethics 5. Agarwal. Family Planning Why the United
Committee for basic science research/clinics at Faculty States Should Care. International Journal of
of Public Health Airlangga University the ethical Environmental Research and Public Health. 2011;
approval granted for this study. Our gratitude also goes 2(8): 788-795
to all the participants involved in this study for their
commitment. 6. Mardiyono. KB Village as an Family Community
Empowerment Effort in East Java. Journal Cakrawala.
2017; Vol. 11 No. December 2: p 129-136
REFERENCE
7. Miller, G., Babiar, S.K. Family Planning and
1. Zultha, Nurhafifah. Implementation of KB Village
Program Effectss. Journal of United States of
Program in Poverty Reduction Efforts. Thesis.
America. 2014; 4(3): 314-323
University of Lampung; 2017.
Model of Peer Intervention Assessment of Nutritional

Educator in the Efforts to Change Behaviour in Decreasing
Overweight in Integrated Islamic Elementary Schools at
Makassar
Anto J. Hadi1, Veni Hadju2, Suriah3, Rahayu Indriasari2, Toto Sudargo4, Mappeaty Nyorong5, Masni6
Public Health Department, Faculty of Public Health, Institut Kesehatan Helvetia, Medan, Indonesia;
1
Nutrition Department, 3Health Promotion Department, Faculty of Public Health, Universitas Hasanuddin,
2
Makassar, Indonesia; 4Health Nutrition Department, Universitas Gadjah Mada, Yogyakarta, Indonesia;
5
Doctoral Student Program, Faculty of Public Health, Universitas Hasanuddin, Makassar, Indonesia;
6
Health Biostatistic Department, Faculty of Public Health, Universitas Hasanuddin, Makassar, Indonesia
ABSTRACT
This study aimed to assess the effect of peer intervention models on nutrition educator intervention in an
effort to change behavior in decreasing of overweight at Islamic Elementary School of Makassar. The design
of this study was quasi-experimental with non-equivalent control group design. The subjects were selected
by proportional random sampling. The intervention did for six months with mentoring of peer nutrition
educators and module administration, obesity prevention management leaflets, peer education for 25 minutes
each week and evaluating using questionnaires and measuring body mass index of children using WHO’s
Antrho Plus. Data processing was analyzed by univariate and bivariate analysis with Independent t-test,
Mann-Whitney test and Paired t-test and multivariate with Hotelling test. The results show that there were
differences in nutritional knowledge, attitudes toward nutrition, physical activity and significant snacking
habits for overweight children before and after peer education by peer nutrition educators (p = 0,000 <0,05).
This proves that there is an influence on the peer assistance model of nutrition educators on change in
nutritional behavior in an effort to control the lifestyle of overweight children after they are given peer
nutrition education. This study expected to implement an integrated peer nutrition education in physical
education learning in schools for obesity prevention.
Keywords: Overweight, Obesity, Nutrition Educator Peer, Nutritional Behavior, Physical Activity
Introduction stated that obesity is one of developing determinant factor

for diabetes mellitus, hypertension, and heart disease(1).
The prevalence of overweight and obesity are one Globally, other research conducted in Singapore shows
of the public health problems that occur in school-age that the prevalence of obesity increased from 9% to 19%.
in various countries. The world health department has This perspective would continue increasing to reach a
prevalence estimate of 9.1% by 2020(2). Obesity is the
cause of various risk factors for disease and death(3).
Corresponding Author: Based on the Republic of Indonesia’s basic health
Anto J. Hadi research (2018), the prevalence of overweight children
Public Health Department, Faculty of Public Health, aged 5-12 years 11.8% overweight and 9% obese,
Institut Kesehatan Helvetia, Medan, Indonesia and the prevalence of overweight in South Sulawesi
Kapten Muslim Street Number 107 province according to body mass index per age of 13-
Medan Helvetia Distric, Medan City, 15 years as many as 13.6% obese and 21.8% obesity(4).
North Sumatera Province, Indonesia The prevalence of overweight and obesity in Indonesia
Phone: 085242877376 occur mostly in school-age children and is a threat to
Email: antoarunraja@gmail.com Indonesian children(5).
A preliminary study conducted by the researchers in Material and Method

16 Integrated Islamic Elementary Schools in Makassar
by anthropocentric measurements and calculating body The study uses a quasi-experimental approach
mass index per age of children and then entering into with non-equivalent control group design with the
the standard deviation values based on sex and age of aim of proving the influence of peer nutrition educator
children, of the total children 2,177 children, who has intervention models on behavior change prevention of
nutritional status consisting of very thin 2.53%, thin obesity in the Integrated Islamic Elementary School
4.92%, normal 62.15%, overweight 13.92%, obesity of Makassar conducted for 6 months. A sample of 80
16.49%. The results of this survey show that school- children consisting of 40 children received intervention
age children prefer to buy food and eat snacks that are in the form of assistance, modules + leaflets and
always over-served triggered by urban lifestyles. This discussions through peer group sharing and 40 children
is a fact of the high trigger of overweight and obese only received modules and leaflets. The research subjects
children. Overweight and obesity are part of the result
were divided into two namely the treatment group and
of an unhealthy diet. The epidemic of overweight and
the control group. Then measurements were taken before
obesity in children caused by bad diet including fewer
and after the intervention (pre-post test) in both groups.
consumption fruits and vegetables and consuming more
The Research had taken two times for measurement of
high-fat foods but less physical activity(6,7).
weight and height of school-age children, one time before
The finding on overweight and obesity are due to and after the intervention. Because each school has a
unhealthy diet behavior and lack of physical activity, thus different number of overweight children, the proportional
an intervention strategy that is used in the prevention of random sampling of each child in the selected school is
obesity that is to assist peer nutrition educators. Nutrition conducted. Data collected were nutritional behavior and
educator peers are reinforcing factors that can influence physical activity carried out through direct interviews
the behavior of school-age children including eating using questionnaires, anthropocentric data including
behavior. Peer groups can have a negative or positive
body weight and height, nutritional status assessment
influence on school-age children. Friends of the same age
determined by WHO’s Anthro Plus 2007 software for
can become peer nutrition educators, as one of the health
school-age children 5-18 years. Before and after the
education strategies(8). Efforts to prevent overweight and
obesity in school-aged children are focused on efforts intervention, the child’s eating pattern as measured by
to improve healthy eating patterns and reduce relaxed the Food Recall form is 24 hours. Analysis of differences
activities through peer nutrition educator approach in in nutritional behavior, diet, physical activity between
schools. Overweight and obesity is a nutritional problem the treatment and control groups after the intervention
when adults can be repaired and prevented when children were used chi-square test, independent t, t paired,
so prevention of obesity in school-age groups can be Wilcoxon, Mann Whitney, T² Ho telling.
effective. The peer intervention model of nutrition
educator is applied to change nutrition behavior, increase Results
physical activity so that it can prevent overweight and
reduce the prevalence of obesity. This study aims to prove This research was conducted in the Integrated
the influence of peer intervention models for nutrition Islamic Elementary School of Makassar from September
educator intervention in an effort to change behavior in 7, 2018, to February 27, 2019. Distribution of children’s
decreasing the incidence of overweight. characteristics can be seen in table 1 as follows:
Tabel 1: Characteristic of Participant
Group
Children’s Characteristics Intervention Control p
n (40) % n (40) %
Sex
Boys 19 47,5 24 60,0
0,262
Girls 21 52,5 16 40,0
Conted…
Grade
IV 28 70,0 20 50,0
0,068
V 12 30,0 20 50,0
Weight (kg) 39,28 ± 5,92 35,99 ± 9,39 0,065
Height (cm) 137,784 ± 5,62 136,73 ± 8,12 0,504
chi-square Test,t independent test
Table 1 shows that children in the intervention group had more female sex (52.5%), class IV (70.0%), average
body weight 39.3 kg with height 137.8 cm. Children in the control group had more female sex (60.0%), average body
weight was 35.9 kg with a height of 152.0 cm. The results of the chi-square test and the independent t-test obtained
p> 0.05, which means the condition of sex, class, weight, and height of the intervention group children with the same
control (homogeneous). Changes in obesity prevention behavior before and after intervention can be seen in the
following table:
Table 2: Effect of Peer Educator Nutrition Assistance on Children Obesity Prevention Behavior
Nutrition Knowledge Pre Post 1(p*) Beda Post 2(p**) Beda

Intervention 14,13 17,55(0,000) 3,43 19,40(0,000) 5,28
Control 9,15 10,73(0,000) 1,58 12,18(0,000) 3,03
p** 0,000 0,000
Nutrition Behavior Pre Post 1(p*) Beda Post 2(p**) Beda
Intervention 41,40 62,43(0,000) 21,03 83,43(0,000) 42,03
Control 33,10 39,28(0,000) 6,17 51,53(0,000) 18,25
p** 0,000 0,000
Physical Activity Pre Post 1(p*) Beda Post 2(p**) Beda
Intervention 23,93 34,05(0,000) 10,13 47,78(0,000) 19,85
Control 13,35 19,33(0,000) 5,98 24,40(0,000) 11,05
p** 0,000 0,000
Snacking Behavior Pre Post 1(p*) Beda Post 2(p**) Beda
Intervention 15,53 12,10(0,000) 3,43 8,95(0,000) 6,58
Control 15,93 14,83(0,000) 1,10 12,80(0,000) 3,13
p** 0,000 0,000
IMT Pre Post 1(p*) Beda
Intervention 20,61 19,92(0,000) 0,69
Control 19,1 18,39(0,000) 0,75
p** 0,564
p*:Wilcoxon test p**:Mann Whitney test
Table 2 based on the Wilcoxon test results showed that all children had knowledge about nutrition, nutritional
attitudes, physical activity and eating habits that increased when post 1 and post-test 2 were compared at pre-test
(p = 0,000 <0,05). This shows that there is an influence of the provision of modules and mentoring peer nutrition
educators on increasing children’s knowledge, nutritional attitudes, physical activity, and snacking habits. Increased
knowledge of nutrition, nutritional attitudes, physical activity, and snack eating habits were higher in the intervention
group compared to controls and decreased nutritional status (p = 0,000 <0,05). The difference in the influence of
peer nutrition educators on changes in nutritional behavior and physical activity towards prevention of obesity can
be shown in the following table:
Table 3: Multivariate Analysis Differences in nutrition strongly supported by self-efficacy having high
Nutritional Behavior and Physical Activity of confidence to change to be better in controlling a healthy
Children lifestyle in children. Knowledge of good nutrition of
children is also in line with the knowledge that has
Nutrition Peer
Value F p increased from the first month to the sixth. Knowledge of
Educator
children’s nutrition results in a decrease in body weight
Hotelling’s Trace 733,67 2888,82 0,000
or a child’s body mass index. Increased knowledge
Nutrition Knowledge 1044,01 649,52 0,000
of nutritional treatment groups from month to month
Nutrition Behavior 20576,11 27260,07 0,000 changes. This was due to the fact that at the beginning
Physical Activity 7507,81 6924,14 0,000 of the visit, the children had been given a module then
Snacking Behavior 296,45 637,00 0,000 given a peer intervention nutrition educator every visit
all children were well-informed in preventing and
Table 3 based on the results of the statistical test
controlling behavior in overweight and obese children.
with the Ho telling’s T test obtained the value of F =
2888.82 and p = 0,000 <0.05. This means that there are The attitude of school-age children to overnutrition
differences in nutritional behavior and physical activity also plays a role in preventing negative nutritional
of children who receive peer nutrition educators with behavior where the attitude is readiness or willingness
no peer nutrition educators. Nutrition educator peers to act and not an implementation of certain motives. The
influence nutrition knowledge, nutritional attitudes, positive actions of school-age children on nutrition have
physical activity and snack eating habits (p <0.05). a direct effect on children’s eating behavior to be positive,
but negative actions on nutrition almost certainly have
Discussion an impact on nutritional attitudes and behavior(11).
This shows that there are differences in attitudes at
Change of eating habit in school-age children the time after post-test 1 and 2 in both treatment and
causing of overweight and obesity are low knowledge of control groups. Nutritional attitude scores were higher
nutrition. Knowledge of child nutrition is very influential in the treatment group than controls and proved in the
on food selection(9). The result of the study prove that all treatment group that with a six-month intervention
children have knowledge about nutrition which increases using peer models, nutrition educators could improve
when post 1 and post-test 2 compared to the pre-test. the nutritional attitudes of overweight children. Thus,
This can be seen from the results of the Wilcoxon test the nutritional attitude of a good child will also have
which shows a difference in students’ knowledge about sufficient ability to control the child’s lifestyle.
nutrition between before and after the post-test 1 and
2. This assumed in the treatment group that with a Nutrition education in educating children using
six-month intervention using peer nutrition educators modules, children are sure and very useful to obtain
can improve children’s nutrition knowledge. The nutritional information from peers so that they can
result means that there is a difference in the nutritional improve their nutritional attitudes in choosing healthy
knowledge of the children in the treatment group before foods. This is due to the treatment group in the form of
and after nutritional education with a mean change in peer nutrition educators, while the control group only
value higher than the control group. This assumed to obtained modules and leaflets without peer nutrition
increase nutrition knowledge after intervention through educators. This statement is justified by other studies
modules, leaflets and peernutrition educators. It results suggesting that peer nutrition education plays a major
in line with the research of Sulisnadewi et al. (2012) role in children’s attitudes and adherence to a diet.
showing that family health nutrition education is Nutrition educator peer needs an individual peer
effective against the family’s knowledge ability to keep approach that aims to help individuals gain a better
diarrhea in children in the treatment group(10). It shows understanding of the over-nutrition problems faced
that after health education with the application of peer and help to make decisions in overcoming these over-
nutrition educators to overweight prevention is very nutrition problems. Education through peer groups is
effective. Afterhealth education is with the application of more effective if children are gathered with their peers or
peer nutrition educators. Good knowledge of children’s their classmates so that children feel more comfortable
and free in discussions so that they can optimally improve Conclusion

their understanding of healthy snacks. Ayaz, et al. (2015)
obtained results through their research that pre-post test The application of peer nutrition educator assistance
and the use of peer nutrition education modules and
scores on students showed a significant value (p <0.05)
leaflets affect the prevention behavior of obesity and the
higher in students who attended a school that applied
reduction in over-nutrition status of children.
peer group learning compared to schools that applied
ordinary learning exercises(12).
Acknowledgments
Overweight children move a little activity than
The enumerator wishes to thank all the child who
children with normal weight. Physical activity is needed
helped in the collection of the data. Respondents who
by children. From there the child learns to enjoy physical
have been willing to spend time in the interview process.
activity. Increased physical activity was higher in the
control group than in the treatment group. Based on the Conflict of Interest: The author (s) declare that they
results of the analysis there were differences in physical have no conflict interest
activity of children after intervention in the treatment
Source of Funding: Self-funded
and control groups, changes in activity showed that there
was an increase to 93.2% in the sixth month while the Ethical Clearance: Ethical approval has been obtained
physical activity of the control group children decreased. from Ethical Commission of Health Research, Faculty
This proves that there is an influence of peer nutrition of Public Health, with protocol number UH910183001.
educator intervention on children’s physical activity.
Increased income of people in certain socioeconomic REFERENCES
groups, especially in urban areas, causes changes in 1. Greiner PA, Edelman C. Health defined: objectives
dietary patterns and patterns of activities that support for promotion and prevention. Edelman CL,
an increase in the number of obese people. Overweight Mandle CL, Organ Heal Promot througthout life
occurs in children who have a lighter level of physical span 7th ed St Louis Mosby Elsevier. 2010;3–25.
activity than children with heavy activity. 2. González GR, Villanueva JS, Alcantar VER,
Quintero AGG. Overweight and obesity in children
The decrease in snack eating habits was higher in
and adolescents in full time schools Morelos,
the intervention group than in the control group. School-
Mexico. Nutr Hosp. 2015;32(6):2588–93.
age children like to eat snacks such as fried foods,
banana chips, cassava chips, sweets, sweets and others 3. Lu AS, Kharrazi H, Gharghabi F, Thompson D.
A systematic review of health videogames on
that are sold freely in the cafeteria while eating fruits
childhood obesity prevention and intervention.
and vegetables is rare so their diet is low in fiber. Snack
GAMES Heal Res Dev Clin Appl. 2013;2(3):131–
foods can reduce appetite so that children who consume
41.
too much snack foods will usually eat more frequency
and fewer portions, often not eating. The behavior of 4. Indonesia KKR. Hasil utama Riskesdas 2018.
Jakarta Badan Penelit dan Pengemb Kesehatan,
children consuming snacks followed by a sedentary
Kementrian Kesehat Republik Indones. 2018;
lifestyle (sedentary behavior). Eating snacks while
playing games, watching television and rarely moving 5. Dasar RK. Riskesdas 2013. Jakarta Badan Litbang
can lead to overweight. It should be a major concern Kesehat. 2013;
that to solve the problem of obesity a multi-factor and 6. Center NC. Nutrition data system for research.
cross-sector approach is needed. Changes in nutritional Minneap Univ Minnesota. 2011;
behavior and increased activity are a good first step. 7. Erni Yetti R, Muhammad Syafar, Andi Zulkifli,
Low-fat foods, rich in fruits and vegetables and limiting Rahayu Indriasari, Zadrak Tombeg, Saskiyanto
consumption of snacks are the right combination for Manggabarani AJH. The Association between Eat
children who want to maintain a normal nutritional Culture and Obesity among Adolescents in Tana
status to prevent obesity. Toraja. 2018;9(11).
8. Gilbert GG. Sawyer & McNeil EB. Heal Educ meningkatkan kemampuan ibu dalam
Sch community Heal Canada Jones barlett Publ merawat anak diare. J Keperawatan Indones.
LLC. 2011; 2012;15(3):165–70.
9. Skouteris H, McCabe M, Swinburn B, Newgreen 11. McDonald J, Roche A, Durbridge M, Skinner
V, Sacher P, Chadwick P. Parental influence N. Peer Education: from evidence to practice.
and obesity prevention in pre‐schoolers: a Flinders Univ South Aust. 2003;
systematic review of interventions. Obes Rev.
12. Ayaz S, Açıl D. Comparison of peer education
2011;12(5):315–28.
and the classic training method for school aged
10.
Sulisnadewi NLK, Nurhaeni N, Gayatri children regarding smoking and its dangers. J
D. Pendidikan kesehatan keluarga efektif Pediatr Nurs. 2015;30(3):e3–12.
Association between Maternal Iron and Vitamin D with Risky

Development of Autistic Children
Ashraf M Osman1, Hanan M Kamel1, Emad A Abdel-Naem2, Aliaa M Higazi2, Noha Mahmoud Abdullah3
1
Professor, 2Assistant Professor, 3Assistant Lecturer, Department of Clinical Pathology, Faculty of
Medicine, Minia University, Minia, Egypt
Abstract
Autism is one of neurodevelopmental disorders that shows increase in prevalence for last two decades. It
was noticed many risk factors associated with development of autism. here in our study. we were focusing
about mothers risk factors that predisposing to get children with autism. we selected mothers that have
autistic children and measured serum levels of maternal iron and vitamin D. It was found that iron and
Vitamin D levels were decrease among mothers with autistic children. Additionally, more reduction in iron
and vitamin D levels associated with severity of autism.
Keywords: iron, vitamin D, mothers, Autism, ELFA, CTMA
Introduction mother and child could participate in the incidence of

these disorders(1). iron and Vitamin D considered as the
Autism Spectrum Disorder (ASD) are most common risk factors for development of autism.
incorporated into a group of diseases concerned about Iron deficiency affects 40%–50% of pregnancies. Iron
neurodevelopmental disabilities. The rate of incidence is necessary l for early neurodevelopmental processes
of both ASD in the pediatric population was significantly that are affected in autism spectrum disorder (ASD)
increased. In 2018 the Centers for Disease Control (2).
Furthermore, the vitamin D is best known for its
(CDC) determined that approximately 1 in 59 children is importance on bone mineral density (3). However vitamin
diagnosed with an ASD. This estimate is a 14% increase D are also required for brain function, via its role as
in 2016 and a 47% increase in 2012. Also, the prevalence neurotrophic and neuroprotective actions, neuronal
of autism associates with the greater severity of learning differentiation, maturation and growth (4). we conducted
disability or lower verbal IQ. These facts make ASD this study to detect the association of maternal Iron and
the most interesting and challenging areas of research. Vitamin D with risky development Of autism.
Due to the progress in the incidence of autism in recent
decades, a wide range of studies have been done to
Subjects and Method
identify the risk and etiological factors that predispose
or underlay autism. It has been suggested that a number This study was conducted on 65 mothers divided
of environmental and risk factors could anticipate to the into 2 groups, control one that containing 20 mothers
development of ASD. The matter is not only one but a with apparently healthy children selected from those
collection of environmental risk factors regarding father, regularly attending the follow-up at outpatient pediatric
clinic for monitoring of their growth. while another
group containing 45 mothers with children suffering
Corresponding Author: from autism, they were selected from patients attending
Noha Mahmoud Abdullah, MSc. the pediatric neuropsychiatric clinic, Pediatric Hospital,
Assistant Lecturer of Clinical Pathology Minia University, Minia, Egypt as well as from Kayan
Department of Clinical Pathology, charity for education and rehabilitation of ASD, Minia
Faculty of Medicine, Minia University, Minia, Egypt Branch, Egypt. About eight ml of venous blood was
Phone: +20 1017021238 collected from each mother by sterile venipuncture under
Email: nohalab25@gmail.com complete aseptic conditions. This sample was divided
as follow: Two ml in ethylene diamine tetra acetic acid Conted…

(EDTA) containing tube for CBC and Six ml into one
Iron (µg/dL)
plain tube for iron and vitamin D. Iron was determined
by Colorimetric CAB Method in which the Iron reacts Range 40-103 24-113 0.1
with chromazurol B and cetyltrimethyl-ammonium Mean ± SD 70.4 ± 13.1 54.6 ± 17.7
bromide (CTMA) to form a colored ternary complex Vit D3 (ng/mL)
(Spectrum Diagnostics, Cairo, Egypt). Vitamin D was Range 35-66 6.1-21.3
0.001*
determined by detecting the level of 25 OH Vitamin D Mean ± SD 49.6 ± 8.5 9.8 ± 4.04
using the ELFA technique (Linked Enzyme Fluorescent
Assay) by (Mini Vidas, Biomerieux, France). Comparison between severity of ASD as regards
laboratory data of the mothers: our data showed reduction
in levels of hemoglobin, iron and vitamin D3 among
Results
mothers of autistic children associated with severity of
Comparison between studied groups regarding autism. Mean ± SD of hemoglobin levels for mothers
laboratory data of mothers : laboratory data of the with mild autism was (12.5 ± 0.8), moderate autism
included mothers found that those with children was (12.2 ± 1.1) and severe autism was (11.3 ± 1.1).
suffering from autism spectrum disorders had low levels There was a statistically significant decrease in mothers
of vitamin D3 as there Mean ± SD was (9.8 ± 4.04). of severe autism hemoglobin levels when compared to
So, there was statistically significant decrease in vitamin mild form (p=0.002) and in mothers with severe when
D3 levels among mothers with autistic children when compared to moderate (p=0.03). Also, mean ± SD of
compared to the control group (p=0.001) (table 1) iron levels in mothers with mild autism was (60.5 ±
19.8), moderate autism was (51.9 ± 12.8) and severe
autism was (47.2 ± 15.8). There were a statistically
Table 1: Comparison between studied groups
significant decrease in mothers with moderate autism
regarding laboratory data of mothers. GI; control
iron levels when compared to mild autism (p=0.01) and
group GII; autism spectrum disorder, SD; standard
in mothers with severe autism when compared to mild
deviation, Hb; hemoglobin, Vit D3; Vitamin D3, N;
(p=0.03). Additionally, mean ± SD levels of vitamin
number, *p value ≤ 0.05 = significant
D3 in mothers with mild autism (12.8 ± 4.2), moderate
GI GII autism (7.6 ± 1.3) and severe autism (6.9 ± 0.3). There
P values
N = 20 N = 45 was a statistically significant decrease in mothers with
Hb (g/dL) moderate autism vitamin D3 levels when compared to
Range 13.5-15.1 9.5-14.5 mild form (p=0.001) and in mothers with severe autism
0.3 when compared to mild (p=0.001) (table 2), (Fig. 1,2)
Mean ± SD 14.2 ± 0.4 12.1 ± 1.1
Table 2: Comparison between ASD subgroups as regards laboratory data of the mothers. group GIIa; mild
autism spectrum disorder (ASD), GIIb; moderate ASD, GIIc; severe ASD, SD; standard deviation, Hb;
hemoglobin, Vit D3; Vitamin D3, N; number, *p value ≤ 0.05 = significant
GIIa GIIb GIIc P-Values
N = 21 N = 12 N = 12 GIIa vs GIIb GIIa vs GIIc GIIb vs GIIc
Hb (g/dL)
Range 10.9-14.5 10.2-13.7 9.5-13
0.4 0.002* 0.03*
Mean ± SD 12.5 ± 0.8 12.2 ± 1.1 11.3 ± 1.1
Iron (µg/dL)
Range 24-113 26-66 25-74
0.01* 0.03* 0.5
Mean ± SD 60.5 ± 19.8 51.9 ± 12.8 47.2 ± 15.8
Vit D3 (ng/mL)
Range 7.3-21.3 6.1-9.5 6.5-7.5
0.001* 0.001* 0.5
Mean ± SD 12.8 ± 4.2 7.6 ± 1.3 6.9 ± 0.3
that 25% of children with rickets also have ASD (10).

Other studies that supported our results were cried out
among Swedish and Australian women. With Swedish
female there was association between maternal vitamin
D deficiency (< 10 ng/ml) and risk of ASD, especially
those with intellectual disability(11) While Australian
women with low vitamin D levels (< 10 ng/ml) in mid-
gestation had two times risk to have a child with autistic
traits compared to those with vitamin D levels >20 ng/
ml (12). Meta-analysis was done and supported evidence
that increased prenatal exposure to vitamin D was
Figure 1: Comparison between ASD severity as associated with improved cognitive development and
regards serum iron levels of their mothers decreased risk of attention deficit hyperactivity disorder
and autism (13). In trying to find relation between vitamin
D and development of autism, first study was done for
parental and child vitamin D pathway gene variants
and autism by Schmidt Rj et al. 2015. They reported
that child GC vitamin D binding protein (VDBP) AA-
genotype/A-allele was associated with autism and they
suggested a role for (VDBP) and lower plasma vitamin
D in autism(14).
Conclusion
The current study supported that mothers with

Figure 2: Comparison between ASD severity as
regards serum vitamin D levels of their mothers chronic iron and vitamin D deficiency associated with
autism risk. Additionally, more progression for both
maternal iron and vitamin D deficiency have relation
Discussion
with severity of autism.
The prevalence of autism was increased in last years.
we studied most common risk factors associated with Conflict of Interest: The authors report no conflicts of
autism. Our data recorded that mothers with chronic iron interest in this work.
and vitamin D deficiency, having children with autism.
Furthermore, sever deficiency of maternal iron or vitamin Source of Funding: by self.
D responsible for severity of autism. As iron play an
Ethical Clearance: Taken from faculty of medicine–
important role in fetal brain development, it was noticed
Minia University Committee.
that perinatal iron deficiency leading to developmental
delay and cognitive deficits (5). S. Basu et al, 2018,
recorded a progressive decrease in concentrations of References
both neonatal hippocampal volumes and cord blood 1. Karimi P, Kamali E, Mousavi SM, Karahmadi
(brain-derived neurotrophic factor) BDNF with severe M. Environmental factors influencing the risk of
maternal iron deficiency(6). Additionally, the association autism. Journal of research in medical sciences:
between advanced maternal age and low iron intake had the official journal of Isfahan University of
a 5-fold increased ASD risk(2). These previous studies Medical Sciences. 2017;22.
are similar to our finding. About vitamin D, researchers
reported vitamin D receptors in most areas of the brain. It 2. Schmidt RJ, Tancredi DJ, Krakowiak P, Hansen
appears to protect neurons and promote neural growth (7). RL, Ozonoff S. Maternal intake of supplemental
Vitamin D deficiency has been associated with cognitive iron and risk of autism spectrum disorder. American
pathology, including ASD (8, 9). Zaky et al. 2015, reported journal of epidemiology. 2014;180(9):890-900.
3. Holick MF. Vitamin D deficiency. New England 10. Zaky EA, Fouda EM, Algohary EA, Al-Shony
Journal of Medicine. 2007;357(3):266-81. ES. Prevalence of autism spectrum disorders in
vitamin D deficient or insufficient rickets. Int J Sci
4. Groves NJ, McGrath JJ, Burne TH. Vitamin D as
Res (Raipur). 2015;4:1365-73.
a neurosteroid affecting the developing and adult
brain. Annual Review of Nutrition. 2014;34:117-41. 11. Magnusson C, Kosidou K, Dalman C, Lundberg
M, Lee BK, Rai D, et al. Maternal vitamin
5. Lozoff B. Perinatal iron deficiency and
D deficiency and the risk of autism spectrum
the developing brain. Pediatric Research.
disorders: population-based study. BJPsych open.
2000;48(2):137.
2016;2(2):170-2.
6. Basu S, Kumar D, Anupurba S, Verma A, Kumar
12. Vinkhuyzen AA, Eyles DW, Burne TH, Blanken
A. Effect of maternal iron deficiency anemia on
LM, Kruithof CJ, Verhulst F, et al. Gestational
fetal neural development. Journal of Perinatology.
vitamin D deficiency and autism-related traits:
2018;38(3):233.
the Generation R Study. Molecular psychiatry.
7. Ali A, Cui X, Eyles D. Developmental vitamin 2018;23(2):240.
D deficiency and autism: putative pathogenic
13. García-SernaAM, Morales E. Neurodevelopmental
mechanisms. The Journal of steroid biochemistry
effects of prenatal vitamin D in humans: systematic
and molecular biology. 2018;175:108-18.
review and meta-analysis. Molecular psychiatry.
8. Benton D. Lifetime nutritional influences on 2019:1.
cognition, behaviour and psychiatric illness:
14. Schmidt RJ, Hansen RL, Hartiala J, Allayee H,
Elsevier; 2011.
Sconberg JL, Schmidt LC, et al. Selected vitamin
9. Mazahery H, Camargo C, Conlon C, Beck K, D metabolic gene variants and risk for autism
Kruger M, von Hurst P. Vitamin D and autism spectrum disorder in the CHARGE Study. Early
spectrum disorder: a literature review. Nutrients. human development. 2015;91(8):483-9.
2016;8(4):236.
Incidence and Risk Factors of Hypocalcaemia in Post

Thyroidectomy Patients in Tikrit Teaching Hospital
Ayoub M. Zedan
Assist. Prof., College of Medicine, Tikrit University, Tikrit, Iraq
Abstract
Hypocalcemia stands for a well-recognized problem of thyroid surgery. It is frequently transitory event
that happens after widespread thyroid resection that may require calcium or vitamin D supplements to
alleviate or prevent the symptoms. This study aims to determine the hypocalcemia incidence beyond to
thyroid surgery and realize the involved risk reasons regarding the patient gender, age and muscular built,
clinical analysis, extent of surgery, ligation of the inferior thyroid artery, and pathology report. This paper
has been performed on 50 patients who experienced thyroid surgery for numerous thyroid illnesses at the
surgical department of Tikrit Teaching Hospital between January 2016 to January 2017. The results of this
occurrence of post-thyroidectomy hypocalcemia are 30% and in most cases (24%) is transient.
On the other hand, it is permanent in just (6%) of cases and has occurred mainly after total thyroidectomy
and in cases with ligation of the inferior thyroid artery. We concluded that post-thyroidectomy hypocalcemia
is a comparatively mutual complication, but it is transient in most patients. Its incidence is linked with the
surgery extent and can be reduced by the use of the correct surgical procedures.
Keywords: hypocalcemia, thyroidectomy, complications, risk factors.
Introduction It typically shows itself in the 1st 24 hours postoperatively

or within the 2-5 days after an operation. Nevertheless, very
Theodor Kocher is accredited with refined methods seldom the onset is overdue after 2-3 weeks5.
of thyroidectomy and decreasing the frequency of
postoperative hemorrhage. He as well determined the In the majority of patients, it is transient that resolves
preservation significance of parathyroid glands 1. naturally, and only a few patients can be developed to
permanent hypocalcemia 6.
Postoperative hypocalcemia represents an effective
complication of thyroidectomy, and its occurrence is In 80% of cases, it resolves in about 12 months 7. The
very common beyond to full thyroidectomy as compared risk of these difficulties relies on the surgery extent, the
with another more conformist thyroidectomy. The characteristics of the primary disease and the familiarity
testified transient hypocalcemia incidence is ranged of the operating surgeon. Additionally, particular
from (1.6% - 9.3%) after subtotal thyroidectomy and surgical difficulties have come across recurrent thyroid
from (6.9%- 42%) after full thyroidectomy. On the other disease, huge goiter, anatomical variation, retrosternal or
hand, permanent hypocalcemia was testified in (0.2 even mediastinal position and injury with respect to the
-3%) of patients beyond to subtotal thyroidectomy and parathyroid glands 8.
in (0.4-29%) of patients later to full thyroidectomy 2,3, 4.
Other causal mechanisms that have been concerned in
the pathophysiology of post-thyroidectomy hypocalcemia
are uptake of calcium by bone for patients with thyrotoxic
Corresponding Author: osteodystrophy, parathyroid suppression from augmented
Dr. Ayoub M. Zedan calcium reinstated from the bone of patients with
Assist. Prof., College of Medicine, hyperthyroidism, transient post-operative hemodilution
Tikrit University, Tikrit, Iraq with raised renal excretion of calcium, augmented
Email: ayoubmotlak@tu.edu.iq calcitonin release due to thyroid manipulation 9,10.
The 1st clinical symptom of hypocalcemia can be and toes) paraesthesia, and carpopedal spasm were given
less usual including numbness and tingling sensation such as calcium gluconate,10-20m1 of 10% solution
nearby the mouth and in the distal edges 11. until the signs and symptoms disappear. Some patients
require the dose to be given 2-3 times per day.
Intravenous calcium gluconate can be given 10-20m1
of 10% solution slowly until the symptoms disappear, Patients who had permanent hypocalcemia were
then 50 m1 of 10% calcium gluconate can be added to given oral calcium and vitamin D supplementations
500 m1 of 5% dextrose solution and administered by and were followed up on regular outpatient checking up
intravenous drip at a rate of 1 m1/kg/h 12. visits.
The histopathological report was reviewed, and the

Aims of the study result was compared with the state of hypocalcemia.
This study aims to investigate the incidence of It was not feasible to perform a parathyroid hormone
hypocalcemia after thyroid surgery and to find out level assay because this test was not available at our
the complicated risk factors leading to hypocalcemia hospital lab.
regarding the patient age, gender and muscular built,
clinical diagnosis, the extent of surgery, ligation of the Results
inferior thyroid artery and pathology report.
A total of 50 patients aged between 20 to 70 years
Patients and Method old underwent thyroidectomy in the period between
January 2016 to January 2017 at the surgical department
This study has been conducted on 50 patients who of Tikrit Teaching Hospital. About 46 were females,
suffered from thyroid surgery for numerous thyroid and 4 were males. The majority of patients (70%) had a
diseases at the surgical department of Tikrit Teaching simple multinodular goiter, (12%) had Grave’s disease,
Hospital from January 2016 to January 2017. (8%) had a toxic nodular goiter, (6%) had thyroiditis,
and (4%) had cancer as shown in Table (1). Total
The patients included were only those who thyroidectomy was performed for (10%) of patients,
underwent subtotal, near full and full thyroidectomies. near-total thyroidectomy for (22%) of patients and
subtotal, thyroidectomy for (68%) of patients as shown
The date form included patient age, gender, muscular
in Table (1).
built, clinical diagnosis, thyroid function status, type of
surgery, ligation of the inferior thyroid artery, pathology
report. Table 1: Distribution of 50 Patients Who Underwent
Surgery According to Various Thyroid Diseases and
Each patient had serum calcium, phosphate and Surgical Procedure
total serum protein measured preoperative and at day
1,2,3,4,5 postoperatively. Patients who had postoperative Distribution of 50 patients who Underwent
hypocalcemia were followed up as outpatients and had Surgery According to Various Thyroid Diseases
serial checking of their serum levels. Thyroid Disease No. of Patients
Multinodular goiter/simple 35
A calcium level of 8 mg/d1 (2mmo1/L) on at least 2
Grave’s disease 6
consecutive measurements was considered as a threshold
Toxic nodular goiter 4
value of hypocalcemia, besides, experiencing symptoms
such as perioral and digital parasthesia and having Thyroiditis 3
chvostek’s and Trousseaus sign was also included in a Cancer 2
definition. Distribution of 50 patients According to the Type
of the Surgical Procedure
It has been considered transient if it resolves within Type of Surgical No. of Patients
6 months and permanent if it stayed after 6 months, and
Total Thyroidectomy 5
the patients are maintained on supplementation therapy
after calcium and vitamin D. Patients who had clinical Near total Thyroidectomy 11
evidence of hypocalcemia (circumoral and acral fingers Subtotal Thyroidectomy 34
1 of 3 patients who developed permanent hypocalcemia had undergone total thyroidectomy, and the other one
had undergone near-total thyroidectomy, and the last patient had undergone subtotal thyroidectomy as shown in
Table (2).
Table 2: Distribution of 50 Patients According to Type of the Surgical Procedure for Various Thyroid
Diseases, Type of the Surgical Procedure and its Related Hypocalcaemia and Type of the Surgical Procedure
Distribution of 50 patients According to Type of the Surgical Procedure for Various Thyroid Diseases
Number of Toxic Nodular
Type of Surgical MNG CA Thyroiditis Grave’s
Patients Goiter
Total Thyroidectomy 5 0 2 0 2 1
Near total Thyroidectomy 11 5 0 1 3 2
Subtotal Thyroidectomy 34 30 0 2 1 1
Distribution of 50 patients who Underwent Surgery According to the Type of the Surgical Procedure and
its Related Hypocalcaemia
Hypocalcemia
Type of Surgical Total
Yes No
Total Thyroidectomy 4 1 5
Near total Thyroidectomy 5 6 11
Subtotal Thyroidectomy 6 28 34
Total 15 35 50
About (30%) of patients developed hypocalcemia postoperatively; in (24%) of them it was transient and in (6%)
was permanent.
1 of 3 patients who developed permanent hypocalcemia had undergone total thyroidectomy, and the other one
had undergone near-total thyroidectomy, and the last patient had undergone subtotal thyroidectomy as shown in
Table (2) Table(3).
Table 3: Distribution of 50 patients who Underwent Surgery According to the Type of the Surgical
Procedure and its Related Transient & Permanent Hypocalcaemia
Type of Surgical Number of Patients Hypocalcemia Transient Ermanent

Total Thyroidectomy 5 4 3 1
Near total Thyroidectomy 11 5 4 1
Subtotal Thyroidectomy 34 6 5 1
All the patients with CA had post-thyroidectomy hypocalcemia while (66.66%) of patients with thyroiditis had
hypocalcemia and (33.33%) of those with Grave’s disease had hypocalcemia and (50%) of those with toxic nodular
goiter had hypocalcemia as depicted in Table (4).
Table 4: Distribution of 50 Patients According to Type of the Surgical Procedure, Histopathological Report and
Their Hypocalcaemia with Incidences of Hypocalcaemia concerning the Ligation of the Inferior Thyroid Artery
Distribution of 50 patients who Underwent Surgery According to the Type of the Surgical Procedure,
Histopathological Report, and Their Hypocalcaemia
Number Toxic Nodular
Type of Surgical Hypocalcemia MNG CA Thyroiditis Grave’s
of Patients Goiter
Total Thyroidectomy 5 4 - 2 0 1 1
Near total Thyroidectomy 11 5 2 - 1 1 1
Subtotal Thyroidectomy 34 6 5 - 1 - -
Conted…
The Incidence of Hypocalcaemia concerning the Ligation of the Inferior Thyroid Artery
Hypocalcemia
LIGATION OF The Inferior Total
Yes No
Thyroid Artery
No. % No. % No. %
Bilateral 10 66.6 6 37.5 16 51.6
Unilateral 5 33.4 10 62.5 15 48.4
Total 15 48.4 16 51.6 31 100.0
For the patients who underwent total and near-total thyroidectomy, 16 patients had undergone bilateral ligation
of the inferior thyroid artery. 10 patients of them (66.6%) had hypocalcemia, with 15 patients out of the 34 who
suffered subtotal thyroidectomy had undergone a unilateral ligation of the inferior thyroid artery and only 5 of them
(33.4%) had hypocalcemia postoperatively.
Table 5: The Incidence of Hypocalcaemia concerning the Age Group
Hypocalcemia
Total
Age Permanent Transient
No. % No. % No. %
20-30 1 33.3 3 25 4 26.7
31- 40 2 66.6 4 33.3 6 40.0
41 – 50 0 0 2 16.7 2 13.3
51 – 60 0 0 2 16.7 2 13.3
61 – 70 0 0 1 8.3 1 6.7
Total 3 20.0 12 80.0 15 100.0
Fig. 1: The incidence of Hypocalcaemia concerning patient genders
About (33.3%) of the patients who had transient hypocalcemia were between 31-40 years of age, 25 between
20-30 years of age, (16.7%) were between 41-50 years of age, (16.7%) were between 51-60 years of age, and finally
(8.3%) were between 61-70 years as stated by Table 5.
(66.6%) of the patients who had permanent hypocalcemia were between 31-40 years of age, (33.3%) were
between 20-30 years of age. Mean age of hypocalcemia patients is 39 years as shown in.
Discussion gland in total thyroidectomy and for the interference

of blood supply of the parathyroid gland in case of the
Postoperative hypocalcemia is a relatively common method of inferior truncal thyroid a ligation 17, 18.
complication of thyroid surgery and is known as a major
cause of postoperative morbidity, but most often it is a Regarding the clinical and the pathological
transient event that occurs after extensive thyroid surgery. diagnosis, we found that all the patients with CA had
post-thyroidectomy hypocalcemia, while (66.66%) of
The results of this study showed that the incidence patients with thyroiditis had hypocalcemia and only
of hypocalcemia is 30% and it was transient in the (33.33%) of those with Graves disease had hypocalcemia
majority of the cases.
and (50%) of those with toxic nodular goiter had, and
Regarding the age, most of the patients who had only 20 of those with simple multinodular goiter had
transient hypocalcemia (33.3%) belong to the 31- hypocalcemia.
40 years age group, and most of the patients who had
These findings are in agreement with other studies
permanent hypocalcemia (66.6%) belong to that age
(which is similar to Thomuusch et al. study) 15, and
group also, which is nearly similar to other studies 1, 13, 14.
(Sippel Rs,) 19, which showed that the thyroid cancer is a
Regarding the gender depicted in Fig.1, most of the risk factor for inadvertent parathyroid excision.
patients who had transient hypocalcemia (91.66%) were
This was due to the radical removal of thyroid tissue,
females, and most of the patients who had permanent
excessive dissection and truncal ligation of inferior
hypocalcemia (66.66%) were females also, which is
thyroid. All of these factors might lead to unintentional
similar to Thomuusch et al. study 15.
removal of the parathyroid gland and subsequent
Regarding the type and extent of the surgical hypocalcemia 20, 21.
procedure, the research found that the incidence
of transient hypocalcemia was (60%) after total Conclusion
thyroidectomy while it was (36.3%) after near-total
thyroidectomy and it was only (14.7%) after subtotal It was concluded that post-thyroidectomy
thyroidectomy. hypocalcemia is a relatively common phenomenon,
especially after extensive thyroid surgery but it is
The incidence of permanent hypocalcemia was transient in the majority of the cases.
(20%) after total thyroidectomy while it was (9%) after
near total thyroidectomy and only (2.9%) after subtotal Its incidence is related to the extent of the surgical
thyroidectomy. procedure especially if this was associated with ligation
of the inferior thyroid artery and the use of correct
These results are agreed with those reported in surgical procedures can only reduce it.
other studies (Ishtiaq Ahmed et al.) 1, and (Wingert,
2006) 16, that showed that the extent of resection and Ethical Clearance: Taken from Tikrit Teaching
surgical has a more significant impact on the rate of post- Hospital.
thyroidectomy hypocalcemia.
Source of Funding: Self-Funding.
Regarding the ligation of the inferior artery, we
Conflict of Interest: None.
found that (66.6%) of the patients who underwent
bilateral ligation of that artery had post-thyroidectomy
hypocalcemia, while (33.4%) of the patients who References
underwent a unilateral ligation of that artery had 1. Ishtiaq Ahmed Chaudhary, Ziaud Din Fridi, Rehan
hypocalcemia,so making that procedure as an important Masood. To ligate or not the inferior thyroid
risk factor. artery to avoid hypocalcemia after thyroid surgery
J Ayub Med Coll Abbottabad 2007;19(2):19-22.
These results are consent with those reported in other
studies (Ishtiaq Ahmed et al.) 1 and (Wingert, 2006) 16. This 2.
Histshi Miki, Hironyuki Inoue, Masayo
result was due to the inadvertent excision of parathyroid Kitaichi, et al. Estimation of free calcium levels
after thyroidectomy, the Journal of Medical 12. Lawrence W. Way, Gerard M. Doherty. Current
Investigation 2009;44:1-2. surgical diagnosis and treatment. New York Me
Graw –Hill medical publishing division. 14th
3. Lee DR, Hinson AM, Siegel ER, Steelman
Edition2015.p317.
SC, Bodenner DL, Stack BC.Comparison of
intraoperative versus postoperative parathyroid 13. Puzziello A, Gervasi R, Orlando G.Innaro N,
hormone levels to predict hypocalcemia earlier Vitale M, Sacco R.Hypocalcaemia after total
after total thyroidectomy.Otolaryngol Head Neck thyroidectomy: could intact parathyroid hormone
Surg.2015;153(3):343-349. be a predictive factor for transient postoperative
hypocalcemia?Surgery 2015;157(2):344-348.
4. Dami Jung, Jong-Kyu Kim, Hyungju Kwon.
Percentage Decline of parathyroid hormone 14.
Han Luo.Hongliu Yang, Tao Wei, Yanping
levels a predictor for post-thyroidectomy Gong, Anping Su.Protocol for management
symptomatic Hypocalcemia.J Endocr- after thyroidectomy: A retrospective study
surg.2017;17(4):168-174. based on one-center experience.The Clin Risk
Mang.2017;13:635-641.
5. Norman S. Williams, Christopher J.K.Bulstrode,
P Ronan O’Connell, Bailey &loves, short practice 15. Thomusch O, Machens A, Sekulla, C, Ukkat J
of surgery. London, Edward Arnold. 26th Edition Braukhoff M, Dralle H. the impact of surgical
Ltd. 2014.p.771. technique on postoperative hypoparathyroidism
in bilateral thyroid: a multivariate analysis of 5846
6. G.R. Qasaimeh, Y Khade F.M. Al-Mahmed. consecutive patients. surgery 2003;133(2):180-5.
Post-thyroidectomy hypocalcemia, Bioline
16. Wingert D. J. Friesen, SR, Eliopoulos J.I.Pierce
International. 2009;14:32-37.
GE, Thomas J.H, HERMRECK A.S. Post-
7. Courtney M. Townsend, R, Daniel Beauchamp, thyroidectomy hypocalcemia. Incidence and risk
B. Mark Evers, Kenneth L. Mattox, Sabiston factors. Am J Surg. 2006;152:606-609.
textbook of surgery. Philadelphia, Elsevier
17. Rix TE, Siha P. Inadvertent parathyroid excision
Saunders. 2004. p. 986.
during thyroid surgery. Surgeon. 2006;4:339-342.
8. Edafe O, Antakia R, Laskar N, Uttley L, {PubMed}.
Balasubramanian SP.A systemic review and meta-
18. Erbil Y, Barbaros U, Temel B, et al. The
analysis of predictors of post-thyroidectomy.Br J
impact of age, vitamin D3 level, and incidental
Surg.2014;101(4):307-20. parathyroidectomy on postoperative hypocalcemia
9. Faiza A Qari Estimation of ionized calcium after total or near-total thyroidectomy. American
after thyroidectomy, Kuwait medical journal. Journal of surgery. 2009;197(4):439.{PubMed}.
2005;37:169-172. 19. Sippel RS, Ozgul O, Harting GK, Mack EA,
10. Meer M Chisthi, Rakhi S Nair, Krishnakumar Chen H. Risks and consequences of incidental
G.Kutlanchettiyar, Induprabha Yadev.Mechanisms parathyroidectomy during thyroid resection.
behind post-thyroidectomy hypocalcemia: ANZ j ournal of surgery. 2007;77(1-2):33-36.
Interplay of calcitonin, parathormone, and {PubMed}.
albumin-A prospective study.Journal of 20. Michael Conrad Tongol and Roberto Mirasol.
Investigative Surg.2017;30(4):217-225. Incidence and Risk factors for post-thyroidectomy
11. F.Charles Brunicardi, Dana K. Anderson, Timothy hypocalcemia.Journal of ASEAN Federation of
R. Billiar, David L. Dunn, John G. Raphael E. Endocrine Societies. 2016;31(1): 30-36.
Pollock, Schwarts principles of surgery. New 21. Cannizzaro MA, Lo Bianco S, Picardo MC.How to
York, Me Graw –Hill medical publishing Division. avoid and manage Post operative complications in
2014.p.1448. thyroid surgery. Update Surg. 2017;69:211-215.
The correlation between Knowledge and Experience of Nurses

toward Triage Decision Making at Lombok Nusa Tenggara
Barat
Baiq Fitrihan Rukmana1, Ahsan2, Kuswantoro Rusca Putra2

1
Master Program of Nursing, 2Lecturer, Faculty of Medicine, University of Brawijaya
ABSTRACT
Triage is important to do at emergency unit. It is used to determine priority of emergency state action so
medical team can promote treatment for patients who need urgent and accurate treatment to improve life
opportunity of them. Triage process is started when a patients gets into ICU where the nurses assess based
on subjective and objective findings which are done quickly and accurately. However, execution of triage
needs sufficient knowledge and experience to find out priority of the patient. This research has purpose to
find out the correlation between knowledge and experience toward triage decision making at emergency unit
of Lombok Nusa Tenggara Barat hospital. This research is an analytic observational by using cross sectional
with 135 respondents. The findings show that there is correlation between knowledge and experience toward
the decision making with each p value is 0.000. Linier regression shows knowledge becomes the most
correlated variable in decision making of triage. Knowledge and experience of working become the most
important variables of nurses in making decision so medical service can be improved.
Keywords: Triage, Life Opportunity, Emergency Unit
Introduction into emergency unit where its nurses assess based on

subjectively and objectively reviewed findings to have
Triage is an important component to do at emergency quick and appropriate treatment(4). Process of triage is
unit(1). It is a way to classify patients based on types done by one medical treatment, a nurse(5).
and levels of emergency state treatment to improve the
treatment and to prioritize cases in handling emergency Nurses at triage have obligations to position the
state condition(2). Triage assessment on patient is the first patients appropriately based on emergency level. The
– main step in providing emergency state treatment as nurses will label the patients based on the conditions
indicator of further action to be given(3). suffered by them started from red for emergent patients,
yellow for urgent patients, green for non-urgent patients,
Triage system is implemented in classifying and black for death patients. After labelling, the nurses
priority of emergency state treatment so medical team bring the patient to treatment room based on the order
can promote medical treatment to patients who need and emergency state priority. Then the nurses provide
urgent and quick treatment in order to increase his life appropriate treatment(6).
opportunity. Triage process is started when a patient gets
High rate numbers of patients visiting ICU causes
nurses must be able to sort its patients quickly and
Corresponding Author: accurately based on injury level of emergency state
Baiq Fitrihan Rukmana condition occurred or suffered(7). Mistake in assessing
Student of Master Program of Nursing, patient’s condition will lead to overwhelming numbers
Faculty of Medicine, University of Brawijaya of patients and length of inpatient at ICU(8). Ferero et
Jalan Veteran, Ketawanggede, al states that mistake in triage will cause to increasing
Kecamatan Lowokwaru Malang, Indonesia number of length inpatient and waiting lists of patients
Email: anafitribaiq@gmail.com at ICU(9).
Thus, triage nurses are demanded to have sufficient inaccurately assessed triage when the patient categorized
experience and knowledge. They will make the nurses as green but they were categorized into yellow and
to be able to review and to cover complex and pressured incomplete documentation of triage such as lack of
conditions(10). In facing this condition, the nurses must giving check list of the triage patient on medical record
act professionally to overcome appearing stressor in and incomplete physical checkup which affect decision
determining step related to severe condition of the making upon triage patients. It has negative impacts on
patient and their families(11). giving service in emergency unit. The purpose of this
research is to find out the correlation of knowledge and
The interruption can be occurred due to lack of experience toward triage decision making at emergency
knowledge of the nurses which lead to inappropriate unit of Lombok Nusantara Tenggara Barat Hospital.
triage decision, incomplete symptom’s identifications,
and incomplete assessment(12). Lack of experience and
Methods and Material
knowledge of the nurses affect toward less response of
the nurses and delay of the nurses causing increasing This analytic observational research with cross
rate of morbidity and mortality. When the nurses cannot sectional approach. The respondents are 135 participants
do triage, it can decrease quality of the treatment from five hospitals in Lombok by using total sampling.
and negative impacts for the patients(3). Based on the To measure knowledge and triage decision making, they
conditions, it is not easy for the nurses to do triage(13). are done by using questionnaire. Each questionnaire
has been validity and reliability tested by using alpha
Based on preliminary study done on October 31, Chronbach 0.806 for its knowledge variable and 0.869
2018 that at hospital Lombok has problem in decision for triage decision making. Working experience is gained
making on triage process. Researcher observed 30 nurses through questionnaire related working experience of the
directly and found that most of them did not do triage nurses. Bivariate analysis by using spearman rank and
when they had new clients. Some of them did triage multivariate analysis are done by using multiple linier
when the clients were in front of ICU’s door or when regression. This research is done after having ethical
the patients just arrived in ICU although they were not clearance from commission of ethics of Universitas
in emergency state condition. Some of the nurses also Mataram, number 13/UN18.F7/ETIK/2019.
Results
Table 1: Characteristics of the Respondents based on Age, Working Experience, Knowledge and Triage
Decision Making
Variable N Mean Median Min-Max SD

Age 135 31.23 30 22-45 4.179
Working Experience 135 8.24 8 1-22 3.736
Knowledge 135 5.56 5 4-8 1.077
Triage decision making 135 71.23 73 48-90 10.46
Based on the table, it is known the youngest patient is Table 2: Characteristics of the Respondents based
22 year old and the oldest one is 45 year old with average on Sex and Education
age 31.23 year old. The longest working experience is No. Variables Categories f %
22 years and the youngest one is 1 year with 8.24 years 1. Male 73 54.1
Sex
in average. Highest score of respondents’ knowledge is Female 62 45.9
8 while the lowest one is 4 with average 5.56. Highest 2. D3 61 45.2
score of decision making is 90 and the lowest one is 48 D4 2 1.5
Education
with average 71.23. S1+Ners 71 52.6
S2 1 0.7
Total 135 100
The table shows the dominant is male with 73 rest of them are affected by other uninvestigated factors.
respondents. Meanwhile, the most dominant education Based on the table, then knowledge becomes the most
is first degree + Ners with total 71. dominant variable correlating to triage decision making
with coefficient score B 6.423.
Table 3: Correlation of Knowledge toward Decision
Making of Triage Discussion
Variable Triage decision making Findings of the research explain correlation between
r = 0.69 knowledge to triage decision making at emergency
Knowledge p = 0.000 unit of Lombok Nusa Tenggara Barat hospital with p =
n = 135 0.000. Score of r is 0.69, showing that there is strong
positive correlation. It explains that higher knowledge
The table shows p = 0.000 (p<0.05) so it is concluded has higher triage decision making of the nurses. Linier
that there is correlative factor between knowledge regression test shows variable is the most dominant to
toward triage decision making at the emergency unit. triage decision making.
The r score is 0.69 showing positive correlation with
strong strength of the correlation where higher score of This research is in line with Aloyce et al in 2014
the knowledge also has higher triage decision making showing that higher knowledge of nurses dealing with
score of the nurses. triage can improve nursing accuracy in triage decision
making at emergency unit. Highest knowledge of the
Table 4: Correlation between Working Experiences nurses can help to categorize triage appropriately
toward Triage Decision Making according to patients’ condition so it improves nurses’
performance and better outcome(14).
Variable Triage decision making
r = 0.289 Triage is autonomous nursing role focusing on
Working experience p = 0.000 patient survival and efficient treatment execution.
n = 135 Clinical decision made by triage nurses needs complex
cognition. Triage nurses must show ability to think
Table 4 shows p = 0.000 (p<0.05) so it can be critically in limited, incomplete, and ambiguity data
concluded that there is correlative factor between environment. Process of effective and efficient decision
working experience to triage decision making at the making depends on broad knowledge and experience
emergency unit. R score is 0.298, showing positive dealing with various disease and patterns of injuries(15,16).
correlation with lower correlation strength in which In a study done by Roudbari & Mirhaghi 2010, it stated
higher working experience has higher triage decision that lower ability of nurses in doing triage is caused
making of the nurses. by their lack of knowledge and incapability to review
patient’s condition(17).
Table 5: Correlation of Knowledge and Working
Emergency Nurse Association in 2011 also
Experiences to Decision Making of Triage recommends that knowledge to be mastered by nurses in
Variable Coefficient B Score p R Square doing triage are triage taking process, triage documenting
Step 1 process, law of health service, abdomen emergency
state, hearth emergency state, trauma, respiratory
Constanta 34.823 0.000
emergency state, psychiatric emergency state, fast track,
Knowledge 6.284 0.000 0.441
musculoskeletal, special condition, and child emergency
Experience 0.181 0.333 state(18). By the existence of these recommendation
Step 2 dealing with needed knowledge by nurses dealing with
Constanta 35.544 0.000 triage, then triage can be done quickly and appropriately
0.437
Knowledge 6.423 0.000 so it improves services at the hospital.
Table 5 shows knowledge variable can explain that The findings also explain that there is correlation
variety of the decision making of triage is 43.7%. The between working experience to decision making of triage
at the emergency unit with p = 0.000. Score of r = 0.289, REFERENCES

explaining that low positive correlation causes higher
1. Augustyn J, Hattingsih S., Amp EV. Implementing
working experience to have higher triage decision making.
a Triage System in an Emergency Unit: a Literature
It is in line with Duko et al 2019, stating that nurses Review. Afr J Nurs Midwifery. 2007;9(2):12-.
whose lengthy working experience decide triage decision 2. Patnaik S, Brazile B, Dandolu V, Ryan P, Liao J.
at emergency unit. Higher experience of nurses will be Mayer - Rokitansky - Kuster - Hauser (MRKH)
something to learn for them to categorize appropriate Syndrome: A Historical Perspective. Gene.
triage according to conditions of patients so it will 2014;33–40.
improve treatment performance and better outcome(19).
3.
Bean E, Mazur T, Robinson A. Mayer-
Benner (1982) stated that becoming expert nurses Rokitansky-Kuster-Hauser Syndrome: Sexuality,
need to develop ability and understanding related to Psychological Effects, and Quality of Life. J
Pediatr Adolesc Gynecol. 2008;22:339–46.
patient management at whole time in which can be
learnt by having many experiences(20). Benner groups 4. Mardiana L. Cancer on Women. Penebar Swadaya.
abilities into 5 levels namely novice, advance beginner, Jakarta;
competent, proficient, and expert. 5. Sundeen S and. Buku Saku Keperawatan. 6th ed.
Jakarta: EGC; 2013.
Triage nurses are expected to be competent in which
they can handle and consider as well as create needed 6.
Keliat BA. Treatment of Mental Health
plan to face current situation in future time. This stage Community. Jakarta: EGC; 2011.
symbolizes that a nurse whose had similar jobs or 7. Kusumawati F, Hartono Y. Manual Guidance of
situation for 2 or 3 years will grow when they find out Psychiatric. Jakarta: Salemba Medika; 2011.
that their action reach into the target, or consciously they
8. Depkes. Report of National Fundamental Health
have planning within their action. Consistency, ability
Research 2013. Jakarta; 2013.
to predict, and time management become description of
competent stage. Competent nurses can perform their 9. Videbeck SL. Psychiatric Mental Health Nursing.
responsibilities dealing with conditions of patients, 4rd ed. Philadhelphia: Lippincott Williams &
more focus, and being able to perform critical thinking Wilkins; 2008.
ability(6,21,22). 10.
Prabowo E. Concpets and Applicaitons of
Psychiatric Treatment. Jakarta: Nuha Medika;
Conclusion 2014.
It can be concluded that there is relationship 11. Association AP. Diagnostic and Statistical Manual
of Mental Disorder Edition “DSM-5.” Washington
between knowledge and working experience of nurses
DC; 2013.
to triage decision making at Lombok Nusa Tenggara
Barat hospital. The most correlative variable in decision 12. Dermawan D, Rusdi. Psychiatric: Concepts and
making is knowledge. By identifying this factor, it is Treatment Framework. Gosyen Pub. Yogyakarta;
expected can contribute to suggest all parties of the 2013.
hospital to improve knowledge and nursing experience 13. Keliat BA, A B, C D, E F, G H, I J. Management
dealing with appropriate triage decision making. of Professional Nursing Practices. Jakarta: EGC;
2010.
14. Maslim R. The Diagnoses of Mental Problems.
Ethical Clearence: This study has passed the ethical Brief Reference of PPDGJ-III and DSM-V.
test held at University of Mataram with no 13/UN18.F7/ Cetakan 2. Jakarta: PT Nuh Jaya; 2013.
ETIK/2019.
15.
Kirana, Keliat, Mustikasari. The Impact of
Source of Funding: None Behavior and Cognitive Behavioral Social
Skills Therapy Trainings toward Clients with 19. Duko B, Geja E, Oltaye Z, Belayneh F, Kedir
Hallucination and Social Isolation Symptoms. J A, Gerbire M. Triage Knowledge and Skills
Keperawatan Stikes Hang Tuah Surabaya. among Nurses in Emergency Units of Specialized
Hospital in Hawasa, Ethiopia: Cross Sectional
16. Harkoma I, Arif Y, Basmanelly. The Impacts
Study. BMC Res Notes. 2019;12(1):21.
of Social Skill Training (SST) and Supportive
Therapy toward Socializing Skills of Clients 20. Alligood M, S PAY, Hamid MDns, Kusman
Suffering Schizophrenia Jambi Psychiatric Ibrahim, S. MNS P. Pakar Teori Keperawatan.
Hospital. JHealSci. 2018;2(1):61–5. Elsevier, editor. 2014.
17. Calafell, A B, C D, E F, G H, I J. Social Skills 21. Hammad K, Peng L, Anikeeva O, Arbon P, Du
Training for People with Schizophrenia: What H, Li Y. Emergency Nurses’ Knowledge and
do we train? Behav Psychoology/Psicologia Experience with the Triage Process in Hunan
Conduct. 2014;22(3):461–77. Province, CHina. Int Emerg Nurs. 2017;35:25–9.
18.
Kristyaningsih T. The Impact of Cognitive 22. Arslanian-Engoren C, Hagerty B, Antonakos C,
Therapy to Self-Esteem and Depression Changes Eagle K. The Feasibility and Utility of the Aid to
of Patients Suffering from Kidney Failure in Cardiac Triage Intervention to Improve Nurses’
RSUP Fatmawati Hemodialysis Room. Jakarta: Cardiac Triage Decision. Hear Lung J Acute Crit
FIK UI; 2009. Care. 2010;39(3):201–7.
Detection of mecA Gene in Methicillin-Resistant

Staphylococcus hemolyticus Isolated from Blood Cultures of
Neonates in Baghdad
Butheina Mahamed Taha1, Nadheema Hammood Hussein1, Khetam H. Rasool1, Sara Ali Jasem Maliki1,
Jumaah Dakel Hussein2
1
Department of Biology, College of Science, Mustansiryah University; 2Medico-legal Department, Ministry
of Health, Baghdad, Iraq
Abstract
In this study 30 clinical isolates of Staphylococcus haemolyticus were isolated from blood cultures of
neonate patients at a hospital in Baghdad and during period extended from January, 2015 to February, 2016.
The of antimicrobial sensitivity test results showed the most effective antibiotics on S. haemolyticus isolates
were linezolid, quinupristin and moxifloxacin which had 100% sensitivity rate, while the all isolates showed
a high level of resistance to oxacillin and benzylpenicillin (100%). Phenotypic detection test of methicillin
resistance to S. haemolyticus isolates showed all 30 S. haemolyticus isolates under test were methicillin
resistance and the results of PCR assay for detection of mecA gene showed from 30 isolates of methicillin-
resistant S. haemolyticus, 28(93.3%) isolates were positive to mecA gene with 258-bp, while only 2(6.7%)
isolates were negative to mecA gene.
Keywords: Staphylococcus haemolyticus, methicillin resistance and mecA Gene.
Introduction There had been a dramatic increase in the emergence

of the antibiotic resistant bacterial isolates, which has
Coagulase-Negative Staphylococci (CoNS) species made the antibiotic choices for the infection control
are the most frequent cause of nosocomial blood increasingly limited and also more expensive (6). The
stream infections (1). Staphylococcus haemolyticus (S. highly antibiotic-resistant and also the ability of S.
haemolyticus), is a part of skin normal flora of the humans haemolyticus to form biofilms make S. haemolyticus a
(2)
. S. haemolyticus, is a well-known opportunistic difficult pathogen to treat (3). S. haemolyticus bacteria
pathogen, and it is the second-most frequently isolated have the highest level of antimicrobial resistance
Coagulase-negative staphylococci from human blood among all species of CoNS (7). Methicillin- Resistant
cultures (the first is Staphylococcus epidermidis) (3, 4). Staphylococci (MRS) cause hard to treat infections,
So, it plays an important role in the hospital-acquired due to the resistant of MRS to the most types of the
opportunistic infections related to implanted medical antibiotics such as macrolides, aminoglycosides and
devices. Infections that caused by S. haemolyticus can beta-lactam antibiotics (8). So this limits the therapeutic
be systemic or localized, and those infections were often options available and also makes the Staphylococcus
associated with the insertion of the medical devices (5). haemolyticus infection a serious threat (9).
The resistant to methicillin is conferred by mecA
gene, which it carried on the staphylococcal cassette
chromosome mec element (SCCmec). So, the increase
in the frequency of methicillin resistant S. haemolyticus
Corresponding Author: isolates as the causal agent of hospital infections and
Dr. Butheina Mahamed Taha also the possibility of the emergence of resistance
Department of Biology, College of Science, to the other types of antibiotics demand trustworthy
Mustansiryah University characterization of these isolates and to an investigation
Email: dr.alkarkhi@gmail.com of clonal spreading within the hospitals (10).
The accurate and rapid diagnosis of antibiotic heated at 90°C for 10 min using a water bath. Samples
resistance genes in the treatment of Staphylococci after that centrifuged at 10000 rpm for (10 min). Those
infections is extremely important in the preventing the samples were used as the DNA template for PCR assay
spread of infections. For the determination of antibiotic (Endimiani et al., 2009).
resistance genes, the PCR-based molecular methods are
often preferred (11). Detection of mecA gene by polymerase chain reaction
(PCR): Polymerase chain reaction (PCR) was used to
This study was aimed to detect the presence of the amplify the mecA gene. Primer sequences for mecA
mecA gene in the methicillin-resistant Staphylococcus (258-bp) were chosen according to the method described
haemolyticus isolates which isolated from neonatal by (Kawano et al., 1996): the forward sequence of mecA
blood cultures. Phenotypic and molecular methods were gene is (5-AGATTGGGATC ATAGCGTCA-3) and the
used to study 36 methicillin-resistant Staphylococcus reverse sequence of mecA gene is (5-GAAGGTATCAT
haemolyticus clinical isolates. CTTGTACCC-3). The forward and reverse primers
were synthesized by (Alpha DNA, Canada). PCR was
Materials and Method performed in the DNA Thermal Cycler (Agilent (8800),
USA). The mixture of PCR for the mecA gene was set
Study Period: Thirty six clinical isolates of
up in total volume of 25µl included: (2X Master mix
Staphylococcus haemolyticus were isolated over a
(12.5µl) (Promega, USA), 1µl of each primer, template
period of study extended from January, 2015 to February,
DNA (4µl) and sterile D.W. (6.5). The negative control
2016 from blood cultures of neonatal which they were
contained all the materials except DNA, D.W. was added
suffering from bacteremia and lying at a hospital for
instead of DNA.
pediatric and obstetric in Baghdad/Iraq.
The program used to amplified mecA gene was: The
Identification of Staphylococcus haemolyticus:
initial denaturation at 94°C for 5min; (denaturation at
Staphylococcus haemolyticus isolates were identified at
94°C for 1 min, annealing at 55°C for 2 min, extension
species level by using the Vitek-2 system (Bio-Merieux,
at 72°C for 3 min) for 26 cycles; and the final extension
France) with the using ID-GP cards according to the
at 72°C for 7 min (12).
manufacturer’s instructions.
Agarose Gel Electrophoresis: The PCR products were
Antibiotic Susceptibility Test: The antibiotic
detected by using gel electrophoresis and the visualized
susceptibility test towards different classes of antibiotics
was done with the aid of RedSafe dye (INtRON, Korea)
was done by Vitek-2 system (Bio-Merieux, France),
and UV transilluminator documentation system (13).
with the using AST-P580 cards and according to the
manufacturer’s instructions.
Results and Discussion
Phenotypic Detection of Methicillin Resistance:
Phenotypic detection of methicillin resistance was Period of Study and Bacterial Isolates: Thirty isolates
done by detection the resistance to methicillin which of Staphylococcus haemolyticus were isolated during
was performed with Vitek- 2 automated system (Bio- the period from January, 2015 to February, 2016 from
Merieux, France), and according to the manufacturer’s the blood cultures of neonate patients at one hospital in
instructions with using of AST-P580 cards that have Baghdad. All 30 S. haemolyticus isolates were isolated
cefoxitin screen test as methicillin resistance indicator. from neonate patients within the age group less than one
month. The results showed that the incidence of infected
Genotypic detection of mecA gene with S. haemolyticus isolates was higher among males
18(60%) than that of females 12(40%).
Extraction of DNA: The bacterial DNA was extracted
according the boiling method by suspending 2-3 Antibiotic Susceptibility Test: The antimicrobial
colonies of each S. haemolyticus isolate which grown on sensitivity test for 30 S. haemolyticus clinical isolates
overnight culture brain-heart infusion agar plates in (500 which isolated from neonatal blood cultures to various
μL) of nuclease-free water (Promega, USA) and then antimicrobial drugs were shown on Table-1.
Table 1: The results of antimicrobial sensitivity test for 30 S. haemolyticus clinical isolates under study
S. haemolyticus isolates Antimicrobial S. haemolyticus isolates

Antimicrobial drugs
S% R% drugs S% R%
Benzylpenicillin 0(0%) 30(100%) Levofloxacin 29(96.7%) 1(3.3%)
Ciprofloxacin 24(80%) 6(20%) Linezolid 30(100%) 0(0%)
Clindamycin 19(63. 3%) 11(36.7%) Moxifloxacin 30(100%) 0(0%)
Erythromycin 12(40%) 18(60%) Nitrofurantion 28(93.3%) 2(6.7%)
Gentamicin 16(53.3%) 14(46.7%) Quinupristin 30(100%) 0(0%)
Oxacillin 0(0%) 30(100%) Tetracycline 16(53.3%) 14(46.7%)
Rifampicin 18(60%) 12(40%) Tigecycline 29(96.7%) 1(3.3%)
Trimethoprime-Sulphamethoxazole 17(56.7%) 13(43.3%) Vancomycin 28(93.3%) 2(6.7%)
The results showed that the most effective antibiotics 258-bp band as shown in Figure-2, while only 2(6.7%)
on clinical isolates of S. haemolyticus were linezolid, isolates were negative to mecA gene. Detection of mecA
quinupristin and moxifloxacin which had 100% gene was done on (1%) agarose gel at 5 V/cm for 1.5 hr.
sensitivity rate followed by tigecycline and levofloxacin which stained with RedSafe dye and visualized on UV
which had 96.7% sensitivity rate then vancomycin and transiluminator documentation system.
nitrofurantion which had 93.3% sensitivity rate. On
the other hand, the isolates were shown a high level
of resistance to oxacillin and benzylpenicillin (100%)
followed by Erythromycin which had 60% resistant rate.
Phenotypic detection of methicillin resistance

S. haemolyticus isolates: According to cefoxitin
screen test that including within the cards of Vitek- 2
system (AST-P580 cards), all 30 clinical isolates of S.
haemolyticus under study were methicillin resistance
Figure 2: Detection of mecA gene by monoplex PCR
(Figure-1). assay; Lane M, 100 bp DNA ladder; lanes 1-11,
amplification of mecA (258bp); lane C, Negative
control
Discussion
Isolates of Staphylococcus haemolyticus are the
second of most frequently isolated bacteria from the
human blood cultures among the coagulase-negative
staphylococci (CoNS) (14), and have the highest level
of antimicrobial resistance (7). Methicillin resistance of
S. haemolyticus is conferred by the mecA gene which
carried on the staphylococcal cassette chromosome mec
element (SCCmec) (15, 16).
Figure 1: Positive result of Cefoxitin screen test that
Our results showed that all 30 S. haemolyticus
done by Vitek- 2 system with the use of AST-P580 card
isolates were resistant to oxacillin and benzylpenicillin
Genotypic detection of mecA gene by polymerase (100%) and all the isolates were susceptible to linezolid
chain reaction (PCR) assay: The results of PCR assay and moxifloxacin. All the S. haemolyticus isolates
for detection of mecA gene showed that, out of 30 isolates were methicillin resistance phenotypically. Our results
of methicillin-resistant S. haemolyticus clinical isolates, demonstrated that the majority of S. haemolyticus
28(93.3%) isolates were positive to mecA gene with clinical isolates under study were positive for molecular
detection of the mecA gene by PCR. Barros and his co- vancomycin screening agar. Pathology. 2007; 39:
workers (10) determined that by PCR of the mecA gene, 375–377.
87% were found to be methicillin resistant. 8. Duran N, Ozer B, Duran GG, Onlen Y, Demir
C. Antibiotic resistance genes & susceptibility
Acknowledgments patterns in staphylococci. Indian J Med Res.
2012; 135: 389-396.
Thanks for Mustansiriya University [http:// 9.
Fredheim EGA, Klingenberg C, Rohde H,
uomustansiriyah.edu.iq]/Baghdad, Iraq for its support to Frankenberger S, Gaustad P, Flægstad T, Sollid
complete this work. JE. Biofilm Formation by Staphylococcus
haemolyticus J. Clin. Microbiol. 2009; 47(4):
Ethical Clearance: The researchers already have ethical
1172–1180.
clearance Department of Biology, College of Science,
Mustansiryah University 10. Barros EM, Ceotto H, Bastos MCF, Dos Santos
KRN, Giambiagi- deMarvala M. Staphylococcus
Source of Funding: Self-funding haemolyticus as an Important Hospital Pathogen
and Carrier of Methicillin Resistance Genes. J.
Conflict of Interest: No conflict of interest
Clin. Microbiol. 2012; 50(1): 166–168.
11. Viale P, Stefani S. Vascular catheter-associated
References infections: a microbiological and therapeutic
1. Rogers KL, Fey PD, Rupp ME. Coagulase- update. J Chemother. Department of Medical
negative staphylococcal infections. Infect Dis and Morphological Research, Medical School,
Clin North Am. 2009; 23(1):73–98. University of Udine, Italy. 2006; 18 (3): 235–49.
2. De Silva, G. DI, Kantzanou M, Justice A, Massey 12. Kawano J, Akira-Shimizu A, Saitoh Y, Yagi M,
RC, Wilkinson AR, Day NPJ, Peacock, SJ. The Saito T, Okamoto R. Isolation of Methicillin-
ica operon and biofilm production in coagulase- Resistant Coagulase- Negative Staphylococci
negative staphylococci associated with carriage from Chickens. J. Clin. Microbiol. 1996; 34(9):
and disease in a neonatal intensive care unit. J. 2072–2077.
Clin. Microbiol.2002; 40: 382-388. 13. Sambrook J, Fritsch EF, Maniatis T. Molecular
3. De Allori MC, Jure MA, Romero C, De Castillo cloning: A laboratory Manual. 2nd ed. P.A. 12
ME. Antimicrobial resistance and production of Cold spring Harbor Laboratory press. Cold Spring
biofilms in clinical isolates of coagulase-negative Harbor, New York. 1989; P: 68.
Staphylococcus strains. Biol. Pharm Bull. 2006; 14. Takeuchi F, Watanabe S, Baba T, Yuzawa H, Ito
29: 1592–1596. T, Morimoto Y, Kuroda M, Cui L, Takahashi M,
4. Mack D, Rohde H, Harris LG, Davies AP, Ankai A, Baba S, Fukui S, Lee JC, Hiramatsu K.
Horstkotte MA, Knobloch JK. Biofilm formation Whole-genome sequencing of Staphylococcus
in medical device-related infection. Int. J. Artif. haemolyticus uncovers the extreme plasticity of
Organs, 2006; 29: 343–359. its genome and the evolution of human-colonizing
5. Falcone M, Giannella M, Raponi G, Mancini C, staphylococcal species. J. Bacteriol. 2005; 187:
Venditti M. Teicoplanin use and emergence of 7292–7308.
Staphylococcus haemolyticus: is there a link?. 15.
Ito T, Katayama Y, Hiramatsu K. Cloning
Clin Microbiol Infect. 2006; 12 (1): 96–97. and nucleotide sequence determination of the
6. Li B, Webster TJ. Bacteria Antibiotic Resistance: entire mec DNA of pre-methicillin-resistant
New Challenges and Opportunities for Implant- Staphylococcus aureus N315. Antimicrob. Agents
Associated Orthopaedic Infections Orthop Res. Chemother. 1999; 43:1449 –1458.
2018; 36(1): 22–32. 16. Endimiani A, Hujer AM, Perez F, Bethel CR, Hujer
7. Chiew YF, Charles M, Johnstone MC, Thompson KM, Kroeger J, Oethinger M. Characterization
KM, Parnell KD, Penno EC. Detection of of blaKPC-containing Klebsiella pneumoniae
vancomycin heteroresistant Staphylococcus isolates detected in different institutions in the
haemolyticus and vancomycin intermediate Eastern USA. J. Antimicrob. Chemother. 2009;
resistant Staphylococcus epidermidis by means of 63:427-437.
Oko Mama Culture Betel Nut Consuming Habit in Kupang

District and its Effect toward Salivary Ph and Flow Rate
Christina Ngadilah1, Hari Basuki N.2, Rika Subarniati T.3

Doctoral Program of Health Sciences, Faculty of Public Health, 2Faculty of Public Health, Airlangga
1
University, Indonesia; 3Head of Public Health Department, Faculty of Medicine, Wijaya Kusuma
University, Indonesia
ABSTRACT
Public health always associated to culture and lifestyle. Lifestyle itself constitutes a concept that commonly
used to define “The way people live”, reflecting the whole social value, attitude, and activity. One of long-
term culture that become personal habit is chewing betel nut. Oko Mama culture is the local culture of the
Timorese tribe who consider it as the symbol of philosophy, dignity, enjoyment, beauty, also as a means of
communication in society, political means, and delaying hunger. Several studies revealed several unbeneficial
of chewing betel nut, such as acute betel nut toxicity, cardiovascular disease, respiratory disorder, and
congenital defect. Besides, betel nut may also alter oral health. This study is aiming to analyse the correlation
of habitual chewing betel nut toward salivary pH and flow rate. This was an observational analytic study,
by means of cross sectional design involving both on male and female aging 17-50 years old in 4 sub-
district, consisting of 2 remote areas and 2 urban areas. The correlation between variables was analysed
using path analysis by means of Smart PLS 3.2.7. The analysis revealed a positive correlation between Oko
Mama culture toward behaviour (p=0.316) and intention (p= 0.454), also a negative correlation between
the culture toward oral hygiene knowledge (p=-0.185) and the effect of chewing betel nut knowledge (p=-
0.111). A positive correlation also recorded toward perceived norm (p=0.931). While intention had a positive
correlation toward behaviour (p=0.429). Regarding oral health, chewing betel nut had negative effect toward
salivary pH (p=-0.167) and salivary flow rate (p=-0.210).
Keyword: community habit, betel nut, salivary pH, flow rate.
Introduction The Oko Mama culture, that used betel nut in

various occasion in daily life, thus, it can be found in
Public health is an integrated matter with the local every household in Timor. Oko Mama is the Timorese
culture. The society in each region have their own tribes culture, that chew the betel nut as the symbol of
concept of health, as the important part of the culture. philosophy, dignity, enjoyment, beauty, also as a means
Betel nut chewing denotes an old habit of the society in of communication in society, political means, and
Kupang. A prior study revealed that in Oelnaineno, sub delaying hunger. This culture denotes the factor that
district Takari, Kupang, 94% people aged 17-60 years drives the society to chew betel nut to date (2).
old chew betel nut. The betel nut usually mixed with
betel, areca nut, lime, sometimes the other ingredients Studies revealed that chewing betel nut might
were added, such as nutmeg, cloves, and even tobacco(1). induce oral precancerous lesion which highly tend to
become cancer. The areca nut itself has been classified as
class I carcinogenic agent by the International Research
Agency for Research Cancer (3). Areca nut only, has
Corresponding Author: significant impact toward health, thus, tobacco addition
Christina Ngadilah may rise worsen health consequence, even death. After
Doctoral Program of Health Sciences, chewing betel nut, several symptoms may appear, such
Faculty of Public Health, Airlangga University, Indonesia as headache, tachycardia, hot sensation and sweating,
Email: christinangadilah62@gmail.com epigastric discomfort, hyperventilation, thirst and
hunger diminish, relax, and overexcited (1). Areca nut from those 4 selected areas. The respondents were
contain arecolin, that possibly toxic toward periodontal asked to fill a questionnaire. The acquired data were
tissue, thus, may worsen the periodontal status (4). analysed by means of path analysis by PLS 3.2.7 to find
a correlation among variables. We hypothesized eleven
The betel nut is addictive to its chewers. The tint
theories; 1) there is a correlation between attitude and
from betel nut can penetrate into oral mucosa, and teeth,
intention; 2) there is a correlation between perceive
yet may disappear if strongly rubbed by areca skin (5).
norm and intention; 3) self-efficacy affect the intention;
The tooth discoloration due to betel nut chewing may
4) Oko Mama culture affect intention; 5) Oko Mama
prevent tooth demineralization. Several studies had
culture affect behaviour; 6) intention affect behaviour;
proved that betel nut could reduce the caries prevalence
(6)(7)(8)
. 7) oral health knowledge affect behaviour; 8) disease
knowledge affect behaviour; 9) habit affect behaviour;
Considering the high number of betel nut chewers 10) behaviour affect salivary flow rate; 11) behaviour
and its effect toward health, thus, it is important to analyse affect salivary pH.
the Oko Mama culture, related to the habit of chewing
betel nut and its effect toward caries. It is expected to be Results
able to help the attempt to reduce betel nut chewers in
Kupang, East Nusa Tenggara as it is dangerous to their The respondents participated in this study consisted
health, especially their dental health. This research aiming of 51.5% female and 48.5% male. The total of betel nut
to syntheses a theory of Fishbein Integrated Behaviour chewers was dominated by female (52.8%). Among the
Model with Dunn Behavioural theory which including population, the betel nut chewers (79.9%) were more
culture as the factor that influence someone behaviour. than those who do not chew betel nut (20.1%). Mostly
respondents were aged 41-50 years old (43.8%), while
Material and Method the respondents aged less than 20 were the minority
(11.3%). The younger the respondents, the less they
This observational analytic study employed a cross
chew betel nut. Most of the respondents were farmers
sectional design. The sub district South Amfoang and
(82.6%), with the last education was elementary school
Takari, denotes remote areas, while the urban areas
(59.2%).
were sub district Nekamese and Kupang Centre. Those
selected areas had the most population. The subject The habit of betel nut chewing more than 5 times a
of this study were the inhabitants aged 17-50 years day were done by 37.5% of the respondents. The average
old. As much as 363 peoples were randomly chosen frequency of betel nut chewing was twice a day. A portion
from 146.597, calculated using estimated proportion of 51.8% the respondents has been chewing betel nut for
population formula. 10 years or more, with 58.1% of them chewed betel nut
The criteria for the respondents were male and with lime and areca nut. The majority of the respondents
female who chewed betel nut, and those who did not learn to chew betel nut form their parents (96,9%).
Table 1: Result from Path Analyzes
Original Mean T Statistic

Path SD P Values
Sample (O) (M) (|O/STDEV|)
Attitude → Intention 0,290 0,293 0,058 4,978 0,000
Behavior → SFR -0,210 -0,208 0,053 3,933 0,000
Behavior → pH -0,167 -0,166 0,046 3,617 0,000
Intention → Behavior 0,428 0,415 0,099 4,323 0,000
Oko Mama → Behavior 0,316 0,315 0,058 5,467 0,000
Oko Mama → Intention 0,463 0,453 0,098 4,739 0,000
Oko Mama → Perceived Norm 0,931 0,931 0,013 73,796 0,000
Habit → Behavior 0,232 0,246 0,098 2,378 0,018
Conted…
Oral Health Knowledge → Behavior -0,020 -0,019 0,016 1,213 0,226

Betel nut knowledge → Behavior -0,013 -0,013 0,018 0,718 0,473
Perceived Norm → Intention -0,202 -0,202 0,080 2,522 0,012
Self-confidence → Intention 0,414 0,422 0,096 4,296 0,000
Similar to TRA/TPB, the most important secretion or salivary properties changes while they are
predisposing factors in Integrated Behaviour Model not chewing betel nut. This condition may contribute
(IBM) is intention. Intention defined as individual to several oral and dental diseases, that directly affect
decision indicator to do a certain behaviour. Without the quality of life. Several studies stated that the normal
intention, behaviour will not be built. The intention itself unstimulated salivary flow rate is 0.3-0.5 ml per minute
was determined by attitude, perceived norm, and self- (9)(10)
, while stimulated salivary flow rate is 10 ml per
efficacy to start doing betel nut chewing as habit. This minute (11)(12). The significant changes of salivary flow rate
study used 4 variables based on the IBM that affect the affect dental and oral health (12). The functional changes of
intention to chew betel nut, that are attitude, perceived salivary gland, is related to oral cavity, throat, oesophagus,
norm, self-confidence and Oko Mama culture. Based on neoplasm, nutrition metabolism, inflammation, genetic
the result from table 1, there were 2 rejected hypotheses,
disease, auto-immune disease, and nervous system
that are 1) oral health knowledge have no effect toward
damage. The varied salivary flow rate also depends on
behaviour (p>0.05), and 2) disease knowledge have no
the time of measurement. Those variations in 24 hours
effect toward betel nut chewing (p>0.05).
depends on the circadian rhythm. Besides, other factors
Attitude had significant correlation toward intention also contribute, such as age and gender.
as much as 0.278 (p<0.05), while perceived norm also
Several studies recorded that unstimulated normal
had significant correlation toward intention as much
salivary pH ranged from 5.5 to 7.9, the higher pH, the
as -0.191 (p<0.05). Self-confidence significantly affect
higher salivary flow rate (12)(13). Salivary pH is controlled
intention as much as 0.417 (p<0.05). Intention had
significant effect toward betel nut chewing as much as by carbonate/bicarbonate acid system, phosphate system,
0.429 (p<0.05). Oko mama’s culture significantly affects and protein system. A study revealed several rate of
the intention to consume betel nut at 0.454 (p value salivary flow from chewing 4 kinds of betel nut mixture,
0,000). The Oko mama culture significantly affects the and raw areca nut only, which resulted the highest
Behavior of consuming betel nut by 0,316 (p value mean of salivary flow rate recorded was 4.18ml in 10
0,000). The habit of consuming betel nut significantly minutes (11). A decrease of salivary secretion or changes
affects the salivary pH of -0.167 (p Value 0,000). The in saliva properties may also contribute to several oral
habit of consuming betel nut significantly affects and dental problems, that directly affect the quality of
the salivary flow rate of -0,210 (p value 0,000). The life. Some of those problems are speak and eat difficulty,
Behaviour Hypothesis influences the Saliva Flow Rate taste perception changes, increase plaque formation,
in the habit of consuming betel nut analysed by looking increase risk of caries, tooth erosion and periodontal
at the Path Coefficients (table 1). This hypothesis is disease, increase of plaque formation, mucosal irritation,
accepted significantly because Path Behaviour to the halitosis, and candidiasis, also decrease the retention
Saliva Flow Rate has a p-value of 0,000 and the value of full denture. Those aforementioned oral and dental
of t-statistics 3,933 and Path Coefficients -0,210. The problems may also affect general health, since the
hypothesis is accepted because p-value is less than 0.05 affected individual may experience lost appetite, that
and t statistic is more than 1.96. From these results it can leading to malnutrition (14).
be concluded that the Behaviour has a negative effect of
-0.210 on the salivary flow rate. There is a significant correlation between chewing
betel nut with salivary flow rate. A study revealed
Discussion unstimulated salivary flowrate in betel nut chewers
was basically same to those who do not, yet the when
The behaviour of chewing betel nut affects salivary stimulated, the chewer group had a higher flow rate (15).
flow rate, may possibly due to the reduce in salivary This is possibly caused by the increase of sensitivity and
salivary mechanism due to areca nut and tobacco. There to control this phenomenon, and further studies to get a
is an opinion, that this also probably due to salivary better understanding in basic biology, mechanism, and
gland hyperplasia, and masticatory muscle hypertrophy epidemiology of betel nut chewing. This may encourage
in long-term betel nut chewer (16). Besides, oral mucosa the prevention, also, stop the betel nut chewing for
also become more sensitive due to toxic effect of betel nut a better health. Those attempts are betel nut uses
(11)(15)
. However, those changes do not affect masticatory monitoring, continuous educate the society to stop the
efficacy (15)(17). Another study showed that the salivary habit, by utilizing advertisement board, and increase
flow rate and pH of the carious and free-caries subject areca nut tax.
were not significantly different (18). Also no significant
differences of salivary flow rate between those subjects. Conclusion
Enamel demineralization may occur in pH <5.5 (19). The
Oko Mama culture affects intention to chew betel
mean pH of the respondents chewing betel nut was 6.6,
nut, and also affect the behaviour to chew betel nut. The
while those who don’t was 6.78 (18).
betel nut chewing behaviour affects salivary pH and flow
There was a significant correlation found between rate. The habit of betel nut chewing shows a change in
betel nut behaviour with the salivary pH (p=0.000; salivary pH and flow rate. Those changes contribute in
t-statistic 3.617 and path coefficient -0.167). Behaviour the occurrence of oral diseases. Complex behaviour of
had negative correlation to salivary pH (-0.21). The betel nut chewing is reflected in varied salivary pH and
current study found changes of salivary pH and flow flow rate.
rate in betel nut chewer, which may lead to various oral
diseases (20). Betel nut chewing denotes socio-cultural
Acknowledgements
expression (Oko Mama), which significantly affect
the perceived norm (0.931). The importance of culture The authors gratefully thank to the society of
affect how the society will behave. Besides, betel nut Kupang, who had been willing to fill the questionnaire,
chewing also noted as social identifier, to be considered and the enumerators, also the interviewees who had a
as cultured and ethical individual. Some individuals big role in this study.
do betel nut chewing in order to be recognized as the
member of society (21). Conflict of Interest: There is no conflict of interest for
every author.
That the areca nut availability promotes betel nut
chewing behaviour. Since betel nut is easily found Source of Funding: This research funded by itself.
in every household, makes it easier to consume and
mostly the chewer firstly learnt from their parents (22). Ethical Clearance: All procedures performed in studies
That in several cases, betel nut chewing was done due involving human participants were in accordance
to the social pressure, and the desire to be recognised with the ethical standards of the Health Research
(21)
. WHO summarized that betel nut is correlated to oral Ethics Committee Faculty of Public Health Airlangga
cancer prevalence (23). Oral carcinoma due to betel nut University.
chewing denotes aggressive malignancy that required
intensive treatments (24). While the society have not fully Informed Consent: Informed consent was obtained
understood about cancer, thus, this need a long-term from all individual participants included in the study.
attempt of prevention. Betel nut chewing was not an oral
and pharynx potentially malignant disorder (OPMD) REFERENCES
only, but also may be the predisposing factors of other
1. Thavarajah R, Joshua E, Anusa A, Kumar Govind
diseases. The high prevalence of betel nut chewing
G. Health hazards of chewing areca nut and
increase the incidence of hepatic cancer. Besides, betel
products containing arecanut. Calicut Med J.
nut chewing also affect cardiovascular, nervous system,
2005;3(2).
digestive system, metabolism, respiratory system, and
reproductive system (25). 2. Nome Y. Oko Mama as an Timorese Tradition
(Oko Mama sebagai tradisi Orang Timor). Pos
To date, there has not any global policy regarding
Kupang. Kupang, NTT; 2015 Sep 12;
betel nut chewing. Multidisciplinary research is required
3. IARC Working Group on the Evaluation of 16. Ono K, Marimoto Y, Inoue H, Masuda W.
Carcinogenic Risks to Humans. Betel Quid Relationship of The Unstimulated Whole Saliva
and Arecanut Chewing. Other Data Relevant Flow Rate and Salivary Gland Size Estimated by
to an Evaluation of Carcinogenicity and Its Magnetic Resonance Image in Healthy Young
Mechanisms. France: Lyon; 2004. Humans. Arch Oral Biol. 2006;51(4):345–9.
4. Trivedy CR, Craig G, Warnakulasuriya S. The 17. Gomes SG, Custódio W, Cury AA, Garcia RC.
Oral Health Consequences of Chewing Areca Effect of Salivary Flow Rate on Masticatory
Nut. Addict Biol. 2002;7(1):115–25. Efficiency. Int J Prosthodont. 2009;22(2):168–72.
5. Norton SA. Betel: Consumption and Consequences. 18. Ahmadi-Motamayel F, Goodarzi MT, Hendi SS,
J Am Acad Dermatol. 1998;38(1):81–8. Kasraei S, Moghimbeigi A. Total Antioxidant
Capacity of Saliva and Dental Caries. Med Oral
6. Möller I, Pindborg J, Effendi I. The Relation
Patol Oral Cir Bucal. 2013;18(4):553–6.
Between Betel Chewing and Dental Caries. Scand
J Dent Res. 1977;85(1):64–70. 19. Lenander-Lumikari M, Loimaranta V. Saliva and
Dental Caries. Adv Dent Res. 2000;14:40–7.
7. Howden GF. The Cariostatic Effect of Betel Nut
Chewing. Papua New Guinea Med J. 1984;27(3– 20. Kantak Y, Kadashetti V, Shivakumar KM, Baad
4):123–31. R, Vibhute N, Belgaumi U, et al. Consequences
of Habitual Arecanut Chewing on Unstimulated
8. Nigam P, Srivastava AB. Betel Chewing and
Whole Mouth Salivary Flow Rate and pH. Int J
Dental Decay. Fed Oper Dent. 1990;1(1):36–8.
Curr Res. 2017;9(5):51237–40.
9. Garrett JR. The Proper Role of Nerves in Salivary
21. Yvette C. Paulino, Novotny R, Miller MJ, Murphy
Secretion: A Review. J Dent Res. 1987;66:387–
SP. Areca (Betel) Nut Chewing Practices in
97.
Micronesian Populations. Hawaii J Public Heal.
10. Ghezzi EM, Lange LA, Ship JA. Determination 2011;3(1):19–29.
of Variation of Stimulated Salivary Flow Rates. J
22. Murphy KL, Herzog TA. Sociocultural Factors
Dent Res. 2000;79(11):1874–8.
that Affect Chewing Behaviors among Betel Nut
11. Thavarajah R, Mishra G, Elizabeth J, Ranganathan Chewers and Ex-Chewers on Guam. Hawaii J
K. Effect of Habitual Areca Nut Chewing on Med Public Heal. 2015;74(12):406–11.
Resting Whole Mouth Salivary Flow Rate and
23. Bhandary S, Bhandary P. Cancer of The Oral
pH. Indian J Med Sci. 2006;60(3):95–105.
Cavity - a Growing Concern in The Micronesia: a
12. Choo RE, Huestis MA. Oral Fluid as a Diagnostic case report from the Marshall Islands. Pac Health
Tool. Clin Chem Lab Med. 2004;42(11):1273–87. Dialog. 2003;10(1):76–8.
13.
Drobitch RK, Svensson CK. Therapeutic 24. J. M. Carpenter, Syms MJ, Sniezek JC. Oral
Drug Monitoring in Saliva. An Update. Clin Carcinoma Associated With Betel Nut Chewing
Pharmacokinet. 1992;23(5):365–79. in The Pacific: an impending crisis? Pac Health
14. Walsh M, Kuhn S. Developments in Personalised Dialog. 2005;12(1):158–62.
Nutrition. Nutr Bull. 2012;37(4):380–3. 25. Chen P-H, Mahmood Q, Mariottini GL, Chiang
15. Khan GJ, Ishaq M. Salivary Flow Rates in Paan T-A, Lee K-W. Adverse Health Effects of Betel
“Tobacco-Betel-Lime Quid” Chewers. J Med Sci. Quid and the Risk of Oral and Pharyngeal Cancers.
2012;20(1):29–32. Biomed Res Int. 2017;1–25.
Determination Safe Duration of Exposure to Benzene in

Workers of Petrolium Processing Industrial Laboratory in
Indonesia by Using Noael of White Mice (Rattus norvegicus)
Ermita Isnaeni Putri Susyanti1, Abdul Rohim Tualeka1, Pudji Rahmawati2, Syamsiar S Russeng3, Atjo
Wahyu3, Ahsan4, Dewi Kartikasari5
Department of Occupational Health and Safety, Public Health Faculty, Airlangga University, 60115,
1
Surabaya, East Java, Indonesia; 2Department of Development of Islamic Society, State Islamic University
Sunan Ampel, Surabaya, Indonesia; 3Department of Occupational Health and Safety, Public Health
Faculty, Hassanudin University, Makassar, Indonesia; 4Faculty of Nurse, University of Brawijaya,
Malang, Indonesia; 5Department of Environtmental Health, Faculty of Public Health, Diponegoro
University, Semarang, Indonesia
ABSTRACT
Benzene is a volatile liquid aromatic hydrocarbon. Benzene is also used in industries related to oil processing,
one of which is fuel. According to the Agency for Toxic Substances and Disease Register (ATSDR), toxic
chemicals contained in oil includes Policyclic Aromatic Hydrocarbons (PAHs), Total Petroleum Hydrocarbon
(TPH), benzene, ethylene and toluene. Of all these toxin substances, benzene is the most dangerous chemical
and exposure to benzene has a serious impact on human health. As a form of control effort, determining the safe
duration of exposure (Dt) for benzene exposure based on the value of RfC (Reference of Concentration) using
NOAEL (No Observed Adverse Effect Level) of white mice (Rattus norvegicus) is needed. This study aimed
to determine the value of No Observed Adverse Effect Level (NOAEL) of white mice (Rattus norvegicus),
safe limits of toxin dosage for the community or Reference of Concentration (RfC), Risk Quontient (RQ)
and safe duration of exposure (Dt) in laboratory workers. This was a cross sectional, observational, and
descriptive study with 51 samples of PT Pertamina RU IV Cilacap laboratory workers. The object sample
used in this study was the air in the work area of the
main laboratory section and the petrochemical and gas
laboratory of PT Pertamina RU IV Cilacap. The results of this study indicated that safe duration of exposure
(Dt) was 19 years; under normal safe duration of exposure for workers. The safe duration of exposure (Dt)
can be a reference for the relevant company to consider the workers’ working period and reduce the exposure
duration with benzene to prevent significant health impact on workers.
Keywords: Benzene, safe duration, laboratory workers, petroleum processing industry
Introduction
Benzene, C6H6, is a volatile liquid aromatic

hydrocarbon. Benzene’s properties are colorless, volatile,
flammable, and distinctive odors1. PT Pertamina is an
industry in Indonesia that provides fuel to meet the
consumption of the Indonesian people. The products include
Corresponding Author: pertamax plus, pertamax, pertalite, and premium which
Abdul Rohim Tualeka have benzene levels of around 1% - 5%3. Toxic chemicals
Department of Occupational Health and Safety, contained in oil content include Policyclic Aromatic
Public Health Faculty, Airlangga University, 60115 Hydrocarbons (PAHs), Total Petroleum Hydrocarbon
Surabaya, East Java, Indonesia (TPH), benzene, ethylene and toluene.4 Of these toxins,
Phone: +62-31-5920948 benzene is the most dangerous chemical and exposure to
Email: abdul-r-t@fkm.unair.ac.id benzene has a serious impact on human health.
A previous research by Dewi Kartikasari, Nurjazuli, The RfC formula used in this study is 5:
Mursid Rahardjo (2016) determined the value of RfC
(Reference of Concentration) based on established RfC = NOAEL
Animal Km
by IRIS (Integrated Risk Information System) of US- Human Km
EPA by 0.03 mg/m3 or equivalent to 0.0085 mg/kg/ Explanation:
day. The previous study still using references from RfC: Reference Concentration (mg/kg)
research in America or Europe so that they cannot be
NOAEL: No Observed Adverse Effect Level (mg/kg)
used as a reference in determining risk in Indonesia
so that previous study did not obtain RfC value using Animal Km: Km factor on animal
NOAEL (No Observed Adverse Effect Level) of white Human Km: Km factor on human
mice (Rattus norvegicus). Saridewi and Tualeka (2012)
determined the value of RfC by using the formula for Data analysis was carried out quantitatively to
calculating RfC with NOAEL of white mice (Rattus determine the safe duration of benzene exposure in
norvegicus) and RfC value of 0.004mg/kg was obtained. laboratory workers.
Based on previous studies, it is obvious the safe

Findings
duration of toxin exposure in an industry cannot be taken
based on the results of research elsewhere. Therefore, in A. Characteristics of Experimental Animal and
this study, the determination of safe duration of benzene Surface Area of the Experimental Animal
exposure based on RfC by using NOAEL of white (Rattus norvegicus): The general toxicity of
mice (Rattus norvegicus) is explained. The aims of this a compound can be interpreted as a potential
reserarch is to determine NOAEL benzene using of white chemical that causes damage when entering the
mice (Rattus norvegicus), average height and weight of human body6. Toxicity test was carried out using
workers in Indonesia, Reference Concentration (RfC) white mice (Rattus norvegicus) as the research
and safe duration of exposure (Dt). objects or experimental animal. Based on the
weight of white mice (Rattus norvegicus), the
Material and Method body surface area of the animal can be calculated
using the following formula:
This is an observational, cross sectional and
descriptive study. The subjects in this study were all 85 Animal BSA = 0.09 × W0.67
workers in the Laboratory section who worked in the
Main Laboratory of PT Pertamina RU IV Cilacap. The Explanation:
object used in this study was ambient air working area BSA: Body Surface Area (m2)
Laboratory PT Pertamina RU IV Cilacap. The sample W: Weight (kg)
size was 51 workers, while the object sample used in this
study was air in the work area of the Main Laboratory
and Petrochemical and Gas Laboratory of PT Pertamina Table 1: Characteristic Distribution of Experimental
RU IV Cilacap. Animal (Rattus norvegicus)
The variables of this study were the concentration Experimental animal

W (kg) BSA (m2)
of benzene in the work area in the laboratory, body (Rattus norvegicus)
weight of workers, height of workers, respiratory rate of 1 0.1405 0.0241
workers, duration of exposure in a day, body surface area 2 0.1405 0.0241
of workers, weight of white mice (Rattus norvegicus), 3 0.1410 0.0242
body surface of white mice (Rattus norvegicus), highest 4 0.1410 0.0242
dose of toxin without effect on experimental animals 5 0.1395 0.024
(NOAEL), Km factor in animals (Animal Km), Km
6 0.1415 0.0242
factor in human in (Human Km), safe limit of dose of
toxin for the community or Reference of Concentration Total 0.844 0.1448
(RfC), Risk Quontient (RQ) and safe duration of Average 0.1407 0.0241
exposure (Dt) in laboratory workers.
B. Characteristics, Body Surface Area and has identified high-density single nucleotide
Worker’s Respiratory Rate: The characteristics polymorphisms (SNPs. This indicates that the
of workers included in this study were body weight, concentration of benzene in the laboratory work
height, working period and worker breathing rate area of PT Pertamina RU IV Cilacap is above the
in 51 workers of PT Pertamina RU IV Cilacap minimum risk level (MRL) 2.
laboratory. Based on Table 2, the average body
Table 3: Benzene concentration in PT Pertamina RU
weight is 67 kg. The average height of workers
IV Cilacap Laboratory Section
is 159 cm. The surface area of the body and the
respiration rate of the workers were 1.72 m2 and Concentration
Location
the average breathing rate was 0.596 m3/hour. (ppm)
Based on data on workers’ weight and height, the Observation table 1 0.011
body surface area and worker breathing rate can Observation table 2 0.006
be calculated using the following formula: Shelter D 0.169
A. The average body surface rate of the worker KR Room 0.059
Observation table 3 0.139
W×h 67 ×159
BSA = = = 1.72 m2 Observation table 4 0.187
3600 3600 R & D analysis table 0.073
Explanation:
Administration room 0.069
Average 0.09
BSA: Body Surface Area (m2)
W: Weight (kg) D. Animal Km and Human Km

h: Height (cm) 1. Animal Km: Determination of safe dosage of
toxin for workers begins with the calculation of
B. Respiratory rate
Animal Km. Animal Km is obtained by using
5.3 ln W 6.9 5.3 ln 67 6.9
BR = = = 0.596 the following formula:
24 24
Explanation: W animal
Animal Km =
BR: Breathing Rate (m3/jam) BSA animal
Explanation:
W: Weight (kg)
Animal Km: Km factor on animal
W: Experimental animal body weight (white
Table 2: Distribution of Worker Characteristics,
mice or Rattus norvegicus) (kg)
Worker’s Body Surface Area, Employee Respiratory
Rate and Average Duration of Workers in the BSA: Surface area of experimental animals (m2)
Petroleum Processing Industry Laboratory Section Table 4: Calculation of Animal Km in Experimental
Animal of White Mice (Rattus norvegicus)
t (hours/day)
BR(m3/hour)
The number
of sample
BSA (m2)
W (kg)
h (cm)
White Mice
norvegicus)
BSA (m2)
Km (W/
Animal
(Rattus
W (kg)
BSA)
51 67 159 1.72 0.596 8

C. Benzene Concentration: The risk level for 1 0.1405 0.024165 5.814194082
minimum risk level (MRL) is acute exposure 2 0.1405 0.024165 5.814194082
(≤14 days) = 0.009 (0.028 mg/m3), moderate 3 0.1410 0.024223 5.820914007
exposure (15-365 days)) = 0.006 ppm (0.019 mg/ 4 0.1410 0.024223 5.820914007
m3), and chronic exposure (> 365 days) = 0.003 5 0.1395 0.024050 5.8004158
ppm (0.009 mg/m3)2determination of quantitative
6 0.1415 0.024165 5.855576247
trait loci, and phylogenetic comparison. Genome
Average 0.1407 0.024165 5.82
sequencing analysis of inbred mouse strains
2. Human Km: The Human Km calculation is Explanation:

performed by using the following formula:
Ink: Intake the amount of risk agent that an
Human Km =
W human individual receives (mg/kg/day)
BSA human RfC: Reference Concentration (mg/kg)
Explanation :
Human Km: Km factor in humans For the characteristics of non-carcinogenic risks,
W: Human Weight (kg) the risk agent intake received by individuals is
BSA: Body Surface (m2) determined by the following formula:
C × Br × tE × fE × Dt

Tabel 5: The Average of Human Km Wb × tAvg (non carcinogen)
0,09 × 0,596 × 8 × 265 ×12, 55
The number Human Km =
W (kg) BSA (m ) 2 67 × 30 × 365
of sample (W/BSA) = 0, 019 mg/kg/day
15 67 1.72 38.95
Explanation:
E. NOAEL (No Observed Adverse Effect Level):
C:The concentration of toxins in the air that is safe
No Observed Adverse Effect Level (NOAEL).
for workers (mg/m3)
NOAEL benzene is 0.022 mg/kg 7, obtained from
the calculation of the following formula: Br: Breathing rate (m3/hour)
NOAEL Benzene = 3 mg/m3 tE: Daily exposure time (hours/day)
3 × 0.00013 × 8 fE: Frequency of annual exposure (day/year)

NOAEL = = 0.022 mg/kg
0, 1405 Dt: Exposure duration (years)
F.
Reference Concentration (RfC): Reference Wb: Worker’s weight (kg)
concentration according to Shaw et al (2007) in Tavg: Average time period (days/years)
Saridewi and Tualeka (2017) uses the following
formula: Then the RQ calculation is as follows:
Animal Km RQ = Intake/RfC = 0, 019/0,003 = 6, 34 (RQ>1)

RfC = NOAEL
Human Km H.
Safe Duration Of Exposure To Benzene:
Explanation: The safe duration can be determined using the
RfC: Reference Concentration (mg/kg) following formula:
Animal Km: Km factor in white mice (Rattus Dt (safe) =

RfC × Wb × tavg
norvegicus) C × Br × tE × fE
Explanation:
Human Km: Km factor on workers
Dt (safe): Safe duration of exposure for workers
Based on the formula above, the RfC calculation (years)
results obtained from NOAEL, Animal Km
RfC: Reference Concentration (mg/kg)
averages, and the Human Km averages are:
5.82 T avg: Average time (days)
RfC = 0.022 = 0.003 mg/kg
38.9 C: Concentration in air (mg/m3)
G. Risk Quotient (RQ): Health risk characteristics
BR: Breathing rate/working breathing rate (m3/
are expressed as risk levels or risk quotient (RQ)
hour)
for carcinogenic effects 4 8 9 10. RQ calculations)
are obtained by the following formula11 :
tE: Length of exposure time (hours/day)
Ink
RQ =
fE: Frequency of exposure (day/year)
RFc
Then Dt (safe) calculation is as follows: the value safe duration of benzene exposure in PT
Pertamina RU IV Cilacap laboratory work environment
0, 003 × 67 × (30 × 365)
Dt (safe) = = 19 years was 19 years.
0, 09 × 0, 596 × 8 × 265
The results of this calculation can be used as a Conclusion

reference for the relevant companies to control benzene
a. Benzene concentration in the laboratory work area
exposure so that it does not have a health impact on their
at PT Pertamina RU IV Cilacap was 0.09 ppm.
workers.
This is below the threshold value that allowed in
Indonesia according to Permenakertrans No.5/
Discussion MEN/X/2018 on Threshold Value of Physical
Factors and Chemical Factors in the Workplace of
Based on research conducted by Swan et al (2010)
0.5 ppm.
states that NOAEL benzene is 3.0 mg/m³ or its value
is equivalent to 0.022 mg/kg. Based on the results of b. NOAEL Benzene in the laboratory work area of
this study, the calculation of NOAEL benzene value in PT Pertamina RU IV Cilacap was 0.022 mg/kg.
white mice (Rattus norvegicus) is 0.022 m/kg. Thus, the
c. Reference Concentration (RfC) in the laboratory
results of this study are safe for human.
work area at PT Pertamina RU IV Cilacap was
The present study used inhalation route that the 0.003 mg/kg.
response dose for the non-carcinogenic effect used was d. The level of risk was unsafe with RQ value > 1
the Reference Concentration (RfC) value. Benzene RfC
e. The safe duration of exposure to benzene in the
value in this study was carried out by using NOAEL of
laboratory work area of PT Pertamina RU IV
white mice (Rattus norvegicus). The research conducted
Cilacap was 19 years.
by Tualeka AR, Wibrata DA, Ahsan A, et al (2019)
indicated that NOAEL could experimentally determine
doses where there was no statistically significant Recommendation
indications of toxic effects or biological problems.
The safe duration of exposure to benzene for non-
The study conducted by Saridewi and Tualeka (2012)
carcinogenic laboratories at PT Pertamina RU IV
obtained a benzene RfC value using NOAEL of white
Cilacap was 19 years. This figure was smaller than the
mice (Rattus norvegicus) is 0.004 mg/kg. Based on the
normal workers safe duration of exposure of 30 years. To
results of this study, the calculation of benzene RfC
normalize safe duration of exposure, the concentration of
values in
white mice (Rattus norvegicus) is 0.003 mg/
toxin must be minimized to adjust the safe limit of toxin
kg. The value of Benzene obtained in the present study
concentration for workers and daily exposure duration
was smaller than those of Rendy’s (2012) obtained a
was also smaller than 8 hours/day.
benzene RfC value is 0.01 mg/kg. It is also smaller than
the results of a study conducted by Dewi Kartikasari, Conflict of Interest: All author have no conflicts of
Nurjazuli, Mursid Rahardjo (2016) obtained a benzene interest to declare
RfC value is 0.0086 mg/kg. Thus results of this study are
safer for humans by using NOAEL of white mice (Rattus Source of Funding: This is an articel about
norvegicus) as a calculation of RfC. “Determination Safe Duration Of Exposure To
Benzene In Workers Of Petrolium Processing Industrial
Toxins with potential to produce non-cancerous or Laboratory In Indonesia By Using NOAEL Of White
non-carcinogenic effects, the health assessment ratio is Mice (Rattus Norvegicus)” of Occupational Health and
stated by Risk Quotient (RQ) where RQ> 1 is categorized Safety Departmen that was supported by Faculty of
as unsafe or risky 4 10. In the calculation, RQ less than 1 Public Health, Airlangga University.
(RQ < 1) does not affect the body, but RQ value of more
than 1 (RQ > 1) is dangerous11.Therefore, it is necessary Ethical Clearence: The study was approved by
to control the effect by determining the safe duration of the institutional Ethical Board of the Public Health,
exposure (Dt) value. Based on the results of this study, Diponegoro University.
REFERENCES Fundamentals with Applications (Paperback). 1

edition. New Jersey: Prentice Hall; 1997. p. 704.
1. Pillay V. Modern Medical Toxicology. fourth.
New Delhi, India: Jaypee Brothers Medical 11. Tualeka AR. Analisis Risiko: Risk Assessment,
Publishers; 2013. p.378 Risk Management & Risk Communication di
Lingkungan Kerja. Surabaya: Graha Ilmu Mulia;
2.
Agency for Toxic Substances and Disease
2015.
Registry. Toxicological Profile for Benzene.
Atlanta: Agency for Toxic Substance and Disease 12. Dewi Kartikasari, Nurjazuli MR. Analisis Risiko
Registry; 2007. Kesehatan Pajanan Benzene Pada Pekerja Di
Bagian Laboratorium Industri Pengolahan
3. Jakab Z. WHO Regional Office for Europe. WHO
Minyak Bumi. Jurnal Kesehatatan Masyarakat
Europe; 2013
[Internet]. 2016;4:892–9. Available from:
4. ATSDR. Public Health Assessment Guidance rom: http://ejournal-s1.undip.ac.id/index.php/
Manual. U.S. Department of Health and Human jkm%0AANALISIS
Services Public Health Service Agency for Toxic
13. Ramon A. Analisis paparan benzena terhadap
Substances and Disease Registry Atlanta, Georgia;
profil darah pada pekerja industri pengolahan
2005.
minyak bumi. Univ Diponegoro. 2007;
5. Saridewi N, Tualeka AR. Penentuan Konsentrasi
14. Noor Salim R. Analisis Risiko Kesehatan Pajanan
Aman Benzena di Stasiun Pengisian Bahan Bakar
Benzene Pada Karyawan di SPBU X Pancoranmas
Umum (SPBU) di Pancoranmas Depok; 2017;
Depok Tahun 2011. Universitas Indonesia; 2012.
6.
Tualeka AR. Toxicology Industry & Risk
15. Tualeka AR, Wibrata DA, Ahsan A, Rahmawati
Assessment. Surabaya: Graha Ilmu Mulia; 2014.
P, S Russeng S, Wahyu A, et al. Determination
7. EPA. User’s Guide Biomarkers Data Base. USA; of Highest Dose of Ammonia without Effect
2004 p. at Work Environment through the Expression
8. EPA-IRIS. Toxicological Review of Benzene of Interleukin-2 Cell in Rattus Novergicus.
(Noncancer Effect) [Internet]. Available from: Macedonia Journal of Medical Science. 2019;
http://www.epa.gov/iris/toxreviews/0276tr.pdf. p.207.
9. IPCS. International Programme on Chemical 16. Menteri Ketenagakerjaan Republik Indonesia.

Safety of WHO. IPCS risk assessment terminology. Peraturan Menteri Ketenagakerjaan Republik
Harmonization Project Document No. 1; 2004. Indonesia Nomor 5 Tahun 2018; 2018.
10.
Louvar FL and Louvar BD. Health and
Environmental Risk Analysis Volume 2:
Assessment the Relevance of Dental Aesthetic Index, Smile and

Desire for Orthodontic Treatment among Iraqi Teenagers
Esraa S. Jasim1, Zainab M. Kadhom2, Noor F.K. Al Khawaja3

1
Assistant Professor, 2Assistant Lecturer, 3Lecturer, Department of Orthodontics, College of Dentistry,
University of Baghdad
ABSTRACT
Purpose: This study aims to assess the psychological effects of the malocclusion on the emotional state of
Iraqi teenagers through comparison of Dental Aesthetic Index (DAI) to certain aesthetic questionnaires and
assessment of the malocclusion severity for them.
Materials and Method: 248 Iraq students, of 14 and 15 years old from secondary school in Iraq were
selected for this study. The students were interviewed and the clinical data of oral examination were collected
by specialist orthodontist under natural day light using dental vernia taking into account the Research Ethics
Committee rules. The collection of DAI parameters was performed together with aesthetic self-perception
data by ten aesthetic questionnaires.
Results: Of the total sample 37.1% are highly desirable and of mandatory treatment need. The students who
were satisfied with the appearanceof their smilereported to be about 84%., while about (13%) of them were
willing to wear braces.
Conclusions: Dissatisfaction with dental appearance has been noted to be more frequent than the desire
for treatment. The DAI correlate significantly with the subjective assessment that is concerned with dental
appearance and orthodontic treatment need.
Keywords: Dental Aesthetic Index; Dental appearance; Self-perception.
Introduction malocclusion seem to affect satisfaction with one’s dental

appearance, facial appearance, general appearance, and
The previous studies found that malocclusion is perceived attractiveness10. Measuring and recording the
associated with the dissatisfaction with the appearance severity and prevalence of malocclusion can be used as
for a great extent, and negatively affect the quality of an epidemiological tool for preventive procedures or for
life4. Moreover, the self-perception of the level of training orthodontic specialists29.
attractiveness or “The positive” feelings toward the
dentofacial complex is a more important factor the In the 1960s, the occlusal indices were first
contribution to self-conception in teenagers than the introduced to help epidemiological studies. DAI is one
self-perceived severity of the malocclusion alone25. of orthodontic treatment need indices8. Although the DAI
Malocclusion influences the quality of life and is a highly indicate the relative employment and social acceptability
prevalent public health problem18. Particular types of of dental appearance, it is preferable to include the
patient’s own psychosocial view3. The demand for
orthodontic treatment in many populations is related
to their desire to improve their degree of attractiveness
Dr. Esraa S. Jasim
and their appearance11. Most of the orthodontic needs
Assistant Professor, Department of Orthodontics,
questionnaires which have been developed in recent years
College of Dentistry, University of Baghdad,
are used as result measures12. The patient’s perception
Baghdad, Iraq
in many researches has been shown to be not favored
Phone: 009647702999312
with the orthodontist’s point of view; therefore the
Email: israa_salman27@yahoo.com
differences may be found between esthetics perceptions and 100 (40%) females were interviewed and examined.
of laypersons and the orthodontists14,28. A specific privacy for each student was accomplished7.
The aim of this study was to assess the psychosocial Students with mental or physical impairment, with
influence of malocclusion on the emotional state of Iraqi previous history of or currently undergoing orthodontic
teenagers through comparison of the DAI carried out treatment were excluded. Clinical data were collected
by orthodontist on certain ten questionnaires answered through oral examination. The examiner used disposable
by the individual her/himself for evaluation of dental mask, gloves, dental mirrors, periodontal probes and
appearance, satisfaction with smile and desire for dental vernia under natural day light through the window23.
orthodontic treatment, In addition to the assessment of The subjects were asked about their self-perception of
the frequency and severity of the malocclusion among malocclusion using organized questionnaire, noting that
interview agenda was piloted before. The DAI used in
Iraqi teenagers.
the assessment of the malocclusion and treatment needs8.
It includes ten parameters of dentofacial structures:
Materials and Method
{[visible missing teeth x 6] + [Crowding] + [Spacing]
The sample of this study involves Iraqi students of + [Diastema x 3] + [Anterior maxillary misalignment]
14 and 15 years; and the research was confirmed by the + [Anterior mandibular misalignment] + [Anterior
Research Ethics Committee. Ten from 260 secondary maxillary overjet x 4] + [Anterior mandibular overjet x
schools were chosen using simple random technique for 4] + [Anterior vertical open bite x 4] + [Anterioposterior
selection. Of the total of 248 students, 148 males (60%) molar relationship x 3] + 13}.
Table 1: Malocclusion estimation according to DAI
Male = 148 Female = 100 Total

DAI
N (%) N (%) N (%)
No or Slight Treatment Need (Below 26) 33(22.3) 39(39) 72(29)
Elective Treatment (26-30) 52(35.1) 32(32) 84(33.9)
Treatment Highly Desirable (30-35) 24(16.2) 17(17) 41(16.5)
Treatment Mandatory (Above 35) 39(26.4) 12(12) 51(20.6)
The formula classifies dental malocclusion as mild Conted Box 1…

occlusion, definite occlusion and severe or very severe
occlusion as explained in Table (1) 8. While aesthetic 3. Do you like the way your teeth look?
self-perception data was collected through ten questions Yes/No
regarding concerns of self-perceived oral appearance 4. How much do you like the way your teeth look?
which was based upon previous researches investigating
i. Very much
self-perception questionnaire16. The questionnaires are
ii. Quite a bit
listed in Box (1).
iii. Not much
Box 1: The Questionnaire iv. Not at all
1. Do you have a pleasant smile? Yes/No 5. Are your front teeth straight? Yes/No
2. How much do you like the appearance of your 6. How would you consider your teeth as compared
smile? to your entire face?
i. Very much i. One of the nicest features of your face
ii. Quite a bit ii. Better than average feature of your face
iii. Not much iii. Below average feature of your face
iv. Not at all iv. One of the poorest features of your face
Conted Box 1… Result
7. Are your teeth good looking? Yes/No As shown in figure (1): about 29% of the total sample
8. Compared to your classmates and friends how needs no treatment, 33.9% need elective treatment and
do you think your teeth look? 37.1% are highly desirable and of mandatory treatment
i. Among the nicest need, males of highly desirable treatment need are more
ii. Better than average than the females in response to the questions put forth
iii. Below average in the questionnaire, 84% of the students reported to be
iv. Among the worst satisfied with the appearance of their smile, almost 46%
of them agree that their teeth need straightening, also
9. Do your teeth need straightening? Yes/No
53% of them stated that they have better than average of
10. If it were possible would you want to wear teeth appearance when compared with their classmates,
braces to straighten your teeth? the students who felt their teeth to be better than average
i. Definitely No and who felt that their teeth to be below average feature
ii. Probably No of their face is equal (37%) and bout 13% of the students
iii. Probably Yes were willing to wear bracesin order to improve their
iv. Definitely Yes smile. The students who were demanding orthodontic
treatments were about (13%) table (3).
Statistical Analysis: The SPSS computer based software
version 25 was used for descriptive data analysis.
As Shown in table (2): no statistical difference between
Comparison of males and females with DAI scores was
done using t-test. Questionnaire results and DAI scores the answers of males and females in (Q1, Q6 and Q9)
were compared by Chi-square test. while there was a statistical difference between answers
of males and females in (Q3,Q4,Q5,Q7and Q8) and very
P value considered to be: highly significant difference in (Q2) and highly significant
Statistically insignificant (NS) at p > 0.05 difference in Q10. The data from table (3) Compares DAI
* Significant (S) at 0.05 ≥ P > 0.01 with the questionnaire and show no statistical difference
**highlySignificant (HS) at p ≤ 0.01 except in (Q3, Q5, Q9 and Q10). That means the DAI
Intra-examiner calibration to ensure the reliability correlate significantly with the questions that concern the
of the results was accomplished, and the kappa value dental appearance and also with the questions that deal
was 0.67, which indicating good agreement 6. with orthodontic treatment need.
Figure 1: Statistical Analysis of Questionnaire

Table 2: Statistical Analysis of Questionnaire
Questions Q1 Q2 Q3 Q4 Q5 Q6 Q7 Q8 Q9 Q10
Chi-square 3.257 28.056 6.498 10.987 6.221 4.17 3.936 8.873 0.62 12.405
P VALUE 0.071 0.00** 0.011* 0.012* 0.013* 0.244 0.047* 0.031* 0.431 0.006**
Table 3: Comparison of levels of DAI with questionnaire
No or slight Treatment Chi

Elective Treatment
Questions Treatment highly Total Square P Value
Treatment mandatory
need desirable X2
YES 21% 18% 8% 10% 57%
Q 3: 9.43 0.024*
NO 8% 16% 9% 10% 43%
YES 23% 23% 9% 12% 67%
Q 5: 10.552 0.014*
NO 6% 11% 7% 9% 33%
YES 13% 16% 11% 14% 54%
Q 9: 10.69 0.014*
NO 16% 18% 5% 7% 46%
i. Definitely No 16% 13% 5% 6% 40%
ii. Probably No 4% 5% 4% 2% 15 %
Q 10: 20.803 0.014*
iii. Probably Yes 6% 12% 5% 9% 32%
iv. Definitely Yes 2% 4% 3% 4% 13%
Discussion they were more dissatisfied with their smile as compare

with males as in Hamamci et al.13 The idea is that the
The recommended treatment cut off point for self-esteems of females could be affected from physical
DAI was 31; any value below it considered as minor injuries more than that of males30. Simultaneously, the
malocclusion severity and there is no definite need for males believe that their teeth need straightening more
treatment19. The age selected for our study are considered than the females and about 65.6% of them want to wear
to be a pertinent age for perception of personal dental
braces, this disagrees with Birkeland et al.5.
appearance since the realization of body image and
awareness of facial aesthetics increases with the age Our findings showed that there is no significant
and takes priority during late adolescence 15, 23. Our difference in the relationship between DAI and self-
results revealed that 84% of students feel comfortable assessment of relative appearance of teeth by the subjects
and satisfied with their smiles; while it was 83.5% in as compared to their entire face and between this index
India25, and about 23.3% were hiding their teeth while and self-assessment of dental appearance as compared to
smiling in Turkey1. There was no significant difference classmates and friends which comes in agreement with
between DAI and self-satisfaction with smile; this agree Josefsson et al.17. There was a significant correlation
with Nayak et al.23 and come in contrast to the Cons et between DAI and all the questions concerning individual
al.8. Also, there is no significant difference between DAI self-perception23; while the DAI correlate significantly
and self-satisfaction with dental appearance as in Yeh et with questions that concern dental appearance and the
al. 28; but it disagree others23,24. In our study the subjects need for orthodontic treatment.
who were satisfied with the appearance of their teeth are
more than of subjects who were dissatisfied, this come The cultural differences are one possible reason for
in agreement with many studies24,28, but in disagreement different results in these studies, as well as racial factors,
with the Mugonzibwa et al.23 religion, individual characteristics, and unrealistic
anticipation 21.
In contrast with our results, the females in some
studies were more dissatisfied with the appearance of their Different studies reinforced the concept of occlusal
teeth as compared with males19, 23,29. At the same time, problems effects on the adolescent’s life and the
importance of subjective measures to identify the impact teenagers using the Dental Aesthetic Index. East
of negative self-perception of dental appearance which Mediterr Health J.2009; 15:1535-41.
increased a lot with the severity of malocclusion5,7; So
3. Ashari A, Mohamed AM. Relationship of the
if we compare the results of our study with previous
Dental Aesthetic Index to the oral health-related
Iraqi study 2, we found that 37.1% of total sample have a
quality of life. Angle Orthod.2016; 86:337–42.
severe malocclusion which need mandatory orthodontic
treatment while about 27% had severe malocclusion 4. Badran SA. The effect of malocclusion and
and treatment was highly desirable27, in contrast to self-perceived aesthetics on the self-esteem
10.3% of the previous Iraqi study results which is an of a sample of Jordanian adolescents. Eur J
unfortunate outcome after a decade of years of recent Orthod.2010;32:638-44.
advances in dentistry. This could be due to poor health
5. Birkeland K, Boe OE, Wisth PJ. Orthodontic
education programs by the Iraqi Ministry of Health,
concern among 11 year old children and their
large displacement of people from rural areas to the
parents compared with orthodontic treatment need
capital in recent years. The demand for orthodontic
assessed by Index of orthodontic treatment need.Am
treatment was 29% among United States students9 and
J OrthodDentofacialOrthop.1996;110:197-205.
35% among Indian23, while in our research it was 13% as
shown in table (3) that is related to reduction in the level 6. Cicchetti DV. Assessing inter-rated reliability for
of education and health awareness about orthodontics in rating scales resolving some basic issues. Br J
some Iraqi communities. Psychiatry.1976;129:452–6.
7. Claudino D, Traebert J. Malocclusion, dental
Conclusions aesthetic self-perception and quality of life in
1.
Dissatisfaction with dental appearance has an 18 to 21 year-old population: a cross section
been noted to be more frequent than desire for study. BMC Oral Health.2013; 7:13:3.
treatment.
8. Cons NC, Jenny J, Kohout FJ, Songpaisan Y,
2. The subjective assessments of dental appearance Jotikastira D. Utility of the dental aesthetic index
and orthodontic treatment need correlate in industrialized and developing countries. J
significantly with DAI. Public Health Dent.1989; 49:136-6.
3. In this study the subjects’ dissatisfaction does not 9. Cubas YP, Hardy D, Dhillon DK, Orellana MF.
necessarily mean they need orthodontic treatment Effectiveness of training dental students in two
but they have enough conviction about their occlusal indices. J Dent Educ.2012; 76:739-45.
aesthetic and dental appearance with little health
10.
Das UM, Venkatsubramanain, Reddy D.
awareness about orthodontics.
Prevalence of malocclusion among school
Conflict of Interest: No conflict of interest children in BangaloraIndai. Int J clinpediatr Dent.
2008;1:10-2.
Ethical Clearance: Taken from University of Baghdad,
Baghdad, Iraq committee 11. Grzywacz I. The value of the aesthetic component
of the index of orthodontic treatment need in the
Source of Funding: Self assessment of subjective orthodontic treatment
need. Eur J Orthod.203; 25:57-63.
References
12. Grzywacz I. Orthodontic treatment needs and
1. Akarsalan ZZ, Sdek B, Erten H, Karabulut E. indications assessed with IONT. Ann Acad Med
Dental esthetic satisfaction, received and desired Stetin.2004; 50:115–22.
dental treatments for improvement of esthetics.
13. Hamamci N, Başaran G, Uysal E. Dental aesthetic
Indian J Dent Res.2009; 20:195-200.
index scores and perception of personal dental
2. Al-Huwaizi AF, Ali Rasheed T. Assessment of appearance among Turkish university students.
orthodontic treatment needs of Iraqi Kurdish Eur J Orthod.2009; 31:168–73.
14. Hamdan AM. The relationship between patient, 23. Nayak UA, Winnier JSR. The Relationship of
parent and clinician perceived need and Dental Aesthetic Index with dental appearance,
normative orthodontictreatment need. Eur J smile and desire for orthodontic correction. Int J
Orthod.2004;26:265–71. ClinPedaitr Dent.2009; 2:6-12.
15. Hurrelmann K. Human development and health. 24. Onyeaso CO, Aderinokun GA. The relationship
Springer.1989. between dental and aesthetic index and
perceptions of aesthetics, function and speech
16. Jenny J, Cons NC. Establishing malocclusion
among secondary school children in Ibadan
severity levels on the Dental Aesthetic Index
Nigeria. Int J Paediatr Dent.2003; 13: 336-41.
(DAI) scale. Aust Dent J.1996; 41:43-6.
25. Phillips C, Beal KN. Self-concept and the
17. Josefsson E, Bjerklin K, Halling A. Self-perceived
perception of facial appearance in children and
orthodontic treatment need and culturally related
adolescents seeking orthodontic treatment. Angle
differences among adolescents in Sweden.
Orthod.2009; 79:12-6.
EurOrthod.2005; 27:140–7.
26. Pietila T, Pietila E. Dental appearance and
18. Kiyak HA. Dose orthodontic treatment affect
orthodontic services assessed by 15–16-year-old
patients’ quality of life? J Dent Educ.2008;72:886–
adolescents in eastern Finland. Community Dent
94.
Health.1996; 13:139– 44.
19. Maghaireh GA, Alzraikat H, Taha NA. Satisfaction
27. Poonacha KS, Deshpande SD, Shigli AL.Dental
with dental appearance and attitude toward
aesthetic index: applicability in Indian population:
improving of dental esthetics among patients
a retrospective study. J Indian SocPedodPrev
attending dental teaching center. J Contemp Dent
Dent.2010; 28:13-7.
Pract.2016; 17:16-21.
28.
Shue-TeYeh M, Koochek AR, Vlaskalic
20. Manipal S, Mohan CS, Kumar DL, Cholan PK,
V, Byod R, Richmond S. The relationship
Ahmed A, and Adusumilli P. The importance
of two professional occlusal indexes with
of dental aesthetics among dental students
patient’s perception of aesthetics, function,
assessment of knowledge. J Inter SocPrev
speech and orthodontic treatment need. Am J
Community Dent.2014; 4: 48–51.
OrthodDentofacailOrthop.2000; 118: 421-28.
21. Meng X, Gilbert GH, Litaker MS. Dynamics
29. Tin-Oo MM, Saddki N, Hassan N Factors
of satisfaction with dental appearance among
influencing patient satisfaction with dental
dentate adults: 24-month incidence. Community
appearance and treatments they desire to improve
Dent Oral Epidemiol.2008; 36:370-81.
aesthetics. BMC Oral Health.2011; 23:11-6.
22.
Mugonzibwa EA, Kuijpers-Jagtman AM,
30. Vallittu PK, Vallittu AS, Lassila VP. Dental
Van’t Hof MA, Kikwilu EN. Perceptions of
aesthetics: A survey of attitudes in different groups
dental attractiveness, orthodontic treatment
of patients. J Dent.1996; 24: 335-8.
need among Tanzanian children. Am J
OrthodDentofacOrthop.2004; 125:426–33.
Effects of BLS Education Using a Bed on the Quality of Chest

Compression
Eun-Kyung Lee1, Sun-Young Jung1

1
Associate Professor, College of Nursing, Daegu Catholic University, The Research Institude of Nursing Science
ABSTRACT
Purpose: This study aimed to change the teaching method to improve the performance of high quality chest
compression.
Method: A quasi-experimental approach with a nonequivalent control group research design was used. 46
subjects were recruited, and randomly assigned to two groups: the experimental group (23 participants; CPR
performed on a bed) and the control group (23 participants; CPR performed on the floor). One participant of
experimental group did not attend, and thus, 45 participants (22 experimental group and 23 control group)
constituted the study cohort. Results: Results showed that new BLS training method used in this study was
more effective in high quality CPR than previous method.
Conclusion: Nurses may encounter a patient that has experienced on a floor, bed, or any setting, although
student nurses are more like to witness cardiac arrest on a bed.
Keywords: BLS, Education, Chest Compression
Introduction Cardiopulmonary Resuscitation (KACPR), and training

involves demonstrating CPR on mannequins placed on
Medical personnel, especially nurses, must the floor. However, results show that CPR quality is
maintain cardiopulmonary resuscitation (CPR) skills dependent on operator position, that is, whether he/she is
because cardiac arrest often occurs unexpectedly and kneeling on the floor, standing next to the patient’s bed, or
the ability to manage situations directly affects patient kneeling on the bed 5,6,7,8,9,10,11. Also, it has been proposed
survival and outcomes1. During the early stage of that a backboard should be used to perform CPR due to
cardiac arrest, effective CPR (appropriate speed and the different widths and firmness of mattresses 12.
depth of compression, complete relaxation between
compressions, minimization of hands-off time, and As previous mentioned, cardiac arrest in hospital
the avoidance of excessive ventilation) is critical1,2,3,4, occurs suddenly. So, the use of a backboard may be
and therefore, nurses are required to administer CPR difficult. In the present study, we undertook to determine
accurately and effectively. the need for change in the Basic Life Support (BLS)
training method for student nurses by comparing the
Currently CPR training of healthcare professionals quality of chest compression in an experimental group,
is conducted in accordance with the Basic Life in which BLS training was conducted on a bed, to that
Support (BLS) guidelines issued by the American of a control group, in which traditional training was
Heart Association (AHA) and Korean Association of conducted on the floor.
Material and Method

Sun-Young Jung Design: A quasi-experimental approach with a
Daegu Catholic University, nonequivalent control group research design was
Associate Professor, College of Nursing, employed to evaluate the quality of chest compression
33, Duryugongwon-ro 17-gil, Nam-gu, Daegu, Korea after cardiopulmonary resuscitation training course on
Email: syjung@cu.ac.kr the floor as compared with training on a bed.
Sample: Nursing students in the third year of a according to the 2010 AHA and 2015 KACPR CPR
baccalaureate nursing program were chosen as study guidelines. The intervention was administered by the
subjects. The criteria for participation were willingness two authors who had BLS instructor certification issued
to participate in the study and not having BLS provider by AHA and over 5 years of experience teaching BLS.
certification as a health care provider. A priori power
analysis was performed using G*Power 3.1 software Data Collection: Participants’ general characteristics,
with an effect size of 0.8 and a power of 80% (one- heights, weights, and chest compression qualities were
sided test at an alpha value of 0.05), and it showed 21 recorded. Before BLS training, general characteristics
participants were required per group. Assuming a 10% were obtained using self-reported questionnaires and
attrition rate, 46 subjects were recruited, and randomly height and weight were measured using (BSM370,
assigned to two groups: the experimental group (23 15.5kg; Biospace, Korea). Chest compression qualities
participants; CPR performed on a bed) and the control were evaluated using a Resusci Anne Simulator equipped
group (23 participants; CPR performed on the floor). with PC Skillreporting (Laerdal Medical, Stavanger,
One participant of experimental group did not attend, Norway) after the BLS training course. Participants
and thus, 45 participants (22 experimental group and 23 were informed that the evaluation would be based on
control group) constituted the study cohort. the data automatically recorded from the mannequins.
Mannequins were positioned on the bed in the same
This study was reviewed and approved by a
manner as mannequins positioned on the floor.
University Institutional Review Board. After obtaining
approval, general characteristics, heights, weights, and Participants were instructed to complete 5-cycles
chest compression data were measured and recorded. of resuscitation. Chest compression qualities were
Participants were informed at the beginning of the course evaluated according to the 2015 KACPR BLS guideline.
that participation was voluntary and that they could Chest compression qualities were assessed using;
withdraw from the study at any time without prejudice. correct compression (%; compression depth 5-6cm,
Ethical Consideration: This study was approved lower half of the sternum), compression rate (n/min),
by the Institutional Review Board of D university mean compression depth (mm), correct chest recoil (%),
(CUIRB-2016-0014). correct hand position (%), and total hands-off time (sec).
Intervention: The only difference between the two Data Analysis: The analyses were performed using
groups was mannequin’s position. Neither group was IBM SPSS Statistics 19.0. χ or t test for comparison of
2
informed that beds were being used in any training general characters and outcome variables between two
program and in the chest compression test. In accordance groups were used
with norm, the control group was trained on the floor,
whereas the experimental group was trained on a bed Findings
without a step. In order to avoid diffusion between the
two groups, the control group (on the floor) underwent Comparison of general characteristics between
training on the first day of the experiment, and the two groups: Forty-five students were enrolled in our
experimental group (on the bed) were trained on the study(control group: 23, experimental group: 22).
following day; 11 to 12 participants attended one of No significant difference was found between general
two 4-hour training sessions conducted on each day. characteristics, that is, age, sex, CPR education, and
A standard hospital bed frame (SSH-220, 200*70cm, previous chest compression experience, of the experimental
Sungsim) with a foam mattress (185*65*6cm, soft foam and control groups. Furthermore, group mean heights and
with polyester coverage; Sungsim) was fixed at a height weights, which are important variables in the context of
of 50cm. Both groups were trained on other BLS topics chest compression , were not different (Table 1).
9
Table 1: General characteristics of the nursing students (N = 45)
Control (n = 23) Experimental (n = 22)

Characteristics Variables χ2/t p
n(%) or M ± SD
Female 20(87.0) 22(100.0)
Sex 3.08† .23
Male 3(13.0) 0(0.0)
Age 21.83 ± 2.71 20.82 ± 1.18 1.61 .12
Conted…
No 8(34.8) 10(45.5)
Previous CPR education 0.53 .47
Yes 15(65.2) 12(54.5)
No 19(82.6) 18(81.8)
Previous chest compression 0.01† 1.00
Yes 4(17.4) 4(18.2)
Height 162.51 ± 6.42 163.31 ± 5.34 0.46 .65
Weight 55.90 ± 11.53 57.91 ± 6.80 0.71 .48
†: Fisher’s exact test
Comparison of outcome variables between two groups: There were significant differences in correct compression
(t=2.13, p=.039), compression rate (t=3.59, p=.001), and mean compression depths (t=4.26, p<.001). Correct
compression was 64.00 ± 35.26 % among participants of experimental group and 43.96 ± 27.47 % for those of the
control group. Compression rates were 119.86 ± 10.05 times/min and 128.57 ± 5.70 times/min among participants
of the experimental and control groups, respectively. We found mean compression depths were 50.77 ± 6.56 mm and
41.78 ± 7.54 mm among participants of the experimental and control groups, respectively. We found no differences
in other variables between two groups (Table 2).
Table 2: Comparison of outcome variables between two groups (N = 45)
Control (n = 23) Experimental (n = 22) t p

Correct compression (%) 43.96 ± 27.47 64.00 ± 35.29 2.13 .04
Compression rate (n/min) 128.57 ± 5.70 119.86 ± 10.05 3.59 .01
Mean compression depth (mm) 41.78 ± 7.54 50.77 ± 6.56 4.26 <.01
Correct chest recoil (%) 84.17 ± 25.04 94.27 ± 15.41 1.62 .11
Correct hand position (%) 91.57 ± 21.17 81.59 ± 30.32 1.28 .21
Total hands-off time (sec) 10.48 ± 1.44 9.82 ± 1.22 1.65 .11
Discussion of the experimental group was 64.00% and the mean

compression depth was 50.77mm. This indicates that the
Over the last decade, the AHA has emphasized high AHA and KACPR satisfy the chest compression guideline.
quality chest compression during CPR. This study was This suggests that the experimental group is more familiar
attempted to change the teaching method to improve the with chest compression on the bed than the control group.
performance of high quality chest compression. Results In addition, since CPR training is performed on the bed,
showed that new BLS training method used in this study it is possible that the strength of the chest compression
was more effective in high quality CPR than previous needed to attain the recommended depth can be learned
method. by considering the softness of the mattress during the
In this study, group correct compressions and mean training. The percentage of cardiopulmonary resuscitation
compression depths, indicating of proper hand position performed by health care providers has been reported
for chest compression of 5-6cm differed. This result to be inadequate17. The causes of insufficient chest
supports previous reports regarding chest compression compressions vary, but the results of this study suggest
by doctors, nurses, and other medical professionals13,14,15 that CPR training has only been performed at the bottom.
by showing chest compression depends on rescuer For this reason, it is considered that chest compression
position. Rescuers performing chest compressions of sufficient depth was not achieved in a hospital cardiac
experience fatigue and exhaustion after 1 minute, which arrest situation. Therefore, it is recommended that doctors
may reduce chest compression depth16. Although the and nurses examine BLS training in hospitals bed to see if
experimental group and the control group performed there is any change in the quality of chest compressions in
the same 5 cycles of CPR, the correct compression the actual CPR situation.
According to another study, which examined chest seconds). This is an area that requires training to shorten
compression by rescuers of height <170cm and weight hands-off time during chest compression to increase the
<65kg, placing an object 10cm above the floor and chance of patient survival.
below the knee was found to be effective18. In the same
manner, the use of a kneeling board could possibly lead In conclusion, nursing students would be better able to
to higher quality chest compression. cope in the clinical practice were BLS training performed
on a bed. Numerous opinions are held on the quality of
The AHA guideline states that at least hundred or CPR with respect to rescuer positions. We suggest students
more compressions per minute are needed to achieve should receive training and education periodically to
adequate chest compression quality19. In the present increase their abilities and preparedness to perform CPR
study, compression rates of the experimental and control anytime when faced with sudden cardiac arrest.
groups were non-significantly different (119.86 ± 10.05/
min and 128.57 ± 5.70/min, respectively). However, Conclusion
the guidelines issued by the European Resuscitation
Council (ERC) state that the quality of correct release Nurses may encounter a patient that has experienced
is likely to decline if the chest compression rate on a floor, bed, or any setting, although student nurses are
exceeds 120 compressions per minute20. The KACPR more like to witness cardiac arrest on a bed. We suggest
guideline, which comprehensively includes such current BLS training targeting medical professionals
recommendations, endorses a chest compression rate should include both on-the-floor and on-the-bed
of 100 to 120 compressions per minute, which concurs environments and that skills be improved by providing
with our results. The control group had a mean chest guidelines that allow would be rescuers to self-monitor
compression rate of 120 per minute and correct chest the quality of chest compression.
recoil 84.17 ± 25.04%, which was non-significantly
Conflict of Interest: No conflict of interest.
lower than 94.27 ± 15.41% of the experimental group,
this possibly explains why did not amount to a greater Source of Funding: Self
quality chest compression or speed. Furthermore, after
performing chest compression with a mattress, one of Ethical Clearance: Taken from the Institutional Review
the students in the control group commented, “I exerted Board of D university (CUIRB-2016-0014).
more force because of the flexibility of the mattress and
carefully checked for sufficient chest relaxation.” That REFERENCE
is this student was motivated to increase the quality of
1. Kouwenhoven WB, Jude JR, Knickerbocker
chest compression.
GG. Closed chest cardiac massage. JAMA.
No intergroup difference between correct hand 1960;173:1064-1067.
position and total hands-off time were observed. It has
2. Wik L, Steen PA, Bircher NG. Quality of bystander
previously been reported that height difference associated
cardiopulmonary resuscitation influences outcome
with the performance of CPR on a floor or bed affect chest
after prehospital cardiac arrest. Resuscitation.
compression depth and rate, but do not affect proper hand
1994;28:195-203.
position on the sternum21,22 or minimizing hands-off time
to less than 10 seconds23,24,25. Consequently, educational 3.
Wik L, Kramer-Johansen J, Myklebust H,
materials do not need to be modified for different training Sorebo H, Svensson L, Fellows B, et al. Quality
environments, rather emphasis should be placed on of cardiopulmonary resuscitation during out-of-
establishing consistent guidelines. hospital cardiac arrest. JAMA. 2005;293:299-304.
AHA and KACPR emphasized minimizing hands-off 4. Travers AH, Rea TD, Bobrow BJ, Edelson DP,
time17,19. In this study no intergroup difference between Berg RA, Sayre MR, et al. Part 4: CPR overview:
hands off time was observed. However, mean hands-off 2010 American Heart Association Guidelines for
times in the experimental and control groups (9.82 ± 1.22 Cardiopulmonary Resuscitation and Emergency
and 10.48 ± 1.44 seconds, respectively) were near to the Cardiovascular Care. Circulation. 2010;122:S676-
maximum recommended by the AHA and KACPR (≤10 684.
5. Tweed M, Tweed C, Perkins GD. The effect 16. Mandersm S, Geijsel, FE. Alternating providers
of differing support surfaces on the efficacy of during continuous chest compression for cardiac
chest compressions using a resuscitation manikin arrest: Every minute or every two minutes?
model. Resuscitation. 2001;51:179-183. Resuscitation, 2009;80(9):1015-1018.
6. Perkins GD, Benny R, Giles S, Gao F, Tweed 17.
Korea Association Cardiopulmonary Rescue.
MJ. Do different mattresses affect the quality of 2015 Korean Guidelines for Cardiopulmonary
cardiopulmonary resuscitation? Intensive Care Resuscitation and Emergency Cardiovascular
Med. 2003;29:2330-2335. Care. KACPR, 2017.
7. Sebbane M, Hayter M, Romero J, Lefebvre S, 18. Park DS. Effects of knee height of CPR rescuer
Chabrot C, Mercier G, et al. Chest compressions on the quality of chest compression. Journal of the
performed by ED staff: a randomized cross-over Korea Academia-Industrial Cooperation Society.
simulation study on the floor and on a stretcher. 2012;13(4):1699-1705.
Am J Emerg Med. 2012;30:1928-1934. 19. American Heart Association. 2010 American
8. Kim JA, Vogel D, Guimond G, Hostler D, Wang Heart Association guidelines for cardiopulmonary
HE, Menegazzi JJ. A randomized, controlled resuscitation and emergency cardiovascular care.
comparison of cardiopulmonary resuscitation 2010.
performed on the floor and on a moving ambulance 20.
European Resuscitation Council. 2010
stretcher. Prehosp Emerg Care. 2006;10:68-70. European Resuscitation Council guidelines for
9. Perkins GD, Smith CM, Augre C, Allan M, Rogers cardiopulmonary resuscitation and emergency
H, Stephenson B, et al. Effects of a backboard, cardiovascular care. 2010.
bed height, and operator position on compression 21.
Qvigstad E, Kramer-Johansen J, Tømte Ø,
depth during simulated resuscitation. Intensive Skålhegg T, Sørensen Ø, Sunde K, et al. Clinical
Care Med. 2006;32:1632-1635.
pilot study of different hand positions during
10. Chi CH, Tsou JY, Su FC. Effects of rescuer manual chest compressions monitored with
position on the kinematics of cardiopulmonary capnography. Resuscitation. 2013;84:1203-1207.
resuscitation (CPR) and the force odelivered
22. Cha KC, Kim YJ, Shin HJ, Cha YS, Kim H,
compressions. Resuscitation. 2008;76:69-75
Lee KH, et al. Optimal position for external
11. Jantti H, Silfvast T, Turpeinen A, Kiviniemi V, chest compression during cardiopulmonary
Uusaro A. Quality of cardiopulmonary resuscitation resuscitation: an analysis based on chest CT in
on manikins: on the floor and in the bed. Acta patients resuscitated from cardiac arrest. Emerg
Anaesthesiol Scand. 2009;53:1131-1137. Med J. 2013;30:615-619.
12. Nishisaki A, Maltese MR, Niles DE, Sutton RM, 23. Beesems SG, Wijmans L, Tijssen JG, Koster RW.
Urbano J. Backboard are important when chest Duration of ventilations during cardiopulmonary
compressions are provided on a soft mattress. resuscitation by lay rescuers and first
Resuscitation. 2012;83:1013-1020. responders: relationship between delivering
13. Tweed M, Tweed C, Perkins GD. The effect chest compressions and outcomes. Circulation
of differing support surfaces on the efficacy of 2013;127: 1585-1590.
chest compressions using a resuscitation manikin 24. Jost D, Degrange H, Verret C, Hersan O, Banville
model. Resuscitation. 2001;51:179-183. IL, Chapman FW, et al. DEFI 2005: a randomized
14. Perkins GD, Benny R, Giles S, Gao F, Tweed controlled trial of the effect of automated external
MJ. Do different mattresses affect the quality of defibrillator cardiopulmonary resuscitation
cardiopulmonary resuscitation? Intensive Care protocol on outcome from out-of-hospital cardiac
Med. 2003;29:2330-2335. arrest. Circulation. 2010;121:1614-1622.
15. Sebbane M, Hayter M, Romero J, Lefebvre S, 25. Cheskes S, Schmicker R, Christenson J, Salcido
Chabrot C, Mercier G, et al. Chest compressions D, Rea T, Powell J, et al. Perishock pause: an
performed by ED staff: a randomized cross-over independent predictor of survival from out-of-
simulation study on the floor and on a stretcher. hospital shockable cardiac arrest. Circulation
Am J Emerg Med. 2012;30:1928-1934 2011;124: 58-66.
Aerobic and Anaerobic Bacteria in Tonsils of Different Ages

with Recurrent Tonsillitis
Gulbahar F. Karim1, Siham Sh. AL-Salihi2, Qanat Mahmood Atya3, Kasim Sakran Abass4
Department of Basic Nursing Sciences, College of Nursing, University of Kirkuk, Kirkuk, Iraq;
1
2
Medical Laboratory Techniques, Kirkuk Technical College, Foundation of Technical Education, Kirkuk,
Iraq; 3Department of Biology, College of Science, University of Tikrit, Tikrit, Iraq; 4Department of
Pharmacology and Toxicology, College of Pharmacy, University of Kirkuk, Kirkuk, Iraq
Abstract
Background: Tonsillitis is considers one of the most otolaryngological diseases. It might lead to tonsillectomy
if not treated properly.
The Aims: of the current study is to determine the prevalence of chronic tonsillitis caused by bacterial
infection among different age groups of both sexes at Kirkuk City. In addition find out the bacterial load in
the tonsillitis cases, as well as their susceptibility pattern to some common antibiotics. Pat
Method: Two hundred and ten throat swabs were tacked from patients with signs and symptoms of chronic
tonsillitis. The swab samples were cultured on different culture media. The isolates were diagnosed using
laboratory methods for identification of bacteria.
The Results: Revealed a high prevalence of chronic tonsillitis in Kirkuk city and it was more predominant
in female (55.63%). The female to male ratio was 1.2: 1. The most affected age group was (1-10) years old,
constitute (35%) of all participant. There are 160 samples produce positive bacterial growth. The results
showed that Streptococcus pyogenes was the most infectious bacteria associated with chronic tonsillitis
which constitute (41.9 %) of bacterial isolates, followed by Staphylococcus aureus (35.6%), Streptococcus
parasanginus (7.5%), Streptococcus mitis (6.3%), Streptococcus agalactiae (5.6%), and Streptococcus
mutans (3.1%). The results of antibiotic sensitivity test, disc diffusion method revealed that the most isolates
under investigation were found to be multidrug resistant. Since all isolates were resistant 100% to Ampicillin,
followed by high rate resistant to penicillin (82.58%), with moderate resistance to Erythromycin (59.92%),
Amoxicillin- Clavulanic acid (59.68%), and less resistant to Cefotaxime (47.70%), Ceftriaxone (38.08).
However, most of them were highly sensitive to Ciprofloxacin, and Imipenem.
Conclusion: The knowledge about the most likely local infectious microorganisms and their susceptibility
to antibiotics can reduce the chance of chronic tonsillitis.
Recommendation: It is recommended to control throat infections and tonsillitis, this required the availability
of primary care with adequate dose, and course of appropriate antibiotics treatment, which play important
role in the prevention of chronic tonsillitis and its long term squeal.
Keywords: Tonsillitis, Antibiotics, Bacteria, Tonsillectomy, Streptococcus pyogenes.
Introduction
Tonsillitis is the term refer to inflammation of

Corresponding Author: tonsils, which are organs of the immune system, this
Gulbahar F. Karim tissue naturally act as a defense against infection1. The
Department of Basic Nursing Sciences, tonsillitis considers one of the most otolaryngological
College of Nursing, University of Kirkuk, Kirkuk, Iraq diseases, which might lead to tonsillectomy operation for
Email: gfkarim22@gmail.com many patients2. It is usually indicated when there are six
attack or more per year for two successive years. Other Bacteriological Study: The swab samples were cultured
indications of tonsillectomy include; obstructive sleep on Brain heart infusion broth (transport media), Nutrient
apnea, Quinsy, and suspicion of malignancy3. It has the agar and MacConkey agar, then incubated at 37ºC for 24
potential when performed for the proper requirement, as hours. Also, they were cultured on chocolate agar then
infectious indication. The etiological agents of tonsillitis incubated anaerobically in a candle jar at 37ºC for 24-
might be viruses, as Epstein-Barr virus, rhinovirus, 48 hours. The growing colonies were further cultured
on other media as Mannitol salt agar. The pure colonies
adenovirus, parainfluenza, influenza type A, and B. Most
were tested with the gram staining, and biochemical
viruses likely have a role in the development of tonsillitis,
tested for identification of bacteria according to Bergey’s
crypt obstruction, and secondary bacterial infection1.
manual of determinative bacteriology [8], then the
The most prevalent bacteria involved in tonsillitis results confirmed by Api, Staph. and Api Strep. System
were Streptococcus pyogenes that cause sore throat4,5, (BioMérieux, France).
Staphylococcus aureus6, Haemophilus influenza7.
The less frequent microorganisms encountered were Antibiotic Susceptibility Test: All the isolated
different Staphylococcus species, Streptococcus bacterial species were submitted to eight antibiotic
species, and other oral microflora6. Also some species of discs using the disc diffusion method9. The antibiotics
intestinal bacteria were detected by some investigators5 including Ampicillin (AM) 30 mg, Penicillin (P) 10mg,
Amoxicillin-clavulanic acid (AMC), Cefotaxime (CTX)
which might be attributed to oral fecal contamination.
30 mg, Ceftriaxone (CRO) mg, Erythromycin (E),
Multidrug resistant emerged among most of these
30mg, Ciprofloxacin (CIP) 10mg, and Imipenem (IMP)
microorganisms, which may be due to injudicious, and mg, (Oxoid Company). A single colony was transferred
over use of antibacterial therapies without following to 5ml nutrient broth then incubated at 37C° for 24hr.
proper antibiotic policy4. The aims of the present study The inoculum was adjusted to 0.5 McFarland turbidity
is to determine the prevalence of chronic tonsillitis standard solution, then spread evenly with sterile swab
caused by bacterial infection among different age groups on the surface of agar. The standard antibiotic discs were
of both sexes at Kirkuk City. In addition find out the placed at some points in the same Petri dishes then they
bacterial species in the tonsillitis cases, as well as their were stand for 45minutes. Later incubated at 37C° for
susceptibility pattern to some common antibiotics. 24hr. The diameter of zones of inhibition were measured
and interpreted according to9.
Patients and Method The Results and Discussion: Table (1) demonstrates
the distribution of tonsillitis according to gender and
Two hundred and ten throat swabs were tacked from
age groups. It revealed the high rate of chronic tonsillitis
patients with signs and symptoms of chronic tonsillitis, in this city. Also it showed that the chronic tonsillitis
who were attending Azadi Teaching Hospital at Kirkuk was more predominant in female with frequency of 89
City during a period of the 1st of January to the end of (55.63%) than male which include only 71(44.38%)
December, 2017, their genders and ages, were recorded. of total participants. The male to female ratio was
The tonsillar swab was inserted into tonsils’ region for 1: 1.25. Regarding the age, it had been found that the
each patient, carefully rotated there, and then withdrawn most affected age group was (1-10) years old with the
avoiding contaminated with mouth and transported frequency of 56(35%) patients. While the less age group
immediately to laboratory under aseptic condition. were (41-50) years old.
Table 1: Distribution of tonsillitis with positive bacterial culture according to gender and age groups
Male Female Total
Years
No. % No. % No. %
1-10 22 13.75 34 21.25 56 35
11-20 18 11.25 26 16.25 44 27.5
21-30 15 9.38 19 11.88 34 21.25
31-40 5 3.13 9 5.63 14 2.24
41-50 0 0 1 0.63 1 0.63
Total 71 44.38 89 55.63 160 100
The result of present study was in agreement with than that reported by [13] who diagnosed (34.3 and 11.9)
Jamal2 who found in a study on tonsillitis including 200 % of their total isolates from children with tonsillitis in
patients, in which the percentage of females was higher Baghdad was S. parasanginus and S. mitis respectively.
(56.6%) than the males. Also other investigators10 in The less frequent bacterial species encountered through
Baghdad reported the children under fifteen years were present research were S. agalactiae and S. mutans which
more susceptible to tonsillitis than other ages. constitute (5.6 and 3.1) % respectively of total isolates.
These finding were relatively higher than that dictated by
These results might be attributed to increased other authors who observed only (4.2 and 0.7) % of their
activity of children at this age group which enhance isolates were belong to these two species S. agalactiae
the exposure to infection than other ages, In addition to and S. mutans respectively. The finding of varies bacterial
contacting children with each other in kinder garden and species with different frequency in this study may be due
school beside, intrafamelial transmission of infectious to the presence of these microorganisms as normal flora
agents that cause the disease. in the upper respiratory tract, moreover most of them
Table (2) illustrates the frequency and percentages were opportunistic and can cause disease especially in
of bacterial species isolated from infected tonsils. immune compromised patients.
From the two hundred and ten throat samples, 160
samples produce positive bacterial growth. Accordingly Table 2: The frequency and percentages of bacterial
only these samples included in the study. Out of 160 isolates of patient with tonsillitis
samples exhibit positive bacterial growth 67(41.9 %)
of isolated bacteria were S. pyogenes, followed by S. Bacteria No. %
aureus 57(35.6%), S. parasanginus 12(7.5%), S. mitis Streptococcus pyogenes 67 41.9
10(6.3%), S. agalactiae 9(5.6%), and S. mutans 5(3.1%). Staphylococcus aureus 57 35.6
This finding indicated that Lancefield Group A Beta Streptococcus parasanginus 12 7.5
Hemolytic Streptococcus GABHS (S. pyogenes) was Streptococcus mitis 10 6.3
the most infectious bacterium associated with tonsillitis. Streptococcus agalactiae 9 5.6
These results were in accordance with that conducted Streptococcus mutans 5 3.1
by Al-Mousawi11 who showed that 43.69% of his total
Total 160 100
isolates were S. pyogenes from throat swabs of 250 cases
of tonsillitis in Najaf governorate. While the results Table (3) demonstrates the results of antibiotic
of current study was higher than other investigator, sensitivity (disk diffusion method. It showed the most
who were found 37.3% of their total isolates were S. isolates under investigation were found to be multidrug
pyogenes from throat infection of patients with tonsillitis resistant because they were resistant to more than
in Yemen12. This result might be due to many virulence three antibiotics. All isolates were resistant 100% to
factors produced by this bacteria, in addition to climate Ampicillin, followed by high rate resistant to Penicillin
variation. More over easy transmission of these bacteria with moderate resistant rate to Erythromycin and less
by droplet spread, thus close contact between children in resistant to Amoxicillin-Clavulanic acid, Cefotaxime,
school or in large families can increase the risk. and Ceftriaxone. Furthermore, there are some resistant
of isolates were emerged to the other aminopencillin as
S. aureus found to be the second most bacteria isolated
Amoxicillin despite its combination with inhibitor agent
in the present study. This result was in accordance with
called clavulanic acid which increase its activity. These
that reported by Bakir and Ali [6] who revealed that this
results were consistent with previous study conducted
bacteria was the most frequent microorganism, which
by Bakir and Ali6 who showed that the most Gram
constitute 37.7% of their total isolates from tonsillitis
positive bacterial isolates from tonsillitis cases were
cases. This finding due to the fact that S. aureus were
posses many virulence factors that attributed to their highly resistant to Penicillin, and Ampicillin, more over
invasiveness and pathogenicity as well as their resistant most of these bacteria were β-lactamase producers.
to multiple antibiotic agents. These results revealed the that the bacterial isolates
under investigation were confer resistant to Beta-
The percentages of S. parasanginus and S. mitis lactam (β-lactam) antibiotics which include Penicillin,
were (7.5, and 6.3)% respectively. This finding was less Ampicillin, Amoxicillin, Cefotaxim, and ceftriaxone.
This finding might be due to the production of all isolates did not contain the resistant genes, so they
β-lactamase enzymes which hydrolyze β-lactam ring concluded that the resistant to erythromycin could
of β-lactam antibiotics14. In contrast other investigators be due to other causes as structural modification of
reported that there were no β-lactamase enzymes had erythromycin by glycosylation, phosphorelation, or
been produced by their isolates which include 67 bacteria lacton ring cleavage by erythromycin esterase.
belong to β-hemolytic group C and F streptococci
from patients with acute pharyngitis at Hilla city15. There are many mechanisms by which bacteria
They suggested the resistant of their isolated bacteria confer resistance to the antibiotic agents including
to antibiotics attributed to other causes as Alteration of intrinsic impermeability, as well as acquired resistance
β-lactam target enzymes, especially penicillin binding as mutations, plasmids, and transposons18. Furthermore,
proteins. Moreover, Penicillin less effective in eradicating the tonsils with chronic inflammation, and adenoid
GABHS which found to be the most frequent bacteria contain more scar tissues following each infection. In
in the current study because Penicillin have the capacity turn causing an impairment of antibiotic penetrating
to eradicate the normal oropharyngeal flora, especially into the core and become more resistant to antibiotic
α-hemolytic Streptococci which provide an ecological therapies19.
barrier to GABHS infection by producing bacteriocin16. Regarding the Ciprofloxacin and Imipenem, most
Concerning the moderate resistant of the studied isolates were found to be sensitive to these drugs
isolates to Erythromycin in the present study, it might with resistant rate of (2.49 and 2.92) % respectively.
be due to irregular and overuse of this drug without This finding was in agreement with other researchers
performed routine culture and sensitivity of microbes who found the most effective antibiotics, and less
to the drug. This might lead to genetic mutation and resistant against his isolates from tonsillitis cases were
acquire resistant gens to antibiotic. Other researchers17 Ciprofloxacin and Imipenem with resistant of (14.9 and
investigated the molecular screening of erythromycin 17.5) % respectively6. Hence they could be used as drugs
gene of seven strains of S. pyogenes. They improved of choice for treating tonsillitis.
Table 3: Illustrates antibiotic susceptibility pattern of all tested isolates
Bacteria S. pyogenes S. aureus S. parasanginus S. mitis S. agalactiae S. mutans

Antibiotics No. % No. % No. % No. % No. % No. %
AM 67 100 57 100 12 100 10 100 9 100 5 100
P 55 82.09 45 78.94 8 66.67 9 90 7 77.78 5 100
AMC 37 55.22 20 35.08 6 50 8 80 7 77.78 3 60
CTX 37 55.22 49 85.96 5 41.67 7 70 3 33.33 0 0
CRO 41 61.19 45 78.94 1 8.33 8 80 0 0 0 0
E 32 47.76 33 57.89 7 58.33 6 60 5 55.56 4 80
CIP 10 14.92 0 0 0 0 0 0 0 0 0 0
IMP 0 0 10 17.54 0 0 0 0 0 0 0 0
It have been concluded that the disease was tonsillitis, this required the availability of primary care
predominates among female, and (1-10) years old age with adequate dose, and course of appropriate antibiotics
group. The major pathogenic bacteria was S. pyogenes. treatment, which play important role in the prevention of
Furthermore Most isolates were multidrug resistant. chronic tonsillitis and its long term squeal.
Most of isolates under investigation were sensitive to
Ciprofloxacin and Imipenem. Hence, the knowledge Conclusion
about the most likely local infectious microorganisms
and their susceptibility to antibiotics can reduce the The chance of chronic tonsillitis can be reduced by
chance of recurrent tonsillitis and its complications. increase the knowledge about the most likely local infectious
It is recommended to control throat infections and microorganisms and their susceptibility to antibiotics.
Conflict of Interest: None 10. AL-Taei FA, Al-Khafaji JK, Al-Gazally ME.
Characterization of Streptococcus pyogenes
Source of Funding: Self Isolated from Throat Swabs in Baghdad Children
Ethical Clearance: Not required. Patients. Journal of Babylon University/Pure and
Applied Sciences, 2016. 5(24): 1227-1233.
References 11. AL- Mouswi JK, AL-yasiri IK. Bacteriological

and Serological Study of Beta Hemolytic
1. Discolo CM, David H, Darrow DH, Koltai PJ.
Streptococcal Throat Infection Among School
Infectious indications for tonsillectomy. Pediatr
Children In Najaf Governorate. 2007. 3(4): 1-11.
Clin N Am. 2003. 50, 445–458.
12. Sheet MM. Streptococcal throat infection among
2. Jamal SF. Familial tendency of tonsillitis in
Yemeni children. Iraqi Journal of Science, 2009.
patients undergoing tonsillectomy surjery.Tikrit
50, (1) : 2009, PP. 126 – 135.
medical jurnal. 2015. 20(2): 29-35.
3. Sadoh WE, Sadoh AE, Oladipo AO, Okunola OO. 13. Razoki NS, Abdullatef RT. Investigate about
Bacterial isolates of Tonsillitis and Pharyngitis in a tonsillitis caused by Streptococcus spp in children
Paediatric casualty setting. Journal of Biomedical and the effect of lactic acid bacterial isolates on it.
Sciences. 2008. 7 Nos.1 & 2: 2016.
4.
Sharma S. Sh, Praveen Sh. Kh, Sulochana 14. Samatha P, Praveen KV. Prevalance of ESBL mpc
Devi KhS, Sahoo B, Singh WS, and Singh TD. β-Lactamase in Gram negative clinical isolates.
Prevalence of Streptococcus pyogenes infection Journal of Bioscience and Technology, 2011. 2(4):
in children aged between 5 to 15 years with acute 353-357.
tonsillopharyngitis and its antibiogram. Journal of 15. Al-Charrakh AH, Al-Khafaji JK, Al-Rubaye
Dental and Medical Sciences. 2014. 13(11): 50-55. RH. Prevalence of β- Hemolytic Groups C and F
5.
Alnori HA, Kawkab Adris Mahmod KM, Streptococci in Patients with Acute Pharyngitis
Mohammed AAM. Bacteriological, Serological in Hilla City/Iraq. Medical Journal of Babylon,
and Histopathological Study on Tonsillectomy 2010. 7 (4): 526-538.
Specimens. The Iraqi Postgraduate medical 16. Rush C, Simon MW. The effect of amoxicillin-
Journal, 2014. 13(2): 219-225.
clavulanate, cefixime and azithromycin on normal
6. Bakir SH, Ali FA. Evaluation of multi-drug throat flora in children with group A streptococcal
resistance and B-lactamase production in throat pharyngitis. Clin Pediatr. 2003. 42:447-449.
infected by gram positive bacteria. European
17. Ali HN, Maysaa AR, Dhahi MA, Abd AK.
Journal of Pharmaceutical and Medical Research,
Molecular screening for erythromycin resistance
2016. 68-76.
genes in Streptococcus pyogenes isolated from
7. Allos DS, Ramzia HA, Rahaman RHA, AL- Iraqi patients with tonsilo-pharyngites. African
Kharofa WA. Isolation and identification of the Journal of Biotechnology. 2015. 14(28):2244-2250.
bacteria causing acute tonsillitis. Tikrit Medical
18. Gutmann L. Cross-resistance to nalidixic acid,
Journal. 2009. 15(1):100-103.
imethoprim and chloramphenicol associated with
8. George MD, David RB, and Richard WC. alteration in the outer membrane of Klebseilla,
Bergey’s Manual of Systemic Bacteriology. 2nd Enterobacter and seratia. J. Infect. Dis. vol. 1985.
Edition, Springer, New York. 2001. 154,pp. 501-507.
9.
CLSI (Clinical and Laboratory Standards 19. El-Amin NM, Faidh HS. Methicillin – resistant
Institute). Reference method for broth dilution staphylococcus aureus in the western region
antifungal susceptibility testing of yeasts; of Saudi Arabia: prevalence and antibiotic
approved standard third edition; CLSI document susceptibility pattern. Ann Saudi Med. 2012.
M27 A3. Clinical and Laboratory Standards 32:513-16.
Institute, Wayne, PA. 2008.
Estimation of Heritability for Reproductive Traits and

Newborn Mortality in Iraqi Buffaloes through the Relationship
of Dams with Daughters
Hamza M. AL-Khuzai1, Makki K. H. AL-Dulaimi2, Zaid E. H. Zaini1

1
Department of Animal Production, College of Agriculture, University of Kufa, Iraq; 2Technical College of
AL-Mussaib, University of AL-Furat AL-Awsat, Iraq
Abstract
Study was conducted in Um-Khashim region (middle of Iraq) during the year 2018 by using 360 local
buffaloes (180 daughters and 180 dams) in different parity to determine the relationship of daughters
performance with their dams for reproduction and newborn mortality. Regression coefficient was estimate
by determine the daughters regression on their dams for number of insemination, abortion rate, dystocia and
mortality rate at first three months after calving. Heritability was also calculated depending on regression
coefficient. Results showed that vary heritability estimates of the traits that studded, the highest heritability
of the insemination number was in the 1st parity (0.38) while the least heritability was in the 4th parity (0.07).
Due to the abortion rate, the highest heritability was noticed in 4th parity (0.39) compared with the least
heritability which noticed in 7th parity (0.12). Dystocia heritability estimate was 0.38 in the 2nd parity while
decreased to reach to 0.07 in 6th parity. Heritability of mortality rate in 1st month after calving was also
differed by parity, the highest estimation was noticed in 1st parity (0.42) and decreased gradually to reach
0.08 in 5th parity.
Keywords: Buffalo, heritability, reproduction performance.
Introduction Many studies around the world mentioned to

reproductive difficulties in buffalo such as silent estrous,
Buffalo is characterized as the main source of dystocia and early or late abortion, 4,5indicated that
dairy in many countries especially in Asia because the reproductive problems in buffalo caused by varied
more than 95% of global buffalo are found in this environmental factors and lead to heavy economic
continent. Buffalo were found since a very ancient time losses. One of reproductive problems is abortion which
in Mesopotamia region (Iraq) and was domesticated classified as ovular and fetal. Dystocia is the other
by Sumerians and Assyrians people, nowadays there important problem which caused by many factors and
are two species (Reverine and Marshes buffalo) which lead to fetus lose6. Some of studies referred that the
differ morphologically, milk production ability and reproductive problems are resulted from maternal effects,
chromosomes number1,2. There are many challenges
7
indicated that the maternal effects are more important
that prevent the buffalo breeding to blossom in Iraq such than direct gene effects especially in postnatal period.
8
indicated that the buffalo are known to have grater
as the deficiency of food and absence of governmental
incidence of maternal dystocia than the other ruminants
supporting3.
while 9referred to the poor reproductive efficiency of
buffalo daughters depending on their dams performance.
The major aim of this study is to focus on the maternal
effects on reproductive problems in Iraqi buffalo such as
Corresponding Author: high number of service per conception and abortion or
Hamza M. AL-Khuzai dystocia through estimation the regression coefficients
Department of Animal Production, and heritability of these traits for daughters on dams and
College of Agriculture, University of Kufa, Iraq exploit the results as a guidelines in the improving of
Email: hamzabreeding_ 1970@ yahoo.com reproductive performance under farming conditions.
Maternal and Method to estimate the regression coefficients of daughters

performance on dams performance were calculated by
Data were made available from 360 buffaloes (180 the formula:
daughters and 180 dams), in different parity and reared
in classical system in the year 2018. The region of study (Xi )(Yi )
XiYi
is known Um-Khashim which located in AL-Najaf n
b=
province –middle of Iraq. 2 (Xi )
2
Xi
Experimental Animals: Animals were reared under n
farming conditions as a herds with different size. Natural where :
insemination is used and the herds are fed on concentrate
x:Dams performance
rations contains from wheat barn and quern cereals.
Roughage food contains mainly from rice hay in addition y:Daughters performance
to green food such as alfa alfa or clover according season. Heritability for all traits that studded was estimated:
In summer, animals were fed on water plants such as h2 = 2b
cane and bulrush as a cheap and bulk food. Vaccines and
veterinary process were made routinely and the milking Results
buffaloes were milked manually twice a day.
Results represented in (table -1) showed a
Number of inseminations per conception, abortion significant estimates (P<0.05) of regression coefficient of
rate, dystocia rate and mortality rate in first three insemination number during the first three parities namely,
months after calving were determined for both dams 0.19, 0.17 and 0.13 respectively while the regression
and daughters. Statistical Analysis System10 was used coefficients were not significant in 4th – 7th parity.
Table 1: Regression coefficients of daughters on dams for many traits in Iraqi buffaloes
Regression coefficient (b)

Parity No. of Abortion (%) Mortality of calves after calving (%)
Dystosia (%)
inseminations rate 1st month 2nd month 3rd month
1st 0.19* 0.18* 0.16* 0.21* 0.18* 0.17*
2nd 0.17* 0.15* 0.19* 0.20 * 0.15* 0.19*
3rd 0.13* 0.19* 0.06 0.18* 0.18* 0.15*
4th 0.04 0.20* 0.08 0.15* 0.20* 0.18*
5th 0.07 0.10 0.09 0.04 0.18* 0.16*
6th 0.09 0.07 0.04 0.08 0.16* 0.06
7th 0.06 0.06 0.11 0.14* 0.12 0.05
* (P<0.05)
Regression of abortion rate was significant in the first 0.17, 0.19, 0.15, 0.18, 0.16 respectively. Results in (Table
four parity namely 0.18, 0.15, 0.19 and 0.20 respectively -2) shoed the heritability estimates of the traits studded,
while no significant regression in the 5th, 6th and 7th parity. the highest heritability of the insemination number was
Regression of dystocia of daughters on their dams was in the 1st parity (0.38) while the least heritability was in
significant in 1st and 2nd only (0.16 and 0.19) compared the 4th parity (0.07). Due to the abortion rate, the highest
with the other parities. Results showed that a significant heritability was noticed in 4th parity (0.39) compared
regression coefficients (P<0.05) of mortality rate the with the least heritability which noticed in 7th parity
1st month after calving in 1st, 2nd, 3rd, 4th and 7th parity (0.12). Dystocia heritability estimate was 0.38 in the
namely, 0.21, 0.20, 0.18, 0.15 and 0.14 respectively and 2nd parity while decreased to reach to 0.07 in 6th parity.
a significant regression in the 2nd month after calving for Heritability of mortality rate in 1st month after calving
all parities except 7th parity (0.18, 0.15, 0.18, 0.20, 0.18 was also differed by parity, the highest estimation was
and 0.16 respectively) while a significant coefficient in noticed in 1st parity (0.42) and decreased gradually to
3rd month after calving in the 1st to 5th parities namely, reach 0.08 in 5th parity.
Table 2: Heritability estimates for many traits in Iraqi buffaloes
Heritability (h2)
Parity No. of Abortion (%) Mortality after calving (%)
Dystocia (%)
inseminations rate 1st month 2nd month 3rd month
1st 0.38 0.36 0.31 0.42 0.35 0.33
2nd 0.33 0.30 0.38 0.39 0.30 0.38
3rd 0.25 0.37 0.12 0.36 0.36 0.29
4th 0.07 0.39 0.15 0.29 0.39 0.35
5th 0.14 0.19 0.17 0.08 0.36 0.31
6th 0.17 0.14 0.07 0.15 0.32 0.12
7th 0.11 0.12 0.22 0.28 0.24 0.10
In 2nd month after calving, heritability estimate of Conclusion

mortality rate was 0.39 in 4th parity compared with 0.24
in 7th parity. The heritability estimates of mortality rate The results of current study providing the link
in the 3rd month after calving was in the same direction, between maternal effect and some of reproduction
the highest value was noticed in 2nd parity compared problems in Iraqi buffalo and we can exploit this
with the 7th parity namely 0.38 and 0.10 respectively. relationship to improve animals under farming
conditions.
Discussion Conflict of Interest: None
The results of present study indicated that the Source of Funding: Self
genetic relationship of dams and daughters are strong
in the beginning of life and trend to decline with the Ethical Clearance: Not required.
progress of age. The results came hormonal with others
past studies that referred to the decrease of maternal Reference
effect with age progress. 11reported that the estimate
of heritability based on daughters regression on dams 1. Borghese I, Mazzi M. Buffalo Population and
performance for reproductive traits were high in early Strategies in the World. Pages 1–39 in Borghese,
parity compared with late parity in Egyptian buffalo. A. (ed.) Buffalo Production and Research. REU
12,13
showed that the regression estimation is an efficient Technical Series 67. Inter-regional Cooperative
tool to estimate the genetic effect of dams on daughter Research Network on Buffalo, FAO Regional
performance. 14,15reported that the maternal effect are Office for Europe, Rome. 2005.
modulate offspring performance through the causal 2. Gurcan EK, Tuna YT, Soysal MI. The morphometric
influence of dam genotype on her daughters. Results
characterization of Anatolian water buffalo
showed a that the abortion rate and newborn mortality
according to body measurements, J. of Tekirdağ
in daughters are correlated with dams status therefore,
Agricultural Faculty, 2011. 8(2): 143- 152.
we can predict of daughters status depending on their
dams and select the best individuals to be dams in next 3. AL-Saedy JKJ. Iraqi buffalo now. Italian Journal
generation. Most of studies referred that the abortion or of Animal Science, 2007. 6:sup2, 1234-1236,
calve mortality are resulted from environmental causes DOI: 10.4081/ijas.. s2.1234.
such as diseases, poor food and bad management16
4. Suthar VS, Dhami AJ. Estrus detection methods
and ignore the genetic relationship between dam and
in buffalo. Vet. World, 2010. Vol. 3(2): 94-96.
daughter. Many studies reported that we can exploit the
genetic parameters such as heritability for selection and 5. Sarfaraz NS, Khuda BM, Hidayatullah S, Hakim
improving but the accuracy of estimation depends on the S. prevalence of abortion in kundhi buffalo in
amount and quality of primary data17. Therefore, we can district hyderabad, sindh–Pakistan. Herald Journal
find a vary estimates of heritability in different studies of Agriculture and Food Science Research, 2013.
for the same traits. Vol. 2 (1): 070 – 077.
6. Galiero G. Causes of infectious abortion in the 12. Schaeffer LR, Jamrozik J. Random regression
Mediterranean buffalo. Italian Journal of Animal models:A longitudinal perspective. J. Anim.
Science. 2007. 6(2): 194-199. Breed. Genet. 2008. 125:145–146.
7. Guimarães JE, Paulo PS, Robledo A, Luiz O, 13. Sesana RC, Biganardi AB, Borquis RA, Faro LE,
Ricardo F, Cláudio V, Carmen S. Maternal effects Baldi F, Albuquerque LG, Tonhati H. Random
on the genetic evaluation of Tabapuã beef cattle. regression models to estimate genetic parameters
Genetics and Molecular Biology, 2004. 27, (4): for test-day milk yield in Brazilian Murrah
517-521. buffaloes. J. Anim. Breed. Genet. 2010, 127:369
–376.
8. Purohit GN, Yogesh B, Chandra S, Pramod K.
Maternal dystocia in cows and buffaloes: a review. 14. Fouqueray T. Maternal effects modulate offspring
Journal of Animal Sciences, 2011. 1: 41-53. development and population dynamics in the
wild. Bio Science. Master Reviews. 2013. 1-7.
9. Imran I, Maryam J, Asif N, Madiha I. Pretentious
genomic selection signatures in CYP19A1 15. Khatun MR, Arifuzzaman M, Ashraf A. A
gene associated with silent estrous behavior in Comparative Analysis on Factors Affecting
water buffalo in Pakistan. Electronic Journal of Calf Mortality of Buffalo in a Breeding Farm.
Biotechnology. 2018. 32: 35-40. Pakistan J. of Bio. Sci. Volume 2009. 12
(23): 1535-1538.
10. SAS. SAS/STAT Ùsers` Guide for Personal
Computers. Release 6.12. SAS Institute Inc., 16. Tonhati H, Fasconcellos FB, Albuquerque LG.
Cary, NC., USA. 2012. Genetic aspects of productive and reproductive traits
in a Murrah buffalo herd in São Paulo, Brazil. J. of
11. Nessim MG. Heat-induced biological changes
Anim. Breed. And Gent. 2018. 117(5):331 – 336.
as heat tolerance indices related to growth
performance in buffaloes. Ph.D. Thesis, Faculty
of Agriculture, Ain-Shams University, Cairo,
Egypt. 2004.
Effect of Thyroid Hormone Abnormalities on Hemoglobin A1c

in Hemodialysis Patients Taking Erythropoietin
Hanan L. Al-Omary1, Zainab M. Alawad2, Buraq Husseini3

1
PhD, Assistant Professor, 2MSc, Assistant Lecturer, Physiology Department, College of Medicine, University of
Baghdad; 3MSc, Assistant Lecturer, Doctor, Department of Anesthesia Techniques, Al-Nisour University College
Abstract
Background: Hemoglobin A1c (HbA1c) is a widely used test for glycemic control. It is done for chronic
kidney disease (CKD) patients. Renal disease is accompanied by thyroid abnormalities, which affect HbA1c,
especially in those taking erythropoiesis-stimulating agents (ESAs). We aimed to find the effect of thyroid
dysfunction on HbA1c in hemodialysis patients taking ESAs and those who do not.
Materials and Method: Fifty six patients were included in this study, which was done between September
2017 and June 2018, in Baghdad Teaching Hospital. Thyroid stimulating hormone, free T3, free T4 and
HbA1c measurements were done. The patients were divided into 2 groups; those who took ESAs and those
who did not, then they were subdivided into those with hypothyroidism and hyperthyroidism according to
the Body mass index (BMI).
Results: Comparing HbA1c levels in hemodialysis patients taking ESAs and those who did not, showed no
significant difference (5.79 ± 1.91 vs. 6.19 ± 1.64, P=0.09). The difference was also not significant in both
hypothyroid and hyperthyroid patients in both high and low BMI patients. The only significant difference in
HbA1c was between hyperthyroid and hypothyroid patients in those not taking ESAs, and having low BMI
(4.97 ± 1.36 and 7.51 ± 0.87 respectively, P=0.02).
Conclusion: There is no significant influence of thyroid hormone changes on HbA1c levels in hemodialysis
patients taking and not taking ESAs.
Keywords: Hemoglobin A1c, Chronic kidney disease, Thyroid dysfunction, Hemodialysis, Erythropoiesis-
stimulating agents.
Introduction development and for preserving water and electrolyte

homeostasis. The kidney is responsible for THs
Chronic kidney disease (CKD) is a universal metabolism and excretion.4 In CKD, level of thyroid
problem causing great burden on the health system.1 It hormones is usually aberrant.3 Different changes occur
is a prevalent state that influence more than fifty million in the thyroid gland, these involve decreased thyroid
people worldwide.2 A lot of endocrinological deviations hormone levels in the circulation, changed metabolism
followed it, although pathogenesis is not settled yet.3 of peripheral hormone, reduced attaching to carrier
Thyroid hormones (THs) are mandatory for kidney proteins, potential decrease in hormone content in
tissues, and a rise in iodine storing in the thyroid gland.
Iodine excretion in urine decreases in CKD, which
increasing inorganic iodine in the presence of iodine in
Corresponding Author: the thyroid gland, which then makes the gland larger.5
Zainab M. Alawad
MSc, Assistant Lecturer, Physiology Department, Although the occurrence rate of hyperthyroidism is
College of Medicine, University of Baghdad nearly the same in end stage renal disease (ESRD) patients
Bab Al Muadam P.O.Box 61023, and normal individuals, hypothyroidism is noticed in
Mail Code 12114, Baghdad–Iraq 3.4% of ESRD patients and 0.6% of normal individuals.
Email: zainabm.alawad@gmail.com This increased occurrence of hypothyroidism in ESRD
illustrates that searching for thyroid abnormal function, The research was in accordance with the ethical
must be taken into account in assessing ESRD patients.5 standards of Helsinki Declaration of 1975, as revised
in 2000. Informed consents were taken from the
Thyroid hormones encourage erythrocyte formation,
participants.
and hypothyroidism generally leads to hypoproliferative
erythropoiesis. Moreover, thyroid hormones stimulate Demographic data, height, weight, smoking
albumin metabolism, and its destruction is decreased in condition, and medications history were recorded.
hypothyroidism. The cases which influence erythrocyte
production cause incorrect increase or decrease in The body mass index (BMI) was measured, a patient
HbA1c.6, 7 with BMI of ≥ 25 was considered obese, and a patient
with BMI of <25 was considered non obese.13
HbA1c is made up by the permanent attachment
of glucose to hemoglobin across the lifetime of the red Blood (ten ml) was withdrawn, 5 ml was sent for
blood cells,8 and it constitutes about 60% to 80% of the HbA1c measurement and 5 ml was centrifuged and the
glycated hemoglobin. In a hyperglycemic state, beta-
serum was frozen then analyzed for free T3, free T4 and
chain of the hemoglobin increases glycation, making the
TSH.
assessment of HbA1c beneficial.9
HbA1 was analyzed within 24 hours of collection
The American Diabetes Association (ADA)
suggested the measurement of HbA1c for diagnosing (refrigerated when not measured directly) by an
diabetes and pre-diabetic state. It is the most approved automated high-performance liquid chromatography
method for evaluating chronic glycemia in diabetic analyzer (ion-exchange chromatography) (HLC-723
patients.10 Low HbA1c levels, which are not because of G7; Tosoh Corporation, Tokyo, Japan or the Menarini
lack of proper nutrition or anemia, were related to better HA-8160 A1C analyser). Free T3 (FT3) and free T4
survival in hemodialysis patients.8 An Updated study (FT4) were determined by fluorimmunnoassay method
found that HbA1c levels may show an underestimated and TSH by immunoradiometric assay (IRMA).
glycemic control results in diabetic patients on
hemodialysis.11 All patients were on hemodialysis for 4 hours/3
times a week. The participants were divided into two
Although some studies reported that erythropoietin groups, those who were on ESAs treatment (number=27)
intake might influence HbA1c in hemodialysis patients, and those who were not (number=29), then they were
this condition is not proved in people with CKD not on
subdivided into high BMI patients (number=30), and
hemodialysis schedule.12
low BMI patients (number=26) and into hypothyroid
We aimed to find the effect of thyroid dysfunction on (number=31) and hyperthyroid (number=25) patients.
HbA1c in hemodialysis patients taking erythropoiesis-
stimulating agents (ESAs) and those who do not. All participants taking ESAs had hemoglobin ≤10.5
g/dl and were considered iron, vitamin B12, and folate
replete before starting the treatment. Patients were
considered iron replete after a serum ferritin level of
Fifty six participants were included in this >200 μg/l or have taken intravenous iron at least 6 weeks
prospective study during the period between September before ESAs treatment. Darbepoetin α (Aranesp) was
2017 and June 2018. They were thirty four females aged given at 750 nanograms/kg (or 60 U/kg as intravenous
36.82 ± 14.46 years and twenty two males aged 47.39 ± bolus injection after each dialysis session) every two
14.17 years. The data were collected from the dialysis weeks and continued during study duration. ESAs dose
unit of Baghdad Teaching Hospital. was adjusted every month till reaching hemoglobin
The patients enrolled were those with ESRD on value of 10.5–12 g/dl.
regular hemodialysis, some of them were taking ESAs Measurement of HbA1c in those taking ESAs was
for at least four months.
done after at least 4 months of the treatment.
Exclusion criteria: Diabetic patients, patients having
The guidelines of the 2005 National Kidney
hemoglobinopathy, and patients taking treatment for
Foundation Kidney Disease Outcomes Quality Initiative
thyroid dysfunction.
did not obviously confirm a target HbA1c level for diabetic Statistical Analysis: Statistical analysis was done by
and ESRD patients, but levels of 6-7% was accepted.14 The SPSS 20.0. Values were in mean ± standard deviation
ADA considered HbA1c levels <5.7% as normal, 5.7- 6.4% and using Independent samples T test where appropriate.
as the pre-diabetic level and ≥6.5% as the diabetic level.15 A P value less than 0.05 was considered significant.
Results
There were no significant differences between males and females regarding age and BMI (Table 1).
Table 1: Age and BMI of hemodialysis patients
Males (number = 22) Females (number = 34) P

Age (years) 47.39 ± 14.17 36.82 ± 14.46 0.13
BMI (Kg/m2) 26.14 ± 8.81 26.72 ± 10.30 0.08
BMI = Body mass index
Regarding HbA1c level, it was non-significantly higher in patients who did not take ESAs (Table 2).
Table 2: HbA1c in patients taking ESAs and patients not taking ESAs.
Patients taking ESAs (number = 27) Patients not taking ESAs (number = 29) P
HbA1c (%) 5.79 ± 1.91 6.19 ± 1.64 0.09
ESAs= Erythropoiesis-stimulating agents
Table 3 shows the differences in HbA1c level between hyperthyroid patients taking and not taking ESAs with high
and low BMI, HbA1c is higher in patients not taking ESAs in both groups of patients with high and low BMI, but these
differences are not statistically significant. Patients with hypothyroidism who were taking ESAs had less HbA1c levels
than those not taking ESAs in both high and low BMI groups, but the difference was also not significant (Table 3).
Table 3: HbA1c in hypothyroid and hyperthyroid patients in those taking ESAs and those who were not in
both high BMI and low BMI groups
High BMI patients (number = 30) Low BMI patients (number = 26)
Patients taking Patients not Patients taking Patients not
ESAs taking ESAs P ESAs (number taking ESAs P
(number = 8) (number = 9) = 7) (number = 7)
HbA1c (%) in
hypothyroid
5.93 ± 2.03 8.14 ± 1.06 0.18 5.91 ± 2.48 7.51 ± 0.87 0.17
patients
(number = 31)
Patients taking Patients not Patients taking Patients not
ESAs taking ESAs P ESAs taking ESAs P
(number = 6) (number = 7) (number = 6) (number = 6)
HbA1c (%) in
hyperthyroid
6.32 ± 2.40 7.34 ± 1.84 0.12 4.8 ± 0.25 4.97 ± 1.36 0.15
patients
(number = 25)
ESAs= Erythropoiesis-stimulating agents; BMI= Body mass index
No significant differences were found in HbA1c between hyperthyroid and hypothyroid patients taking ESAs or
not with high BMI although it was slightly higher in hypothyroid patients not taking ESAs, Table 4.
Table 4: The differences of HbA1c between hypothyroid and hyperthyroid high BMI patients in those taking
ESAs and those who were not
Patients with high BMI not taking ESAs Patients with high BMI taking ESAs
(number =1 6) (number = 14)
Hyperthyroid Hypothyroid Hyperthyroid Hypothyroid
P P
HbA1c (%) 7.34 ± 1.84 8.14 ± 1.06 0.27 6.32 ± 2.40 5.93 ± 2.03 0.19
ESAs= Erythropoiesis-stimulating agents; BMI= Body mass index
A statistically significant difference was shown in HbA1c in participants not taking ESAs with low BMI between
hypothyroid and hyperthyroid patients being higher in hypothyroid group (P=0.02) whereas this difference was not
significant in patients taking ESAs (Table 5).
Table 5: The difference of HbA1c between hypothyroid and hyperthyroid low BMI patients in those taking
ESAs and those who were not
Patients with low BMI not taking ESAs Patients with low BMI taking ESAs
(number = 13) (number = 13)
Hyperthyroid Hypothyroid Hyperthyroid Hypothyroid
P P
HbA1c (%) 4.97 ± 1.36 7.51 ± 0.87 0.02 4.8 ± 0.25 5.91 ± 2.48 0.09
ESAs = Erythropoiesis-stimulating agents; BMI = Body mass index
Discussion when erythrocytes have normal lifespan. Patients on

dialysis have shorter red cell survival; which reduces
HbA1c may be influenced by the severity of kidney the needed time for sugar to bind with hemoglobin, and
malfunction.2 This study found that HbA1c level is lower resulting in lower HbA1c levels.17 It was shown that
in patients taking ESAs than those who did not, however hemodialysis patients treated with erythropoietin have a
the difference was not significant. transient reduction in HbA1c.12
In hemodialysis patients, blood loss during No significant differences were found in HbA1c
treatment and multiple blood tests cause reduction of between hyperthyroid patients taking ESAs and those
erythrocytes survival. Shortened red blood cell survival, who were not whether they have high or low BMI,
the transfusion of blood and erythropoietin also decrease although the level is higher in patients not taking ESAs.
HbA1c.11 This agrees with Ng et al, 8 who found a The same results were obtained in hypothyroid patients.
reduction of HbA1c in patients treated with ESAs and HbA1c was higher in those with high BMI, this was in
iron therapy. The decrease of the HbA1c after ESAs or accordance with other researchers.18,19 However, Iso et
iron has been thought to be due to the production of new al,20 and Koga et al,21 found no association between BMI
erythrocytes, leading to disturbance of young to old cells and HbA1c.
percentage, in addition to a change in red-cell glycation
rates.8 Nakao and team mentioned a decrease in HbA1c Hypothyroidism and hyperthyroidism, cause
in non-diabetic patients with CKD on hemodialysis after changes in kidney function, and reticulocyte production.
ESAs treatment. This reduction was higher compared HbA1c was non-significantly different between
with our results, which could be explained by the fact hyperthyroid and hypothyroid patients in high BMI
that iron therapy when given at the same time, most group whether in those taking ESAs or not. But the
likely stimulated HbA1c lowering action.16 difference was significant between hyperthyroid and
hypothyroid patients in the group of low BMI and was
Blood sugar binds with the hemoglobin to pinpoint not taking ESAs, where it was higher in hypothyroid
a level for HbA1c. But, HbA1c results are only correct patients. This agrees with Kim and co-workers who
found that HbA1c is spuriously high in non-diabetic in Patients with Chronic Kidney Disease - A
patients with overt hypothyroidism.6 HbA1c was higher Prospective Study. Int J Sci Study. 2017;5:68-72.
in hypothyroid patients than control subjects, and its
4. Iglesias P, Diez JJ. Thyroid dysfunction and
levels were reduced by thyroid hormone treatment. THs
kidney disease. Eur J Endocrinol. 2009;160:503-
potentiate erythrocyte formation, and hypothyroidism
515.
mostly causes hypoproliferative erythropoiesis,22 THs
replacement increases erythropoietin, reticulocyte count, 5. Lee SY, Chang DL, He X, Pearce EN, Braverman
and mean corpuscular hemoglobin (MCH). The change LE, Leung AM. Urinary iodine excretion and serum
in HbA1c value has a significant negative correlation thyroid function in adults after iodinated contrast
with the change in reticulocyte count or MCH. All administration. Thyroid. 2015;25:471-477.
the above suggests that thyroid hormone treatment is 6. Kim MK, Kwon HS, Baek KH, Lee JH, Park WC,
accompanied by a reduction of HbA1c.6,23 Whereas, Sohn HS, et al. Effects of thyroid hormone on
Ford and team reported a significant increase in HbA1c A1C and glycated albumin levels in nondiabetic
in the hyperthyroid group due to alterations of glycemic
subjects with overt hypothyroidism. Diabetes
regulation in most hyperthyroid patients.24
care. 2010;33:2546-2548.
The limitation is a relatively small sample size 7. Beltran del Rio M, Tiwari M, Amodu LI, Cagliani
as it was hard to find patients with thyroid problems J, Rodriguez Rilo HL. Glycated hemoglobin,
especially hyperthyroid ones who have renal problems. plasma glucose, and erythrocyte aging. J Diabetes
Sci Technol. 2016;10:1303-1307.
Conclusion
8. Ng JM, Cooke M, Bhandari S, Atkin SL, Kilpatrick
There is no significant difference in HbA1c level ES. The effect of iron and erythropoietin treatment
between hemodialysis patients who were taking ESAs on the A1C of patients with diabetes and chronic
and those who were not, in the hyperthyroid and kidney disease. Diabetes Care. 2010;33:2310-2313.
hypothyroid patients having high and low BMI although 9. Hill AN, Appel SJ. Diagnosing diabetes with A1C:
it was lower in the treatment groups. The only significant implications and considerations for measurement
difference in HbA1c was found between hyperthyroid and surrogate markers. The Nurse Practitioner.
and hypothyroid patients who were not taking ESAs and 2010;35:16-23.
with low BMI being higher in the hypothyroid group.
10. Kalantar-Zadeh K, Kopple JD, Regidor DL, Jing
Conflict of Interest: None. J, Shinaberger CS, Aronovitz J, et al. A1C and
survival in maintenance hemodialysis patients.
Source of Funding: None.
Diabetes care. 2007;30:1049-1055.
Ethical Clearance: All experimental protocols were 11. Uzu T, Hatta T, Deji N, Izumiya T, Ueda H,
approved by the College of Medicine, University of
Miyazawa I, et al. Target for glycemic control in
Baghdad, Iraq, and all experiments were carried out in
type 2 diabetic patients on hemodialysis: effects of
accordance with approved guidelines.
anemia and erythropoietin injection on hemoglobin
A1c. Ther Apher Dial. 2009;13:89-94.
References
12. Brown JN, Kemp DW, Brice KR. Class effect of
1. Hill NR, Fatoba ST, Oke JL, Hirst JA, O’Callaghan erythropoietin therapy on hemoglobinA1c in a patient
CA, Lasserson DS, et al. Global prevalence of with diabetes mellitus and chronic kidney disease
chronic kidney disease–a systematic review and not undergoing hemodialysis. Pharmacotherapy:
meta-analysis. PloS One. 2016;11:e0158765. The Journal of Human Pharmacology and Drug
2. Cavanaugh KL. Diabetes management issues Therapy. 2009;29:468-472.
for patients with chronic kidney disease. Clin 13. Britton KA, Pradhan AD, Gaziano JM, Manson
Diabetes. 2007;25:90-97. JE, Ridker PM, Buring JE, et al. Hemoglobin A1c,
3.
Kannan A, Sriramakrishnan V, Kannan B, body mass index, and the risk of hypertension in
Anandan H. Thyroid Function Abnormalities women. Am J Hypertens. 2011;24:328-334.
14. Shrishrimal K, Hart P, Michota F. Managing risk factors; a study of nonsmoking Japanese male
diabetes in hemodialysis patients: observations office workers. Int J Obes. 2000;24:1226-1230.
and recommendations. Cleve Clin J Med.
20. ISO H, KIYAMA M, NAITO Y, SATO S,
2009;76:649-655.
KITAMURA A, IIDA M, et al. The relation of body
15. American Diabetes Association. Diagnosis and fat distribution and body mass with hemoglobin
classification of diabetes mellitus. Diabetes Care. A1c, blood pressure and blood lipids in urban
2010;33 Suppl 1:S62-69. Japanese men. Int J Epidemiol. 1991;20:88-94.
16. Nakao T, Matsumoto H, Okada T, Han M, Hidaka 21. Koga M, Matsumoto S, Saito H, KASAYAMA S.
H, YOSHINO M, et al. Influence of erythropoietin Body mass index negatively influences glycated
treatment on hemoglobin A1c levels in patients albumin, but not glycated hemoglobin, in diabetic
with chronic renal failure on hemodialysis. patients. Endocr J. 2006;53:387-391.
Internal medicine. 1998;37:826-830.
22. Cinemre H, Bilir C, Gokosmanoglu F, Bahcebasi
17. Little RR, Rohlfing CL, Tennill AL, Hanson T. Hematologic effects of levothyroxine in iron-
SE, Connolly S, Higgins T, et al. Measurement deficient subclinical hypothyroid patients: a
of HbA1c in patients with chronic renal failure. randomized, double-blind, controlled study. J Clin
Clinica Chimica Acta. 2013;418:73-76. Endocrinol Metab. 2009;94:151-156.
18. Aucott LS, Philip S, Avenell A, Afolabi E, Sattar 23. Larsen P, Davies T. Hypothyroidism and thyroiditis.
N, Wild S. Patterns of weight change after the In: Williams Textbook of Endocrionology, P. R.
diagnosis of type 2 diabetes in Scotland and their Larsen, H. M. Kronenberg, S. Melmed, and K.
relationship with glycaemic control, mortality and S. Polonsky (eds.). Maryland Heights, Missouri,
cardiovascular outcomes: a retrospective cohort Saunders Elsevier, U.S.A. 2002, pp. 423–455.
study. BMJ open. 2016;6:e010836.
24. Ford HC, Lim WC, Crooke MJ. Hemoglobin A1
19. Nakanishi N, Nakamura K, Suzuki K, Tatara K. and serum fructosamine levels in hyperthyroidism.
Effects of weight variability on cardiovascular Clinica Chimica Acta. 1987;166:317-321.
Efficacy of the Health Promotion Model-Based Intervention in

Enhancing the Health Responsibility of Middle School Female
Student: A Randomized Controlled Trial
Hiba Abdul-Wahid Dawood1, Afifa Ridah Aziz2

MSc, 2PhD, Professor, Pediatric Nursing Department, College of Nursing, University of Baghdad, Iraq
1
Abstract
A randomized controlled trial (RCT) was conducted by applying the Health Promotion Model (HPM) to (1)
determine the effect of the Health Promotion Model-based intervention in promoting the health behaviors
for students, (2) identify the association between students’ age, family’s socioeconomic status (SES), body
mass index (BMI), and the health behaviors, and (3) investigate the differences in the health behaviors
between the groups of grade, SES, birth order, and BMI. The study included a simple random sample of
(180) female students (90 students for the study group and 90 students for the control group), who aged
11-16-years who were selected from the middle school of “Al-Ahwaz “ in Al-Rusafa side in Baghdad City.
Data were collected through a self-report instrument that used the Health-Promoting Lifestyle Profile.
The study results revealed that the HPM-based intervention has positive effects on students’ Health
Responsibility, Physical Activity, Nutrition, Spiritual Growth, Interpersonal Relations, and Stress
Management. Younger students demonstrated poorer Health Responsibility, poorer Nutrition, and poorer
Spiritual Growth. The better the socioeconomic status, the better the Stress Management. Except for obese
students, students with greater BMI enjoy greater the Physical Activity level. The researcher recommends the
need to implement interventions based on the health promotion models; particularly the Health Promotion
Model in improving adolescents’ health-related behaviors, the need to conduct similar studies on larger
sample size in different areas across Iraq, and the need to include other factors that can have an influence on
students’ health behaviors in future studies.
Keywords: Health Promotion Model; Health Responsibility
Introduction In Iraq, the total number of girls who age 10-14-years

is estimated to 1.9 million; which constitutes 6 percent
Adolescents constitute 1.2 billion of the world’s of total population (2). According to Iraq woman
population, about 90% of those adolescents live in integrated social and health survey (I-WISH), girls who
low and middle-income countries. Promoting healthy age 10-14-years-old reported that they need information
practices during adolescence is considered an investment about girls’ family right and duties (61.7%), dealing
in countries’ future health and social infrastructure. with adults (61.41%), free self-expression (61.1%), right
Many risk or protective factors for future adult disease nutrition (58.5%), 58.5%), dealing with the disabled
either start or are reinforced during this critical period (57.8%), child abuse and its combating (52.8%), dealing
of life (1). with males (51.1%), and sport activities (49.7%).
Health promotion is defined as the process of

Corresponding Author: enabling people to increase control over, and to improve,
Hiba Abdul-Wahid Dawood their health, enables people to increase control over their
MSc, Pediatric Nursing Department, own health (3).
College of Nursing, University of Baghdad, Iraq
Phone: +9647716905759 Moreover, health promotion covers a wide range of
Email: msz_bh@yahoo.com social and environmental interventions that are designed
to benefit and protect individual people’s health and Purpose Statement: This study aims to determine the
quality of life by addressing and preventing the root effect of the Health Promotion Model-based intervention
causes of ill health, not just focusing on treatment and in promoting the health behaviors for students;
cure (4). For children and adolescents, health promotion is particularly health responsibility.
defined as those strategies that promote child and young
people’s health, prevent disease in children and young Material and Method
people, and foster equity for children and young people,
within a framework of sustainable development (5). This Study Design: The research design for this study was
involves advocating for children and enabling their an experimental, randomized controlled trial design,
voices to be heard, promoting a broad sense of health control occurs to decrease the possibility of error and
and wellbeing, assessing health needs, implementing thus increase the probability that the study’s findings are
a range of public health interventions, seeing children an accurate reflection of reality and the researcher can
in the context of their families and communities, and reduce the influence or confounding effect of extraneous
cooperating between a wide network of individuals and variables on the study variables, also controlling
organizations (6). extraneous variables enable the researcher to identify
relationships among the study variables accurately and
Adolescence is a transition from childhood to examine the effects of one variable on another.
adulthood and includes rapid developmental, physical,
psychological, cognitive, and behavioral changes (7). Study Population: The study population included
Adolescence is viewed as an appropriate time to establish middle school female students. The target population
healthy habits and prevent future health complications(8). for this study was drawn from adolescents. The total
number of students in this school was 780 who aged
Health-related values, beliefs, and behavior patterns
from 11-17-years-old, who were living in Baghdad City,
that are typically formed during adolescence ultimately
who met the inclusion criteria mentioned below.
affect health outcomes in adulthood (9). Furthermore, the
behavioral patterns during these developmental periods The researcher distributed (200) copies of the study
help determine young people’s current health status and questionnaire to the accessible students. The returned
their risk for developing chronic diseases. questionnaires were 190; 10 of them were incomplete.
Health Responsibility: Health responsibility involves So, they were excluded from the data analyses. The final
an active sense of accountability for one’s own well- sample size was 180. Thus, the response rate was 95%.
being. It includes paying attention to one’s own health,
Ethical Considerations: The research proposal was
educating oneself about health, and exercising informed
first reviewed and approved by the Department of
consumerism when seeking professional assistance(10-12).
Adolescence is a transitional period accelerated by Pediatrics Nursing. Thereafter, the student researcher
physical, psychological, social, cultural, emotional and (SR) obtained the approval of the Ministry of Planning
cognitive changes (13). Throughout the adolescent years, and Development/The Central Organization of Statistics,
the body and brain grow and change, and while trying to and the Ministry of Education, Al-Rusafa II Directorate
become adjusted to these changes, the adolescent must of Education.
learn to negotiate new responsibilities and establish
The Health-Promoting Lifestyle Profile II (HPLP)
a new sense of self-identity and autonomy which is
was used to measure the health behaviors (12). The HPLP
essential for independence (14-15). With this transition,
opportunities and challenges present for improving is a 4-point Likert type scale that is composed of 9
health and preventing disease. As adolescents progress items. These items were measured on a 4-point Likert
from childhood to adulthood, they take on increasing scale. Responses on this scale range from 1 (Never) to
individual responsibility for their daily health habits. 4 (Routinely). Total scores range from 9 to 36, with a
Trying to emulate adult roles and behaviors is normal and higher score means better health responsibility.
healthy in these adolescent years, but some adolescents
The study sample were randomly and equally selected
experiment in ways that endanger their health and safety
from each grade (seventh, eighth, ninth). The simple
and contribute to the development of chronic disease in
adulthood (16). random sample method was used to recruit study subjects.
The study questionnaire was given to participants Perceived Benefits, Perceived Barriers, Perceived Self-
to complete (self-reporting). Distributing questionnaires Efficacy, Activity-related affect or feeling states related
in person allow the researcher to explain the instructions to each health behavior to oneself or to the situation, and
before the participants start answering the questions. The Interpersonal and situational influences. These lectures
questionnaires were also used to collect the data in three were presented for students for each grade separately by
time points (pre-intervention, post-intervention I 6-weeks data show. Each lecture lasted for 45 minutes.
after intervention, post-intervention II 6-weeks after post-
intervention I) in middle school. After completing the The descriptive statistical measures of frequency,
pretest phase, the researcher initiated intervention that percent, mean, and standard deviation were used to
is based on the six constructs of the Health Promotion describe participants’ demographics. The repeated
Model. This intervention included 12 lectures about measures analysis of variance (RM-ANOVA) was used
health responsibility. This intervention emphasized the to measure the difference in the Health Responsibility
behavior-specific cognition and attitudes that include: over time.
Study Findings
Table 1: Participants’ Sociodemographic Characteristics
Study (N = 90) Control (N = 90)

Frequency Percent Frequency Percent
Age
11 2 2.2 4 4.4
12 11 12.2 14 15.6
13 33 36.7 24 26.6
14 29 32.2 24 26.6
15 11 12.2 16 17.8
16 4 4.4 8 8.9
Mean (SD) 13.53 ± 1.07 13.64 ± 1.30
Socioeconomic Status
Upper lower class 23 25.6 14 15.6
Lower middle class 46 51.1 38 42.2
Upper middle class 20 22.2 32 35.5
Upper class 1 1.1 6 6.7
BMI:
Underweight 14 15.5 22 20.8
Normal range 52 57.8 48 53.3
Overweight 16 17.8 15 16.7
Class I Obesity 7 7.8 5 5.6
Class II Obesity 1 1.1 0 0.0
Mean (SD) 22.59 ± 5.2 22.6 ± 3.6
The age mean for participants in the study group is group, the age mean is 13.64 ± 1.3; more than a quarter
13.53 ± 1.07; more than a third age 13-years-old (n = 33; age 13 and 14-years-old (n = 24; 26.6%), followed
36.7%), followed by those who age 14-years-old (n = by those who age 15-years-old (n = 16; 17.8%), those
29; 32.2%), those who age 12 and 15-years-old (n = 11; who age 12-years-old (n = 14; 15.6%), those who age
12.2%), those who age 16-years-old (n = 4; 4.4%), those 16-years-old (n = 8; 8.9%), and those who age 11-years-
who age 11-years-old (n = 2; 2.2%). For the control old (n = 4; 4.4 %).
Concerning the SES, more than two-fifth in the study those who are overweight (n = 15; 16.7%), and those
group are of the lower middle class (n = 46; 51.1%), who have class I obesity (n = 5; 6.9%).
followed by those who are of the upper lower class (n
= 23; 25.6%), those who are of the upper middle class Table 2: Descriptive Statistics for the Values of the
(n = 20; 22.2%), and one who is of the upper class (n = Health Responsibility over Time
1; 1.1%). For the control group, more than two-fifth are
of the lower middle class (n = 38; 42.2%), followed by Health Std.
Mean N
those who are of the upper middle class (n = 32; 35.5%), Responsibility Deviation
those who are of the upper lower class (n = 14; 15.6%), Study Pretest 19.23 4.38 90
and those who are of the upper class (n = 6; 6.7%). Study Posttest I 26.25 4.27 90
Study Posttest II 26.53 4.30 90
Regarding the BMI, the BMI mean for participants
Control Pretest 19.63 4.90 90
in the study group is 22.59 ± 5.2; more than a half are of
Control Posttest I 19.43 5.34 90
normal range (n = 52; 57.8%), followed by those who are
overweight (n = 16; 17.8%), those who are underweight Control Posttest II 19.66 4.84 90
(n = 14; 15.5%), those who have class I obesity (n = 7; The values of the Health Responsibility for the study
7.8%), and one who has class II obesity (n = 1; 1.1%). group noticeably increase by time compared to the control
For the control group, the BMI mean is 22.6 ± 3.6; group (Pretest = 19.23 vs. 19.63, Posttest II = 26.25 vs.
more than a half are of normal range (n = 48; 53.3%), 19.43, Posttest II = 26.53 vs. 19.66) respectively. Higher
followed by those who are underweight (n = 22; 24.4%), score means better Health Responsibility.
Table 3: Tests of Within-Subjects Effects for the Health Responsibility

Type III Sum Mean Partial Eta
Source df F Sig.
of Squares Square Squared
Sphericity Assumed 3080.363 2 1540.181 146.896 .000 .623
Greenhouse-Geisser 3080.363 1.123 2741.946 146.896 .000 .623
HR (Study)
Huynh-Feldt 3080.363 1.128 2731.280 146.896 .000 .623
Lower-bound 3080.363 1.000 3080.363 146.896 .000 .623
Sphericity Assumed 1866.304 178 10.485
Error (HR Greenhouse-Geisser 1866.304 99.985 18.666
Study) Huynh-Feldt 1866.304 100.375 18.593
Lower-bound 1866.304 89.000 20.970
Type III Sum Mean Partial Eta
Source df F Sig.
of Squares Square Squared
Sphericity Assumed 2.867 2 1.433 2.255 .108 .025
HR Greenhouse-Geisser 2.867 1.021 2.809 2.255 .136 .025
(Control) Huynh-Feldt 2.867 1.021 2.807 2.255 .136 .025
Lower-bound 2.867 1.000 2.867 2.255 .137 .025
Sphericity Assumed 113.133 178 .636
Error (HR Greenhouse-Geisser 113.133 90.840 1.245
Control) Huynh-Feldt 113.133 90.903 1.245
Lower-bound 113.133 89.000 1.271
HR: Health Responsibility
There was a (a priori p = 0.01) significant difference this analysis is .695, which indicates that approximately
(F (1.123, 99.985) = 146.896, p = 0.01) in the Health 69% of the total variance in the Health Responsibility
Responsibility over time for participants in the study values is accounted for by the variance in the administered
group. The omnibus effect (measure of association) for intervention.
For the control group, there was no significant 2.

Ministry of Planning - Central Statistical
difference (F (1.021, 90.840) = 2.255, p = 0.136) in the Organization-CSO. Iraq woman integrated
Health Responsibility over time. The omnibus effect social and health survey (I-WISH): Summary
(measure of association) for this analysis is .025, which report. Baghdad: Ministry of Planning - Central
indicates that approximately 14% of the total variance Statistical Organization-CSO; 2012. Available
in the Health Responsibility values is accounted for by from https://reliefweb.int/sites/reliefweb.int/files/
the chance. resources/I- WISH%20Report%20English.pdf
3. World Health Organization. Health promotion.
Discussion of Findings 2018a. [cited 2018 October 21] Available, from
This RCT used the Health Promotion Model as a World Health Organization: http://www.who.int/
theoretical framework to enhance female students’ health healthpromotion/conferences/previous/ottawa/en
behaviors. There was a noticeable increase in the values 4.
World Health Organization. What is health
of the Health Responsibility for the study group over promotion? 2018b. [cited 2018 October 21]
time with a statistically significant difference. Moreover, Available, from World Health Organization: http://
approximately 69% of the total variance in the Health www.who.int/features/qa/health-promotion/en/
Responsibility values is accounted for by the variance
in the administered intervention. This finding indicates 5.
Kohler L. Child public health. European
the positive influence of the HPM-based intervention in Journal of Public Health. 1998; 8(3): 253-255.
enhancing students’ Health Responsibility. Retrieved from http://eurpub.oxfordjournals.org/
content/8/3/253.abstract
Conclusions 6. Korin MR. Health promotion for children and
adolescents. New York, NY, USA: Springer. 2016.
The HPM-based intervention has positive effects
on students’ Health Responsibility. The younger the 7.
AlBuhairan FS, Olsson TM. Advancing
student, the poorer the Health Responsibility. adolescent health and health services in Saudi
Arabia: exploring health-care providers’ training,
Implication for Practice: There is a need to implement interest, and perceptions of the health-care needs
interventions based on the health promotion models; of young people. Advances In Medical Education
particularly the Health Promotion Model in improving
And Practice [Internet]. 2014 Sep 4 [cited 2019
adolescents’ health-related behaviors.
May 13];5:281–7.
Implications for Research: There is a need to conduct 8. Vitamin D Council. New study reports 96%
similar studies on larger sample size in different areas of adolescents in Saudi Arabia are vitamin D
across Iraq. There is a need to include other factors that deficient; 2015 Available from: https://www.
can have an influence on students’ health behaviors in vitamindcouncil.org/vitamin-d-news/new-study-
future studies. reports-96-of-adolescents-in-saudi-arabia-are-
Implications for Education: It is crucial to incorporate vitamin-d-deficient-09-2015/
teaching materials that focus on promoting individuals’ 9. Mulye TP, Park MJ, Nelson CD, Adams SH,
health behaviors; particularly among adolescents into Irwin CE Jr, Brindis CD. Trends in adolescent and
the curricula of different nursing programs. young adult health in the United States. Journal of
Conflict of Interest: The researchers declare that there Adolescent Health [Internet]. 2009 Jul [cited 2019
is no conflict of interest. May 13];45(1):8–24.
10. Ardell DB. High level wellness: An alternative
References to doctors, drugs and disease. Berkley, CA: Ten
Speed Press. 1986.
1. World Health Organization (WHO). Adolescent
health research priorities: Report of a technical 11. Travis J & Ryan R. Wellness workbook (2nd ed.).
consultation. Geneva: 2015 Berkley, CA: Ten Speed Press: 1988.
12. Walker SN, Sechrist KR, Pender NJ. The Health- 15. McNeely C, Blanchard J. The teen years explained:
Promoting Lifestyle Profile: Development A guide to healthy adolescent development.
and psychometric characterizations. Nursing Baltimore, MD: John Hopkins Bloomberg School
Research, 1987; 36(2): 76-81. of Public Health and Center for Adolescent
Health; 2010.
13. Lassi ZS, Salam RA, Das JK, Wazny K, Bhutta
ZA. An unfinished agenda on adolescent health: 16.
National Research Council and Institute of
Opportunities for interventions. Seminars In Medicine, & Committee on Adolescent Health
Perinatology [Internet]. 2015 Aug [cited 2019 Care Services and Models of Care for Treatment,
May 13];39(5):353–60. Prevention, and Healthy Development. In R. S.
Lawrence, J. A. Gootman, & L. J. Sim (Eds.),
14.
DiClemente RJ, Hansen WB, Ponton LE.
Adolescent health services: Missing opportunities.
Handbook of Adolescent Health Risk Behavior.
Washington: National Academies Press: 2009.
New York: Springer Science & Business Media,
Available from: http://books.nap.edu/openbook.
LLC. 2013.
php?record_id=12063&page=1).
Detection of Rotavirus Genotypes with Conventional PCR in a

Group of Iraqi Children with Acute Viral Gastroenteritis
Hiba Sabah Jasim

Department of Microbiology, College of Medicine, University of Baghdad
Abstract
Rotaviruses are one of the major causes of acute viral gastroenteritis in children under 5 years old worldwide,
the highest mortality is observed in developing countries. The genome of the rotavirus is composed of 11
segments of ds RNA, according to the antigenic characteristics of the middle layer protein VP6 the virus can
be classified into A to I serogroups, the most common serogroup that can cause more than 90% of the rotavirus
infections in human is the rotavirus A. This study aimed to detect the rotavirus genotypes in the children
with acute viral gastroenteritis as this disease causes many deaths and cost the country a lot of money for
treatment, additionally if the diagnosis of the virus is early the disease will be under control. Methodology:
This study was conducted during March to September 2017; included 200 stool samples collected from
hospitalized children. Samples were of two groups, 150 sample of patient with acute viral gastroenteritis,
the other 50 samples were collected from healthy children also under 5 years old. The result considered
positive if ELISA and/or PCR gave positive result, while considered negative if both of them gave negative
result. Findings: The incidence of the rotavirus in the patient group was (70/150) while only two cases (2/50)
of the control group showed positive result, the most prevalence serotype was G2P4 with (40/150) in the
patient group, additionally this serotype was the only serotype that was detected in control group in both two
cases that showed positive result with rotavirus. Conclusion: Rotavirus genotyping is a major risk factor of
viral gastroenteritis in children as the percentage of the virus was high. Recommendation: Prophylaxis and
treatment of children under 5 years old is very important especially for children that attend hospitals.
Keywords: Rotavirus, genotyping, ELISA, Conventional PCR.
Introduction The inner layer of is formed by VP2, VP1 and VP3 (8, 9),
additionally the virus consist of nonstructural proteins
Rotaviruses are the major cause of acute viral with diverse functions, such as NSP1 play a role in the
gastroenteritis in children under five years old (1, 2). These modulation of the immunity, NSP3 regulates the viral
viruses are the common cause of gastroenteritis in the gene expression, and NSP4 play important role in the
world especially in developed countries (3, 4), rotaviruses induction of diarrhea in infected cells (10, 11).
infections result in an estimated of 400,000 to 500,000
deaths in young children (5). The virus enters the cells by receptors then form
endosome. The viral protein in the third layer damage
Rotaviruses are nonenveloped viral capsid the membrane of the endosome, this will create a
containing a genome of 11 double stranded RNA (6, 7). differences in the calcium concentration causing
The outer layer of the virus is formed by VP4 and VP7 breakdown of VP7 into its subunits, then VP2, and VP6
proteins. While the intermediate layer consists of VP6, accumulate around the dsRNA forming the double layer
a conserved region, which is useful in the genotyping. particle (DLP), which is transcriptionally active (12). The
RNA is replicated and the DLPs are assembled, then the
Corresponding Author: DLPs migrate to the endoplasmic reticulum, finally the
Dr. Hiba Sabah Jasim, PhD, progeny of the virus released by lysis (13).
Department of Microbiology, College of Medicine,
University of Baghdad Serotypes of the virus are defined by using antisera
Email: dr.alkarkhi@gmail.com to purified virus particles prepared in hyperimmunized
animals. By measure the reactivity of antibody with the cycling, the PCR products were electrophoresed in 2%
two proteins (VP4 and VP7), which induce antibodies agarose gel. Presence of 240 bp band means positive
with neutralizing activity (14, 15). In most cases the antibody result, and this means that the quality of cDNA is good,
reactivity is against VP7. Because VP7 makes up a all samples in this study were of good quality. Then
greater percentage, also induces more specific antibodies concentration and purity of cDNA of each sample was
than VP4 does, possibly because VP4 is lost during measured using Nanodrope instrument.
preparation of virus. The serotypes of viruses, defined by
ELISAs, also confirmed by molecular techniques, which Rotavirus antigen was detected by ELISA by
greatly simplified virus characterization, additionally the removawell strips plates (USA), 90 µl of each sample
early diagnosis and treatment of the disease (16, 17). was add to two wells of the plate coated with pre and
post immunization serum, incubated in the optimum
conditions of the reaction (37°C, 2 hours, washing 5
Material and Method
times), rotavirus antigen was detected by adding HRP
This study was included 200 stool samples, 150 was conjugated to anti SA-11 antibody, then incubated for 90
obtained from children with acute viral gastroenteritis minutes in humid conditions, TMB substrate was added
attend to the pediatric department of Al-Emamain and incubate in the room temperature for 15 minutes,
Medical City at Baghdad, Iraq from March to September the reaction was stopped by adding 1 M phosphoric acid
2017, the other 50 samples was collected from healthy (USA), the results was read at 450 nm.
children as control group.
Rotavirus G and P genotyping: For the genotyping of
All samples were diagnosed by latex agglutination rotavirus, G and P typing methods were used; PCR was
detection of rotavirus using the Diralex Rota-Adeno carried out separately for the VP7 and VP4 genes, using
Kit (Finland), another diagnosis of the virus by ELISA the products of the first PCR of VP7 and VP4 genes
technique. as templates. For G genotyping G1, G2, G3, G4, G8,
and G9 specific primers, and for P genotyping, P4, P6,
RNA Extraction: Extraction of RNA from stool P8, and P9 specific primers were used in the PCR, the
samples was done using QIAamp® RNA Mini Kit sequence of these genotypes was shown in table 1 and 2.
(USA) according to the manufacture instruction.
A negative control consisting of buffer only was
Reverse transcriptase PCR was done in order to included also non template control was added; finally
convert the nucleic acid RNA to cDNA, and the integrity electrophoresis amplicon visualization was performed
was checked by PCR amplification of GAPDH which using an UV light transluminator.
was performed according to Rameshkumar (18). After
Table 1: This table shows the primer sequences for P genotype of rotavirus(19)
Type Primer sequences 5’-3’ Size Product
First amplification 876 bp
VP4 Forward TGGCTTCGCTCATTTATAGACA
VP4 Reverse ATTTCGGACCATTTATAACC
Second amplification genotyping primers
P4 CTATTGTTAGAGGTTAGAGTC 483 bp
P6 TGTTGATTAGTTGGATAA 267 bp
P8 TCTACTTGGATAACGTGC 345 bp
P9 TGAGACATGCAATTGGAC 391 bp
Table 2: This table shows the primer sequences for G genotype of rotavirus(19)
Type Primer sequences 5’-3’ Size Product

First amplification 897 bp
VP7 forward TAGCTCCTTTTAATGTATGG
Conted…
VP7 reverse AACTTGCCACCATTTTTTCC

Second amplification genotyping primers
G1 CAAGTACTCAAATCAATGATGG 158 bp
G2 CAATGATATTAAACATTTTCTGTG 244 bp
G3 ACGAACTCAACACGAGARG 464 bp
G4 CGTTTCTGGTGAGGAGTTG 403 bp
G8 GTCACACCATTTGTAAATTCG 651 bp
G9 GTTGATGTGACTAYAAATAC 110 bp
Results
This study showed the relationship between ELISA, and conventional PCR for detecting rotavirus 70
(46.7%) by PCR, while the percentage of the rotavirus with ELISA was 50 (33.3%). The incidence of diarrhea was
more in the female group as 90 patients, while the number of male patients was 60, in control group the number of
female was more than male, female samples were 30, while male samples were 20, as shown in table 3.
Table 3: This table shows the classification according to age groups and sex
Patients Control
Age group
Male Female Male Female
2 weeks- 2 months 14 20 6 8
2 - 6 months 22 30 8 12
6 months- one year 14 22 2 6
One - 5 years 10 18 4 4
Total 60 90 20 30
Results shows the highest incidence in the group of children with bottle feeding with 57.14%, also the incidence
of rotavirus infection was high in the mixed type feeding with 28.57%, the lowest percentage of the infection was in
breast feeding with 14.28%, as shown in table 4.
Table 4: This table shows the distribution of rotavirus according to kind of feeding:
Kind of feeding Patient number % Control number % Total number %

Bottle feeding 40 57.14 2 100 42 58.8
Breast feeding 10 14.28 0.00 0.00 10 13.9
Mixed feeding 20 28.57 0.00 0.00 20 27.8
Total 70 100 2 100 72 100
The highest positive results were in the age group two to six months 42.3%; the lowest incidence was in the
age group one to five years 17.9 %, by ELISA, while the results using PCR shows the highest percentage in the age
group two to six months 61.5%; the lowest incidence was in the age group one to five years which was 21.4% as
shown in table 5 and 6.
Table 5: This table shows the frequency of rotavirus by ELISA
Patients Control
Age Group
+ve % -ve % +ve % -ve %
2 weeks- 2 months 10 29.4 24 70.6 o.oo o.oo 14 100
2 - 6 months 22 42.3 30 57.7 0.00 0.00 20 100
Conted…
6 months- one year 13 36.1 23 63.9 2 25 6 75

One- 5 years 5 17.9 23 82.1 0.00 0.00 8 100
Total 50 33.3 100 66.7 2 4 48 96
Table 6: This table shows the frequency of rotavirus by conventional PCR
Patients Control
Age group
+ve % -ve % +ve % -ve %
2 weeks-2 months 14 41.2 20 58.2 0.00 0.00 0.00 0.00
2-6 months 32 61.5 20 38.5 0.00 0.00 0.00 0.00
6 months-One year 18 50 18 50 2 100 0.00 0.00
One -5 years 6 21.4 22 78.6 0.00 0.00 0.00 0.00
Total 70 46.7 80 53.3 2 4 48 96
PCR was used for genotyping of both VP4 and VP7, revealed G2P4 was detected (57.14%) in patients samples
followed by G9P8 (7.14%), G2P8, G3P9, G4P4 (5.71%), G1P9 (4.29%), G1P4, G1P6, G8P4 (2.86%) and G3P4,
G4P6, G4P9, G8P8 (1.43%), as shown in table 7.
Table 7: This table shows the frequency of the rotavirus genotypes by conventional PCR
Genotypes of
P4 % P6 % P8 % P9 %
Rotavirus
G1 2 2.86 2 2.86 0 0.00 3 4.29
G2 40 57.14 0 0.0 4 5.71 0 0.00
G3 1 1.43 0 0.00 0 0.00 4 5.71
G4 4 5.71 1 1.43 0 0.00 1 1.43
G8 2 2.86 0 0.00 1 1.43 0 0.00
G9 0 0.00 0 0.00 5 7.14 0 0.00
Discussion This study detect the virus in 33.3% (50/150) from

patients samples by ELISA, this result is similar to other
Rotaviruses are with high diversity and can be Iraqi study which detect the virus in 37% (24), also other
differentiated into several different groups according to
studies in neighboring countries such as in Jordan the
the antigenicity and gene composition of their VP6 (6, 7).
prevalence of the virus was 33% (25), in Iranian study the
The genome of rotavirus shows typical features which
incidence was 35% (26), while in Turkey the prevalence
found in all rotaviruses regarded encoded proteins and
of the virus was 37% (27). While the detection of the virus
conserved sequences at the genome segment ends.
by conventional PCR in this study was 70/150 which
Each segment was found to encode one protein, with
the exception of segment 10, which possesses two open represented 46.7%, this result was similar to another
reading frames (20, 21), for that reason this study was Iraqi study which detect the virus in 42.45% (28), also
demonstrated to detect 24 different genotypes by PCR. these results similar to result in Kuwait as the prevalence
was 44% (29), but the result of this study in the detection
Rotavirus is a major cause of viral gastroenteritis of the virus by PCR is less than the results in Oman
in human especially children (22) using ELISA a good which was 50% (30), also in Syria as the virus was detect
method for detection, additionally it’s of low cost and in 61% of the samples (31).
need simple experiences. However rapid and specific
diagnostic method to detect the virus is needed to The main objective of this study was to design
facilitate treatment of the disease (23). a simple and sensitive PCR method for detection of a
broad range of rotavirus genotypes to be applied to 6. Estes MK, Kapikian AZ, M. Kniepe, S. E. Straus,
routine monitoring of stool samples. Fields virology, 5th ed. Lippincott, Williams and
Wilkins, Philadelphia, PA. 2007:1917-1974.
The method detect the presence of rotavirus in
70/150 isolates from patients group, also detect the virus 7. Ramig RF, Ciarlet M, Mertens PPC, Dermody
in 2/50 isolates from control group as shown in (Table 7), TS. Virus taxonomy. Eighth report of the
involving 13 different G-P types from the 24 genotypes ICTV. Elsevier Academic Press, Amsterdam,
Netherlands. 2005:484-496.
that was used in this study. The most prevalence was
G2P4 which was detected in 57.14%, this result was 8. Chen D, Luongo CL, Nibert ML. Rotavirus
similar to another Iraqi study as the detection was open cores catalyze 5_-capping and methylation
53.33% (24). of exogenous RNA: evidence that VP3 is a
methyltransferase. Virology. 1999; 265: 120–130.
In conclusion, this work reports the development,
and application of PCR for the rapid detection of 9.
Pizarro JL, Sandino AM, Pizarro JM.
rotavirus genotypes. The results reported in this study Characterization of rotavirus transferases activity
associated with polypeptide VP3. J. Gen. Virol.
highlight the inadequacies of non-molecular methods
1991; 72: 325–332.
used for the routine detection of viruses and emphasize
the importance of application of molecular to clinical 10. Mori Y, Borgan MA, Ito N, Sugiyama M.
services in hospital laboratories to provide definitive Diarrhea-inducing activity of avian rotavirus
diagnoses, molecular methods could provide valuable NSP4 glycoproteins, which differ greatly from
information on the incidence of currently circulating mammalian rotavirus NSP4 glycoproteins in
viral strains, therefore lending itself to surveillance of deduced amino acid sequence in suckling mice. J.
viral transmission. Virol. 2002; 76: 5829–5834.
11. Sasaki S, Horie Y, Nakagomi T. Group C rotavirus
Ethical Clearance: The researcher already has ethical
NSP4 induces diarrhea in neonatal mice. Arch.
clearance from College of Medicine, University of
Virol. 2001; 146: 801– 806.
Baghdad
12. Lawton J, Estes AMK, Prasad BV. Three-
Source of Funding: Self funding dimensional visualization of mRNA release from
actively transcribing rotavirus particles. Nat.
Conflict of Interest: No conflict of interest
Struct. Biol. 1997; 4:118–121.
References 13. Patton JT, Spencer E. Genome replication and

packaging of segmented double-stranded RNA
1. Fischer TK, Viboud C, Parashar U. Hospitalizations viruses. Virology. 2000; 277: 217–225.
and deaths from diarrhea and rotavirus among
children _5 years of age in the United States, 14. Hoshino Y, Saif LJ, Sereno MM. Infection
immunity of piglets to either VP3 or VP7 outer
1993–2003. J. Infect. Dis. 2007; 195:1117–1125.
capsid protein confers resistance to challenge with
2. Parashar UD, Gibson CJ, Bresee JS. Rotavirus a virulent rotavirus bearing the corresponding
and severe childhood diarrhea. Emerg. Infect. Dis. antigen. J. Virol. 1988; 62: 744-748.
2006; 12: 304–306.
15. Offit PA, Blavat G. Identification of the two
3. Lopman BA, Reacher MH, Hanon FX. Viral rotavirus genes determining neutralization
gastroenteritis outbreaks in Europe, 1995– 2000. specificities. J. Virol. 1986; c57: 376-378.
Emerg. Infect. Dis. 2003; 9: 90–96.
16. Birch CJ, Heath RL, Gust ID. Use of serotype-
4. Simpson R, Aliyu S, Iturriza-Gomara M. Infantile specific monoclonal antibodies to study the
viral gastroenteritis: on the way to closing the epidemiology of rotavirus infection. J. Med.
diagnostic gap. J. Med. Virol. 2003; 70: 258–262. Virol.1988; 24: 45-53.
5. Parashar UD, BreseeeJS, Gentsch JR. Rotavirus. 17. Gerna G, Sarasini A, Di-Matteo A. Identification of
Emerg. Infect. Dis. 1998; 4: 561–570. two subtypes of serotype 4 human rotavirus by using
VP7-specific neutralizing monoclonal antibodies. J. 25.

Youssef M, Shurman A, Bougnoux M-E,
Clin. Microbiol. 1988; 26: 1388-1392. Rawashdeh M. Bacterial, viral and parasitic
enteric pathogens associated with acute diarrhea in
18. Rameshkumar K, Clark D J. Efficient extraction
hospitalized children from northern Jordan. FEMS
of DNA from paraffin- embedded tissue using
Immunol Med Microbiol. 2000; 28: 257–63.
nucleon HT kit for clinical molecular pathology
research. Life Science News: Biosciences. 1998. 26. Khalili B, Cuevas LE, Reisi N. Epidemiology
of rotavirus diarrhoea in Iranian children. J Med
19. World Health Organization (WHO) (2009) Manual
Virol. 2004; 73: 309–412.
of Rotavirus Detection and Characterization
Method. 27. Karadag A, Acikgoz ZC, Avci Z. Childhood
diarrhoea in Ankara, Turkey: epidemiological
20. Rainsford EW, McCrae MA. Characterization of
and clinical features of rotavirus-positive versus
the NSP6 protein product of rotavirus gene 11.
rotavirus negative cases. Scand J Infect Dis. 2005;
Virus Res. 2007; 130: 193–201.
37: 269–75.
21. Torres-Vega MA, Gonzalez RA, Duarte M. The
28. Abood W, Al- Juboury S, Al- Rodhan M.
C-terminal domain of rotavirus NSP5 is essential
Prevalence and factors associated with rotavirus
for its multimerization, hyperphosphorylation and
infection among infants admitted for diarrhea in
interaction with NSP6. J. Gen. Virol. 2000; 81:
the region of Mid Iraq. AL- Qadisiya Medic J.
821–830.
2014; 10(18).
22. Mustafa NS, Elhag WI. Diagnosis of rotavirus
29. Marmash RW, Dalwai AK, Szucs G, Albert MJ:
gastroenteritis by a latex agglutination test in
Genotypic characterization of rotaviruses and
Khartoum State, Sudan. J. Pharm. Biomed. Sci.
prevalence of serotype-specific serum antibodies
2013; 33(33): 1594-1598.
in children in Kuwait. Epidemiol Infect. 2007;
23. Al-Yousif Y, Anderson J. Chard-Bergstrom C, 135(8): 1331-1337.
Bustamante A, Muenzenberger M, Austin K, Kapil
30. Al Awaidy SA, Bawikar S, Busaidy S: Considerations
S. Evaluation of a latex agglutination kit (Virogen
for introduction of a rotavirus vaccine in Oman:
Rotatest) for detection of bovine rotavirus in fecal
rotavirus disease and economic burden. J Infect Dis
samples. Clin. Diagnos Lab. Immunol. 2001; 8:
2009, 200(Suppl 1): S248- S253.
496-498.
31. Teleb N. Rotavirus Surveillance Network in the
24. Ahmed H, Coulter B, Nakagomi O. Molecular
Eastern Mediterranean regional. Presented at the
characterization of Rotavirus gastroenteritis
8th International Rotavirus Symposium 2008,
strains, Iraqi, Kurdistan. Emerg. Infect Dis. 2006;
June 3-4 Istanbul.
12(5).
Effect of Adding Medicinal Plant Extracts to The Broiler Diets

on Productive Performance
Huda Q. Al-Himdany1, Fadhil R. Abbas2, Ahmed A. Allaw3

1
College of Agricultural Engineering Sciences, University of Baghdad, Iraq; 2College of Agriculture,
University of Al Qasim Green, Iraq; 3College of Agriculture, University of Tikrit, Iraq
Abstract
Considering approaches to efficiently produce broiler, Therefore, this study was conducted to demonstrate
the effect of adding some extracts to medicinal plants (Oleobiotec®) in increasing the efficiency of production
performance of broiler,for the period from 12 February to 18 March 2016. In this study, 192 chicks (Ross
308) one day old were randomly distributed to four treatments, each including three replicates of 16 birds,
which were: Control group T1 (without addition) and the treatments T2, T3 and T4 which received extracts
to medicinal plants(Oleobiotec®)at concentrations 100, 150 and 200 mg/kg feed respectively. The results of
this study indicated that the addition of Oleobiotec® to the broiler diet, particularly T3 and T4 enhance the
production performance of broiler especially in body weight and weight gain. Also, the results showed a
significant improvement in the feed conversion ratio for T3 (150 mg Oleobiotec®/kg feed). Also, the results
revealed no significant effect in feed consumption rate in all treatments and for all periods except two week.
Its was concluded from the results of this experiment that’s adding different levels of Oleobiotec® to the broiler
diet enhance the productive traits of birds especially for the treatment T3 (150 mg Oleobiotec®/kg feed).
Keywords: extracts to medicinal plants (Oleobiotec®), Broiler, Productive performance
Introduction 12 years of research and experiments which contain

effective substances that increase the metabolic rate of
The continuous use of industrial antibiotics as food and supply the body with oxygen and nutrients7.
growth promoters in poultry diets led to the emergence It also contains phenolic compounds such as Thymol
of resistant bacteria, which prompted Europe Union and Carvacrol, which are highly effective antioxidants
countries to ban their use in 20061. The researchers and thus protect red blood cells from damage caused
encouraged the selection of many alternatives, including by oxidation as antioxidant activity improves through
probiotics, prebiotics, Organic acids, enzymes, herbs and the transport of oxygen needed to form hemoglobin8,9
medicinal plants. Most of these substances are natural as well as contains both terpenoids and flavonoids
sources that work towards enhancing the environment of within essential oils and spices which acts as anti-
digestive tract and enhance immunity through its role as inflammatory and work to maintain the level of white
antifungal and antibacterial2. Using of medicinal plants blood cells within the normal range10,11, also it contains
as additives to the broiler diets has great importance an active substances as Cinnamaldehyde which has a
due to their containment of effective substances such significant role in enhancing the function of the immune
as flavins, glycosides, polyphenols, terpenoids and system in the bird body12. Furthermore, the Oleobiotec®
saponens3. Plant oils or extracts can be used as an contain Shogaol and Zingerone that’s act as antibacterial
alternative to antibiotics because these plants have agents. Oleobiotec® product is a mixture of extracts of
antibacterial efficacy as well as their beneficial effect on six medicinal plants, three of which are essential oils of
the digestive system4,5 and improve immune status and each of the plants of Marjoram, Thyme, Cinnamon and
support growth and public health without toxic residues the other three components are powder of spices for each
that may be caused by drugs and antibiotics6. of the Ginger, Turmeric and Pepper plants, this product
The Oleobiotec®, extracted from a number of specialized for poultry nutrition is a fine yellow powder
medicinal plants and spices, has been used for nearly added to the broiler diets by 100 g/ton13.
Therefore, the aim of this study was to know the Conted…

effect of adding the Oleobiotec® product to the diets on
the production performance of the broiler chicks. Soybean meal 28 20
Protein concentration (1)
10 10
Materials and Method Sunflower oil 3 3
This study was conducted in the poultry field of Limestone 1 1.2
the Department of Animal Production at the College of Salt 0.3 0.3
Agriculture/Al-Qasim Green University for the period Calculated chemical structure (2)
from 12 February to 18 March 2016 to investigate the Crude protein 22.74 20.16
effects of adding different levels of Oleobiotec® products
ME, Kcal/Kg feed 3078 3125.2
to the diets on the production performance of broiler. In
Lysine% 1.02 0.95
this study, 192 chicks (Ross 308) of one day old were
randomly distributed to four treatments with 48 chicks Methionine + cystine (%) 0.83 0.75
per treatment, each treatment included three replicates Calcium% 0.97 1.0
of 16 birds. Chicks were weighed and distributed to Available phosphorus % 0.41 0.48
the treatments which were: T1 control group (without (1)
Life Company – Jordan, contain 44% protein 2800
addition) and the treatments T2, T3 and T4 received
k.cal, 12% fat, 25% ash, 5% calcium, 2.9% phosphorus,
Oleobiotec® at concentrations 100, 150 and 200 mg/
2.55% Methionine+Cysteine, 2.8% lysine.
kg feed respectively. The chicks were breed in ground
cages its dimensions are 2x2 m covered with sawdust, Chemical structure was calculated according to the
(2)
water introduced to the chicks ad libitum while diet analysis of diet material found in NRC
was given to the chicks as starter and finisher diets
(table 1). The experiment continued for 35 days and the Results and Discussion
productivity traits were measured for each week of the
experiment which included body weight, weight gain, Table 2 shows the effect of adding different
Feed consumption and Feed Conversion Ratio (FCR). concentration of Oleobiotec® to broiler diet on the mean
Complete Randomized Design were used to study the of body weight during the weeks of the experiment. The
effect of treatments on the studied traits and comparing results revealed a significant increasing (P <0.05) for the
the significant differences between the means using treatments T1 and T4 in body weight which were (169.0
Duncan test14, while the Statistical Analysis System and 167.6 g) respectively, compared with T3 that’s
(SAS) was used to analyze the data statistically15. recorded less mean of body weight 160.3 g in the first
Table 1: Ingredient composition and chemical week of experiment. While no significant differences
analysis of the basal diet were found between all treatments for the period 2, 3 and
4 weeks of experiment. Whereas, at the 5 week period
Starter Finisher the results showed a significant increase (P <0.05) for
Feed ingredient%
(1-21 d) (22-35 d) the treatments T3 and T4 compared with T1 which were
Yellow corn 30 30 2083, 2070.3 and 1963.6 g respectively.
Wheat 27.7 35.5
Table 2: Effect of adding different levels of Oleobiotec® to the broiler diets on average live body weight
(g/bird) (mean ± standard error)
Body weight (g)
Treatments
1w 2w 3w 4w 5w
T1 169.00 ± 0.00 a 446.00 ± 4.00 856.33 ± 12.81 1404.00 ± 18.01 1963.67 ± 18.01 b
T2 161.33 ± 2.72 ab 458.67 ± 10.33 846.00 ± 24.55 1422.00 ± 21.00 2015.33 ± 15.33 ab
T3 160.33 ± 1.33 b 462.67 ± 6.33 864.67 ± 14.67 1374.67 ± 32.62 2083.00 ± 27.15 a
T4 167.67 ± 3.71 a 454.33 ± 8.98 862.33 ± 15.14 1383.00 ± 29.14 2070.33 ± 4.63 a
Significant * N.S N.S N.S *
a,bMeans within the same column with different letters are significantly different p < .0.05.
N.S: no significant
The results of effect adding different concentration of Oleobiotec® to the broiler diet on weekly weight gain (g)
are summarizing in table (3). The result shows a significant increase (P <0.05) in weight gain (g) for the treatment
T1 at one week of experiment compared with T3 which were 126.3 and 118.3 g, respectively. While the results
revealed no significant differences between the treatments at, 3 and 4 weeks of experiment. Whereas, the treatments
T3 and T4 indicate to a significant increasing (P <0.05) in the weight gain compared with the treatment T1 at 5 week
of experiment which were 708.3, 687.3 and 559.6 g, respectively. Also, the cumulative weight gain revealed to a
significant increasing (P<0.05) for the treatments T4 and T3 compared with control treatment T1.
Table 3: Effect of adding different levels of Oleobiotec® to the broiler diet on Body weight gain (g/bird)
(mean ± standard error)
Body weight gain (g/bird)

Treatments
1w 2w 3w 4w 5w (1-5)w
T1 127.00 ± 0.33 a 277.00 ± 4.33 410.33 ± 12.47 547.67 ± 5.29 559.67 ± 43.55 b 1921.67 ± 41.83 b
T2 119..33 ± .2.64 ab 297.34 ± 7.88 387.33 ± 18.98 576.00 ± 18.73 593.33 ± 36.33 ab 1973.33 ± 15.17 ab
T3 118.33 ± 1.33 b 302.34 ± 5.89 402.00 ± 12.74 510.00 ± 21.28 708.33 ± 29.45 a 2041.00 ± 29.45 a
T4 125.67 ± 3.71 ab 286.66 ± 12.11 408.67 ± 10.89 520.67 ± 43.06 687.33 ± 24.63 a 2028.33 ± 4.93 a
Significant * N.S N.S N.S * *
Means within the same column with different letters are significantly different p < .0.05.
a,b
N.S: no significant
The results of table (4) manifest the effect of the addition of Oleobiotec® to broiler diet on the weekly and
accumulative feed consumption rate. The results of Table (4) showed that there were no significant differences
between the experimental factors in the feeding consumption rate at the first, third, fourth and fifth week of the
experiment
The treatments T2, T3 and T4 appeared a significant decrease (P <0.05) in the feed consumption rate during
the second week compared with control group T1. Also, the results revealed no significant differences between the
experiment treatments in the accumulative feed consumption rate (1-35 day).
Table 4: Effect of adding different levels of Oleobiotec® to the broiler diet on Feed consumption rate (g/bird)
(mean ± standard error)
Feed consumption rate (g/bird)

Treatments
1w 2w 3w 4w 5w (1-5)w
T1 155.33 ± 3.92 469.67 ± 6.35 a 636.00 ± 5.29 909.67 ± 42.60 1279.00 ± 52.55 3449.67 ± 37.49
T2 152.67 ± 2.02 435.33 ± 6.38 b 657.33 ± 10.33 896.00 ± 23.06 1224.33 ± 53.18 3365.67 ± 40.22
T3 155.00 ± 2.64 437.33 ± 3.33 b 638.67 ± 2.91 870.00 ± 10.69 1343.67 ± 28.69 3444.67 ± 27.76
T4 162.66 ± 6.17 440.00 ± 2.00 b 635.33 ± 9.21 898.67 ± 30.96 1307.00 ± 37.87 3443.67 ± 36.24
Significant N.S * N.S N.S N.S N.S
Means within the same column with different letters are significantly different p < .0.05.
a,b
N.S: no significantly
Table 5 shows the effect of supplementation different 1.3 and 1.22 respectively. while the results indicate
levels of Oleobiotec® product to the broiler diet on feed to a significant decrease (P <0.05) in the FCR for the
conversion ratio (FCR). At 1 week of experiment the treatments T2 and T3 compared with control group T1
results appeared a significant increase (P <0.05) in the for the period 2 week which recorded 1.46, 1.44 and
FCR for the treatment T3 compared with T1 which were 1.69 respectively. No significant differences were found
between all treatments at the third and fourth week of age, From the results of the present study, it was concluded
while in the fifth week the results observed a significant that all enhancements observed in the productive traits for
decrease (P <0.05) for the treatments T3 and T4 which the treatments T2, T3 and T4 may be due to containing
reached 1.9 for each compared with the control treatment the previous treatment on different levels of Oleobiotec®
product and its containing a number of medicinal plants
T1 which reached 2.29. As well as, accumulative FCR
and its active compounds improved the taste of diet and
for the period from 1 to 35 days, showed a significant improve appetite and health of birds, then improved
decrease (P <0.05) for the treatment T3 compared with digestion and absorption, which had a positive effect on
control group which were 1.68 and 1.79 respectively. the qualities of productivity.
Table 5: Effect of adding different levels of Oleobiotec® to the broiler diet on feed conversion ratio (g feed/g
gain) (mean ± standard error)
Feed conversion ratio (g feed/g gain)

Treatments
1w 2w 3w 4w 5w (1-5)w
T1 1.22 ± 0.02b 1.69 ± 0.05a 1.55 ± 0.06 1.66 ± 0.06 2.28 ± 0.11a 1.79 ± 0.03a
T2 1.27 ± 0.02ab 1.46 ± 0.04b 1.69 ± 0.09 1.55 ± 0.05 2.06 ± 0.11ab 1.70 ± 0.01ab
T3 1.31 ± 0.02a 1.44 ± 0.02b 1.58 ± 0.05 1.70 ± 0.06 1.89 ± 0.11b 1.68 ± 0.03b
T4 1.29 ± 0.01ab 1.53 ± 0.06ab 1.55 ± 0.05 1.72 ± 0.17 1.90 ± 0.12b 1.69 ± 0.02ab
Significant * * N.S N.S * *
a,bMeans within the same column with different letters are significantly different p < .0.05.
N.S: no significant
The birds that fed diet supplemented by 150 and a capsules containing different levels of Oleobiotec® at
200 mg Oleobiotec®/kg feed enhanced the amount of 50, 100 and 150 ppm three times per week.
feed consumed then improve the FCR which increased
the birds weight and this significant enhancement in Conclusion
productive parameters may be due to containing the
Oleobiotec® product to many effective compounds The results of current study shows that supplementing
that acts as antioxidant16,17,18. The oils found in the 150 mg of Oleobiotec® per kg feed enhanced the
productive performance traits of the broiler.
Oleobiotec® formula are rich in essential fatty acids that
enough the needs of body for growth. These ingredients Conflict of Interest: None
also improve the nutritional value of nutrients trough
stimulation the secretion of a number of digestive Source of Funding: self
enzymessuch as Lipase, Amylase and Protease which Ethical Clearance: Not required.
has an important role in the process of digestion and
absorption through its prominent role in the analysis
References
of fat, carbohydrate and protein components19,20.
The Oleobiotec® product contains aromatic oils that 1. Grashorn MA. Use of Phytobiotics in broiler
contain an active ingredients as Carvacrol, Thymol nutrition an alternative to in feed antibiotics. J.
Animal and Feed Sci. 2010. 19 : 338-347.
and Eugenol, which in turn stimulates digestion and
increases the digestibility of nutrients as well as its role 2. Panda K, Rama-Rao SV, Raju MV. Natural growth
as antimicrobial, antiviral, antifungal and gas expeller, promoters have potential in poultry feeding
and these active substances promote metabolism of systems. Feed Tech. 2006, 10 (8) : 23-25.
proteins, carbohydrates and fats, and thus increase the 3. Tipu MA, Akhtar MS, Anjum MI, Raja ML. New
rate of growth21,22,23. These factors were reflected in the dimension of medicinal plants as animal feed. Pak
improvement of the productive parameters of the birds. Veter J. 2006, 26:144 –148.
These results agreed with Noaman and Allaw7, that’s 4. Acamovic T, Brooker JD. Biochemistry of plant
confirmed the existence of a significant enhancement in metabolites and their effects in animals. Proc.
the productive parameters when fed the broiler chicks on Nutr. Soc. 2005. 64, 403–412.
5.
Wenk C. Are herbs, botanicals and other 14. Duncan BD. Multiplerange and multiple f-test
related substances adequate replacements for Biometrics, 1955. 11:1-42.
antimicrobial growth promoters? In: Barug, D.,
15. SAS. SAS/STAT Users Guider for Personal
de Jong, J., Kies, A.K., Verstegen, M.W.A. (Eds.),
Computers Release 901 SAS. Institute Inc. Cary
Antimicrobial Growth Promoters. Wageningen
and N.C USA. 2110.
Academic Publishers, The Netherlands, 2006. pp.
329–340. 16. Ruby AJ, Kuttan G, Babu KD. Anti – tumor
and antioxidant activity of natural curcuminoids
6. Toghyani M, Toghyani M, Zamanizad M, Shahryar
cancerlett, 1995. 94: 79 – 83.
HA. Assessment of performance, immune
responses, serum metabolites and prevalence of 17. Botsoglou NA, Christaki E, Florou–Paneri P,
leg weakness in broiler chicks submitted to early Giannenas I, Papageorgiou G, Spais AB. The
age water restriction. Trop. Anim. Health Prod. effect of a mixture of herbal essential oils or α–
2011. 43, 1183-1189. tocopheryl acetate on performance parameters
And oxidation of body lipid in broilers. S. Afr. J.
7. Noaman HA, Allaw AA. The effect of Drenching
Anim. Sci. 2004. 34: 52–61.
Vegetable Preparation Oleobiotec®® in The
Productive Performance of Broiler Ross 308. 18. Bozin B, Mimica-Dukic N, Simin N, Anackov
Journal of Tikrit University For Agriculture G. Characterization of the volatile composition
Sciences. 2016. 16(1): 88-95. of essential oils of some lamiaceae spices and
the antimicrobial and antioxidant activities
8. Jamroz D, Kamel C. Plant extracts enhance broiler
of the entire oils. J. Agric Food chem. 2006.
performance. J.Anim. Sci., 2002. 80 (suppl. 1): 41
8:54(5):1822-B.
(Abstract).
19. Yamahara C. Gastrointestinal Motility Enhancing
9. Bolukbasi S, Erhan M. Effeet of Dietray Thyme
Effect of Ginger and its Active Constituents.
(Thymus vulgaris)on layin, Mens performance
Chem. Pharm. Bull. 1990. 38(2):430-431.
and Escherichia coli (E.coli) Concentration in
Feces. Ataturk University Tty, the Faculty of 20. Yamamoto A, Gaynor D. Therapeutic potential of
Agriculture, Dep. of Anim. Sci., 2007. 25240, inhibition of the NFKB pathway in the treatment
Erzurum, Turkey. of inflammation 7 Cancer. J. Clin. Investigation.
2006. 107 (2):135
10. Blomhroff R. Antioksidants and oksidatif stres
Tidsskr Nor Laegeforen, 2004. 17:124 (12):1643-5. 21. Lee KW, Evarts H, Beynen AC. Essential oil in
broiler nutrition. Int. J. Poult. Sci. 2006. 3: 738 -
11. Anderson RA. Chromium and polyphenols from
752.
cinnamon improve insulin sensitivity. Proc. Nutr.
Soc.; 2008. 67(1):48-53. 22. Razooqi AJ. Effect of addition ginger rhizomes
powder to the water feed on productive
12. Yahaya O, Yabefa JA, Umar IO, Datshen MM,
performance of broiler. Diyala Journal of
Egbunu ZK, Ameh J. Combine antimicrobial
Agricultural Sciences, 2011. vol: 3(2),p:558-567.
effect of ginger and honey on some human
pathogens. Pharmacology and Toxicology. 2012. 23. Saeid JM, Ismail IH, AL-Baddy MA, Mohamed
3 (5) 237-239. AB, Shelah AA. The Use of Some Plant Extracts
as Growth Promoter in Broiler Chickens. Journal
13. Noirot V, Phodé SA. A natural alternative to
of Tikrit University for Agriculture Sciences,
poultry growth promoters. Journal of International
2011. Vol: 11 (2) P: 306-319.
Poultry Production. 2009. 17(8): 15-17.
Structural Behavior Analysis of Building Environment

Automation System in Pharmaceutical Industries
Jacky Chin1, Lin Shu-Chiang2, Satria Fadil Persada3, Ilma Mufidah4, Choesnul Jaqin1
Department of Industrial Engineering, Mercu Buana University, Jakarta, Indonesia; 2Department of
1
Business Management, Texas Health and Science University, Texas, USA; 3Department of Business
Management, Institut Teknologi Sepuluh Nopember, Surabaya, Indonesia; 4Department of Industrial
Engineering, Telkom University, Bandung, Indonesia
Abstract
An automation system in industry is evolving significantly over recent years. Beside the quality of the
system, one of the aspects determining the success of acceptance a new system is user’s perception. This
research examines influential factors of user’s behavioral intention in building environment automation
system practical use. A development model of the Theory of Planned Behavior (TPB) with three internal
factors, Attitude (ATT), Subjective Norm (SN), and Perceived Behavioral Control (PBC), was developed to
predict the behavior of managerial level when deciding whether to implement a new system, which was the
Building Automation System (BAS) in pharmacy industry. The study found statistically significant support
for the hypothesized model, indicating that the tested relationships between the factors and behavioral
intentions to use BAS were positively significant. These findings can be served for explaining the behavior
intention for users within the context of a building automation system.
Keywords: behavioral intention, theory of planned behavior, building environment automation, attitude,
perceived behavioral control.
Introduction sector was the sector with the highest share of total
energy consumption by the amount of 33% (1). In order
In the past, less automation systems for building to respond to the competitive energy environment, in
used towards energy and environmental management, the current global economic crisis, Indonesia faces
primarily for monitoring of energy consumption, with numerous challenges associated with growing energy
insufficient control functions and high dependence on demand and high-energy cost. To accomplish this
the human factor. Nowadays, Building Automation advantage, many ASEAN countries have adopted the
Systems (BAS) becomes increasingly popular to use in energy-efficiency programs, which focus on automation
many types of building. In an industrial building, BAS system in industries (2).
was applied to control supply of electricity, lighting,
cooling system, heating system, ventilation, etc. The current study aims to explore factors that
influence user’s acceptance in building automation
In southeast Asia, Indonesia was the largest energy system that has been implemented in the industries.
consumer, with 36% of the region’s total primary Several literatures exposed that the performance of
consumption (1). As of 2013, the country’s industrial the smart Building Automation System (BAS) benefits
reduce energy expense expressively for electricity
consumption, especially in commercial buildings (3-
10)
. Similar studies that observed the users’ behavior in
BAS or smart grid through structural equation modelling
Jacky Chin
concentrated on residential housing, commercial
Department of Industrial Engineering,
housing and general-purpose use of energy (11-13) instead
Mercu Buana University, Jakarta, Indonesia
in industrial sector (10).
Email: jacky.chin@mercubuana.ac.id
Materials and Method PU means a degree to which a person accepts as true

that using a certain system would enrich his or her
Nowadays, BAS are currently being developed to job performance and PEOU means a degree to which
be applied in buildings, namely the “green buildings”, a person accepts that using a certain system would be
for environmental and energy controlling (3). Indeed, the free of struggle. According to Davis, the perceived ease
application of these systems has become increasingly of use and perceived usefulness have direct correlations
popular, revealing the ongoing interest of the scientific to the factor attitude and have associations with the
community on this topic (14). The submission of a behavior intention to use (24). TAM is able to determine
traditional quantitative control method based on the the perceived ease of use and perceived usefulness of
preset continuous values of physical parameters is not technology applications can affect users’ utilization
enough for users’ response in the indoor environment efficacy of system (12, 25). Furthermore, in BAS behavior
(10, 15)
. The checking items contain of observing of study, PEU and PU are reflected as the key factors that
consumption in lighting, production electricity supply impact user intention to use smart monitoring. PU has
for machines, heating ventilation air conditioning in a relationship to ATT (10), while PU is a factor that was
building and several others (5, 8, 16). proposed by the authors, as proven in previous research
Theory of Planned Behavior (TPB) is able to has indirect relationship with PEOU (26).
investigate the factors of user’s behavior towards using In addition to TPB model, this research also observes
information technology or in adoption new technology. the correlation between the two constructs PEOU and
Similar with TPB, Technology Acceptance Model PU. These relationships are not being investigated in
(TAM) shows that users’ intention directly affects their previous studies that employed TPB as the theoretical
actual behavior (10, 16-20). The research uses an extension framework. Following their illustration, we hypothesized
of TPB model by including TAM external factors, PEOU that ATT, SN and PBC will influence BI, respectively.
and PU. Behavior intention can be affected by perceived Finally, our study contributes to this gap literature by
behavioral control, subjective norm, and attitude (21). discovering the correlation between two core TAM
Attitude (A) can be described as the degree of which variables and the three core TPB variables. The findings
the users follows their negative or positive emotion to of these studies show that internal factors and external
use new technology (16, 22). Subjective Norm (SN) can be factors are crucial elements of user’s acceptance and
described as the perceived public burden to complete or adoption of new system. Therefore, our study examines
not to complete the behavior (17, 21). Perceived Behavioral the important role of those factors in understanding user
Control (PBC) can be described as difficulty of control participation intention. In summary, six hypotheses in
the behavior, which is assumed to “reflect past experience Table 1 are assembled based on extension of TPB model
as well as predicted impediments and obstacles (17, 21, 23). in predicting adoption behavior of BAS usage.
Table 1: Research hypotheses

Item Hypothesis Reference
H1 Perceived Usefulness (PU) is positively affecting Attitude (ATT) of users to use BAS (31, 32). (10, 16, 24, 33)
Perceived Expected Ease of Use (PEOU) is positively affecting Attitude (ATT) of users to
H2 (10, 16, 24, 33)
use BAS (31, 32).
Perceived Expected Ease of Use (PEU) is positively affecting Perceived Expected
H3 (10, 16, 24, 33)
Usefulness (PU) of users to use BAS(31, 32).
Attitude (ATT) is positively affecting Behavioral Intention to Use (BI) of users to use
H4 (10, 16, 22, 24, 33)
BAS(31, 32).
Perceived Behavioral Control (PBC) is positively affecting Behavioral Intention to Use
H5 (20, 23, 34)
(BI) of users to use BAS.
Subjective Norm (SN) is positively affecting Behavioral Intention to Use (BI) of users to
H6 (17, 21-23)
use BAS.
The sample of this research is from Indonesia, which was considered as the biggest country in Southeast Asia.
To assess our research model, we employed the online questionnaire survey from December 2014 to April 2015. The
respondents who have used BAS for building monitoring for more than 6 months were asked to join in the survey.
Among the 157 respondents, 86% of the respondents are between 18 and 28 years old and 14% were between 29
and 38. All respondents filled out the same questionnaire, which are represent of six latent of behavior technological
adoption factors in BAS. All the observed item was measured on a 5-point Likert-type scale with anchors ranging
from “1 = strongly disagree” to “5 = strongly agree”(27).
The confirmatory factor analysis was conducted to test a measurement all factors based on reliability and validity.
next, a structural equation modelling (SEM) was used to examine the structural relationships among the factors in
our model (10). As displayed in Table 2, The result of the model shows positive values for six path correlations for
both external factors and internal factors of TPB. Furthermore, most hypothesized path of the influencing factors to
behavior intention of use BAS are statistically significant except for one paths, which is SN to BI (Hypothesis 5).
PU positively correlated with ATT (Hypothesis 1), PEOU positively correlated with ATT (Hypothesis 2), and PEOU
positively correlated with PU (Hypothesis 3). Moreover, in basic internal factors of TPB, ATT positively correlated
with BI (Hypothesis 4), and PBC positively correlated with BI (Hypothesis 6).
Table 2: Hypotheses results
Hypothesis Relationship Estimate (β) Significance (p) Result

H1 ATT ← PU 0.784 0.004*** Supported
H2 ATT ← PEOU 0.503 0.006*** Supported
H3 PU ← PEOU 0.341 0.005*** Supported
H4 BI ← ATT 0.624 0.02** Supported
H5 BI ← SN 0.014 0.13 Rejected
H6 BI ← PBC 0.561 0.007*** Supported
This study used AMOS software for the reliability and the convergent validity statistical test of the questionnaire,
as presented in Table 3. All the value of our factor loadings exceeded the recommended minimum measurement (0.7)
(28)
. The second measurement was Cronbach’s α, and each questionnaire item exceed the minimum measurement of
the Cronbach’s α value (0.7) (29). As shown in Table 3, the measure of composite reliability exceeds the minimum
requirement (>0.6), and the last measurement, the six factors exceed the minimum measurement for the AVE
measures (>0.5) (30).
Table 3: Realibility and Validity Results
Factor Item Factor Loadings Cronbach’s α CR AVE

PU1 0.83
PU 0.79 0.80 0.60
PU2 0.70
PEOU1 0.66
PEOU PEOU2 0.75 0.77 0.82 0.57
PEOU3 0.81
ATT1 0.70
ATT 0.85 0.86 0.62
ATT2 0.83
SN1 0.96
SN SN2 0.93 0.92 0.91 0.81
SN3 0.89
Conted…
PBC1 0.91
PBC PBC2 0.83 0.88 0.89 0.78
PBC3 0.87
BI1 0.74
BI 0.74 0.87 0.76
BI2 0.82
All the model fit parameter results meet four (R2 = 56%). Finally, our study results demonstrate that
criteria for the recommendation of model fit, namely ATT and PBC had a significant influence on BI. Hence,
Root Mean Square Error of Approximation (RMSEA), Hypothesis 4 and Hypothesis 6 were supported.
Goodness-of-Fit Index (GFI), Comparative Fit Index
(CFI), and Normed Fit Index (NFI), as described in the The latent variables of perceived ease of use and
measurement model fit testing in Table 4. perceived usefulness were integrated as external factors
into TPB. Those factors influence user’s intention
through the attitude, perceived ease of use and perceived
Table 4: Model Fit Test Results
usefulness The result from the framework model of
Model fit Minimum extended TPB is very useful to provide an understanding
Model Result
parameters value of aspects of the user’s adoption of BAS technology in
RMSEA < 0.05 0.041 manufacturing. Finally, according to the result of path
GFI > 0.90 0.922 correlations, the final model contributes 56% (R2 = 56%)
CFI > 0.90 0.914 to the real situation, indicating that the research factors
NFI > 0.90 0.918 can represent 56% of total intention to use of BAS.
We expect the outcomes of this research to deliver

Conclusions insight for future study on enhancing the theoretical of
Our research model focuses on explaining the TPB in BAS by collaborating with other related factors.
fundamentals how the attitude is formed and how it leads The results from our study support that PU, PEOU, ATT,
to the eventually adopting behavior intention of use BAS and PBC are become as an important role in predicting
in pharmacy manufacturing. Therefore, the research technology adoption behavior of BAS. Therefore,
framework integrates TPB with two external factors of the system must be considered to distribute various
TAM, in a complementary manner to completely predict controlling tasks in order to reduce the usefulness, and
system use of BAS in organizations. Past research which enhance ease of use of the system.
only reported part of this framework, focused on the Conflicts of Interest: The authors declare no conflict of
social and technical factors affecting adoption behavior interest.
of smart grid. The validation of this framework is crucial
in terms of developing a new research approach in a Source of Funding: Self
similar application.
Acknowledgments
The result explained the R2 and path correlation
for all hypotheses. The relationships between PU (β = The authors would like to thank companies in
0.784, p < 0.01), PEOU (β = 0.503, p < 0.01), and ATT Indonesia and individuals for their assistance and
were positive and significant. Next, PEU (β = 0.341, p support during the planning and execution of this
< 0.01) has a significant influence on PU. The model research. Laurensia Mei Lie for support to edit and run
testing results explained 63.8% of the variance in ATT. the software.
SN (β = 0.014, p > 0.05) was not significant affected BI,
then hypothesis 5 were not supported. ATT (β = 0.624, Ethical Clearance: Taken from Mercu Buana University
p < 0.01) and PBC (β = 0.561, p < 0.05) positively and committee, and based on COPE’s Best Practice
significantly affected BI, explaining the variance of BI Guidelines.
References buildings in Indonesia. Applied Energy.

2014;128:336-49.
1. DEN. Outlook Energi Indonesia. 2014.
13. Fung C, Tang S, Wong K, editors. A proposed
2. WEO. Southeast Asia Energy Outlook & WEO
study on the use of ICT and smart meters to
2013 Special Report. World Energy Outlook
influence consumers’ behavior and attitude
Special Report. 2013.
towards Renewable Energy. Power and Energy
3. Marinakis V, Karakosta C, Doukas H, Androulaki Society General Meeting, 2010 IEEE; 2010:
S, Psarras J. A building automation and control IEEE.
tool for remote and real time monitoring of energy
14. Wong J, Li H, Wang S. Intelligent building
consumption. Sustainable Cities and Society.
research: a review. Automation in construction.
2013;6:11-5.
2005;14(1):143-59.
4. Müller E, Poller R, Hopf H, Krones M. Enabling
energy management for planning energy-efficient 15. Yao R, Zheng J. A model of intelligent building
Factories. Procedia CIRP. 2013;7:622-7. energy management for the indoor environment.
Intelligent Buildings International. 2010;2(1):72-80.
5. Aslam W, Soban M, Akhtar F, Zaffar NA. Smart
meters for industrial energy conservation and 16. Chin J, Lin S-C. A behavioral model of managerial
efficiency optimization in Pakistan: Scope, perspectives regarding technology acceptance
technology and applications. Renewable and in building energy management systems.
Sustainable Energy Reviews. 2015;44:933-43. Sustainability. 2016;8(7):641.
6. Rocha P, Siddiqui A, Stadler M. Improving energy 17. Chin H-C, Choong W-W, Alwi SRW, Mohammed
efficiency via smart building energy management AH. Using Theory of Planned Behaviour to
systems: A comparison with policy measures. explore oil palm smallholder planters’ intention
Energy and Buildings. 2015;88:203-13. to supply oil palm residues. Journal of Cleaner
Production. 2016;126:428-39.
7. Ngai EWT, Chau DCK, Poon JKL, To CKM.
Energy and utility management maturity 18. Lin S-C, Persada SF, Nadlifatin R, Tsai H-Y,
model for sustainable manufacturing process. Chu C-H. Exploring the influential factors of
International Journal of Production Economics. manufacturers’ initial intention in applying
2013;146(2):453-64. for the green mark ecolabel in Taiwan.
International Journal of Precision Engineering
8. Figueiredo J, Sá da Costa J. A SCADA system and Manufacturing-Green Technology.
for energy management in intelligent buildings. 2015;2(4):359-64.
Energy and Buildings. 2012;49:85-98.
19.
Nadlifatin R, Razif M, Lin S-C, Persada
9. Fong KF, Hanby VI, Chow TT. HVAC system SF, Belgiawan PF. An assessment model of
optimization for energy management by Indonesian citizens’ intention to participate
evolutionary programming. Energy and Buildings. on environmental impact assessment (EIA): a
2006;38(3):220-31. behavioral perspective. Procedia Environmental
10. Chin J, Lin S-C. Investigating users’ perspectives Sciences. 2015;28:3-10.
in building energy management system with an 20. Persada SF. Pro Environmental Planned Behavior
extension of technology acceptance model: a case
Model to Explore the Citizens’ Participation
study in indonesian manufacturing companies.
Intention in Environmental Impact Assessment:
Procedia Computer Science. 2015;72:31-9.
an Evidence Case in Indonesia. 2016.
11.
Lowry G. Modelling user acceptance of
21. Lee CJ, Geiger-Brown J, Beck KH. Intentions
building management systems. Automation in
and willingness to drive while drowsy among
Construction. 2002;11(6):695-705.
university students: An application of an extended
12. Chou J-S, Gusti Ayu Novi Yutami I. Smart meter theory of planned behavior model. Accident
adoption and deployment strategy for residential Analysis & Prevention. 2016;93:113-23.
22. Ajzen I, Fishbein M. Understanding attitudes and 30. Subramanian N, Gunasekaran A, Yu J, Cheng J,
predicting social behaviour. 1980. Ning K. Customer satisfaction and competitiveness
in the Chinese E-retailing: Structural equation
23. Ajzen I. Perceived behavioral control, self-
modeling (SEM) approach to identify the role of
efficacy, locus of control, and the theory of planned
quality factors. Expert Systems with Applications.
behavior. Journal of Applied Social Psychology.
2014;41(1):69-80.
2002;32(4):665-83.
31. Chin J, Jiang B, Mufidah I, Persada S, Noer
24.
Davis FD. User acceptance of information
B. The investigation of consumers’ behavior
technology: system characteristics, user perceptions
intention in using green skincare products: a
and behavioral impacts. International journal of
pro-environmental behavior model approach.
man-machine studies. 1993;38(3):475-87.
Sustainability. 2018;10(11):3922.
25. Pai F-Y, Huang K-I. Applying the technology
32. Mufidah I, Jiang BC, Lin S-C, Chin J, Rachmaniati
acceptance model to the introduction of healthcare
YP, Persada SF. Understanding the consumers’
information systems. Technological Forecasting
behavior intention in using green ecolabel product
and Social Change. 2011;78(4):650-60.
through pro-environmental planned behavior
26. Davis FD, Bagozzi RP, Warshaw PR. User model in developing and developed regions:
acceptance of computer technology: a comparison lessons learned from Taiwan and Indonesia.
of two theoretical models. Management science. Sustainability. 2018;10(5):1423.
1989;35(8):982-1003.
33. Wallace LG, Sheetz SD. The adoption of software
27. Lin S-C, Persada SF, Nadlifatin R, editors. A study measures: A technology acceptance model
of student behavior in accepting the Blackboard (TAM) perspective. Information & Management.
Learning System: A Technology Acceptance 2014;51(2):249-59.
Model (TAM) approach. Computer Supported
34. Persada S, Lin S, Nadlifatin R, Razif M.
Cooperative Work in Design (CSCWD),
Investigating the citizens’ intention level in
Proceedings of the 2014 IEEE 18th International
environmental impact assessment participation
Conference on; 2014: IEEE.
through an extended theory of planned behavior
28. Hooper D, Coughlan J, Mullen M. Structural model. Global Nest Journal. 2015;17(4):847-57.
equation modelling: Guidelines for determining
model fit. Articles. 2008:2.
29. Cronbach LJ. Coefficient alpha and the internal
structure of tests. Psychometrika. 1951;16:297-334.
The Impact of Radiation on Total Thrombocyte of Hospital

Radiology Workers in Kupang
Jannes Bastian Selly1,3, Andreas Umbu Roga2, Noorce Christiani Berek2, Luh Putu Ruliaty2, Jacob M. Ratu2
1
Master Program in Public Health Sciences, 2Faculty of Public Health, University of Nusa Cendana, NTT
Indonesia; 3University of Citra Bangsa Kupang, NTT Indonesia
Abstract
Ionizing radiation that used in diagnosis and treatment process in hospital is not only providing the benefits,
but also has negative impact on health. The officer in radiology installation of hospital has high risk of
decreased number of thrombocyte, due to exposure experienced countinously during the work. The previous
study using mice as object of research, found that exposure to ionizing radiation resulting in a decrease in
the number of thrombocytes. Decreased total thrombocytes caused by the damage to cell. Thrombocytes
destruction post-irradiation is 15 times faster than the recovery. This study aimed to analyze the effects
of radiation exposure on the total thrombocyte of workers in radiology installation in hospital of Kupang.
Subjects in this study were 20 workers from 3 hospitals selected by purposive sampling technique. This
research was an observational analytic with cross sectional approach. Data used are exposure doses and blood
examination results carried out together within a period of 1 year. The result was shown that the average
dose of radiation exposure received by the officer during working for 1 year was 0.776 mSv. This value
was still relatively safe because it was below the dose limits set by International Commision for Radiation
Protection (ICRP). However the result of the analysis was shown that there was significant effect between
radiation exposure dose received by the officer with total thrombocytes (p value=0:05). The regression
equation was shown that the increase of 1 unit dose would decrease the number of thrombocytes was 10.3.
The regression coefficient (R2=0197) shown that the effects of radiation exposure dose against the decrement
of total thrombocytes was 19.7%. It was recommended for the workers and hospital management to increase
the efforts against radiation protection, thus the stochastic effects of exposure could be minimized.
Keywords: Thrombocyte, exposure doses, ionizing radiation, radiology installation
Introduction during the work (3). To control the activity of radiation

workers, International Commission of Radiation
The type of radiation used in the radiodiagnostic Protection (ICRP) has set a radiation dose threshold
process is ionizing radiation. Interaction of ionizing for radiation workers at 20 mSv per year (4). These
radiation with the body’s cells can cause free radicals regulations apply to all the countries in the world,
that harm the health (1). Radical compounds in the including in Indonesia. In addition to limiting the value
body form bonds within cells, causing cells to become of doses, radiation officers are also required to carry out
abnormal and potentially become cancerous (2). periodic health checks to determine changes that occur
in the body due to exposure to ionizing radiation (5).
Workers at radiological installations have high
risk affected by the ionizing radiation. This can happen The effects of ionizing radiation are grouped into
because radiation exposure can occur continuously two, namely the deterministic and stochastic effects(6).
The deterministic effect occurs when the dose threshold
value is exceeded. This effect will cause damage and
Corresponding Author: cell death whose symptoms can be directly observed
Jannes Bastian Selly such as reddish skin and blistering. High doses, for
Master Program in Public Health Sciences, example >100 mSv, can cause central nervous system
University of Nusa Cendana, NTT Indonesia damage, followed by death within a few hours or days(6).
Email: bastian.jannes04@gmail.com Stochastic effect, there is no definite dose threshold
value. A small radiation dose even if it does not kill cells, The radiation coefficient of an organ or tissue
but can turn cells into abnormal. These abnormal cells shows the sensitivity of the organ or tissue to radiation
have the possibility to continue to divide and develop exposure(10). With the level of sensitivity of blood
into cancer(6). Stochastic effects of radiation exposure cells, this can be an indicator to evaluate the health of
are known as the silent killer, therefore health checks
radiology workers(11).
for radiology workers must be carried out so that the
initial symptoms or signs of initial damage to cells Thrombocytes are a component of blood that plays a
due to radiation exposure can be identified early and role in the process of blood clotting when a wound occurs.
anticipatory steps can be taken to ensure the safety and
The previous study in mice as experimental animals,
health of radiology workers(4,5).
it was found that the high-energy ionizing radiation,
Blood is a biological component that is sensitive resulting in a decrease in the number of thrombocytes.
to exposure to ionizing radiation(7). Blood is composed Thrombocytes count decreased linearly with increasing
of a combination of approximately 55% of blood doses of radiation. Thrombocytes recovery after radiation
plasma and 45% blood cells (erythrocytes, leukocytes exposure occurs 15 times slower than the damage
and thrombocytes). Blood plasma is composed of suffered(12). Other studies have also found that high-
approximately 90% water. Water (H2O) is molecule
dose radiation exposure in cancer patients undergoing
highly susceptible to ionizing radiation. When it
radiotherapy impacts decreased thrombocytes count up
exposed to radiation, free radicals will formed(8,9).
Free radicals are atoms or molecules that have a free to 29.96%(13). Normal total thrombocytes were in the
electron unstable. Free radicals will bind to other atoms range of 150 to 400. Lower thrombocytes count is 150,
or molecules on cells to become stable(9). These ties identified as thrombocytopenia. Thrombocytopenia that
make abnormal molecules formed in the body. This will is lower than 100have a high chance of bleeding to cause
provide a change in blood components(8). death(14–16). Therefore, this study was conducted in order
to analyze the impact of radiation doses to the blood
Bone marrow, especially the red marrow as a place of
blood production, is also a tissue that is very sensitive to profile, especially thrombocytes.
ionizing radiation as seen from the radiation coefficients
for each tissue and organ shown in Table 1 below(10). Methodology
Table 1: Radiation coefficient for each tissue and organ This research is an observational analytic research
Type Organ/Tissue WT* WT** with cross sectional approach. The total respondents in
Genital (gonads) 0,25 0,20 this research are 20 workers from 3 hospital, they are
Hospital of Prof. Dr. W. Z. Johannes, Wirasakti and
Bone marrow 0,12 0,12
Naibonat. Independent variable in this study was a dose
The large intestine (colon) - 0,12
of radiation exposure, while the dependent variable is
Lungs 0,12 0,12
the number of thrombocytes. The data in this research
Gastric - 0,12
is secondary data dosimeter readings on individuals and
Kidney - 0,05
the results of routine blood tests workers every year.
Breast (mammary) - 0,05 Data radiation exposure dose for 1 year juxtaposed with
Liver (liver) - 0,05 the data results of blood tests in the same year.
Gullet (esophagus) - 0,05
Thyroid (thyroid) 0,03 0,05 Findings
Skin - 0,01
a. Characteristics of Respondents: Respondents
The bone surface 0,03 0,01
in this study were 20 workers consisting of 14
Chest 0,15 -
men (70%) and 6 women (30%). A total of 10
Other organs 0,03 0,05
respondents (50%) aged between 25 and 35
Source: BATAN 2005 years, 4 respondents (20%) aged 36 to 45 years
*According to a Decree No. 01/Ka. BAPETEN/V-1999 and 6 respondents (30%) aged over 46 years.
**According to the ICRP No. 60 (1990) Based on the background of expertise, as many
as 16 respondents (80%) is radiographer, two

respondents (10%) are specialists of radiology,
and two other respondents (10%), respectively
nurses and administrative personnel. Before
working on the installation of radiological,
every officer has conducted a complete medical
examination and declared healthy. Furthermore,
regular health check, including blood, for every
workers. The type of individual dosimeters used
by the respondents is the TLD (thermoluminensce
dosimeter) badge. The reading of the radiation
dose values in the TLD is done every 3 months.
The results of exposure dose readings will be Figure 1: Linear curve effects of radiation exposure
archived by the hospital management, so as to get dose to the number of thrombocytes
a dose for 1 year, it will be accumulated value of
Regression equations to estimate the number of
the dose every 3 months for 1 year.
thrombocytes workers due to radiation exposure dose in
b. Dose Radiation Exposure: Based on the data accordance with the curve above is
search results is known that the average value of ^ = 178.3 − 188.6X,
Y
the exposure dose received by an officer for one
year was 0.78 mSv. The highest dose received The above equation explains that the coefficient
by the officer of 0.87 mSv, while the lowest dose for the variable thrombocytes count officer was 178.3,
of 0.73 mSv. Radiation exposure dose received while the coefficient for the radiation exposure dose is
by any officer for a year is still relatively safe, variable (-188.6). This value indicates that, when there
because it is below the limit values specified is no radiation exposure or radiation dose is 0 mSv, then
dose of 20 mSv per year(4). Although the radiation estimated the number of thrombocytes of officer is 178.3
× 103/mL. When a dose of radiation exposure and the
exposure dose every officer did not show a high
value is not zero, then the thrombocytes count will be
value, remain aware of the possibility of stochastic
amended. An increase of 1 unit dose radiation exposure,
effects can occur(6).
resulting in a decrease of thrombocytes by 10.3 × 103/
c. The Total Thrombocyte: The search results and mL (17). Regulations set by the ICRP that the dose of
tabulation of data showed that the average number radiation exposure to the workers should not be above
of thrombocytes officer is 282.6 × 103/mL. This 5 mSv every three months makes sense, because if the
value is still in the normal range of thrombocytes exposure dose of radiation received by the officer by 5
counts. But individually there are two workers who mSv, the thrombocytes amount is expected to decline
had abnormal thrombocytes count is 603 × 103/ by 51.5 × 103/mL of 178.3 × 103/mL becoming 126.8
mL, exceeding the normal value (thrombocytosis) × 103/mL. This amount is below the normal amount of
thrombocyte, that is 150 × 103/mL and categorized by
and below the normal value (thrombocytopenia)
thrombocytopenia(14).
is 63 × 103/mL.
In this study, a total of 2 workers have abnormal
d. The Impact of Radiation Exposure Dose to
total thrombocytes, each thrombocytosis and
Thrombocyte Amount: The analysis showed that
thrombocytopenia. The person who experienced
the dose of radiation exposure have a significant thrombocytopenia, is not the worker who received the
influence on the number of thrombocytes in the highest dose of exposure. Likewise, respondent who
radiation officer hospital radiology installations experience thrombocytosis, was not workers who get
in Kupang. Linear curve effects of radiation the lowest dose. Therefore, according to the researchers,
exposure dose of the thrombocytes count is shown there are factors other than the dose of radiation exposure,
in Figure 1 causing the officer had thrombocytopenia. Need to do a
more complete examination by a doctor to both of these informed consent sheet states the willingness of workers
officials. This equation model can explain the effect of as respondents in voluntary research.
the radiation exposure dose to thrombocytes count at
19.7% (R2=0,197). This means that there are factors Ethical Clearance: This study using human as research
other than exposure dose which causes a decrease in subjects, therefore, before obtaining the permission, the
thrombocytes count by 80.3%. author submitted ethical clearance to Health Research
Ethics Committee, Faculty of Medicine Nusa Cendana
Decreased thrombocytes count at the workers in this University. This research had been permitted with
study amounted to 5.78%. This value is relatively lower ethical approval recommendation number 05/UN15.16/
when compared with previous studies that found that a KEPK/2019 dated January 30, 2019.
decrease in the number of thrombocytes due to radiation
exposure reached 29.96%(13). Researchers assume that Reference
this occurs because of differences in the dose received
by the study subjects. Radiation exposure dose in this 1. Mohamed MA, El Saeid AA, Ahmed MA.
study was only 0.776 mSv, whereas in the previous Cellular response of blood and hepatic tissue
study it was 500 mSv. In addition, the respondents in to gamma irradiation. J Radiat Res Appl Sci
this study are the worker who was in a healthy condition, [Internet]. 2016;9(3):242–8. Available from:
while respondents in the earlier study are cancer patients http://linkinghub.elsevier.com/retrieve/pii/
undergoing radiotherapy process. S1687850715001247
2.
Tetriana D, Evalisa M. Sangat penting,
Conclusion pemeriksaan kesehatan pekerja radiasi. Bul Al.
2006;7(3):93–101.
Although the radiation exposure dose received by
workers is below the ICRP-determined threshold, it has a 3. Gerić M, Popić J, Gajski G, Garaj-Vrhovac V.
significant effect on changes in platelet count. Increased Cytogenetic status of interventional radiology
radiation exposure dose of 1 mSv predicted to reduce the unit workers occupationally exposed to low-dose
number of thrombocyte at. Therefore, it is expected that ionising radiation: A pilot study. Mutat Res - Genet
the efforts of protection for personnel is maintained and Toxicol Environ Mutagen. 2018;(October):1–6.
even increased to minimize the radiation dose received. 4.
Vetter RJ. ICRP Publication 103, The
Health checks including routine blood tests also should Recommendations of the International
be closely monitored, given in some hospitals have not Commission on Radiological Protection. Health
done routinely. The results of monitoring and health Phys. 2008;95(4):445–6.
checks can be a prognosis that can be anticipatory efforts
5. Jang S, Lee JK, Cho M, Yang SS, Kim SH, Kim
in ensuring the health and safety of workers at hospitals
WT. Consecutive results of blood cell count and
radiology installation in kupang.
retrospective biodosimetry: Useful tools of health
Conflicts of Interest: The author is a student of public protection regulation for radiation workers. Occup
health sciences and did not have a relationship with the Environ Med. 2016;73(10):694–700.
respondents in this case are workers on the hospital
6. Smilowitz NR, Balter S, Weisz G. Occupational
radiology installation in Kupang. Therefore, any data and
hazards of interventional cardiology.
analytical results in this study show it is in accordance
Cardiovasc Revascularization Med [Internet].
with the actual data obtained during the research.
2013;14(4):223–8. Available from: http://dx.doi.
Statement of Informed Consent: Before conducting the org/10.1016/j.carrev.2013.05.002
study, the authors explained about the process that will 7.
Azzam EI, Jay-Gerin JP, Pain D. Ionizing
be conducted during the study. Things that are described radiation-induced metabolic oxidative stress and
include research procedures, benefits, and things that prolonged cell injury. Cancer Lett [Internet].
should be conducted by the respondents during the 2012;327(1–2):48–60. Available from: http://
study. Furthermore, the authors give the informed dx.doi.org/10.1016/j.canlet.2011.12.012
consent sheet to the radiology workers. Statement in the
8. Disease I, Prof H, Saroso S. Profil Hematologi 13.

Nisa AK, Juswono UP, Martono S. Efek
dan Pemantauan Dosis Petugas Radiologi di Radioterapi Terhadap Produksi Sel Darah
Rumah Sakit Penyakit Infeksi (RSPI) Prof. Dr. Pada Penderita Ca Mammae Dan Ca Cervix.
Sulianti Saroso Tahun 2014-2015 Hematological 2009;37(2):3–6.
Profile and Dose Monitoring at Officer Radiology
14. Lee EJ LA. Thrombocytopenia. Prim Care Clin
in Hasil penelitian The International. 2015;29–37.
Off Pract. 43(4):543–57.
9. Selly JB, Abdurrouf, Juswono UP. Efek Ekstrak
15. Agrawal S, Sachdev A GD dan CK. Platelet
Sterculia quadrifida R.Br. terhadap Kandungan
Counts and Outcome in The Pediatric Intensive
Radikal Bebas Organ Hati akibat Pencemaran
Care. Indian J Crit Care Med. 2008;121:102–8.
Logam Berat. Nat B. 2015;3(2):175–81.
16. Alves da Silva D, Maia AF, Machado R, Souza
10.
Badan Tenaga Nuklir Nasional (BATAN).
de Medeiros Freitas VL, Dal Castel Pinheiro
Pengenalan Radiasi. Pusat Pendidikan dan
R, Fernanda de Andrade Franco N, et al.
Pelatihan Badan Tenaga Nuklir Nasional. 2011.
Overview of Occupational Radiation Exposure
11.
Lusiyanti Y, Yaifudin MU. Penerapan Efek in Medical Workers in Santa Catarina, Brazil,
Interaksi Radiasi Dengan Sistem Biologi Sebagai Between 2014 and 2017. Radiat Prot Dosimetry
Dosimeter Biologi. J Forum Nukl. 2008;2(1978– [Internet]. 2018;(August):1–6. Available from:
0176):21–2. https://academic.oup.com/rpd/advance-article/
doi/10.1093/rpd/ncy125/5077518
12. El-Shanshoury H, El-Shanshoury G, Abaza A.
Evaluation of low dose ionizing radiation effect 17. A F. DISCOVERING STATISTICS USING SPSS
on some blood components in animal model. J THIRD EDITION. SAGE Publications Ltd 1
Radiat Res Appl Sci [Internet]. 2016;9(3):282–93. Oliver’s Yard 55 City Road London EC1Y 1SP;
Available from: http://linkinghub.elsevier.com/ 2009. 197 p.
retrieve/pii/S1687850716000042
Importance of Collaborative Intervention of Preconception

Nutrition in Suppressing the Stunting Case in East Nusa
Tenggara, Indonesia
Jeffrey Jap1, Sri Sumarmi2, Nyoman Anita Damayanti3

Doctoral Student, Program of Public Health, 2Lecturer, Department of Health Nutrition, 3Lecturer,
1
Department of Health Administration and Policy, Faculty of Public Health, Universitas Airlangga,
Surabaya, Indonesia
Abstract
The result of Basic Health Research (Riskesdas) in 2013 on stunting case (short stature) in Indonesia reaches
37.2%. The basic cause of this stunting is due to anemia on women in pregnancy (37.1%). Malnutrition cases
become one essential threat for women in pregnancy in Indonesia and East Nusa Tenggara in particular. In
East Nusa Tenggara province, this stunting case is still a problem that requires immediate treatment. This
can be seen from the proportion of stunted toddlers which is more than 50%. The purpose of this research
was to find a form of collaborative intervention in order to cope with the stunting issues with specific targets
for preconception mothers.
The type of descriptive research was literature study with qualitative approach.
The result indicated that the collaborative intervention related to preconception nutrition was to prevent the
occurrence of anemia on women in pregnancy which endedup in stunting. Therefore, it was necessary to
collaborate on all parties to intervene, especially during the preconception period.
Keywords: Collaboration, Preconception Nutrition, Stunting, Malnutrition
Introduction Basic Health Research Results (Riskesdas) in

2013 shows that the most case of nutritional problems
Nutrition is a very important thing in life. Humans on toddlers in Indonesia is stunting (short stature)
can perform all the works optimally if all the nutritional that reaches 37.2%. This is in line with the number
needs are fulfilled. Nutrition becomes the determinant of anemia case on women in pregnancy that reaches
of the quality of Human Resources (HR) of a nation.1 37.1%. Stunting case becomes one threat for women
Indonesia itself has been dealing with nutritional in pregnancy in Indonesia and East Nusa Tenggara in
problems for a long time and has been included in 17 particular. In East Nusa Tenggara Province, the number
countries out of 117 countries with high prevalence of stunted children is even higher, which is 51.77%. In
of stunting (37.2%), wasting (12.1%) and overweight fact, one of the districts in East Nusa Tenggara, namely
(11.9%) on toddlers.2 South Central Timor (TTS) has stunting prevalence of
70.5%.3 This figure is above Afghanistan, which ranks
highest in the world with the stunting prevalence of
59%.4 This is directly proportional to the economic
Corresponding Author: condition of East Nusa Tenggara which is in the order
Jeffrey Jap of the three respectively poorest provinces in Indonesia;
Doctoral Student, Program of Public Health, Papua 28.40 percent, West Papua 25.73 percent, and
Faculty of Public Health, Universitas Airlangga, East Nusa Tenggara 22.58 percent.2
Surabaya, Indonesia
Jl. Mulyorejo Surabaya, Indonesia In other words, the quality of the baby born depends
Email: japjeffrey@yahoo.com on the mother’s nutritional status before and during
pregnancy or preconception.5 A pregnant woman will Table 1: Figure of CED on Mothers

give birth to a healthy baby if the level of health and
CED proportion
nutrition are in good status. However, there are still Age
Pregnant Not pregnant
many pregnant women who have nutritional problems,
especially malnutrition such as Chronic Energy 15-19 38.5 46.6
Deficiency (CED) and nutrition anemia.6 20-24 30.1 30.6
25-29 20.9 19.3
Pregnant women who suffer from CED and anemia
30-34 21.4 13.6
have greater risk of illness, especially in the third
35-39 17.3 11.3
trimester of pregnancy compared with normal pregnant
women.6 As a result, they have a greater risk of having 40-44 17.6 10.7
a baby with Low Birth Weight (LBW), death during 45-49 20.7 11.6
bleeding, laborious postpartum delivery for being weak Source: Riskesdas 2013
and they are also vulnerable to have health problems.
Generally, infants born with Low Birth Weight (LBW)
Table 2: Figure of Low Birth Weight (LBW)
cannot absorb new environmental stresses optimally,
which may result in stunted growth and development, LBW percentage
and it is considered as stunting.5 Baby’s weight
2010 2013
< 2500 g 11.1 10.2
Material and Method 2500-399 g 82. 85.0
This research was a descriptive research type of > 4000 g 6.4 6.8
literature study with qualitative approach. The use Source: Riskesdas 2013
of qualitative method aimed to obtain data not only
measured mathematically but explored its meaning. The central and local governments have made many
The main data sources in qualitative research were breakthroughs to fix this problem, and after tracing it
documents and journals.7 Journals taken based on turned out that the intervention was much more focused
titles with keywords; collaboration between LBW at the time of conception and afterwards, such as; with
preconception nutrition. Inclusion criteria; 1) Related PMT program, complementary feedinng, improvement
to collaboration, LBW and preconception nutrition, 2) of posyandu service and community empowerment. PMT
International journals indexed by schopus. Exclusion program denotes a program done by the government to
criteria; 1) Year published from 2013 - 2018, 2) Having improve children’s nutrition status by giving additional
complete journal access.The number of journals can be food to the children with malnutrition status or less
as many as 75 journals and after passing the inclusion nutrition status. Posyandu constitutes a regular program
and exclusion criteria of 35 filtered journals. for family planning and integrated health, to give optimal
health service for children under 5 years old. The result
indicated that the stunting prevalence was still high and
Findings
tendency of reduction was still very slowly. Basic Health
Stunting and Nutrition Issues in the Preconception Research (Riskesdas) results in 2013 put East Nusa
Period: The cause of nutritional problems was very Tenggara in the position far above the national average
complex. Mothers’ preconception nutrition had a with 51.77% of stunting prevalence. Not to mention, one
significant contribution in cases of malnutrition and of the districts in East Nusa Tenggara which is South
stunting in children. The table 1 shows that Chronic Central Timor (TTS) has 70.5% of stunting prevalence.
Energy Deficiency (CED) in those who are pregnant This figure is above Afghanistan which ranks highest in
tends to be higher than those who are not pregnant. This the world with 59% of Stunting prevalence.3
condition will affect the growth and development of the
fetus in the womb.8 Therefore, the mother should be Discussion
prepared as well as possible in order not to encounter
CED during the pregnancy. If it is not anticipated as The relationship between Micronutrients and
early as possible, then it will end up in Low Birth Weight Maternal Nutrition Status in Preconception will be
(LBW) as in the table 2. presented below.
Micronutrients are the nutrients needed by the body temperature, basic metabolism, reproduction,
humans’ body in small amounts, but have a very growth and development, red blood cell formation and
important role in the formation of hormones, enzyme muscle and nerve function.14
activity and regulate the function of the immune system
The results of research conducted by Sumarmi
and reproductive system11. Micronutrients are vitamins
et al (2017) provide an illustration that there is a
(both water soluble and fat soluble) and minerals.
relationship between the mother’s body mass-index
Minerals are divided into two groups: macro-minerals
with micronutrient intake. So, the intake is necessary to
and micro-minerals. Macro-minerals are minerals that
prevent the occurrence of anemia on the mothers.15
the body needs at least 100 mg per day (e.g. calcium,
phosphorus), whereas micro-minerals (trace elements) Solutions directly, nutrition problems are caused by
are minerals that the body needs which less than 100 mg low nutrient intake and health problems.16 In addition,
per day (e.g. zinc, iron).10 nutrient intake and health problems are two things that
affect each other.17 The indirect effect is the availability
There are also micro-minerals which are needed of food, the pattern of care and the availability of clean
only a few micrograms per day, such as cuprum and water, sanitation and health services.
molybdenum. Micronutrients are obtained from outside
the body such as from food or supplements, because Actually, East Nusa Tenggara already has the
the body is unable to produce it in sufficient amount in authorized capital to make a total revolution both for
accordance with the needs of the body. Micronutrients the micro and macro level. At the micro level, East
are extremely needed by the body, even though the body Nusa Tenggara has REVOLUSI KIA program, which
only needs very small amount of it.11 is a program to decrease the number of both mother
andbaby’s death during childbirth. This program has
For breastfeeding mothers, micronutrient status clearly decreased maternal mortality from 330 deaths
will determine the health, growth and development of (2008) to 128 (2015) and infant mortality from 1274
infants who are breastfed, especially at the age of the (2008) to 965 (2015). However, this program has not
first 6 months after the baby was born. Therefore, it is pressed the number of stunting.18
necessary to prepare before the conception period.12
The things which are prepared include preparing the One thing that causes why the mentioned figures
prospective mother by providing nutritious nutritional is difficult to decrease because there is no maximum
intake so that there will be no micronutrients deficiency intervention in preconception.19 Preconception must be
during the conception.13 intervened not only by all health workers but all parties
within the range of human life.5 Health workers should
Here are some essential micronutrients that must be be the leaders in this matter. Quality nutrition services
met during preconception; 1) Vitamin A; Vitamin A has to women in preconception can be realized if all the
really important roles in the preconception period, such existing professions in the Community Health Center
as, boosting immunity, cell differentiation (cell shape (Puskesmas) and their networks and the public are able to
and function changes), reproduction (keeping fertility perform collaborative health services by implementing
to enter the conception), preparation of embryo growth, six strategic steps as stated by Previous study describes
and growth and development of cells, including bones the role of each health worker in the hospital is an effort
and teeth.11 2) Iron; Iron is an essential mineral for the to overcome the problem of nutrition through six things,
formation of haemoglobin which serves to carry oxygen namely; 1) creating work culture in the workplace, 2)
from the lungs to all body tissues, electrons into cells, affirming the role of nutrition in health, 3) determining
and form the necessary iron nutrient enzymes for cellular diagnosis, 4) doing quick and precise intervention, and
energy production, immune system, and brain function. follow-up monitoring; 5) communicating and planning
During this preconception, iron has extremely important related nutrition issues well, 6) developing further
role to prevent iron deficiency during pregnancy handling of post-intervention and continuing education
and birth6. If this is done, then there will be no baby related to nutrition. In addition, collaboration is also
stunting 3) Zinc; This is very important to be noticed by needed from other parties outside the health sector.16
prospective mothers especially during the preconception Collaboration with all other related sectors, either directly
period.12 4) Iodine; Iodine is an important component or indirectly, can provide a positive contribution.20 The
in thyroid hormone synthesis, a hormone that regulates Community Health Center (puskesmas) is necessary to
create a preconception period that is fully prepared and References

well-done towards conception.21
1. Azétsop J, Joy TR. Access to nutritious food,
Another factor that should be well considered is socioeconomic individualism and public health
the state of the family itself, one of them is the level ethics in the USA: a common good approach.
of education. An improved level of education will Philosophy, Ethics, and Humanities in Medicine.
have an opportunity to get better jobs where income is 2013 Dec;8(1):16.
also more regular and in greater amount.22 In addition,
2. Hanandita W, Tampubolon G. The double burden
if low levels of education do not improve the socio-
of malnutrition in Indonesia: Social determinants
economic conditions, that will end up in stunting (short
stature) and malnutrition.23 Then the intervention of the and geographical variations. SSM-population
government and all the people is necessary, especially the health. 2015 Dec 1;1:16-25.
environment in which the mother lives. Another study 3. Indonesia KK. Basic Health Research 2013.
on 115 families with toddlers in 2014 with household- Jakarta: Health Research and Development
level food diversity. The result shows that there is a Agency RI. 2013.
relationship between food diversity and income (number
and type).24 The poor are often able to survive and even 4. Akseer N, Salehi AS, Hossain SM, Mashal MT,
rise again, especially when they have a network or social Rasooly MH, Bhatti Z, Rizvi A, Bhutta ZA.
order that protects and saves them.22 Achieving maternal and child health gains in
Afghanistan: a Countdown to 2015 country
The role of government in community empowerment case study. The Lancet Global Health. 2016 Jun
becomes one of the alternative solutions. The bottom 1;4(6):e395-413.
line is on improving the family economy.25 Government
through various policies should pay more attention to 5. De Onis M, Branca F. Childhood stunting: a
improve family nutrition. With the presence of village global perspective. Maternal & child nutrition.
funds and village-focused development, it is expected to 2016 May;12:12-26.
boost the improvement of specialized micro-nutrients in
6. Abu-Ouf NM, Jan MM. The impact of maternal
the preconception period.15
iron deficiency and iron deficiency anemia
on child’s health. Saudi medical journal.
Conclusions 2015;36(2):146.
Based on the exposure in the analysis and discussion 7.
Yilmaz K. Comparison of quantitative and
in the preceding section, here are the main conclusions qualitative research traditions: Epistemological,
of the study. That preconception nutrition was very theoretical, and methodological differences.
important to prevent stunting in children in East Nusa European Journal of Education. 2013
Tenggara. Therefore, it is necessary to have collaboration Jun;48(2):311-25.
among the health professions and other related sectors to
8. De Alencar Britto RP, Florêncio TM, Silva AA,
improve nutrition in the preconception period.
Sesso R, Cavalcante JC, Sawaya AL. Influence of
Conflict of Interest: There is no conflict of interest for maternal height and weight on low birth weight:
every author. a cross-sectional study in poor communities
of northeastern Brazil. PLoS One. 2013 Nov
Source of Funding: This research funded by self-funded 11;8(11):e80159.
Ethical Clearance: There are no human participants 9. Allen LH, De Benoist B, Dary O, Hurrell R,
involved in this research. However the procedure of this World Health Organization. 2006. Guidelines on
research had already gotten ethical approval of Health food fortification with micronutrients.
Research Ethics Committee, Faculty of Public Health, 10. Quattrini S, Pampaloni B, Brandi ML. Natural
Univeritas Airlangga. mineral waters: chemical characteristics and
Informed Consent: This research used secondary data. health effects. Clinical Cases in Mineral and Bone
No informed consent needed. Metabolism. 2016 Sep;13(3):173.
11. Godfrey KM, Cutfield W, Chan SY, Baker PN, Benefit Adequacy 2013 Apr 23. National
Chong YS. Nutritional Intervention Preconception Academies Press (US).
and During Pregnancy to Maintain Healthy
18. East Nusa Tenggara Health Profile 2015. Dinas
Glucose Metabolism and Offspring Health
Kesehatan Provinsi NTT; 2015. Kupang.
(“NiPPeR”): study protocol for a randomised
controlled trial. Trials. 2017 Dec;18(1):131. 19. Tuomainen H, Cross-Bardell L, Bhoday M,
Qureshi N, Kai J. Opportunities and challenges
12.
Nguyen PH, Young M, Gonzalez-Casanova
for enhancing preconception health in primary
I, Pham HQ, Nguyen H, Truong TV, Nguyen
care: qualitative study with women from
SV, Harding KB, Reinhart GA, Martorell R,
ethnically diverse communities. BMJ open. 2013
Ramakrishnan U. Impact of preconception
Jul 1;3(7):e002977.
micronutrient supplementation on anemia and
iron status during pregnancy and postpartum: a 20. Sinha B, Taneja S, Chowdhury R, Mazumder S,
randomized controlled trial in rural Vietnam. PloS Rongsen‐Chandola T, Upadhyay RP, Martines J,
one. 2016 Dec 5;11(12):e0167416. Bhandari N, Bhan MK. Low‐birthweight infants
born to short‐stature mothers are at additional risk
13. Gonzalez-Casanova I, Nguyen P, Hao W, Pham H,
of stunting and poor growth velocity: Evidence
Truong T, Nguyen S, Martorell R, Ramakrishnan
from secondary data analyses. Maternal & child
U. Preconception anemia and birth outcomes
nutrition. 2018 Jan;14(1):e12504.
in Vietnam (804.6). The FASEB Journal. 2014
Apr;28(1_supplement):804-6. 21. Stutsky BJ, Spence Laschinger HK. Development
and testing of a conceptual framework for
14. Ízaltin E, Hill K, Subramanian SV. Association
interprofessional collaborative practice. Health
of maternal stature with offspring mortality,
and Interprofessional Practice. 2014;2(2):7.
underweight, and stunting in low-to middle-income
countries. Jama. 2010 Apr 21;303(15):1507-16. 22. Magnuson K, Shager H. Early education: Progress
and promise for children from low-income
15. Hoddinott J, Alderman H, Behrman JR, Haddad
families. Children and Youth Services Review.
L, Horton S. The economic rationale for investing
2010 Sep 1;32(9):1186-98.
in stunting reduction. Maternal & Child Nutrition.
2013 Sep;9:69-82. 23.
Prendergast AJ, Humphrey JH. The stunting
syndrome in developing countries. Paediatrics and
16. Tappenden KA, Quatrara B, Parkhurst ML,
international child health. 2014 Nov 1;34(4):250-65.
Malone AM, Fanjiang G, Ziegler TR. Critical
role of nutrition in improving quality of care: an 24.
Amugsi DA, Mittelmark MB, Oduro A.
interdisciplinary call to action to address adult Association between maternal and child dietary
hospital malnutrition. Journal of Parenteral and diversity: an analysis of the Ghana demographic
Enteral Nutrition. 2013 Jul;37(4):482-97. and health survey. PloS one. 2015 Aug
25;10(8):e0136748.
17. Caswell JA, Yaktine AL, National Research
Council. Individual, Household, and 25. Yang Z, Huffman SL. Nutrition in pregnancy and
Environmental Factors Affecting Food Choices early childhood and associations with obesity in
and Access. InSupplemental Nutrition Assistance developing countries. Maternal & child nutrition.
Program: Examining the Evidence to Define 2013 Jan;9:105-19.
Evaluation of Folic Acid Content in the Pregnant Women

Karbala Hospital for Gynecology and Obstetrics, Karbel, Iraq
Abstract
Folic acid is a naturally available nutrient which is found in various foods like egg yolk, vegetables, legumes
etc. It is involved in de novo DNA’s biosynthesis in growing cells and in transmethylation reactions. The
present study aim to evaluate the correlation of folic acid content and pregnancy outcome in the Iraqi women.
This case-control study (n=30 each) includes a pregnant women enrolled in Karbala maternity teaching
hospital with 23rd to 25th gestational week. About 33.33%, 53.33% and 41.67% women were included in the
age group of less than 20, 1-30 and 30-40 years, respectively. Folate deficient women showed significant
decreased in the fetus weight as compared to the healthy women. The Folate deficient women showed lower
serum folate (112.93 ± 22.18pmol/ml) as compared to healthy control (164.13 ± 31.38pmol/ml). The fetus
birth weight is positively correlated with the presence of folic acid supplementation. From this study, we can
conclude that folic acid supplementation is necessary for the child development. It should be taken before
planning the pregnancy.
Keywords: Folic acid, gestational week, folic acid supplementation, Folate, birth weight
Introduction to 25-50% with respect to synthetic folates2-3. It is seen

in various clinical studies that there is increased demand
Folic acid is an essential micronutrient for the of folate in pregnant women which lead to serum folates
fetal body development in the pregnant women, which average reduction4, due to uteroplacental organs and
human body cannot biosynthesize and from the diet, fetus growth, and perhaps to increased urinary folate
it must be obtained as a supplements. Folic acid is a excretion and catabolism.
naturally available nutrient which is found in various
foods like egg, vegetables, legumes etc. It is involved Folate metabolism and pathways critical components
in denovo DNA’s biosynthesis in growing cells and in are affected by number of genetic polymorphisms,
transmethylation reactions. It also serves as enzymatic and are associated with increased risk of neural tube
reaction’s substrate, involved in the biosynthesis of defect (NTDs)5. Metabolism of folic acid generates
amino acid and vitamin metabolism1. Neither folic acid the structure blocks of nucleic acid, and is important in
nor folate is metabolically active so as to participate in the repair and synthesis of DNA. DNA destabilization
metabolism both of them must be reduced. On absorption, may lead to aberrations in chromosome and potentially
folic acid is reduced to tetrahydrofolic acid (THFa) by malignant transformations6-9. A study was showed in
dihydrofolate reductase (DHFR)1. The THFa is also pregnant women, as compared to the maternal serum,
called as folic acids, active form. From the gastrointestinal the THFa levels are higher in cord blood which may
tract it is rapidly absorbed, mainly from the jejunum and be for accumulation in fetus10. Numerous studies have
duodenum. The natural folates bioavailability is reduced suggested that the risk of NTD’s may be reduced by folic
acid supplementation11-13.
There is also observational and clinical trial based

Coresponding Author:
concern that high levels of folic acid increase some
diseases risk, like autism spectrum disorder, colorectal
Karbala Hospital for Gynecology and Obstetrics,
cancer and infant bronchitis14-15. The world health
Karbel, Iraq
organization recommends concentration of RBC
Phone: 009647801128547
folate>400ng/ml (906nmol/L) in reproductive age
Email: drj.alkilaby@gmail.com
women so as to achieve NTD’s greatest reduction16. to statistical analysis using GraphPad Instat (3.0, Trial
Dietary folates good sources which are often cited Version). Unpaired t-test was done to estimate the
includes leafy green vegetables, whole grains, broccoli, statistical significance.
orange juice and legumes17.
Results
Deficiency of folate is relatively common,
even though it can be corrected easily by folic acid A pregnant women attending at Karbala maternity
administration or supplementation. The human and
teaching hospital were enrolled in the present study.
animal studies have shown that the folates plays
About 97.3% response rate was observed. The average
an essential role during brain and nervous system
development18. Especially, women are predisposed to respondent age was 28.55 years. About 33.33%, 53.33%
deficiency of folate during pregnancy, due to a rapid and 41.67% women were included in the age group of
fetal growth period, and cell divisions high rates19. The less than 20, 1-30 and 30-40 years, respectively.
maternal folate content is also associated with other
outcomes of adverse pregnancy, such as malformation Folate deficient women showed decreases in the fetus
like fetal death, restriction of fetal growth, preterm weight: Folate deficient women showed significant
delivery, preeclampsia, although detail these results (p=0.0259) decreased in the fetus weight as compared
remains inconclusive20. With this background, the to the healthy women. The birth weight of the fetus is
present study aims to evaluate the correlation of folic shown in the Figure 2. This decrease in the fetus birth
acid content and pregnancy outcome in the Iraqi women. weight and due to other complications, about 76.67%
women undergone the C-section delivery. While only
Material and Method 23.33% normal delivery occurs.
This study included 60 pregnant women enrolled
in Karbala maternity teaching hospital January 2019
to April 2019. The pregnant women with 23rd to 25th
gestational week were included in the present study.
The test was performed at Karbala maternity teaching
hospital.
Fasting blood (n=60) was collected by a single

puncture form the folate deficient group (FD group) and
healthy participants after obtaining informed consent.
The parameters like child birth weight, type of delivery
and duration of pregnancy was recorded. Some socio
demographic characteristics such as monthly income,
Figure 1: The birth weight of the fetus delivered by
education level, marital status, previous number of
FD group and healthy women
pregnancies etc. were also recorded.
The fasting blood was collected (2ml) in the plain Average weeks of child delivery were found to be
vacutainers from the vein after getting participant oral about 37.73 and 39.51 weeks in women with folic acid
consent. The samples were kept at room temperature supplementation and healthy women, respectively.
for 30min. Followed by the centrifugation at 3000rpm The presence of folic acid deficiency leads to the
for 15min. The serum was separated and kept at 20°C premature delivery. However, the women are on folic
for further study. Serum folate content was estimated by acid supplementation, none of the women showed NTD.
commercially available kits (Sigma, USA). The fetus birth weight is positively correlated with the
Statistical Analysis: Results were presented as Mean presence of folic acid supplementation. The folate content
± Standard Error (SE). Obtained data were subjected of enrolled women were depicted in the Figure 2.
Women showing placental abruption or recurrent

loss of pregnancy are reported to show mild
hyperhomocysteinemia30. Maternal use of folic acid with
multivitamins is reported in the risk reduction of cleft
lip without or with palate of cleft lip31. The center for
disease control and prevention (1991) have suggested
that women with history of NTD affected pregnancy
should ingest daily folic acid (approximate 4gm) before
planning the pregnancy32. Consequently, the U.S. Public
Health Service (1992) have recommended approximately
0.4gm daily folic acid consumption to childbearing age
women through diet, supplementation and fortification
Figure 2: The folate content of FD group and
to prevent NTD’s33.
healthy women
During the period of pre-conception, stillbirths risks
Discussion secondary to neural tube defect were about 41% lowered
with supplementation of folic acid34. Therefore, it was
In the present study, we have done the evaluation of suggested that, for the benefit of public and reduction
folic acid content in the pregnant women. Some studies in recurrent NTDs risk, that targeted counseling of
from Iraq21, Nigeria22, and sudan23 no one of NTD’s
folic acid should be given to previous NTD affected
mothers was having periconceptional supplementation
pregnancy35. On the constant supplementation of folic
of folic acid. For the prevention of neural tube disease
acid, there are several controversies in prevention of
supplements of folic acid are generally essential means.
NTD’s during the 2nd and 3rd trimester of pregnancy,
For a childbearing age woman it is almost impossible
unlike its supplementations well recognized beneficial
to achieve the recommended external intake of folate
100% only from the natural folate food sources, and to effects before and shortly after conception. Charles et al36
achieve they have to drastically increase the utilization found supplementation of folic acid when from initial
of pulses, vegetables, fruits, legumes in their diet. The antenatal appointment time and onwards it is given is
natural folate absorption is not efficient like folic acid24. of no difference and no benefit in birth and gestational
There is no any consensus regarding the folic acid correct age of pregnancy and placental weight was observed,
daily dose needed in NTD prevention. The US institute of in contrast to the review of the Cochrane, which has
medicine’s current recommendation has considered 400 reported that folic acid supplementations high doses
mcg of folic acid per day to be sufficient to get folates may reduce the low birth weight risk36. Similarly, Fekete
optimum cellular concentration at least after daily intake et al37 reported folic acid supplementations no beneficial
for 8-12 weeks25. Many clinical studies regarding folate effect on either on gestational length or on placental
have demonstrated that supplementation of folate reduces weight. Hence, it is very necessary to do more research
the recurrence and occurrence of the neural tube defects26. on the effect of folic acid supplementations in pregnancy,
which is useful and necessary in the expand the further
In some parts of the India poor knowledge and
guidelines and recommendations for pregnant women37.
low awareness was found concerning the deficiency of
folic acid among pregnant women27. Katre et al28 found In 2006, the world health organization and food and
that vitamin B12 increased dose, but not folic acid was agricultural organization (united nations) have published
found to be linked with lower levels of plasma total
guidelines for helping countries in setting the level of
homocysteine in pregnancy28. However, closure of the
target fortification and their maximum and minimum
neural tube occurs by gestations 28 days much before
levels, the legal minimum level etc. to be used for flour
the woman knows about the pregnancy and addresses
fortification of folic acid38. The folic acid enriched cereal
an antenatal clinic these studies are important29. Many
grain products mandatory fortification was authorized
of the countries are bringing policies to increase the
prepregnancy folate status in ladies, by enhancing in 1996 and 1998, in US, it was fully implemented39.
supplementation, utilization of foods which are folate Although, folic acid intake is increased by mandatory
rich and their fortification29. flour fortification programs, it is shown by research that
to all women of reproductive age, it does not reaches uracil-DNA glycosidase from Escherichia coli. J
adequately40. For maximum benefit and to reach all Biol Chem. 1977;252(10):3286-94.
population groups effectively additional food products
7. Goulian M, Bleile B, Tseng B. Methotrexate-
with folic acid fortification might be needed41.
induced misincorporation of uracil in DNA. Proc
Natl Acad Sci USA. 1980;77(4):1956-60.
Conclusion
8. Reidy JA. Folate and deoxyuridine sensitive
The Folate deficient women showed lower serum chromatid breakage may result from DNA repair
folate as compared to healthy control. Perhaps, this leads during G2. Mutat Res. 1987;192(3):217-9.
to lower birth weight of the child. The women are on folic
9. Duthie S. Folic acid deficiency and cancer:
acid supplementation, hence none of the women showed
mechanisms of DNA instability. Br Med Bull.
NTD. The fetus birth weight is positively correlated with
1999;55(3):578-92.
the presence of folic acid supplementation. From this
study, we can conclude that folic acid supplementation is 10. Obeid R, Kasoha M, Kirsch SH, Munz W,
necessary for the child development. It should be taken Herrmann W. Concentrations of unmetabolized
before planning the pregnancy. folic acid and primary folate forms in pregnant
women at delivery and in umbilical cord blood.
Ethical Clearance: The blood was collected from Am J Clin Nutr. 2010 Dec;92(6):1416-22.
the Karbala maternity teaching hospital after their
investigation. Oral consent was taken before enrolled the 11. Hoffbrand AV. The history of folic acid. Br J
patients in the study. Haematol 2001,113: 579-589.
12. Sutton M, Daly LE, Kirke PN. Survival and
disability in a cohort of neural tube defect births in
Conflict of Interest: Nil Dublin, Ireland. Birth Defects Res. A Clin. Mol.
Teratol. 2008,82,701-709.
References 13. Dolk H, Loane M, Garne E. The prevalence of
congenital anomalies in Europe. Adv. Exp Med
1. Zhao M, Chen YH, Chen X, Dong XT. Folic acid
Biol 2010,686:349-364.
supplementation during pregnancy protects against
lipopolysaccharide-induced neural tube defects in 14. Jennings BA, Willis G. How folate metabolism
mice. Toxicology Letters 2014;224(2):201-208. affects colorectal cancer development and
treatment; a story of heterogeneity and pleiotropy.
2. Cuskelly CJ, McNulty H, Scott JM. Effect of
Cancer Lett. 2014:S0304-3835(14)00131-1.
increasing dietary folate on red-cell folate:
implications for prevention of neural tube defects. 15. Wiens D, DeSoto MC. Is high folic acid intake
Lancet 1996,347: 657-659. a risk factor for autism?-A review. Brain Sci.
2017,10;7(11).
3. Gregory JF. Bio-availability of folate. Eur J Clin
Nutr 1997,51: 554-559. 16. Viswanathan M, Treiman KA, Doto JK Middleton
JC, Coker-Schwimmer EJL, Nicholson WK. Folic
4.
Tamura T, Picciano M. Folate and human
acid supplementation: An evidence review for
reproduction. Am J Clin Nutr 2006,83:993-1016.
the U.S. preventive services task force. AHRQ
5. Molloy AM, Brody LC, Mills JL, Scott JM, Kirke Publication 2017,14-05214-EF-1.
PN. The search for genetic polymorphisms in the
17. Dunlap B, Shelke K, Salem SA, Keith LG. Folic
homocysteine/folate pathway that contribute to
acid and human reproduction—ten important
the etiology of human neural tube defects. Birth
issues for clinicians. J Exp Clin Assist Reprod
Defects Res. A Clin. Mol. Teratol. 2009,85,285–
2011;8:2.
294.
18. Schmidt RJ, Tancredi DJ, Ozonoff S, Hansen RL,
6. Lindhahl T, Ljungquist S, Siegert W, Nyberg B,
Hartiala J, Allayee H, Schmidt LC, Tassone F, and
Sperens B. DNA N-glycosidases: properties of
Hertz-Picciotto I. Maternal periconceptional folic in a rural area of India in 2010. Int J Prev Med,
acid intake and risk of autism spectrum disorders 2013,4(10):1213–1216.
and developmental delay in the CHARGE
28. Katre P, Bhat D, H. Lubree, Otiv S, Joshi S,
(Childhood Autism Risks from Genetics and
Joglekar C, Rush E, Yajnik C. Vitamin B12 and
Environment) case-control study. Am J Clin Nutr folic acid supplementation and plasma total
2012;96:80–9. homocysteine concentrations in pregnant Indian
19. Li Z, Ye R, Zhang L, Li H, Liu J, Ren A. women with low B12 and high folate status. Asia
Periconceptional folic acid supplementation Pac J Clin Nutr, 2010,19(3):335–343.
and the risk of preterm births in China: a large 29. Gupta H, Gupta P. Neural tube defects and folic
prospective cohort study. Int J Epidemiol 2014. acid. Indian Pediatrics. 2004,41(6):577–586.
20. Sengpiel V, Bacelis J, Myhre R, Myking S, Devold 30. Nelen WLDM, Steegers EAP, Eskes TKAB, Blom
Pay A, Haugen M. Folic acid supplementation, HJ. Genetic risk factor for unexplained recurrent
dietary folate intake during pregnancy and risk early pregnancy loss. Lancet 1997,350, 861.
for spontaneous preterm delivery: a prospective
observational cohort study. BMC Pregnancy and 31. Shaw GM, Lammer EJ, Wasserman CR, O’Malley
Childbirth 2013,13:160. CD, Tolarova MM. Risks of orofacial clefts in
children born to women using multivitamins
21. Al-Ani ZR, Al-Hiali SJ, Al-Mehimdi SM. Neural containing folic acid periconceptionally. Lancet
tube defects among neonates delivered in Al- 1995,345:393–396.
Ramadi Maternity and Children’s Hospital,
western Iraq. Saudi Med J 2010,31:163-169. 32. Centers for Disease Control and Prevention.
CDC Grand Rounds: Additional opportunities
22. Adeleye AO, Dairo MD, Olowookere KG. Central to prevent neural tube defects with folic acid
nervous system congenital malformations in a fortification. MMWR Morb. Mortal. Wkly. Rep.
developing country: issues and challenges against 2010,59,980–984.
their prevention. Childs Nerv Syst 2010,26:919-924.
33. Crider KS, Bailey LB and Berry RJ. Folic acid
23. Elsheikh GEA. Neural tube defects: pattern and food fortification—Its history, effect, concerns,
incidence in Omdurman Maternity Hospital, and future directions. Nutrients 2011,3:370-384.
Sudan. [dissertation]. Khartoum (Sudan):
University of Khartoum; 2004. 34. Imdad A, Yakoob MY, Bhutta ZA. The effect
of folic acid, protein energy and multiple
24. Institute of Medicine. Folate. In Dietary reference micronutrient supplements in pregnancy on
intakes for thiamin, riboflavin, niacin, vitamin B6, stillbirths. BMC Public Health. 2011,11,3:S4.
folate, vitamin B12, pantothenic acid, biotin, and
35. Grosse SD, Collins JS. Folic acid supplementation
choline; National Academy Press: Washington,
and neural tube defect recurrence prevention. Birth
DC, USA, 1998;196–305.
Defects Res A Clin Mol Teratol. 2007,79(11):737-42.
25. Lamers Y, Prinz-Langenohl R, Bramswig S,
36. Charles DH, Ness AR, Campbell D, Smith GD,
Pietrzik K. Red blood cell folate concentrations
Whitley E, Hall MH. Folic acid supplements in
increase more after supplementation with [6S]-
pregnancy and birth outcome: re-analysis of a
5-methyltetrahydrofolate than with folic acid
large randomised controlled trial and update of
in women of childbearing age. Am J Clin Nutr.
Cochrane review. Paediatr Perinat Epidemiol.
2006;84(1):156-61.
2005,19(2):112-24.
26.
Czeizel AE, Dudas I. Prevention of the
37. Fekete K, Berti C, Trovato M, Lohner S,
first occurrence of neural-tube defects by
Dullemeijer C, Souverein OW, Cetin I, Decsi
periconceptional vitamin supplementation. N.
T. Effect of folate intake on health outcomes in
Engl. J. Med. 1992,327,1832–1835.
pregnancy: a systematic review and meta-analysis
27. Pal PP, Sharma S, Sarkar TK, Mitra P. Iron and on birth weight, placental weight and length of
folic acid consumption by the ante-natal mothers gestation. Nutr J. 2012,11:75.
38. Annex D-A procedure for estimating feasible Final Rule. 21 CFR Parts 136,137 and 139. Fed.
fortification levels for a mass fortification Regist. 1996,61,8781–8789.
programme. In Guidelines on Food Fortification
40. Imhoff-Kunsch B, Flores R, Dary O, Martorell R.
with Micronutrients, 1st ed.; Allen, L., de Benoist,
Wheat flour fortification is unlikely to benefit the
B., Dary, O., Hurrell, R., Eds.; World Health
neediest in Guatemala. J. Nutr. 2007,137,1017–
Organization: Portland, OR, USA, 2006;294-312.
1022.
39. Food and Drug Administration. Food standards:
41. Dary O. Establishing safe and potentially efficacious
amendment of standards of identity for enriched
fortification contents for folic acid and vitamin B12.
grain products to require addition of folic acid.
Food Nutr. Bull. 2008,29:S214–S224.
Isolation, Identification and Antibiotic Susceptibility Testing

of Bacterial Pathogens Causing Seminal Fluid Infection in
Human Males Admitted to the Infertility Centers in Najaf
Province
Jinan Mohammed Hussein1, Anaam Jawad Alabbasy1, Suhair Abdulkareem Al-Rammahi1, Ahmed
Abdulridha Ameen Shlash2
1
Department of Biology, University of Kufa, Girl of Education Collage; 2M.Sc in Medical Microbiology
Abstract
Bacterial infections have been identified as one of the causes of infertility, bacteria can cause immobilization
and agglutination of spermatozoa. The aim of research was to detect the bacterial pathogens in seminal fluid
culture from infertile men and determine the antibiotic sensitivity pattern in vitro.Seminal fluid samples
were collected for culture and antibiotic sensitivity testing and were processed according to the standard
techniques of microbiology. A total of 120 seminal fluid samples collected from human males admitted to
the infertility centers in Najaf province, 74 (61.66%) of samples revealed positive significant growth of
bacteria, while 46(38.33%) samples were with no growth. Eleven species of different bacterial organisms
were isolated.
Keywords: Staphylococcus, Infertility, Semen, E-coli.
Introduction the principal microorganism that causes prostatitis and

epididymitis(10). Infections have been recognized in the
Urogenital tract infection in male is one of the reproductive system of male infertility for decades(11-14).
important causes of infertility, worldwide since genital
tract inflammation and infection have been associated
with(8-35%) cases of male infertility(1). Seminal fluid
infection by bacteria refers to the presence of bacteria Seminal Fluid Samples and Collection: A total number
in seminal fluid samples(2).Bacterial infection of seminal of 120 samples were collected from human males having
fluid may play a major role in infertility(3). Male accessory urogenital tract infection through a period of 6 months
sex glands infection is a major risk factor in infertility(4). (from Feb to July 2018). The specimens were collected
The direct effect on sperm function (movement, from patients who referred to infertility centers in Holly
morphological form), deterioration of sperm formation, Najaf. The samples have been labeled according to the
autoimmune processes resulting from inflammation sex and age of all patients and without delay cultivation.
and dysfunction of the attached sex glands(4). Thus, the Seminal fluid specimens were collected from human
microbiological investigation of the male partners in the male patients suffering from urogenital tract infection.
two contractile populations can be useful for detecting The patient should not have a sexual activity for 3 days
urogenital tract infection in males, especially non- before collecting a semen sample, also asked to pass urine
symptomatic infection.The isolation of microorganisms first, wash, rinse hands, penis before the specimens were
from seminal fluid especially of infertile men had been collected, then start the sample collection. The specimens
widely reported(5-9). It is always recommended that were collected into clean wide-mouthed 15 ml sterile plastic
microbiological study of semen can be performed in vials and incubated at 37 ºC for 30 minutes for liquefaction,
asymptomatic infertile men with leukocytospermia. then seminal fluid analysis (SFA) was done to diagnose
The most widely studied genital microorganism in asthenospermia and leukocytospermia. Swabs were
relation to male infertility is Escherichia coli, which is inserted into the specimens and then directly inoculated on
blood agar, chocolate agar and MacConkey agar. All plates Results
were incubated aerobically at 37ºC for 48 hrs.
Out of 120 seminal fluid samples collected from
Seminal Fluid Culture: All growing isolates on surface human males admitted to the infertility centers in Najaf
of blood agar, chocolate agar and macConkey Agar province,74 (61.66%) of samples revealed positive
were identified according to some biochemical test
significant growth of bacteria on culture media, while
including Oxidase test, Urase test, Citrate test, Indole
46 (38.33%) with no growth (Figure-1-A). The bacterial
test and motility test(15). Then all isolate streaked on
CHROMagarTM Oreintation medium (CHROMagar™, isolates of the predominant growth from the clinical
France), finally, the diagnosis was confirmed using samples were considered in the study. Additionally,
Vitek2 compact system (Biomerieux, France) using ID only one positive culture per a patient was included.
cards to detect gram positive and gram negative bacteria. Duplicate isolates from the same infective episode in
the same patient were also excluded. The samples were
Antibiogram Profile using Disk Diffusion Method:
collected from patients with different age groups started
Antibiotic susceptibility test of different isolates were
carried out according to the criteria of the Clinical and with the age of 20 years old reaching to 60 years old.
Laboratory Standards Institute(16) using disk diffusion The highest number of patients having seminal fluid
method by Kirby-Bauer method(17). developing cells were infection was in the age group (31-40) years old 33
suspending then adjusted to a 0.5 McFarland standard tube (44.59%) followed by the age group (20-30) years old
and spread on surface of Mueller Hinton Agar by using 21 (28.37%) and the lowest number in age group (51-60)
disks commercially obtainable antibiotics(Bioanalyse, years old 8 (10.81%) (Figure-1-B). The distribution of
Turkey) including Amoxicillin(10µg), Amoxicillin +
gram positive and negative among the bacterial culture
Clavulanic acid (30µg), ceftriaxone (30µg), cefepime
positive cases revealed that the gram positive isolates
(30µg), imipenem (10µg), meropenem (10µg), amikacin
(30µg), ciprofloxacin (5µg), levofloxacin (5µg), and were 42 (56.75%), while gram negative bacterial isolates
Doxycycline (30µg). were 32 (43.24%) (Figure-1-C).
Figure 1―A: Total number of seminal fluid samples, samples with positive growth and samples with no
growth., B: Distribution of age groups among 74 bacterial isolates causing seminal fluid infection., C:
Distribution of gram positive and gram negative among 74 bacterial isolates causing seminal fluid infection
The distribution of pathogens causing seminal fluid Conted…

infection, out of 42 gram positive bacterial isolates,
2. Klebsiella pneumoniae 7 9.45
the most predominant pathogen was Staphylococcus
aurous 18 (24.32%) followed by Enterococcus faecalis 3. Neisseria gonorrhoeae 5 6.75
9 (12.16%), Staphylococcus saprophyticus 7 (9.45%), Pseudomonas
4. 3 4.05
staphylococcus epidermidis 5 (6.75%), Streptococcus aeruginosa
pyogenes 2 (2.70%) and Streptococcus pneumoniae 5. Proteus mirabilis 2 2.70
1 (1.35%)(table-1). While out of 32 gram negative Among gram positive organism, S. aureus was
bacterial isolates, the most predominant pathogen was found (83.33%) sensitive to Imipenem followed by
Escherichia coli 15(20.27%) followed by Klebsiella Meropenem (66.66%) and Ciproflxacin (50.0%). In case
pneumoniae 7(9.45%), Neisseria gonorrhoeae 5 of S. saprophyticus Imipenem was the drug of choice
(6.75%), Pseudomonas aeruginosa 3 (4.05%) and showed (85.71%) sensitive followed by Ceftriaxone,
Proteus mirabilis 2 (2.70%) (Table-1). Meropenem and Doxycycline in percentage (57.14%).
The effective antibiotics on S. epidermidis were
Table 1: Species wise distribution of semen Imipenem and Levofloxacin reaching to (80%) followed
pathogens by Ciprofloxacin and Doxycycline reaching to (60%).
Percentage Enterococcus faecalis was (100%) sensitive to imipenem
Pathogens Number followed by Meropenem (88.88) and Amikacin (77.77%).
(%)
Gram positive 42 56.75 % Also S. pyogenes antibiotic sensitivity showed that
Imipenem antibiotic was most affective with percentage
1. Staphylococcus aurous 18 24.32
of (100%) followed by Ceftriaxone, Ciprofloxacin,
2. Enterococcus faecalis 9 12.16
Levofloxacin and Amikacin with percentage reached to
Staphylococcus (50%). The pathogen S. pneumoniae showed sensitivity
3. 7 9.45
saprophyticus
to the antibiotics Imipenem, Ceftriaxone, Ciprofloxacin,
Staphylococcus Levofloxacin, Amikacin in percentage reaching to
4. 5 6.75
epidermidis
(100%),(Table-2). Among over all gram positive bacterial
Streptococcus
5. 2 2.70 isolates, Imipenem was found to be (88.09%) sensitive,
pyogenes
followed by Meropenem (59.52%), Amikacin (57.14%)
Streptococcus
6. 1 1.35 and Ciprofloxacin (52.38%). Among gram negative
pneumoniae
bacterial isolates, E. coli was found highly susceptible to
Gram negative 32 43.24 %
Imipenem (86.66%), followed by Meropenem (73.33%)
1. Escherichia coli 15 20.27 and Doxycycline (60%). K. pneumoniae was highly
sensitive for Imipenem (85.71%) and equally sensitive by Ciprofloxacin in percentage (66.66%). P. mirabilis
to Ceftriaxone, Meropenem and Amikacin (57.14%). showed sensitivity for all Meropenem, Levofloxacin
In case of N. gonorrhoeae, Imipenem was the drug of and Doxycycline in percentage (100%) (Table-3). In
choice showed (100%) sensitive followed by Amikacin overall gram negative bacterial isolates, Imipenem was
(80%) and Ceftriaxone, Ciprofloxacin and Meropenem found to be (87.50%) sensitive, followed by Meropenem
in percentage of (60%) P. aeruginosa showed (100%) (71.87%), Doxycycline (56.25%) and Amikacin
sensitivity to both Imipenem and Meropenem followed (53.12%) (Table-4).
Table 2: Antibiotic sensitivity pattern of overall gram positive bacterial organisms
Antibiotic disk Sensitive Percentage Intermediate Percentage Resistant Percentage

Amoxicillin 1 2.38 2 4.76 39 92.85
Amoxicillin clavulanic acid 4 9.52 4 9.52 34 80.95
Ceftriaxone 20 47.61 2 4.76 20 47.61
Cefepime 10 23.80 3 7.14 29 69.04
Imipenem 37 88.09 4 9.52 1 2.38
Meropenem 25 59.52 11 26.19 6 14.28
Ciproflxacin 22 52.38 5 11.9 15 35.71
Levofloxacin 21 50 10 23.80 11 26.19
Amikacin 24 57.14 4 9.52 14 33.33
Doxycycline 18 42.85 13 30.95 11 26.19
Table 3: Antibiotic sensitivity pattern of gram negative bacterial organisms
E. coli K. pneumoniae N. gonorrhoeae P. aeruginosa P. mirabilis

(N = 15) (N = 7) (N = 5) (N = 3) (N = 2)
Antibiotic disk
R (%)
R (%)
R (%)
R (%)
R (%)
S (%)
S (%)
S (%)
S (%)
S (%)
I (%)
I (%)
I (%)
I (%)
I (%)
Amoxicillin 0 0 100 0 0 100 0 20 80 0 0 100 0 0 100
Amoxicillin
0 13.33 86.66 0 28.57 71.42 40 0 60 0 33.33 66.66 0 50 50
clavulanic acid
Ceftriaxone 35.29 20 40 57.14 14.28 28.57 60 20 20 33.33 33.33 33.33 0 0 100
Cefepime 26.66 6.66 60 42.85 0 57.14 20 20 60 0 66.66 33.33 50 0 50
Imipenem 86.66 0 13.33 85.71 14.28 0 100 0 0 100 0 0 50 50 0
Meropenem 73.33 6.66 20 57.14 28.57 14.28 60 40 0 100 0 0 100 0 0
Ciproflxacin 46.66 6.66 46.66 42.85 14.28 42.85 60 20 20 66.66 0 33.33 0 100 0
Levofloxacin 33.33 26.66 40 42.85 28.57 28.57 20 40 20 0 0 100 100 0 0
Amikacin 35.33 0 46.66 57.14 14.28 28.57 80 0 20 33.33 66.66 0 0 0 100
Doxycycline 60 6.66 33.33 71.42 0 28.57 40 20 40 0 100 0 100 0 0
Table 4: Antibiotic sensitivity pattern of overall gram negative bacterial organisms
Antibiotic disk Sensitive Percentage Intermediate Percentage Resistant Percentage

Amoxicillin 0 0 1 3.12 31 96.87
Amoxicillin clavulanic acid 2 6.25 6 18.75 24 75.00
Ceftriaxone 14 43.75 6 18.75 10 31.25
Cefepime 9 28.12 4 12.50 19 59.37
Conted…
Imipenem 28 87.50 2 6.25 2 6.25

Meropenem 23 71.87 5 15.62 2 6.25
Ciproflxacin 15 46.87 5 15.62 12 37.50
Levofloxacin 11 34.37 8 25.00 13 40.62
Amikacin 17 53.12 3 9.37 12 37.50
Doxycycline 18 56.25 5 15.62 9 28.12
Discussion E. coli, P. mirabilis, K. pneumoniae and Mycoplasma.

Ekhaise and Richard 2011 found that S. aureus 7
Bacterial infection of the reproductive system can (77.8%) were the most common isolates. However, it
weaken the production of sperms or cause scarring and has been reported that the presence of bacteria in semen
obstruction of the tubules that transport sperms and may affect fertility in several ways including sperm
causing infertility. Testicular infection can stop sperm damage, which hinders movement, and changes the
production by blocking the small testicular tubules in chemical composition of semen(19). Seminal infection
which sperms are produced called seminiferous tubules. could be the cause of the chronicity of urinary tract
The newly produced sperm are stored temporarily in the infection by acting as the reservoir of infection(20). Some
epididymis, a member alongside the testis that consists possible pathophysiological mechanisms that lead to
of coiled sperm ducts where semen final maturity as it the development of infertility are linked to the presence
slowly moves through sperm channels. Infections in the of microorganisms in the ejaculation(18).Microbial
epididymis may interfere with the proper maturation infections of the semen are major causes of male
of sperm and can block sperm transport. In this study infertility(20).The viability and integrity of the semen
61.66% of seminal fluid culture was found significant lies in its characteristic mobility(21).The negative effects
bacterial growth. The commonest isolates were S. of these microorganisms on the sperm reproductive
aureus (24.32%) followed by E. coli (20.27%), Entero. potential were detected in E. coli and S. aureus infections
faecalis (12.16%), K. pneumoniae and S. saprophyticus among other microorganisms(22).Presence of E. coli in
(9.45%), both S. epidermidis and N. gonorrhoeae semen decreases sperm motility. Bacteria affect sperm
(6.75%), P. aeruginosa (4.05%), both S. pyogenes motility by adherence(23-25).
and P. mirabilis(2.70%), and S. pneumoniae (1.35%).
Similar studies conducted by other researchers, a local Conflict of Interest: There is no any Conflict of Interest
study in Babylon by(16) revealed that out of 70 bacterial
Ethical Clearance: Ethics committee refer that there is
isolates from male patients having seminal fluid
no plagiarism and there is no mistakes or wrong results
infection gram positive bacteria constituted 44(62.9%)
in this work.
while gram negative bacteria constituted 26(37.1%)
of isolates, coagulase negative staphylococci (CoNS) Source of Funding: Self funding.
represented by S. epidermides and S. saprophyticus
were the common type of bacterial isolates 25(35.7%) References
followed by S. aureus 19 (27.2%), E. coli 12 (17.1%),
Enterobacter aerogenes 8 (11.4%), Acinetobacter spp 1. Aldahmoshi H, Habeeb S, Alcharrakh A. Study
4 (5.7%) and Moraxella spp 2 (2.9%). Other national of Some Bacterial Isolates Associated with
studies, Mogra et a1,1981 found that 42.9% significant Leukocytospermia in Asthenospermic Patients
bacterial growth, the type of organisms isolated were in Hilla City, Iraq. Int. Res.J. Medical Sci :2013,
S. faecalis (31.4%), E. coli (17.1%), and coagulase 1(3):1-11.
negative Staphylococci (14.3%). Orji et al, 2007 2. Auroux M, Jacques L, Mathieu D, Auer J. Is
reported S. aureus was the highest prevalent bacteria the sperm bacterial ratio a determining factor in
isolated (37.1%). The study(18) obtained 73% positive impairment of sperm motility: an In-vitro study
bacterial cultures. The most common aerobic organisms in man with Esherichia coli. Internat J Androl:
grown were Corynebacterium, S. aureus, S. epidermidis, 1991, 14(4):264-70.
3. Bartoov B, Ozbonfil D, Maayan M, Ohad E, 14. Li H Y, Liu J H. Influence of male genital bacterial
Nitzan Y. Virulence characteristics of male genital infection on sperm function. Zhonghoa. Nan. Ke.
tract Escherichia coli isolated from semen of Xue : 2005, 8(6):442-444.
suspected infertile men. Andrologia: 1991, 23, 15.
MacFaddin J F. Biochemical tests for the
387-394. identification of medical bacteria. 3rd ed., The
4. Bauer A, Kirby W, Sherris J, Turck M. Antibiotic Williams. and Wilkins-Baltimor, USA, 2000.
susceptibility testing by a standardized single dick 16. Mogra N N, Dhruva A A, kothari L K . Nonspecific
method. Am. J. Clin. Pathol :1966, 45: 493-496. seminal tract infection and male infertility. J.
5. Bukharin O, Kuzimin M, Ivanov I. The role of the Postg. Med: 1981, 27(2):99-104.
microbial factor in the pathogenesis of male in 17. Mogra N, Dhruva A, Kothari L K. Non-specific
fertility. Zh. Microbial. Epidemiol. Immunobiol : seminal infection and male infertility: A
2003, 2: 106-110. bacteriological study. J Post Grad Med: 1981,
6. Diemer T, Ludwig M, Huwe P, Haler D, Weidner 27(2): 99-104.
W. Influence of genital urogenital infection on 18. Nikkanen V, Gronroos M, Suominen J, Multamaki
sperm function. Curr. Opin. Urol: 2000, 1(1) 39-44. S. Silent infection in male accessory genital
7. Diemer T, Weidner W, Michelmann H, Schiefer H, organs and male infertility. Andrologia. : 1979,
Rovan E, Mayer F. Influence of Escherichia coli 11:236-241.
on motility parameters of human spermatozoa in 19. Onemu S O, Ibeh I N. Studies on the significance
vitro. Int. J. Androl: 1996, 19: 271- 277. of positive bacterial semen cultures in male
8. Ekhaise F, Richard F. Common bacterial isolates fertility in Nigeria. Int. J. Fertil. Women Med:
associated with semen of men attending the 2001, 46(4):210-214.
fertility clinic of the university of Benin teaching 20. Orji I, Ezeifeka G, Amadi E S, Okafor F. Role of
hospital (U.B.T.H), Benin City. geria. Africa J enriched media in bacterial isolation from semen
Microbi Resear. 2011: 5(22): 3805-3809. and effect of microbial infection on semen quality:
9. Elbhar A. Male genital tract infection:the point of A study on 100 infertile men. Pak. J. Med. Sci:
view of the bacteriologist. Gynecol. Obstet. Fertil. 2007, 23(6):885-888.
2005: 33(9):691-697. 21. Orji I, Georg E, Sabinu AE, Florence O. Role
of enriched media in bacterial isolation from
10. Esfandiari, N., Saleh, R.A., Abdoos, M., Rouzrokh,
semen and effect of microbial infection on semen
A. and Nazemian, Z. Positive bacterial culture
quality: A study on 100 infertile men. Pak J Med
of semen from infertile men with asymptomatic
Sci: 2007, 23 (6):885-88.
leukocytospermia. Int J Fertil Women’s Med:
2002, 47:265-70. 22. Rehewy M S, Hafez E, Thomas A, Brown W J.
Aerobic and anaerobic bacterial flora in semen
11. Gdoura R, Kchaou W, Znazen A, Chakroun N,
from fertile and infertile groups of men. Arch.
Fourati M, Ammar L, Hammami A. Screening
Andrology: 1979, 2: 236-38.
for bacterial pathogens in semen samples from
infertile men with and without leukocytospermia: 23. Sanocka D, Ciupinska M, Kurpis Z M. Bacterial
2008, 40(4):209-218. infection and semen quality. J Reprod Immunol
:2005, 67(1-2): 51-56.
12. Gomez C I, Stenback, W A, James A N, Criswell
B S, Williams RP. Attachment of Neisseria 24. Stephen P B, Rusell O D, David F K. Current
gonorrhoea to human sperm. Microscopical study problems in obstetrics, gyneacology and fertility.
Yearbook Medical Publishers, Incorporated: 1989
of the effect of trypsin and iron. Brit J Ven Dis;
: p. 199.
1979:(55) :245 – 55.
25. Villanueva, C A, Flores G A, Beltran M, Echavarria
13. Karpuz V, Gokturk A, Meral M. The effects of
M, Ortiz F J, Arredondo J L. Bacteriospermia
sperm morphology and motility on the outcome of
and male infertility: A method for increasing the
intracytoplasmic sperm injection. Marmara Med
sensitivity of semen culture. Int.J.Fertile Women
J; 2007: 20: 92-97.
Med: 1999, 44(4):198-203.
Conjecture of TSP Concentration and PM.10 through

Measurement Dust Fall
(Study of Dust Dispersion from Special Roads for Coal
Transport)
Junaidi1, Rahmawati1, Muhammad Pahruddin1, Agnes T Diana Nerawati2

Department of Environmental Health, Health Polytechnic Ministry of Health Banjarmasin;
1
2
Department of Environmental Health, Health Polytechnic Ministry of Health Surabaya
ABSTRACT
The naming of pollutants in the form of particles refers to their physical characteristics or relative size.
Dustfall describes large particles that can settle (fall) because it is influenced by its gravitational force. TSP
or dust are smaller particles that can float in the air and follow the movement of the wind. PM10 or PM2,5
are very small particles (equivalent diameter of 10 microns and 2.5 microns) that can enter the human
respiratory tract. The existence of these particles is interrelated because they originate from the same source,
which is a solid which is mechanically destroyed. Because it comes from the same source and process, the
presence of one type of particle under natural conditions will also be followed by the presence of other
particles. This makes it possible to estimate the existence of other particles by measuring one of the selected
types of particles.
This study aims to obtain an estimation model of PM10 and TSP levels through the measurement of
dustfall concentration. Dustfall, TSP and PM10 measurements were carried out simultaneously at one coal
haul roadside location for 24 hours divided per hour in each measurement set, air temperature humidity
measurement, and observation of coal transport volume were also carried out in each measurement set.
The results of the study show that; air temperatures ranged from 26 - 35OC and air humidity ranged from
42 - 76%, dustfall levels ranged from 676.95 - 4,041.14 tons/km2. Month, TSP levels ranged from 153.2 -
9457.8 µg/m3 and levels PM10 ranges from 145.0 - 7,603.4 µg/m3. The particulate matter in the air has a
positive correlation with air temperature and has a negative correlation with air humidity. The model of TSP
relationship with PM10 was TSP = 0.077 + 1.251 (PM10), the relationship between dustfall and TSP was
dustfall = 935,702 + 305,333 (TSP), the relationship between dustfall and PM10 was dustfall = 938,719 +
393,762 (PM10).
It was concluded that there was a relationship between dustfall with the levels of TSP and PM10 individually,
and the estimation model PM10 and TSP by the dustfall was a dustfall filled with 60% by TSP and PM10
and TSP filled with 77.8% PM10.
Keywords: pollutants, dustfall, TSP, PM10
Introduction
The naming of pollutants in the form of particles
refers to their physical characteristics or relative size.
Dust fall describes large particles that can settle (fall)
Corresponding Author: because they are influenced by their gravitational force.
Junaidi TSP or dust are smaller particles that can float in the air
Health Polytechnic Ministry of Health Banjarmasin and follow the movement of the wind. PM10 or PM2,5 are
Email: jun_aidi1204@yahoo.co.id very small particles (equivalent diameter of 10 microns
and 2.5 microns) that can enter the human respiratory Measurements were carried out for 24 hours divided per
tract. The existence of these particles is interrelated hour of observation, besides that, measurements were
because they originate from the same source, which is a also made on the air temperature, air humidity and the
solid which is mechanically destroyed. Because it comes volume of traffic passing by coal. The measurement
from the same source and process, the presence of one data are analyzed statistically and see the third particle
type of particle under natural conditions will also be fraction of the type of dust.
followed by the presence of other particles. This makes
it possible to estimate the existence of other particles by
measuring one of the selected types of particles.2
Method
The coal transportation traffic disperses the Total

Particles into ambient air in a certain amount. The total
scattered particles consist of various sizes, ranging from
large to small. In this study measurements were carried
out on dustfall, TSP and PM10 simultaneously on one
spot on the side of the road that was considered safe,
which is 5 meters away on the edge of the coal haul road.
The concentration of dust from direct measurements in the field is as follows:
Table 1: Concentration of dust fall, TSP and PM.10 at the Research Site
No. Days to Dust Fall (ton/km2.bulan) TSP (µg/m3) PM.10 (µg/m3)

1. 12.00 – 13.00 4.041,14 9.457,8 7.603,4
2. 13.00 – 14.00 3.972,35 8.336,5 6.826,7
3. 14.00 – 15.00 812,34 3.918,8 2.480,1
4. 15.00 – 16.00 2.663,72 4.152,6 3.468.3
5. 16.00 – 17.00 2.554,47 5.016,4 3.275,6
6. 17.00 – 18.00 1.188,05 869,0 716,0
7. 18.00 – 19.00 852,96 618,2 486,3
8. 19.00 – 20.00 1.218,51 788,2 584,0
9. 20.00 – 21.00 1.329,28 582,3 447,3
10. 21.00 – 22.00 1.396,21 362,0 298,6
11. 22.00 – 23.00 676,95 267,6 185,6
12. 23.00 – 00.00 888,80 356,1 280,5
13. 00.00 – 01.00 1.035,73 362,1 261,0
14. 01.00 – 02.00 1.090,25 311,5 245,8
15. 02.00 – 03.00 1.343,49 215,6 192,4
16. 03.00 – 04.00 893,57 153,2 145,0
17. 04.00 – 05.00 1.613,70 1.062,5 812,7
18. 05.00 – 06.00 1.462,21 838,9 566,1
19. 06.00 – 07.00 1.847,85 2.643,4 1.891,2
20. 07.00 – 08.00 1.399,99 3.465,8 3.092,6
Conted…
21. 08.00 – 09.00 1.190,17 2.865,1 2.072,3

22. 09.00 – 10.00 1.787,15 2.783,6 2.129,4
23. 10.00 – 11.00 1.367,11 2.971,6 2.179,4
24. 11.00 – 12.00 2.172,13 1.120,7 1.076,2
Average 1.616,59 2.229,98 1.721,5
Description: Quality standards According to PPRI No. results of dustfall in the field = 1,616.59 tons/km2.
41 of 1999 Month deducted by 970,638 tons/km2. Month (Dustfall
constant = 970,638 - 414,735 (TSP) + 912,450 (PM10)),
Dust Fall: 20 tons/km2. Month

to 645.95 tons/km2. Month or 40%, it can be concluded
TSP: 230 µg/m3
that the remaining 60% of dustfall is TSP concentration
PM10: 150 µg/m3
and PM10.
The concentration of dust fall in Total Suspended Conclusions and Recommendations

Particulate (TSP) and Particulate Matter 10 micron
(PM.10) is very high and has exceeded the maximum Conclusion:
quality standard set by PP 41 of 1999. The high
1. Measured Particulate Matter 10 micron (PM10)
concentration of the three dust parameters is caused by:
concentration ranged from 145.0 - 7.603.4 µg/m3,
zz The first factor, is the density or volume of coal Total Suspended Particulate (TSP) ranged from
transportation traffic, recorded the volume of coal 153.2 - 9,457.8 µg/m3 and dust fall ranged from
truck traffic passing a total of 5,283 units or an between 676.95 - 4,041.14 tons/km2. month.
average of 220 units per hour. The high level of
2. The air temperature at the study site ranged from
dust around the road, especially the special road for
26OC to 35OC and air humidity ranged from 42 -
coal transportation, corresponds to several previous
studies, such as;3-4,7 76%.
zz The second factor, is that the road conditions are 3. The model for estimating TSP and PM10 by dust
less compact, so that when there is friction between fall is
the wheels of the vehicle and the road body and air a. PM10 and TSP fill 60% of dustfall
turbulence due to vehicle speed (reaching 60 km/h) b. PM10 fills 77.8% of TSP
it triggers the dispersion of particles into the air
around the road. Recommendation:
zz The third factor, is air temperature and air humidity, 1. Determination of TSP and PM10 concentrations
these two factors are related to the nature of dust can be done by measuring the level of dustfall
(Patty, 1976); During the day the air temperature using a dustfall collector and the estimator using
can reach 35OC, with a low humidity of 42% and a the model results of this study.
correlation of air temperature with positive particle
2. Further research on PM2.5 dust fraction by
content, that is, the higher the air temperature the
PM10 and TSP, because these three particulate
more the particle content, while the air humidity is
parameters have the same unit
negatively related, or the smaller the air humidity
high particle content. Conflict of Interest: None
The percentage of PM10 from TSP ranges from Ethical Clearance: From ethical committee at Health
63.3% 96.0% with an average of 77.8% ( ± 8.4%), while Polytechnic Ministry of Health Banjarmasin & Surabaya
the dustfall content is filled by 60% of the concentration
of TSP + PM10 obtained from the average measurement Source of Funding: Self
REFERENCES Human Health and Rubber Plants (Study in Tapin

Regency, South Kalimantan Province). Doctoral
1.
As, Z.A. Analysis of PM2.5 Exposure to
Program in Environmental Sciences Dissertation,
Settlements Around Coal Transport Roads
Post-Graduate UB, Malang. 2016.
(Case Study: Tapin District, South Kalimantan
Province). Master of Thesis, ITB, Environmental 6. Junaidi. Dust Distribution of Transport Corridors
Engineering, Bandung. 2010. in Tapin Regency South Kalimantan. IOSR Journal
of Environmental Science, Toxicology and Food
2. Austin J., Brimblecombe P. and Sturges W. Air
Technology (IOSR-JESTFT) e-ISSN: 2319-2402,
Pollution Science for the 21st Century [Book]. -
p- ISSN: 2319-2399. Volume 10, Issue 5 Ver. II
UK: Elsevier,. 2002.
(May. 2016), PP 47-52. 2016. Available from :
3. Eastwood, P. Particulate Emissions from Vehicles. www.iosrjournals.org.
John Wiley & Sons Ltd. England. 2008.
7. Phalen, R.P. Inhalation Studies, Foundations and
4. Holgate, S.M., J.M.Samet, H.S. Koren and R. Techniques, 2nd edition. Informa Healthcare.
Maynard. Air Pollution and Health. Academic New York. 2009.
Press. London. 1999.
5. Junaidi. Study of Dust Concentration from Special
Coal Transportation Roads and the Risks to
Development of Cardiovascular Complications in True

Polycythemiavera Patients Influenced by Increased Blood
Viscosity
Kaliberdenko V. B.1, Kuznetsov E. S.2, Shanmugaraj K.3, Keerthanaa B.3, Al-Nsour J. M.4, Poleshchuk O. Yu.5
Associate Professor, Department of Internal Medicine No.2, 2Assistant, Department of Internal Medicine
1
No.1, 3Department of Internal Medicine No.2, 4Associate Professor, Department of Oncology, 5Assistant,
Department of Stomatology, V. I. Vernadsky Crimean Federal University, Simferopol, Russia
Abstract
True polycythemia is a clonal myeloproliferative process, from the group of Ph-negative myeloproliferative
diseases, developing at the level of the stem hematopoietic cell with a subsequent violation of the proliferation
and differentiation of hematopoietic cells. Purpose of the study is to analyze the features of the development
of cardiovascular complications in patients with true polycythemia and to establishment of correlation
between age of the patients, duration of the disease and the effectiveness of their symptomatic therapy.
Materials and methods - An Assessment of the evolution of complications in cardiovascular system with
patients suffering from polycythemiavera was evaluated, and a correlation was established between age of
the patients, duration of illness, and the effectiveness of their symptomatic therapy. An analysis of 30 patients
suffering from polycythemiavera – 23 men and 7 women were studied. Results - The main complications
that develop as syndromes and symptoms in patients suffering from polycythemiavera were found and the
probability of development of thrombotic complications were assessed. The possibility of progressing of
complications in cardiovascular system were as follows, symptomatic arterial hypertension, coronary artery
diseases(CAD) and hypertension, increases with age of the patients and with the length of the disease.
Keywords: Polycythemiavera (Erythemia, Vaquez-osler disease), Cardio-vascular complications, thrombotic

complications, Myeloroliferative disease, JAK2.
Introduction The history of true polycythemia is conditionally

divided into three eras. The first one is related to the
True polycythemia (syn. Erythremia) is a clonal description of the disease by the Frenchman Louis
myeloproliferative process, from the group of Ph-negative Vaquez in 1892 and in 1903 by the Canadian William
myeloproliferative diseases, developing at the level of Osler [5]. Increased blood viscosity and splenomegaly
the stem hematopoietic cell with a subsequent violation in their patients, prompted the idea that impaired blood
of the proliferation and differentiation of hematopoietic formation is associated with enhanced proliferation
cells [2]. Ultimately, the uncontrolled formation of blood of hematopoietic cells. At the same time, phlebotomy
cells leads to pancytosis (erythrocytosis, thrombocytosis, (bloodletting) began to be used as a “first line” therapy
leukocytosis) with symptoms of splenomegaly. [5]
, and the disease was isolated into a separate non-
zoological form, and erythremia was referred to as
Corresponding Author: Vaquez-Osler disease. The second epoch is diagnostic at
Vitalii B. Kaliberdenko, MD, PhD, the beginning of 19th century in 1939, on the basis of a
Associate Professor, detailed analysis of blood parameters and trepanobiopsy,
Department of Internal Medicine No.2, attempts were made to differentiate absolute polycythemia
V. I. Vernadsky Crimean Federal University, from relative polycythemia. It is worth noting that in
Simferopol, Russia this era they began to use radioactive phosphorus as
Phone: +7(978)1222851 a treatment for erythemia. Finally, the third era, when
Email: vit_boris@mail.ru increased attention to Vaquez-Osler disease from all
diseases in hematology allowed scientists to create the The diagnosis of polycythemiavera is confirmed in
American Polycythemia Research Group. This period, the presence of two large and one small criteria or in
from 1967 to the present day, made many discoveries. the presence of the one large and two small criteria [7].
First of all, research in the field of molecular genetic The distribution of patients in stages was carried out
mechanisms of development and course of this disease according to the clinical and pathogenetic classification.
contributed to the discovery of a mutation in the JAK2 The determination of risk groups for the development
gene as a trigger in the pathogenesis of erythremia [2]. of thrombotic complications in patients with true
This made it possible to revise treatment approaches, in polycythemia was carried out by assigning scores to
particular, in addition to traditional phlebotomy and the such signs as age, white blood cell count (WBC) and
use of antiplatelet agents, drugs from the group of Janus venous thrombosis in history.
kinase (JAK), as well as hydroxyurea and interferon-α,
The conservative therapy offered to our patients,
are available for use in patients with true polycythemia.
for the most part, was aimed at relieving symptoms
Analysis, collection and systematization of the obtained
and reducing the development of complications
data on this disease led to the creation of diagnostic
(escuzan, therapeutic phlebotomy, aspecard, heparin,
criteria of the WHO, 2008[7].
dipyridamole, hydroxyurea). In order to study the
Therefore, the study of cardiovascular complications relationship between age, duration of the disease and
in patients with erythremia is a very urgent task, the the effectiveness of symptomatic therapy, Spearman’s
solution of which will improve the quality and duration rank correlation coefficient was used. Statistical data
of life of patients. processing was performed using Microsoft Office Excel
2013, Statistica-10.
Purpose of the Study
Research Results
To study the features of the development of
cardiovascular complications in patients with true By stages, patients with erythremia were distributed
polycythemia and to establish the relationship between as follows: In Stage I - 5 patients, Stage IIa - 7 patients,
age, duration of the disease and the effectiveness of Stage IIb - 10 patients and in Stage III - 8 patients.
symptomatic therapy. Despite the relatively latent course of erythremia,
especially in the initial stages, in the studied patients, a
Materials and Method group of syndromes and symptoms can be distinguished,
which are the result of changes in the rheological
The study analyzed data of 30 patients with erythema properties of blood and pancytosis (see table 1). The
- 23 men and 7 women who were under observation in most frequent complaints that were presented in patients
the conditions of the Department of Hematology and were associated with damage to the cardiovascular
Chemotherapy of the Crimean Republican Oncological system: increased blood pressure, headache, dizziness,
Clinical Clinic named after V. M. Efetov, Simferopol. shortness of breath, discomfort, and recurrent pain in the
The Patient’s registration was carried out from October heart area. However, in patients with previous cardiac
2013 to September 2016. The median age is 57.5 years pathology, there is a sharp progression and deterioration
(from 29 to 86 years). In order to verify the diagnosis in the debut of the disease. But among the majority of
of true polycythemia, we have used the WHO 2008 patients, complaints of the cardiovascular system were
diagnostic criteria, which included 2 groups: large
detected for the first time. Analyzing the findings, we
(hemoglobin level is more than 185 g/l and 165 g/l in
grouped them into symptomatic hypertension 16.7%
men and women, respectively, including other signs
(n=5), hypertension 20% (n=6) and CAD 16.7% (n=5).
increasing the volume of circulating erythrocytes,
confirmation of mutations in the JAK2 V617F gene) and Plethoric syndrome was detected in 10% (n=3) of
small criteria (results of trepanobiopsy; erythropoietin cases, the main manifestations of which were flushing of
level; spontaneous growth of erythroid colonies without the face, palms, and pruritus. Changes in the bone tissue,
growth factors) [7]. The criteria were developed on the which on the one hand are associated with impaired
basis of a comprehensive clinical and laboratory picture, blood circulation in the vessels of the microvasculature
in order to evaluate true polycythemia in a patients. and the appearance of microthrombus in the capillaries,
are a manifestation of the ossalgic symptom 10% (n=3). complications (0.686, T-crit. = 0.487 with p=0.05), age
In this case, patients complain of persistent pain in and complications (0.931, T-crit. =0.487 with p=0.05).
the lower limbs, joints. On the other hand, enhanced Feedback between duration and effectiveness of the
proliferation of pathologically altered hematopoietic treatment (0.694, Tcrit. =0.487 with p=0.05), age and
cells leads to bone marrow fibrosis - osteomyelofibrosis treatment efficacy (0.954, Tcrit. =0.487 with p=0.05).
10% (n=3). Phenomena of splenomegaly and portal
hypertension in patients with erythremia were detected Discussion
in 13.3% (n=4) and 3.3% (n=1) cases, respectively. At
the same time, the latter had an episode of spontaneous In WHO, MPN category includes seven
bleeding from the veins of the esophagus. subcategories, the term “MPN” usually refers to the three
JAK2 mutation-enriched clinicopathologic entities: PV,
Table 1: The main clinical syndromes and symptoms essential thrombocythemia and primary myelofibrosis
in patients with PolycythemiaVera (PMF)[22]. PV and its sister diseases constitute stem cell-
derived clonal myeloproliferation that is characterized
Number of patients, by three mutually-exclusive “driver” mutations: JAK2,
Syndrome/symptom
n = 30, (%)
CALR, and MPL, with respective distribution frequency
Hypertension 6 (20%) of ~99, 0, and 0% for PV, 55, 22, and 3% for ET and
CAD 5 (16.7%) 65, 20 and 7% for PMF [23]. The most frequent MPN-
Symptomatic arterial associated JAK2 mutation is the exon 14 JAK2V617F,
5 (16.7%)
hypertension which is responsible for almost all the JAK2 mutations in
Plethoric 3 (10.0%) ET and PMF, and 97% of those seen in PV; the remainder
Ossalgic 3 (10.0%) 3% of JAK2 mutations in PV are spread across exons 12,
Osteomyelofibrosis 3 (10.0%) 13, and 14 [24, 25].
Splenomegaly 4 (13.3%) The successes from recent years have helped to
Portal hypertension 1 (3.3%) make accurate and timely diagnosis of Vaquez’s disease,
and therapy as effective as possible. However, the
The high frequency of thrombotic complications in
problem of cardiovascular complications in patients
patients with erythremia makes it necessary to isolate
with true polycythemia is not completely resolved and
patients at risk. Thus, patients belonging to the low-risk
is not sufficiently studied [6]. First of all, it is associated
group (0 points) were identified in 23.3% (n=7) cases,
with a cascade of changes that occur with the blood
the intermediate-risk group (1-2 points) - 30% (n=9)
of patients with erythremia. The most simplified is the
and the high-risk group (≥ 3 points) - 46.7% (n=14) of following scheme: an increase in the mass of circulating
patients with erythremia (table 2). erythrocytes leads to an increase in hematocrit, which
ultimately leads to a change in the rheological properties
Table 2: Risk groups for the development of of blood - an increase in viscosity. Such changes
thrombotic complications in patients with true increase the risk of thrombotic complications in patients
polycythemia with erythremia, which in some cases become the first
manifestations of the disease, and in others may be
Sign System of risk stratification Points fatal. So, thrombotic complications are the main cause
Age 57–66 years 2 of death and disability in 12-49% of patients with
Leukocytes ≥ 15*109/L 1 true polycythemia, and every fifth patient has at least
Venous thrombosis in history 1 one episode of thrombosis in the history [6]. But true
Low risk group - 23.3% polycythemia is not limited to thrombotic complications,
Medium risk group - 30% since the effect on the cardiovascular system leads to the
High risk group - 46.7% development of numerous complications which will be
discussed in our article. It should also be remembered that
By determining the Spearman’s rank correlation the risk of various complications of the cardiovascular
coefficient, a direct relationship was established system increases with the transition of the disease to the
between the following indicators: duration and terminal (anemic) phase [13, 14].
Diagnosis of PV often requires the presence of and a high risk of thrombotic complications deserve
a JAK2 mutation, in addition to documentation of special attention, since the question of achieving a full
increased hemoglobin/hematocrit, to a threshold level therapeutic response, controlling complications and
established by the 2016 WHO criteria (>16.5 g/dL/49% improving the quality of life remains open.
for males and >16 g/dL/48% for females) [22]. In addition,
bone marrow morphologic assessment is encouraged, in Conflict of Interests: None declared.
order to distinguish PV from JAK2-mutated ET [26,27,28] Source of Funding: Self funding by authors
and obtain cytogenetic information, which has recently
been shown to be prognostically relevant [29,30,31]. Clinical Ethical Clearance: In our study involving all human
features in PV include mild-to-moderate degree of participants were in accordance with ethical standards
splenomegaly, mild-to-moderate degree of constitutional of the responsible committee on human experimentation
symptoms, including fatigue and pruritus, symptoms and with the Helsinki Declaration of 1964 and later
of hyperviscosity, leukocytosis, thrombocytosis, amendments.
microvascular symptoms (visual disturbances, atypical
chest pain, erythromelalgia, paresthesia), thrombotic References
and bleeding complications, and risk of leukemic
1.
Andersen C., et al. A phase II study of
transformation or fibrotic progression[32].
vorinostat (MK-0683) in patients with
primarymyelofibrosis(PMF) and post-
Conclusion polycythemiavera myelofibrosis(PPV-MF).
A variety of clinical manifestations and a high Haematologica. 2013;98:279.
percentage of complications, differing in nature and 2. Barbui T., et.al. Philadelphia-Negative Classical
severity, in patients with erythremia continues to create Myeloproliferative Neoplasms: Critical Concepts
difficulties both in treatment and in improving the and Management Recommendations. JCO.
quality of life of patients [6]. Changes in rheological 2011;29(6):761-770.
properties and increase in blood viscosity, according to
3. Colombi M., et. al. Thrombotic and hemorrhagic
the results of our research, have a greater impact on the
complications in essential thrombocythemia.
cardiovascular system with the development of a number
Cancer. 1991; 67(11): 26-30.
of syndromes and symptoms - hypertension, CAD,
symptomatic arterial hypertension in 53.4% of cases. 4.
Pearson TC, Wetherley-Mein G. Vascular
The age peak of morbidity appearing from middle-aged occlusive episodes and venous hematocrit
and elderly patients makes them more vulnerable to the in primaryproliferativepolycythaemia. 1978;
development of thrombotic complications. In our study 2(8102) :219-222.
about true polycythemia, men from 40 to 70 years are 5.
Osler W., et al. Chronic cyanosis with
more susceptible. The risk of developing complications polycythaemias and enlarged spleen: a newentity.
such as hypertension, CAD, symptomatic hypertension 1903;126:187-192.
increases with age and with the duration of the disease.
6. Marchioli R., et al. Cardiovascular events and
When analyzing the effectiveness of therapy in patients
intensity of treatment in polycythemiavera.
with erythremia, an inverse relationship was established
Lancet. 2013;368:22-33.
between the experience of the disease and age. Thus,
the high age and long-term course of the disease makes 7. Vardiman, J. The 2008 revision of the WHO
the sensitivity to treatment low, which is associated classification of myeloid neoplasms and
both with thrombotic complications in patients of this acuteleukemia: rationale and important changes.
age group and with the risk of progression of the tumor Blood. 2009;5(114):937-952.
process with transition to leukemia, the development 8. Gori T. Viscosity, platelet activation, and hematocrit
of intoxication syndrome, secondary myelofibrosis. In progress in under-standing their relationship with
such cases, it is necessary to consider cytoreductive or clinical and subclinical vascular disease. Clinical
targeted therapy, as a “first-line” therapy [3]. Of course, Hemorheology and Microcirculation. 2011; 49:
elderly patients with a long course of the disease 37-42
9.
Sever M., et. al. Therapeutic options for 21. Broseus J, Park JH, Carillo S, et al. Presence
patients with polycythemiavera and essential of calreticulin mutations in JAK2-negative
thrombocythemia refractory/resistant to polycythemiavera. Blood. 2014;124:3964-3966.
hydroxyurea. Leuk. Lymphoma. 2014;55:85-90.
22. Arber, D. A. et al. The 2016 revision to the WHO
10.
Campbell PJ, et. al. Correlation of blood classification of myeloid neoplasms and acute
counts with vascular complications in essential
leukemia. Blood. 2016;127:2391-2405.
thrombocythemia: analysis of the prospective PT1
cohort. Blood. 2012;120(7):9-11. doi:10.1182/ 23. Tefferi, A., Pardanani, A. Myeloproliferative
blood-2012-04-424911. neoplasms: a contemporary review. JAMA
11. Klampfl T., et.al. Somatic mutations of calreticulin Oncology.2015;1:97-105.
in myeloproliferative neoplasms. The New 24. Tefferi, A. Somatic JAK2 mutations and their
England Journal of Medicine. 2013;369:79-90. tumor phenotypes. Blood. 2016;128:748-749.
12.
Geyer H.L., et. al. Distinct clustering of
25. Alghasham, N., Alnouri, Y., Abalkhail, H. &
symptomatic burden amongst myeloproliferative
Khalil, S. Detection of mutations in JAK2 exons
neoplasm patients. Blood. 2014;123(24):3-10.
doi:10.1182/Blood-2013-09-527903. 12-15 by Sanger sequencing. International Journal
of Laboratory Hematology. 2016;38:34-41.
13. Kuznetsov E.S., V.B. Kaliberdenko, A.N. et
al. Troponinemia as a marker of necrobiotic 26. Barbui, T., Thiele, J., Vannucchi, A. M. &
syndrome in hemic hypoxia of varying severity. Tefferi, A. Rationale for revision and proposed
International Scientific Research Journal. 2015; changes of the WHO diagnostic criteria for
6-2(37):119-121.[In Russian] polycythemiavera, essential thrombocythemia
14. Kuznetsov E.S., V.B. Kaliberdenko, A.N. et al. and primary myelofibrosis. Blood Cancer Journal.
Features of heart rhythm with etiological hemic 2015;5:e337.
hypoxia. International Research Journal. 2016;8-2 27. Kvasnicka H. M. et al. European Leukemia Net
(50):97-99.[In Russian]
study on the reproducibility of bone marrow features
15. Nangalia J., et al. Somatic CALR mutations in in masked polycythemiavera and differentiation
myeloproliferative neoplasms with nonmutated from essential thrombocythemia. American journal
JAK2. The New England Journal of Medicine. Hematology. 2017;92:1062-1067.
2013;369:2391–2405.
28. Barbui, T. et al. Diagnostic impact of the 2016
16. Wang L., et al. Whole-exome sequencing of revised who criteria for polycythemiavera. American
polycythemiavera revealed novel driver genes
journal of Hematology. 2017;92:417-419.
and somatic mutation shared by T cells and
granulocytes. Leukemia. 2014;28:935-938. 29. Tang G. et al. Characteristics and clinical significance
17. Delhommeau F., et al. Mutation in TET2 in of cytogenetic abnormalities in polycythemiavera.
myeloid cancers. The New England Journal of Haematologica. 2017; 102:1511-1518.
Medicine. 2009;360:2289-2301. 30. Barraco D. et al. Cytogenetic findings in WHO-
18. Tefferi A, et al. TET2 mutations and their defined polycythaemia vera and their prognostic
clinical correlates in polycythemiavera, essential relevance. British journal of hematology. 2017 (in
thrombocythemia and myelofibrosis. Leukemia. press).
2009;23:905-911.
31. Tefferi, A. et al. Survival and prognosis among 1545
19. Kent DG., et al. Order matters: Sequence of patients with contemporary polycythemiavera: an
mutation acquisition in myeloproliferative international study. Leukemia. 2013;27:1874-1881.
neoplasms impacts disease pathogenesis and stem
cell potency. Blood. 2013;122:2888. 32. Tefferi, A. Barbui. T., Polycythemiavera and
essential thrombocythemia: 2017 update on
20. Ortmann CA., et al. Effect of mutation order on
myeloproliferative neoplasms. The New England diagnosis, risk-stratification, and management.
Journal of Medicine. 2015;372:601-612. American journal of Hematology. 2017;92:94-108.
Determination of Safe Concentration of Benzene Exposure

in Workers in a Laboratory of Oil Processing Industry in
Indonesia
Kharina Almira Djalali1, Abdul Rohim Tualeka1, Pudji Rahmawati2, Syamsiar S Russeng3, Atjo Wahyu3,
Ahsan4, Dewi Kartikasari5
Department of Occupational Health and Safety, Faculty of Public Health, Airlangga University, 60155
1
Surabaya, East Java, Indonesia; 2Department of Development of Islamic Society, State Islamic University
Sunan Ampel, Surabaya, Indonesia; 3Department of Occupational Health and Safety, Faculty of Public Health,
Hassanudin University, Makassar, Indonesia; 4Faculty of Nurse, University of Brawijaya, Malang, Indonesia;
5
Department of Environtmental Health, Faculty of Public Health, Diponegoro University, Semarang, Indonesia
ABSTRACT
Benzene is one of the substances included in the poison of air pollution. The Environmental Protection
Agency (EPA) has classified benzene in Group A carcinogens for humans. The widespread use of benzene
in the industrial world can have harmful consequences. The amount of exposure workers receive has a
negative impact on their health. Workers at the petroleum refinery laboratory are workers at risk of exposure
to benzene. The study aimed to measure the safe concentration limit in the Main Laboratory section of PT.
Pertamina RU IV Cilacap. This was a cross sectional, observational, and descriptive study with 51 samples
of PT Pertamina RU IV Cilacap laboratory workers. Variables of this study were benzene concentration
in the workplace, working time per day, work respiration rate, worker height, weight, and body surface
area, white mice body surface and weight, Km factor on workers (Human Km), Km factor on animals
(Animal Km), No Observed Adverse Effect Level (NOAEL), safe human dose (SHD), and benzene safe
concentrations (C safe) in the air for workers.
The result indicated that safe concentration (C safe) limit in PT Pertamina RU IV Cilacap was 0.03 ppm. It
is less than the safe concentration set by Minister of Manpower and Transmigration Regulation No. 13 of
2011 which stated that the c safe is 0.5 ppm. It showed that the TLV in the Main Laboratory section of PT.
Pertamina RU IV Cilacap is not safe for workers as benzene concentration in this laboratory is 16.67 times
bigger than its safe concentration of benzene.
Keywords: Benzene, safe concentration, laboratory worker
Introduction carcinogens for humans. The widespread use of benzene

in the industrial world can have harmful consequences.
Benzene is one of the substances included in the The amount of exposure workers receive has a negative
poison of air pollution. The Environmental Protection impact on their health. Workers at the petroleum refinery
Agency (EPA) has classified benzene in Group A laboratory are workers at risk of exposure to benzene.
One of the chronic effects of being exposed to benzene
is a bone disorder of the spinal cord which changes the
blood profile.
Abdul Rohim Tualeka
Department of Occupational Health and Safety, Benzene enters the body through inhalation. It enters
Public Health Faculty, Airlangga University Campus C, in the form of steam with the main absorption occurring
Jalan Mulyorejo, Surabaya, 60115, Indonesia in the lungs. A number of cases of benzene poisoning
Phone: +62 81 333 519 732 occurs through the respiratory tract in the workplace.
Email: abdul-r-t@fkm.unair.ac.id Ninety per cent of those cases are because of inhaling the
benzene as much as ± 8 m3 of air for 8 hours/day every Secondary data is taken from the information about
day1long exposure, exposure frequency, and duration of working process and the number of workers involved.
exposure. The measures include the analysis of hazard
identification, dose- response analysis, exposure analysis, The variables of this study were workplace benzene
risk characteristics, and risk management. The results of concentration, working time per day, work respiration
the average concentration of benzene from 8 point was rate, worker height, worker body weight, worker’s body
0,287 mg/m3. The average yield intake of all workers surface area, body surface area and weight of white mice,
on non-carcinogenic effects was 0.0027 mg/kg/day. The Human Km, Animal Km, No Observed Adverse Effect
average of workers intakes of carcinogenic effect was Level (NOAEL), safe human dose (SHD), and benzene
0.0039 mg/kg/day. A total of 19 respondents (37.35. safe concentrations in the air for workers (C safe).
Benzene as a toxic substance has a safe concentration. The formula for calculating Safe Human Dose
Based on research that has been done in the PT. (SHD) used in this study was the formula by Shaw et
Pertamina RU IV Cilacap, the average concentration of al (2007)
benzene measured at 8 points was 0.09 ppm. It is below Animal Km
the Threshold Limit Value (TLV) set by Minister of SHD = NOAEL
Human Km
Manpower and Transmigration in its regulation No. 13
To determine the safe concentration of benzene
of 2011 which is equal to 0.5 ppm. However, this TLV
for workers in the Laboratory of PT Pertamina RU IV
can still bring health effects for the workers. Based on
Cilacap, the data was analyzed using manual qualitative
the Environmental Protection Agency (EPA) research, a
analysis.
long-term tolerance of benzene exposure in the air with
a concentration limit of 0.004 ppm can cause case of
leukemia one in 10,000 populations (2013). Result
A. Characteristic of Experimental Animal (White
Safe benzene concentration is needed as a benchmark
Mice): The toxicity of a chemical is known
for exposure limits that are permitted to avoid the
when the substance enters the body and affects
occurrence of health effects for workers. However, many
or damages the human body. Toxicity test of a
of safe concentration origin are not known. Research by
chemical can be done using experimental animals,
Saridewi and Tualeka in 2012 shows calculation results
such as white mice that qualitatively have similar
of safe concentrations derived from NOAEL and Rfc
response to toxins to human. Table 1 shows weight
values2.
and body surface area (BSA) of white mice.
Based on the description above, this study aimed
to determine the Threshold Limit Value of benzene in Table 1: Distribution of Experimental Animal
the Main Laboratory section of PT. Pertamina RU IV (White Mice)
Cilacap.
Experimental Animal W BSA
(White Mice) (kg) (m2)
Material and Method
1 0.1405 0.024165
It is an observational, cross sectional and descriptive 2 0.1405 0.024165
study. Subject for this study is 51 out of 85 workers of 3 0.1410 0.024223
the Laboratory section of PT. Pertamina RU IV Cilacap. 4 0.1410 0.024223
The object sample of this study is the air in the working 5 0.1395 0.024050
area of Main Laboratory and Petrochemical and Gas 6 0.1415 0.024165
Laboratory of PT. Pertamina RU IV Cilacap.
Based on the weight of white mice, its body
Primary data is taken from the measurement of surface area (BSA) can be calculated using the
benzene concentration in the air sample in the working following formula:
area of Laboratory of PT. Pertamina RU IV Cilacap
Animal BSA = 0.09 × W0.67
and the weight of experimental animal, white mice.
Annotation:
Conted…
BSA: Body Surface Area (m2) KR Room 0.059
W: Weight (kg) Observation Table 3 0.139
Observation Table 4 0.187
B. Workers Characteristic: The characteristics of
R & D analysis table 0.073
workers in this study consisted of workers’ weight,
height, working time and the average respiratory Administration office 0.069
rate in the PT. Pertamina RU IV Cilacap. Table 2 Average 0.09
shows the characteristics of workers.
Measurement results of benzene concentration in the
Based on the average weight and height of the PT. Pertamina RU IV Cilacap shows that it is still below
workers’, body surface area and respiration rate of the TLV of 0.5 ppm, which based on the Regulation of
the workers can be calculated using the following the Minister of Manpower and Transmigration No. 13 of
formula: 2011 concerning the Threshold Limit Value of Physical
1. The Average of Workers’ Body Surface Factors and Chemical Factors in the Workplace. The
Area: highest concentration of benzene in the PT. Pertamina
RU IV Cilacap is 0.187 ppm, the lowest is 0.006 ppm
BSA = W.h / 3600 = 67.159 / 3600 = 1.72 m2 and the average is 0.09 ppm.
Annotation:

However, this is still above the minimum risk level
BSA: Body Surface Area (m2)
(MRL) set by ASTDR (2007), which stated that the acute
W: weight (kg) exposure (≤ 141 days) is 0.009 ppm, moderate exposure
h: height (cm) (15-364 days) is 0.006 ppm and chronic exposure (≥ 365
2. The Average of Workers’ Respiration Rate days) is 0.003 ppm.
BR = 5.3 ln W – 6.9/24 = 5.3 ln 67 – 6.9/24 A. Animal Km dan Human Km: The calculation
= 0.596 m3/jam of animal Km and human Km was made as a step
before determining the threshold limit value for
Annotation:

workers.
BR: Breathing Rate (m3/hour)
1. Animal Km
h: height (cm)
W animal
Animal Km =
Table 2: Distribution of Workers’ Characteristics, BSA animal
Annotation:

Respiration Rate and Working Time in Average
Animal Km: animal Km factor
Sample W h BSA BR t
W animal: animal weight (white mice)
Size (kg) (cm) (m2) (m3/h) (hour/day)
51 67 159 1.72 0.596 8 BSA Animal: Body Surface Area of white mice
Table 4 shows the result of Animal Km
C. Benzene Concentration: Table 3 shows the
calculation. It shows the weight, BSA and
measurement result of benzene concentration in
animal Km of the white mice.
8 different measurement spots in the working area
of laboratory of PT. Pertamina RU IV Cilacap.0 Table 4: Animal Km of the Experimental Animal
(White Mice)
Table 3: Benzene Concentration in the Working Area
of Laboratory of PT. Pertamina RU IV Cilacap Experimental
W BSA Animal Km
Animal
Location Concentration (ppm) (kg) (m2) (W/BSA)
(White Mice)
Observation Table 1 0.011 1 0.1405 0.024165 5.814194082
Observation Table 2 0.006 2 0.1405 0.024165 5.814194082
Shelter D 0.169 3 0.1410 0.024223 5.820914007
Conted… G. Safe Concentration of Benzene: The calculation

of safe concentration of benzene in the laboratory
4 0.1410 0.024223 5.820914007
of PT. Pertamina RU IV Cilacap can be made
5 0.1395 0.024050 5.8004158
using William (1985) as follows:
6 0.1415 0.024165 5.855576247
Rata-Rata 0.1407 0.024165 5.82 SHD W mg
Safe Concentration =
2. Human Km d BR t m3
Conversion formula from mg/m3 to ppm is as
W human
Human Km = follows:
BSA human
Annotation:

mg m
3
Human Km: human Km factor Safe Concentration = × 24.5 ppm

MW
W human: weight of workers Annotation:

BSA human: Body Surface Area of workers Safe concentration: safe concentration of a toxic
Table 5 shows the result of human Km in the air for workers (mg/m3)
calculation. It shows the weight, body surface SHD: Safe Human Dose (mg/kg)
area and the average human Km.
W: weight (kg)
Table 5: The average human Km

d: % of substances absorbed by the lungs
Sample W BSA Human Km BR: breathing rate (m3/hour)

Size (kg) (m2) (W/BSA) t: working time (hour)
51 67 1.72 38.95
Based on the above formula, the results of
E. NOAEL: No Observed Adverse Effect Level the calculation of the safe limit of benzene
(NOAEL) is a calculation that must be done to concentration in the Laboratory section of PT.
determine the extent to which the concentration Pertamina RU IV Cilacap as follows:
of chemicals. NOAEL of benzene is 0.022 mg/
kg (EPA, 2005). It is obtained by the calculation (0.003)(67)
C safe (mg/m3) = mg/m3
using the following formula: (50%)(0.596)(8)
= 0.092 mg/m3
3 × 0.00013 × 8
NOAEL Benzene (mg/m ) = 3
(0.0092mg / m )( 24.5ppm )
3
0.1405 C safe (ppm) =
= 0.022 mg/kg (78.11 mg mol)
F. Safe Human Dose: Safe Human Dose (SHD) = 0.03 ppm
can be calculated using the formula of Shaw et al
The calculation result of the safe concentration
(2007):
benzene in the air in the working area of the PT.
Animal Km Pertamina RU IV Cilacap can be used as a predictor
SHD = NOAEL
Human Km of safe toxin concentration limits for workers in the
Annotation:
workplace when the Threshold Limit Value (TLV) has
SHD: Safe Human Dose (mg/kg) not been established. It can also be used as a comparison
with the current TLV set by other institutions.
NOAEL: No Observed Adverse Effect Level (mg/kg)
Based on the formula above, SHD can be obtained Discussion
by calculating NOAEL, the average animal Km
dan the average human Km as follows: Trial activities in the Laboratory of PT Pertamina
RU IV Cilacap which involves test samples in the
SHD = 0.022
5.82
= 0.003 mg/kg form of crude oil and fuel-based products and non-fuel
38.95 products containing benzene and which can evaporate
at certain temperatures and pressures is a source of Rfc used was a provision determined by IRIS (Integrated
benzene hazards for workers. Stages of handling the test Risk Information System) from US-EPA which was
sample require combustion or heating the test sample. It equal to 0.0086 mg/kg/day. However, this study
causes benzene to evaporate into the air in the working obtained Rfc result of 0.003 mg/kg. It was derived from
environment which later can cause negative effect for the calculation of NOAEL, Animal Km and Human Km.
workers’ health. It is due to that benzene is in Group A Saridewi and Tualeka (2012) used the Rfc calculation
of carcinogens for humans (EPA). formula and get the Rfc value of 0.004 mg/kg. A research
conducted at the Wedoro shoe factory, Sidoarjo, which
Workers in the Laboratory of PT Pertamina RU IV used the same Rfc calculation formula, obtained the Rfc
Cilacap work with a duration of 8 hours/day for 265 value of 0.0036 mg/kg.
days/year. The results of interviews with 51 respondents
found that 21.6% respondents reported to experience The measurement result of benzene concentration
dizziness, 21.6% irritability, 17.6% sleep disorders, in 8 different measurement spots in the working area of
13.7% breathlessness, and 11.8 % nausea1long exposure, laboratory of PT. Pertamina RU IV Cilacap showed that
exposure frequency, and duration of exposure. The its highest benzene concentration was 0.187 ppm and
measures include the analysis of hazard identification, the lowest was 0.006 ppm. It is still far below the TLV
dose- response analysis, exposure analysis, risk set by Minister of Manpower and Transmigration in its
characteristics, and risk management. The results of regulation No. 13 of 2011, which stated that the TLV of
the average concentration of benzene from 8 point was benzene is 0.5 ppm.
0,287 mg/m3. The average yield intake of all workers
on non-carcinogenic effects was 0.0027 mg/kg/day. The The obtained safe concentration limit of benzene in
average of workers intakes of carcinogenic effect was the Laboratory of PT. Pertamina RU IV Cilacap is 0.03
0.0039 mg/kg/day. A total of 19 respondents (37.35. ppm. It is below the TLV set by Minister of Manpower
and Transmigration in its regulation No. 13 of 2011,
Calculation of safe concentration limit in PT. which stated that the TLV of benzene is 0.5 ppm. It
Pertamina RU IV Cilacap was carried out in some steps. indicated that working area in the Laboratory of PT
It was started with the calculation of NOAEL, followed Pertamina RU IV Cilacap is not safe for workers as it is
by calculation of SHD/Rfc and, as a final step, calculation 16.67 times bigger than the safe limit in the Laboratory.
of the safe limit of benzene concentration. Saridewi and
Tualeka (2012) who conducted a study to determine the Benzene contains gasoline which can have an
benzene safe concentration limits also performed such impact on blood hemoglobin levels. Exposure to
calculation steps using NOAEL and SHD/Rfc. benzene through the respiratory tract with certain doses
can damage human blood cells. Benzene can provide
According to EPA, NOAEL (No Observe Adverse an impact on the spinal cord which can cause aplastic
Effect Level) is an experiment in determining doses that anemia, immune cell damage and acute bleeding. It is
do not indicate a statistically significant effect on toxic proved by workers complaints of uncomfortableness of
effects or biological functions3. NOAEL benzene values respiratory tract and eyes. The use of personal protective
in this study is 0.022 mg/kg determined by EPA (2005). equipment (PPE) for workers such as masks is strongly
Based on research results by Swean et al (2010), the recommended. It is to reduce their risk of inhaling
result of NOAEL benzene was 3.0 mg/m3 or equal to benzene. It is also strongly recommended for workers to
0.022 mg/kg. The research conducted by Kruskal Wallis consume nutritious foods such as beef liver and salmon,
to determine NOAEL values by testing the expression to increase their immunity against benzene5.
of imuneractive interleukin-2 showed that the IRS score
results were not significantly different so that they could Conclusion
be used as a reference for NOAEL values3.
1. NOAEL benzene in the Laboratory Section of PT.
SHD (Safe Human Dose) or Rfc is a dose reference Pertamina RU IV Cilacap is 0.022 mg/kg.
for humans. When the dose received by human exceeds
2. SHD/Rfc benzene in the Laboratory Section of
the SHD/Rfc value, the risk for human health is also
PT. Pertamina RU IV Cilacap is 0.003 mg/kg
greater4. Generally, in the previous study, the value of
3. Safe concentration of benzene in the Laboratory 2. Saridewi N, Tualeka AR. Penentuan Konsentrasi
Section of PT. Pertamina RU IV Cilacap is 0.092 Aman Benzena di Stasiun Pengisian Bahan Bakar
mg/m3 or equal to 0.03 ppm. Umum (SPBU) di Pancoranmas Depok. 2006;
3. Tualeka AR, Wibrata DA, Ahsan A, Rahmawati
Recommendation P, S Russeng S, Wahyu A, et al. Determination
of Highest Dose of Ammonia without Effect at
The Threshold Limit Value (TLV) of benzene
Work Environment through the Expression of
concentration obtained from manual calculations of
Interleukin-2 Cell in Rattus Novergicus. Open
this study can be used as the TLV of benzene in PT.
Access Maced J Med Sci [Internet]. 2019 Mar
Pertamina RU IV Cilacap.
15;7. Available from: https://www.id-press.eu/
It is strongly recommended for workers to use mjms/article/view/oamjms.2019.207
personal protective equipment (PPE) such as masks 4. Rahman. Public Health Assessment : Model
during working hours, and for the company to provide Kajian Prediktif Dampak Lingkungan dan
high nutritious food for workers. Aplikasinya Untuk Manajemen Risiko Kesehatan.
Conflict of Interest: All authors have no conflicts of Depok; 2007.
interest to declare. 5.
Tualeka AR. Toxicology Industry & Risk
Source of Funding: This is an articel “Penentuan
Konsentrasi Aman Pajanan Benzene pada Pekerja di 6. Menteri Tenaga Kerja dan Transmigrasi Republik
Bagian Laboraturium Industri Pengolahan Minyak Indonesia. Peraturan Menteri Tenaga Kerja dan
Bumi“ of Occupational Health and Safety Departmen Transmigrasi Nomor PER. 13/MEN/X/2011
that was supported by Faculty of Public Health, tahun 2011 tentang Nilai Ambang Batas Faktor
Airlangga University. Fisika dan Faktor Kimia di Tempat Kerja. Jakarta:
Kementrian Tenaga Kerja dan Transmigrasi
Ethical Clearence: The study was approved by Republik Indonesia; 2011
the institutional Ethical Board of the Public Health,
Diponegoro University 7. US-EPA. Benzene (CASRN 71-43-2). Wshington,
DC: Irish, US EPA; 2015
REFERENCE 8. US-EPA. Carcinogenic effects of benzene:

An update. Prepared by the national center
1. Dewi Kartikasari, Nurjazuli MR. Analisis Risiko
for envirnmental health, office of search and
Kesehatan Pajanan Benzene Pada Pekerja Di
development. Washington, DC: US EPA; 1998
Bagian Laboratorium Industri Pengolahan Minyak
Bumi. J Kesehat Masy [Internet]. 2016;4(4):892–
9. Available from: http://ejournal-s1.undip.ac.id/
index.php/jkm%0AANALISIS
Functional Gastrointestinal Disorders in Pediatrics
Khudhair Khalaf Shallal

High Diploma in Pediatrics, Directorate of Health of Anbar, Iraq
Abstract
Characterization over infancy then adolescent practical gastrointestinal disorders (FGIDs) has advanced in
the course of the longer room manner nowadays culminate among another room. The generation regarding
diagnose the Fgid only then organic sickness has been excluding is wan, now we bear proof in conformity
with supporting symptom based diagnosis. The child adolescent room five, we lengthen thinking means of
putting off the word up to expectation in that place was “no proof because natural disease” in all the definition
and replace that along “after fabulous clinical evaluation the signs and symptoms can’t lie attributed after
any other scientific conditions.” This changing allows clinician in conformity with perform selective and
not checking out in imitation of the guide a high-quality analysis about the FGID. The additionally point
so much FGID can be coexist together with sordid medicine stipulations so much them-selves end results
between GI symptom (exciting bowel diseases). In Rome five, purposeful nausea and functionally vomiting
currently describe. Rome third “abdominal punishment related practical gastrointestinal disorders” has been
modified to “functionally stomach castigation disorder” and we have derived a modern terms, useful belly
pain not in any other case specified, in conformity withdraw youth whosoever function now not suit a unique
disorder, such namely cross bowel, purposeful dyspepsia, then belly migraine. Rome five FGID definition
beautify clarities because of each clinician then researcher.
Keywords: Children, Adolescent, Abdominal, Nausea, Vomiting, Functionally Disorder
Introduction aptitude according to record pain, as can stand pushed

by hypervigilance, underlies the diminished punishment
Behavioral research on psychological and social thresholds among IBS patients, rather than improved
effects to understand the bulge of the digestive system. neurosensory sensitivity. Studies of the consequences
The actual behavior of visceral hyperplasia and about stressors about appreciation concerning colorectal
hypersensitivity detected among a huge subset of those distention into healthy topics and IBS sufferers hold
suffering from IBS and FD is still unclear. Thinking best particularly inconsistent findings, fit in conformity
about “visceral hypersensitivity” such as pain thresholds with variants amongst the stressors ancient then potent
is much less experienced during sensorial sensory confounders, such as distraction (2). However, an
examination as it is, reporting punishment in less instruction as controlled because distraction proved as
pressure or volumes all through frequent inflating the GI IBS patient, not healthful subject, rated rectal distensions
balloon catheterization (1). However, as much we bear extra intense and unpleasant throughout dichotomously
outlined, such is becoming an increasing number of clear ear strength compare together with relaxations (3).
that psychological procedures yet psychosocial elements
may affect visceral perceptual sensitivity. There are Throughout the recorded history, the decade of
various research endorses so a multiplied psychological entertainment at home has had intimate connotations
that the pace of the amount goes beyond its real function.
It is usually considered personal or ambiguous. Their
Corresponding Author: dysfunction is related to embarrassment, emotion,
Khudhair Khalaf Shallal shame or strong bowel performance as required by
High Diploma in Pediatrics, general well-being. In addition, we understand intestinal
Directorate of Health of Anbar, Iraq function after dysfunction, so the animals are closely
Email: Dr_khudair2008@yahoo.com linked with strength and emotion: I find them strong in
swallowing, I cannot drop that much longer, and then I targeting coping strategies, as well as like parents’ then
have the butterflies in my stomach. On the contrary, or children’s beliefs about, or responses to, children’s
perhaps as it evolves for health benefit, the substance and discipline complaints, brought about increased baseline
feces are unhealthy according to the senses; the scene or in accordance with follow-up decreases in discipline
odor, or after contact with it, executes the administration and GI signs compared together with an educational
according to the pathological responses, nausea, or intervention controlling for time yet attention, yet up to
vomiting. Each person has a scary law so that it is then expectation it impact was mediated by way of changes
combined derived next to an equal anlage, the original within parents’ cognitions as regards their child’s pain (7).
neural crest.(4) This facility in the intestines also explains
what is the element of tension or psychologically Function Gastrointestinal Disorder: Regurgitation
compounded components after the intestinal properties Reflux refers within consequence including retrograde
and dysfunction of the function, Gastrointestinal involuntary motion concerning gastric issue within then
symptoms, disease, and bitter The understanding of how overseas of the stomach after is often referred to as
these factors are pronounced in the tradition of some other gastroesophageal reflux. When the reflux is immoderate
factors, along with changing norms, trust systems, or ample afterward maintain visualized certain is called
prototyping, has evolved in a timely manner, the similar regurgitation. Regurgitation atop stomach contents
section traces cultural influences in terms of research, among the esophagus, mouth, and/or nose is widely
capacity for symptoms, gastrointestinal symptoms, used among kiddies afterward is inside the predicted
Thus leading to the identification and classification of quantity about behaviors amongst sound infants. Infant
beneficial GI disorders (5). regurgitation is the most common FGID within the
advanced yr concerning life. Recognition over infant
Environmental Influence: Childhood environmental regurgitation avoids useless scientific medical doctor
factor: parental belief and behavior. There is a familial visits then bold investigations yet remedy because about
total regarding morning FGID. Children about grown- gastroesophageal reflux sickness (GERD) (8). Infant
up irritable bowel symptom (IBS) sufferers accomplish regurgitation is super out of vomiting and is described by
more fitness greatness visits than the young people on using an internal frightened system exposure involving
non-IBS parents. This pattern is no longer confined both autonomic and skeletal muscle agencies concerning
in conformity with gastrointestinal (GI) signs and who gastric factor are forcefully expelled thru the
symptoms and holds because of maternal yet paternal trencherman due to the fact over coordinated actions
symptoms (6). Although even is permanent research upstairs the youthful bowel, stomach, esophagus, and
within a genetic clarification because of these familial diaphragm. Regurgitation is moreover excellent out of
patterns, where teenagers analyze out of parents do rumination, inside who till at present swallowed food
redact a too greater performance according to the hazard is returned in accordance in imitation of the pharynx
because of increasing an FGID than genetics. The or mouth. When the regurgitation about gastric issue
primary learning principle over fantastic reinforcement reasons troubles or contributes of accordance concerning
or reward, described as a match following partial adroitness injury and irritation (eg, esophagitis,
behavior that will increase the likelihood about so obstructive apnea, wonderful airway disease, pulmonary
much behavior occurring among the future, is a likely aspiration, maintenance, and all difficulties, afterward
contributor according to what that be able to occur. failing into pursuance including thriving), such is
Children whose mothers enhance sickness conduct ride referred in accordance with as like GERD (9).
extra extreme stomachaches yet extra school absences
than vile children. In addition, when parents had been The cause because of acceptance regarding
requested in imitation of show effective and feeling diagnostic entities. Based regarding medical experience,
responses in imitation of their children’s punishment in especially about youngsters alongside anxiousness then
a laboratory, the frequency regarding pain complaints depression, practical nausea but realistic vomiting are
was once higher than parents are recommended in at existing blanketed of Rome IV (10). Some sufferers
imitation of pass by them. Finally, a great randomized maintain nausea alone, partial bear vomiting alone, but
scientific analysis regarding teens with useful belly scrappy have nausea then vomiting. We agree with so
punishment found as cognitive-behavioral cure (CBT) much the absence over concomitant discipline between
that troubles suggests he ought to now not continue to in the administration upstairs dependancy disorders. A
be sure namely portion regarding beneficial dyspepsia. worthwhile current inpatient interdisciplinary strategy so
Pathophysiologic considerations. Clinical evaluation. worried pediatric psychology, pediatric gastroenterology,
We preserve set up realistic nausea and beneficial scientific nutrition, toddler life, remedy recreation,
vomiting as detach entities, but sufferers together afterward rubdown therapy has been mentioned between
with chronic nausea dense times file mild vomiting younger people along with so condition (13).
including more than a few frequencies. The attendance
of extreme vomiting amongst culling in pursuance with Morbidities: Morbidity associated with FGIDs is
nausea affords a one-of-a-kind state of affairs among as among overall psychosocial. Pain interferes collectively
like middle anxious governance disease, GI anatomic together with day-to-day college appearance afterward
abnormalities (eg, malrotation), gastroparesis, or inner performance, mate relationships but distribution in
pseudo-obstruction hold excluded. Biochemical trying household yet non-public activities. One outdoors
out may also encompass pardon regarding serum concerning x teens together with practical belly
electrolytes, calcium, cortisol, or thyroid hormone punishment attends college into deep situations whilst
levels. Intestinal bunker but dynamism troubles (eg, extra than 28% in relation to sufferers have absenteeism
gastroparesis, inner pseudo-obstruction) labor in larger than secure day concerning people Data beyond
conformity with posture considered then cut far away adults undergo tested according to that amount victims
from the appearance regarding recurrent vomiting. Kin whosoever suffer beyond FGIDs may also additionally
about useful nausea or vomiting after sluggish gastric undergo couch difficulties, headaches, dizziness yet
emptying in teens is no longer in reality established. fatigue. Similar studies, however, are lacking in pediatrics.
We did no longer consider an everyday pinnacle GI Furthermore, psychological issues definitive specifically
endoscopy a makes use of because of forecast on anxiety and fail are common. Children alongside FAP
practical nausea besides vomiting. Psychological bear a leaning into conformity on maintaining a lower
evaluation is imperative in younger people inclusive of attribute concerning entity than wholesome teenagers
practical nausea afterward practical vomiting (11). but the comparable multiplication on existence
specifically sufferers along with demonstrable herbal
Clinical Evaluations: Effortless repetitive regurgitation, gastrointestinal disease. There are additionally pointers,
swallowing, and/or spitting inside minutes in regard to therefore, siblings concerning teens inclusive of FGIDs
beginning a feast outline rumination. Other ordinary journey extra emotional/behavioral signs and symptoms
complaints correspond concerning stomach pain, than their peers however their symptoms are not quite
bloating, nausea, heartburn, then a number of somatic virtually identified by way of their mother and father
symptoms, absolute namely headaches, dizziness, yet (14)
. Children which include persistent belly discipline
sleeping difficulties. Differential foreboding includes preserve immoderate utilization about the fitness
gastroesophageal reflux, gastroparesis, achalasia, outweigh system namely as they, along collectively
bulimia nervosa, and ignoble purposeful then bodily along with their parents, pray solutions due to the fact
gastric yet tiny inside diseases, but within none regarding the unexplained stomach pain. They hold a couple of
what entities does the regurgitation bust location directly visits between consequences with healthcare vendors
away later on eating. One instruction suggested to that and may also even petition 2nd but third opinions. They
amount high-resolution esophageal manometry execute document the challenge about lowlife a widespread
discover subgroups including surprising mechanisms background upon to desire is neglected through road
touching disease to up to expectation total reply to about their provider. As a result, pediatricians may also
precise management techniques stability (12). additionally experience compelled then concern victims
in imitation of a doublet about tests, which includes
Treatments: An uncompromising understanding of pick tests, radiological lookup afterward endoscopies
cogitation omen yet a colorful inspiration according to according to preserve outside from missing a big illness
conquer that are fundamental among achieving successful afterward within accordance along with attempt in
treatment. Due to concept syndrome does posture conformity together with achieving an organic diagnosis.
conceptualized into phrases regarding a discovered The FGIDs are, therefore, a possibly debilitating outfit in
habit, remedy hourly has historical techniques profitable regard to issues (15).
social functioning afterward usage regarding fitness

greatness decreased. The proven above according to
desire on to 70% on young adults alongside dyspepsia
had been asymptomatic yet an awful bunch elevated
intestinal 2 years over the diagnosis. Other studies,
however, observed so 30%-50% on formative years
which includes continual purposeful stomach castigation
seasoned frugality as many adults via the discipline
restricted everyday activity inside totally 30%. Moreover,
victims are more into the whole likelihood than controls
afterward trip anxiety, somatization, hypochondriasis,
yet associative dysfunction as like adults. Studies endure
proven then extreme symptoms at the gratuity namely
accurate as much an as improvement within signs
and signs at three months bear been related alongside
Figure 1: Functionality gastrointestinal disorder with greater prognosis, whilst psychological elements
dominant diagnosis in Norwegian children with but judgment tolerance hold been terrible prognostic
abdominal pain. FAP = functional abdominal pain. warning signs (17).
IBS = irritable bowel syndrome.(10)
Conclusion
Functional Dyspepsia: The prevalence involving
dyspepsia varies in 3.5% and 27% relying related Chronic belly castigation of infancy remain
to affect us on a respecting the origin. The recurrent very difficult clinic essence according the average
abstention afterward discipline situated into the pediatrician as properly as specialist. The differential
higher abdomens as much is not relieved with the aid analysis enormous then no confirmatory laboratory
of defecation, not related collectively along with an marker. However, including beyond Rome criteria, white
exchange among stool pattern than no longer defined records then absolute bodily examination in mixture
with the aid regarding a natural disease. Dyspepsia is with restricted laboratory then imaging research now
typically poly-symptomatic. Ninety-nine percentage indicated need to conduct in accordance to the diagnosis.
above big sufferers bring extra than associate symptoms, FGIDs the purpose concerning giant anxiety, immanency,
more than 80% file larger than signs a lot less than 0.1% and illness into young people so nicely namely adults.
record partial symptom. The castigation or castigation As our perception about this stipulations improves, our
may additionally posture related in conformity with medicine interventions pleasure growth too, no longer
vomiting, nausea, stomach fullness, bloating but rapidly solely try after take them, however additionally in
satiety. The referred in imitation of and 26% over 127 conformity with interfering promptly into the disorder
pediatric subjects had ulcer-like symptoms even as 15% direction hence namely according to the rule in long
manifested dysmotility like signs (16). term. Pediatrician have to keep aware of doubtlessly
modifiable morning chance factor then must provide this
Prognosis: Every baby is pronounced in regard to
young person and their households a therapeutic option
the natural history of FGID. In adults, the occurrence
so takes within a score the physiological properly as the
over Ibs and Fd is regular upstairs time, alternatively
psychological factors about the diseases.
collectively including a big turnover inside multiplication
status. Patients who have diagnosed along with realistic Ethical Clearance: People identified as potential
stomach judgment no longer fast end on abject a natural research participants because of their status as relatives
disease as regards approximate follow-ups. after his or carers of patient’s research participants by virtue of
colleagues pronounced to that amount volume 30% - their professional role in the university and departments.
45% on their sufferers together with continual stomach
Source of Funding: Self-Funding
judgment persisted between accordance together with
journey discipline then two years touching a follow-up Conflict of Interests: The authors declare there is no
but it have an impact on concerning the kid’s behavior, conflict interests.
Reference Deposition (CBD) for Solar Cell Applications”,

International Journal of Scientific Engineering and
1. Eswaran S, Muir J, Chey WD. Fiber and functional
Research (IJSER), http://www.ijser.in/archives/
gastrointestinal disorders. Am J Gastroenterol.
v5i12/v5i12.php, Volume 5 Issue 12, December
2013;
2017, 35 - 37
2. DROSSMAN DA. The functional gastrointestinal
12. Chitkara DK, Di Lorenzo C. Pharmacotherapy for
disorders and the Rome II process. Gut. 2010;
functional gastrointestinal disorders in children.
3. Levy RL, Olden KW, Naliboff BD, Bradley LA, Current Opinion in Pharmacology. 2006.
Francisconi C, Drossman DA, et al. Psychosocial
13. Hoyme HE. A Practical Clinical Approach to
Aspects of the Functional Gastrointestinal
Diagnosis of Fetal Alcohol Spectrum Disorders:
Disorders. Gastroenterology. 2006;
Clarification of the 1996 Institute of Medicine
4. Buie T, Campbell DB, Fuchs GJ, Furuta GT, Levy Criteria: In Reply. Pediatrics. 2005;
J, VandeWater J, et al. Evaluation, Diagnosis,
14. Noritz GH, Murphy NA. Motor Delays: Early
and Treatment of Gastrointestinal Disorders in
Identification and Evaluation. Pediatrics. 2013;
Individuals With ASDs: A Consensus Report.
Pediatrics. 2010; 15. A. S. B. A. and M. A. A. Abdullah Hasan Jabbar,
Maytham Qabel Hamzah, Salim Oudah Mezan,
5. M. M. A-kadhim, A. Hamad, S. Abed, A.
“Green Synthesis of Silver/Polystyrene Nano
Mahdi, and A. H. Jabbar, “ Polystyrene Doped
Composite (Ag/PS NCs) via Plant Extracts
with Vinylpyridinium Chloride for Bio-Sensor
Beginning a New Era in Drug Delivery,” Indian J.
Device Applications, Journal of Global Pharma
Sci. Technol., vol. 11, no. 22 June 2018, pp. 1–9.
Technology, 2018; 10(07): 369-373.
16. Evans KN, Sie KC, Hopper RA, Glass RP,
6. Barbara G, Feinle-Bisset C, Ghoshal UC, Santos
Hing A V., Cunningham ML. Robin Sequence:
J, Vanner SJ, Vergnolle N, et al. The intestinal
From Diagnosis to Development of an Effective
microenvironment and functional gastrointestinal
Management Plan. Pediatrics. 2011;
disorders. Gastroenterology. 2016;
17.
Smith MJ, Gerber JS, Hersh AL. Inpatient
7. Mayer EA. Gut feelings: the emerging biology of
antimicrobial stewardship in pediatrics: A
gut-brain communication. Nat Rev Neurosci. 2011;
systematic review. J Pediatric Infect Dis Soc. 2015;
8. Abdullah Hasan Jabbar (2015) “Study Magnetic
18. A. H. Jabbar, M. Q. Hamzah, S. O. Mezan, N.
Properties And Synthesis With Characterization Of
N. Hasan, and M. A. Agam, “A Continuous
Nickel Oxide (NiO) Nanoparticles”, 6 (8): 94-98.
Process for the Preparation, Characterization
9. Ammoury RF, Pfefferkorn MDR, Croffie JM. and Study Thermal Properties of Nickel Oxide
Functional gastrointestinal disorders: Past and Nanostructure,” Int. J. Sci. Eng. Res., vol. 9, no.
present. World Journal of Pediatrics. 2009. 3, 2018 pp. 590–602.
10.
Drossman DA. Functional gastrointestinal 19. Adams JA, Kellogg ND, Farst KJ, Harper NS,
disorders: History, pathophysiology, clinical Palusci VJ, Frasier LD, et al. Updated Guidelines
features, and Rome IV. Gastroenterology. 2016; for the Medical Assessment and Care of Children
11. M. Q. Hamzah, Abdullah Hasan Jabbar, Salim Who May Have Been Sexually Abused. Journal
Oudah Mezan, “Synthesis and Characterization of of Pediatric and Adolescent Gynecology. 2016.
Cu2ZnSnS4 (CZTS) Thin Film by Chemical Bath
Saponin Maintaining and Dose Determining in Carica Papaya

Leaf Cookies as a Breast Milk Booster (galactogogue)
Krisdiana Wijayanti1, Hertanto W. Subagio2, Martha Irene Kartasurya3, Sri Achadi Nugraheni3
1
Doctoral Student, Faculty of Public Health, 2Professor, Faculty of Medicine, 3Associate Professor, Public
Health Nutrition Department, Faculty of Public Health, Diponegoro University, Semarang, Indonesia
Abstract
Background: Papaya leaf has been proven to increase breastmilk production as the saponin content
increases oxytocin level. However papaya leaf has a bitter taste, therefore cookies form is a good alternative
to increase compliance. Saponin content has to be maintained and the dose should be determined to be an
effective breastmilk booster (galactogogue).
Objective: This study aimed to find the best process in 1. Minimizing the bitter taste of papaya leaf, 2.
Maintaining saponin content of cookies, 3. Finding the highest dose of acceptable cookies, and 4. Determining
the amount of cookies has to be consumed by lactating mothers as a breastmilk booster.
Method: For minimizing the bitter taste of Carica papaya leaf we compared the pH level of mashed papaya
leaf after three different treatments. For saponin maintaining, we compared two different temperature and
duration of baking processes. Hedonic tests were performed to find the dose of papaya leaf cookies which
were acceptable. The number of cookies should be consumed was calculated based on amount of saponin in
the cookies, which had been shown to have an effective outcome.
Findings: This study found that Carica papaya leaf which was boiled twice in 60⁰C for 10 minutes had
the lowest pH compared to be soaked in 2.5% volume of quicklime (calcium oxide) solution or 10 minutes
boiled in the cooked rice water. Baking Carica papaya leaf cookies in 60⁰C for 70 minutes could maintain
saponin content compared to be baked in 130⁰C for 35 minutes. Hedonic test results showed that there
was no significant differences in acceptability levels of Carica papaya leaf content between the groups. A
hundred gram cookies with 40% carica papaya leaves contained 3.67g saponin, thus for 1.8g saponin intake/
day in two cookies of 25g should be consumed.
Conclusion: The best method in reducing the bitter taste of Carica papaya leaf cookies was by boiling in
60⁰C for 10 minutes. Saponin content in the cookies could be maintained by 60⁰C for 70 minutes baking.
The highest dose but acceptable taste of carica papaya leaf cookies was 40%. Two pieces of 25g carica
papaya leaves cookies can be consumed as galactogogue.
Keywords: Breastmilk booster, Carica papaya, Cookies, galactogogue, saponin.
Introduction have been conducted to increase breastmilk production,

including medical treatment and herbal galactogogue
Exclusive breastfeeding is important for baby’s growth consumption.2 In Malaysia, 87% of insufficient breastmilk
and health1. However, many problems occur in exclusive problems were overcame by herbal galactagogue because
breastfeeding practice. One of the important problems it is considered safer and more available.3 In Thailand
was breastmilk production insufficiency. Many efforts herbal galactagogue such as banana heart (Musa
acuminata), basil (Ocimum), water pumpkin (Lagenaria
Corresponding Author: siceraria), pumpkin (Cucurbita) had been shown to
Martha Irene Kartasurya, be significantly associated with milk production.4 In
Faculty of Public Health, Diponegoro University Indonesia katuk leaves (Sauropus androgunus (L) Merr)
Email: mkartasurya64@gmail.com increased milk production to 50.7%.5
Some plants including Carica papaya leaf can The method used in determining the degree of
increase milk production because they contain certain acceptability was hedonic test. Untrained panelists of
compounds and minerals.6 Compared to katuk leaves, breastfeeding mothers were employed in this test. They
papaya leaves contain mangan and potassium which were provided with the cookies containing 0%, 10%,
increase prolactin and oxytocin hormones for milk 20%, 30% and 40% carica papaya leaves. Then, they
forming and milk ejecting.5,6 Furthermore Carica papaya were requested to taste the cookies alternately, with 5
leaves are more available in Indonesia than katuk leaves. minutes space of time. Panelists were allowed to drink
However, the bitter taste caused by of carpain alkaloid mineral water in order to neutralize the taste. After that
content in carica papaya is the main reason for them the panelists were asked to gave a score according to
unconsumption.7 Preparing of Carica papaya leaves in the level of taste acceptance in the range of extremely
the form of cookies, may enhance the acceptance level like (6), very much like (5), moderately like (4), slightly
of papaya leaves as a source of saponin. Processing like (3), neutral (2), unlike (1).12 Furthermore, data was
Carica papaya leaves into cookies has some benefits of categorized in accepted and not accepted. The accepted
a much better taste, easier to consume at any time and category toward the taste of cookies was determined
less perishable. when the panelist stated extremely like, very much like,
moderately like, slightly like and neutral.
Materials and Method The taste of cookies was not accepted when the
panelists stated dislike. Univariat analysis was used
The materials used in this study were Carica
to find the distribution of accepted and not accepted
papaya leaves processed in the form of cookies. Several
cookies in several doses. Normality of data in each
steps were carried out to get cookies that contained
was tested using Saphiro Wilk test. Data analysis in
saponin from carica papaya leaves in a less bitter taste, the two group showed that all data was not normally
acceptable in taste and proper dose in administering. The distributed, therefore Mann-Whitney test were used to
first step was reducing the bitter taste of Carica papaya compare between scores of each dose Carica papaya
leaves. The method of the first step was comparing leaves content with other dose in related with level of
pH level of the mashed leaves that already processed acceptibility.13
with three different treatments. The first treatment was
boiling the leaves at 60⁰C for 10 minutes and discharged The dose of Carica papaya leaf cookies as breast
the water. Then the leaves were boiled again with the milk booster was determined by calculating the
same temperature for another 10 minutes.8 The second saponin content. Saponin was tested using a UV-vis
treatment in minimizing the bitter taste of papaya leaves spectrophotometry method. Previous study done in
was soaking carica papaya leaf in 2.5% volume of Tehran on 2013 involving of 78 Iranian girl infants
calcium oxides solution (25g calcium oxides in 1000 ml 0-4 months old showed that 1.8g saponin a day in the
water) for 90 minutes. The third treatment was boiling fenugreek seed tea was able to increase the breast milk
papaya leaves in the cooked rice water for 10 minutes. production.14 Based on that finding the dose calculation
Cooked rice water was made by boiling 250g rice in could be done with the formula below:
1000ml water.9
Saponin content in the cookies 1.8 g saponin
=
The methods for maintaining saponin in carica 100 g X
papaya leaf cookies were found by comparing 2 baking 100 × 1.8
processes (in different temperature and duration). X=
Saponin content in the cookies
The temperature which generally used for cookies is The process of making carica papaya leaf cookies is
130⁰C in 35 minutes.10 However saponin is damaged as follows: blending 40g Carica papaya leaves, mixing
at temperature higher than 60⁰C of heating.11 Therefore with 60g wheat flour, 50g sugar, 40g margarine, 17g egg
we compared the saponin content of cookies baked in yolks, 10g skim milk, 1g baking soda and 0.5g salt using
130⁰C for 35 minutes and 60⁰C for 70 minutes. In 70 an electric mixer. Round cookies with a diameter of 5cm
minutes, cookies were ready looked yellowish and have was formed from the and then baked. Baking process
a crunchy texture. was terminated when the cookies was cooked.15 The
sign of cooked cookies are yellowish color and crunchy leaf as a breast milk booster. Therefore reducing a bitter
texture. The same procedures were applied in making of taste did not influence the effect of carica papaya leaves
0%, 10%, 20%, and 30% of carica papaya leaf cookies. as a breastmilk booster. The most reason of the low
enthusiasm in consuming Carica papaya leaf among
Findings Indonesia comunities is the strong bitter taste.17 Therefore
reducing the bitter taste will increase the acceptibility of
The findings was explained based on 4 goals of of Carica papaya leaves.7
this research, which are:
Baking Process: Two methods of baking process
Reducing the Bitter Taste: For reducing the bitter were compared to find the best method in maintening
taste, three different methods were compared to find the saponin content of Carica papaya leaves. The
pH level as an indicator for a bitter taste, the lowest pH saponin content should be maintained maximally for
will be chosen as the sign of the least bitter taste from galacgtogogue purpose. Table 2 shows two different
several methods. The lower the pH, the more acidic the baking processes (based on the temperature and duration)
solution. Lowering the pH produced the biggest increase of cookies and the saponin content after treatments.
in sourness of food and results in less bitter taste.16 Table
1 shows the pH levels resulted from different several
Table 2: Saponin content in 100g cookies after two
treatments. It can be seen from the table that the lowest
different baking processes
pH in carica papaya leaves was 7.70, therefore the best
method in reducing bitter taste was boiling leaves twice Baking Process Saponin
in the temperature of 60⁰C. Temperature of 130⁰C for 35 minutes (-)
Temperature of 60⁰C for 70 minutes 3.67g
Table 1: pH levels of carica papaya leaf after three
Table 2 reveals that saponin was totally damaged by
different treatments
the baking process of 130⁰C in 35 minutes. The heat of
Treatments Ph level > 60⁰C damages the saponin stucture. 11 Therefore the
Boiling twice in 60⁰C for 10 minutes 7.70 best temperature of baking to maintain saponin content
Boiling in cooked rice water for 10 minutes 7.84 was 60⁰C. After 70 minutes, the cookies were already
Soaking in 2,5% calcium oxide solution for cooked and crunchy.
8,13
90 minutes
Hedonic Test: Thirty-nine breast feeding women were
The bitter taste in the Carica papaya leaf was caused employed as panelists in the hedonic test. They were
by alkaloid carpain substance (C14H25NO2).7 Boiling is served with the cookies containing 0%, 10%, 20%,
the most practice method for bitter taste elimination, 30% and 40% carica papaya leaves. Table 3 shows the
because of decomposition process of alkaloid carpain.9 percentage of acceptability of several different doses
Carpain is not related with the function of carica papaya Carica papaya leaf cookies.
Table 3: Taste acceptability level cookies with several different doses of Carica papaya leaf
Accepted Not
Papaya accepted Total
extremely very much moderately slightly Total
leaf neutral unlike
like like like like accepted
content
n % n % n % n % n % n % n % N %
0% 8 20.5 9 23.1 8 20.5 11 28.2 2 5.1 38 97.4 1 2,6 39 100
10 % 5 12.8 9 23.1 9 23.1 13 33.3 2 5.1 38 97.4 1 2,6 39 100
20 % 4 10.3 8 20.5 9 23.1 12 30.8 4 10.3 37 94.9 2 5,1 39 100
30 % 3 7.7 7 17.4 10 25.6 12 30.8 4 10.3 36 92.3 3 7,7 39 100
40 % 2 5.1 6 15.4 9 23.1 13 33.3 6 15.4 36 92.3 3 7,7 39 100
Table 3 shows that the percentage of dislike Lactating mothers need an additional 40 mg potassium
panelist was slightly increased with the increasing per day. Thus potassium need of lactating mothers is
amount of Carica papaya leaves in cookies. However, 510mg/day.18 Two pieces of 25g Carica papaya leaf
most of panelists accepted the taste of 0%-40% Carica cookies contained 80mg potassium, which supplied
papaya leaf cookies. Furthermore we also conducted 15.7% potassium need for lactating women per day
acceptibility test betwen two groups of cookies based on
the amount of carica papaya leaf content. Carica papaya leaf cookies contained 0.01mg/g
mangan. The need of mangan for adult women is 1.8mg/
day. During lactation period, the women need additional
Table 4: Comparison of acceptibility levels between
0.8mg aditional mangan per day. Thus 2.6mg mangan is
two groups of papaya leaf content
needed by lactating mothers everyday.18 Two pieces of
Compared cookies P* 25g cookies contained 0.50mg mangan which contributed
10% - 20% 0.465 to 19,2% mangan need for breastfeeding mother.
10% - 30% 0.232 Mangan and potassium can stimulate the production
10% - 40% 0.052 and activity of prolactin and oxitocyn. Mangan content
20% - 30% 0.648 in Carica leaf cookies stimulated pituitary gland
20% - 40% 0.237 in producing prolactin, which increase breast milk
30% - 40% 0.466 production. Potassium deficiency caused tiredness and
mood swings which inhibited oxytocin production.
*Mann-Whitney
Potassium has relaxing effect, thus may stimulate
Table 4 shows that there was no significant oxytocin production which is needed for breast milk
difference in acceptibility levels of Carica papaya leaf ejection.2
content between the groups. The acceptibility berween
30% and 40% of Carica papaya leaves in the cookies Conclusion
was not different. Therefore we used 40% carica papaya
leaf cookies for galactogogue purpose and use it for dose The best process of making papaya leaves cookies
calculation. which can be used as galactogogue was boiling leaves
twice at ≤ 60⁰C before adding other ingredients and
Dose Calculation: The laboratory test shows that there bake the cookies of 40% Carica papaya leaves in 60⁰C
was 3.67g saponin in 100g of 40% Carica papaya leaf for 70 minutes. Two pieces of 25g papaya leaves cookies
cookies. This finding was used to calculate the dose of every day can be consumed by lactating mothers as a
cookies. The need of saponin content for galactogogue galactogogue (breastmilk booster).
based on previous research was 1.8g a day.14
Conflict of Interest: The authors have no conflict of
The calculation of the dose: interest related with conducting and reporting this study.
100 × 1.8 g Source of Funding: This study was funded by the
X=
3,67 g researcher.
X = 49g
Ethical Clearance: This study was approved by the
Forty nine grams was rounded to 50g, thus 2 pieces
Ethic Committee for Health Research, Faculty of
of 25g Carica papaya leaf cookies fullfilled the need of
Public Health, Diponegoro University (No.079/EC/
saponin content as galactogogue. Two pieces of cookies
FKM/2018).
a day was also feasible to be consumed as snack.
Other than saponin, Carica papaya leaves also REFERENCES
contain potassium and mangan which also have
galactogogue effect. Laboratory test results showed that 1.
World Health Organization/Unicef. Breast
there was 1,6mg/g potassium in the cookies. Women Feeding Counseling Practice 40 Hours WHO
in 19-29 years old need 470mg potassium everyday. Module. (in Indonesian) WHO/UNICEF.2017.
2. Sultana A, Rahman KU, Manjula S. Clinical Test of Rice flour Cookies with Sukun Flour
Update and Treatment of Lactation Insufficiency. Subtitution.(In Indonesian) Jurnal Aplikasi
Medical Journal of Islamic World Academy of Teknologi Pangan. 2016 Sep 10;5(4).
Sciences. 2013 Jan;109(555):1-0.
11. Yang H, Zhang N, Zeng Q, Yu Q, Ke S, Li X. HPLC
3. Mills E, Duguoa JJ, Perri D, Koren G. Herbal Method for The Simultaneous Determination of
Medicines in Pregnancy and Lactation: An Ten Annonaceous Acetogenins After Supercritical
Evidence-Based Approach.© 2006. Abingdon, Fluid CO2 Extraction. International Journal of
Oxon: Taylor & Francis Medical. 2006. Biomedical Science: IJBS. 2010 Sep;6(3):202.
4.
Buntuchai G, Pavadhgul P, Kittipichai W, 12. Wahyuningtias D, Putranto TS, Kusdiana RN.
Satheannoppakao W. Traditional Galactagogue Hedonic Test in Brownies Cookies Using Wheat
Foods and Their Connection to Human Milk Flour and Whole Grain (in Indonesian). Binus
Volume in Thai Breastfeeding Mothers. Journal Business Review. 2014 May 30;5(1):57-65.
of Human Lactation. 2017 Aug;33(3):552-9.
13. Sastroasmoro S., Ismael S. Basics of Clinical
5. Sa’roni, S. R., Sadjiman, T., Sja’bani, M., & Research (5th Eds.) (In Indonesian). Jakarta :
Zulaela, Z. Effectiveness of The Sauropus Sagung Seto; 2014. 104-123,361-364,437,513.
Androgynus (L.) Merr Leaf Extract In Increasing
14. Ghasemi V, Kheirkhah M, Vahedi M. The Effect
Mother’s Breast Milk Production (in Indonesian).
of Herbal Tea Containing Fenugreek Seed on The
Media Penelitian dan Pengembangan Kesehatan,
Signs of Breast Milk Sufficiency In Iranian Girl
2004;14(3).
Infants. Iranian Red Crescent Medical Journal.
6. Ayoola PB, Adeyeye A. Phytochemical and 2015 Aug;17(8).
Nutrient Evaluation of Carica Papaya (pawpaw)
15. Mutiara, E., Adikahriani dan S. Wahidah. The
Leaves. Ijrras. 2010 Dec;5(3):325-8.
Developing Of Biscuit Formula of The Sauropus
7. Boshra V, Tajul AY. Papaya-an Innovative Raw Androgynus (L.) Merr Leaf in Increasing
Material for Food and Pharmaceutical Processing Breastmilk Production. Jurnal Pengabdian
Industry. Health Environ J. 2013;4(1):68-75. Kepada Masyarakat. 2014; 20 (77).
8. Saran PL, Choudhary R. Drug Bioavailability 16. Fischer U, Noble AC. The Effect of Ethanol,
and Traditional Medicaments of Commercially Catechin Concentration, and pH on Sourness and
Available Papaya: A review. African Journal of Bitterness of Wine. American Journal of Enology
Agricultural Research. 2013 Jul 4;8(25):3216-23. and Viticulture. 1994 Jan 1;45(1):6-10.
9. Putri SH, Sayuti K, Nurdin H. Study of Carica 17. Turlina, L., & Wijayanti, L. The influence of Carica
Papaya Leaf (Carica papaya L.) dan Surian Leaf Papaya Leaf Instant toward the Milk Production
(Toona Sureni, BL, Merr) Combination and Its of Breastfeeding Mothers (in Indonesia). Jurnal
Aplication in Wet Noodle Product (in Indonesian). Media Komunikasi Ilmu Kesehatan, 2015;7(01).
Jurnal Teknotan. 2017 Jul 27;11(1).
18. Health Department of Indonesia, The Guideline
10. Wulandari FK, Setiani BE, Susanti S. Nutrient of Nutitrition Balance (in Indonesian). Jakarta:
Content Analysis, Energy Value and Organoleptic Kemenkes 2014.
Factors Related to Competence in Prehospital Care
Ns. Kristianto Dwi Nugroho1, dr Setyawati Soeharto2, Yulian Wiji Utami2

1
Student Magister of Nursing, 2Lecturer, Faculty of Medicine, Brawijaya University, Malang, Indonesia,
Sawojajar, Malang, Est Java, Indonesia
Abstract
Pre-hospital service in Indonesia is a service which is relatively new and still in the development stage.
The main priority of this development is human resource development by increasing competence. But
unfortunately, Indonesia does not yet have core competencies in pre-hospital services. On the other hand,
competency is not an independent matter, many factors are related such as work experience and personality
characteristics. This study used cross sectional approach with paper-based survey method on 120 respondents
from,12 health centers (puskesmas), call center of TEMS and TEMS team in Hospital of Dr. Iskak. Experience
had correlation with the competency of ambulance officers with sufficient correlation strength (p=0.000).
Similarly, the personality characteristics had correlation that was also sufficient (p=0.000). Multivariate
analysis found that experience was removed from the equation, and obtained the characteristics that related
to competency. But the equation had a low strength (adjusted r square=0.232). In this study, competency
related to two main variables, they were personality characteristics and experience. Experience was not
only considered according to the length of working, but also how the people mastery their work. Neither the
personality characteristic, had a role in the formation of a good competency. Personality characteristic was
factor that related to the competency. The competency needed to improve the quality of pre-hospital service
and reduce mortality experienced by the patient.
Keywords: Ambulance Officer competency; personality characteristics; experience
Introduction conducted was by developing the human resource in pre-

hospital service. Competency is a key factor in human
Pre-hospital services in Indonesia have been started resources development5. Various pre-hospital services
since the 1980s by Association of Indonesian Surgeon. and its competency due to there is no international
But the lack of support from the government and various consensus about this service6. Indonesia has not yet
stakeholders resulted this service did not develop1. The developed specific competencies that concerning to pre-
government initiated pre-hospital service that called by hospital services, thus the researcher used the ambulance
Sistem Pelayanan Gawat Darurat Terpadu (SPGDT) officer competencies that developed by the Paramedics
in 20162,3. SPGDT has the aim to provide emergency Australasia7. In this competency, there are three main
service, reduce mortality and prevent permanent competencies that consist of professional practice,
disability on patients2. clinical practice, and professional knowledge.
Prehospital service in Indonesia is relatively Competency is not a variable that is completely
new, thus it requires a special development to get the free, many factors related to it8,9. Experience is a factor
maximum service4. The first thing that should be that related to the competency of ambulance officers.
Although experience is not only measured by the length
Corresponding Author: of work, but it’s measured by the reliability in handling
Ns.Kristianto Dwi Nugroho, S.Kep problems in the work environment10,11. Personality
Student Magister of Nursing, Faculty of Medicine, can also affect someone in solving problem, ability in
Brawijaya University, Malang, Indonesia working together, and establishing an interpersonal
Phone: 085641985092 relationship. Those things are very necessary within
Email: kristianto.nugroho77@yahoo.co.id the scope of pre-hospital8,9. Therefore, personality
characteristics and experiences in both directly or damaged, an ad hoc communication network backbone
indirectly related to the competency of ambulance should be build to support emergency medical services.
officers. Then, there is a question “Are personality Combinations of requirements need to be considered
characteristics and experiences related to the increasing before deciding on the best option. In the present study
of ambulance officers competence?” we have proposed a Low Altitude Platform consisting of
tethered balloons combined with Wireless Fidelity (WiFi.
Material and Methodology Variable of personality characteristics such as the ability
to cooperate, creativity, timely and ambitious13.
The study was an analytic observational research and
cross-sectional as a method of approach. The population The questionnaire had been developed by the
in this study was all of health workers who served researcher which consisted of 38 questions. The answer
pre-hospital in Tulungagung that were often known as of question in the form of Likert scale with 1 to state
TEMS (Tulungagung Emergency Medical Services). strongly disagree to 4 for strongly agree. Validity test
TEMS had three main parts in conducting pre-hospital was conducted in PSC (Public Safety Center) of Malang
services, they were call center, TEMS team in Hospital with Cronbach’s alpha (0.917), thus the questionnaire
of Dr. Iskak, and supporting team that consisted of 14 was reliable to use in research.
puskesmas throughout Tulungagung. The study was
conducted from February to March 2019. Finding
Simple Random Sampling was a sampling technique There were 150 questionnaires that were distributed
in this study. The following was several criteria in in 14 puskesmas, call centers and TEMS team in
sampling process: (1) respondents worked in TEMS Hospital of Dr Iskak. 136 questionnaires were returned
environment, (2) respondents were health workers and 16 questionnaires were excluded because there were
(doctors, nurses, midwives), (3) respondents were able incomplete data filled.
to read and communicate well. Total of 120 respondents
obtained by using measurement method of “rule of From the demographic data, more than half of
trump’s”. respondents in this study were women (61.6%), mostly,
aged between 25-34 years (45.8%). Nearly a third of
The instrument of competency assessment was respondents (30.8%) had worked less than 20 months in
arranged by researchers that developed from Australasia pre-hospital services. The most profession of respondents
Competency of Paramedics 2011. There were three main in this study was nurses who worked in TEMS (68.3%)
competencies of officers, they were professional practice, and most of them work in puskesmas (84%).
clinical practice, and professional knowledge7. The
independent variable consisted of working experience and The requirement to conduct bivariate analysis was
personality characteristics. In this study, the experience by looking at the distribution of data14. Normality test
was not only measured by the length of working of shows that the three variables are abnormally distributed
respondents, but by how they understanding the work, (p=0.000), so the test used Spearman rank test15.
procedures and control of existing equipment12such as Bivariate analysis shown (table 1) that experience had
a tsunami, earthquake or volcanic eruption, affecting correlation with the competency of ambulance officer
humans. In order to support emergency medical (p=0.000). Similarly, the personality characteristics
communication services in natural disaster areas where also had correlation with the competency of ambulance
the telecommunications facility has been seriously officer (p = 0.000).
Table 1: Bivariate Analysis

Competency of Officer N Mean ± SD Correlation Coefficient p-value
Work experience 120 11.72 ± 1.958 0.372 0.000
Personality characteristics 120 20.1 ± 1.682 0.421 0.000
Table 2 shows that word experience variable was excluded from the equation and have adjusted r-square of
0.232.
Table 2: The most significant factors
Model Variable B Sig. Adjusted R Square

(Constant) 53.002 0.000
1 Experience 0.305 0.304 0.232
Personality characteristics 1.881 0.000
(Constant) 54. 420 0.000
2 0.232
Personality characteristics 1.988 0.000
Discussion disaster areas where the telecommunications facility

has been seriously damaged, an ad hoc communication
Demography: The demographic of respondents network backbone should be build to support emergency
indicated that most of the puskesmas who have medical services. Combinations of requirements need to
responsibility to maintaining the health of community. be considered before deciding on the best option. In the
Good coordination that made the pre-hospital services present study we have proposed a Low Altitude Platform
more efficient with the officers17. Coordination was consisting of tethered balloons combined with Wireless
always conducted by all of stakeholders in order to Fidelity (WiFi.
provide the services well, efficiently and optimally18.
Experience played a key role in enhancing the
The demographic also found that more than two- competency of ambulance officers. This was according
thirds of respondents were nurses (68.3%). This was to research conducted by Steigerwald23was shown that
in accordance with the regulations in Indonesia that all the experience of nurse was a key factor to improve
of healthcare workers were health workers19. This data the competency. Improving the experience could be
also explained that more than a quarter of respondents enhanced not only by the length of work. The provision
had worked less than 20 months. But there were several of training and simulation about as similar and
respondents who had worked more than 20 months. Pre- complexity in the field could also be performed. Training
hospital services in Tulungagung was start in in 201520. and a good simulation had the advantage of reducing the
The respondents who had worked more than 20 months risk that would be experienced by the patient24. Good
were respondents who had been working for pre-hospital simulation also could increase the knowledge of nurse
service in each puskesmas or hospital independently and and other health professionals in providing services
not coordinated, then become a system such as TEMS. 24,25
such as patients with cardiac arrest, myocardial
infarction, trauma and stroke, while population-based
Experience: This study described that the experience
studies including all diagnoses are few. We examined
of work had significant effect against competency
the diagnostic pattern and mortality among all patients
(p=0.000). Experience was one important aspect in
brought to hospital by ambulance after emergency
improving competency. Previous research had shown
calls. DESIGN Registry-based cohort study. SETTING
that the experience affected the improvement of
AND PARTICIPANTS We included patients brought to
competency and assess the deterioration of the client’s
hospital in an ambulance dispatched after emergency
situation 21,22
calls during 2007-2014 in the North Denmark Region
This study did not determine the experience (580 000 inhabitants.
according to the length of work, rather than how the Personality characteristics: Personality characteristic
officers mastery their work. The length of working of was a psychological characteristic that reflected an
officer did not give guarantee that the officer also had individual’s response to the environment. Everyone
good competency10. The understanding of the work, had a different personality, but could possibly had the
and mastery of the procedures to be important in the similar personality characteristics26. Thus, personality
experience of working12such as a tsunami, earthquake or characteristics had an important role against competency.
volcanic eruption, affecting humans. In order to support Bivariate analysis shown that personality characteristics
emergency medical communication services in natural had correlation with competency (p=0.000).
Competency development was not only about motivation to nurses and ambulance officers could be
training and experience, but extended into the domain given to be able to improve competency indirectly10.
of personality traits. Several personality characteristics
such as curiosity, easy to get along with, creative, The improvement of personality characteristics by
timely and ambitious affected the competency10. Thus, conducting selection with people who had an interest
human resource development in pre-hospital service in pre-hospital service. This greatly affected the
was also necessary to improve the characteristics of characteristics of the inside of an ambulance officer10.
each individual. A good development of individual Good mentorship also seen to improve the characteristics
characteristics effectively would be improved the of the personality of each ambulance attendant. Expected
competency of a group27,28. eventually to increase the overall competency of the
ambulance officers9.
The personality characteristics which related with
the improvement of competency was a feeling to conduct It was undeniable that there were still many factors
the entire job. The desire to always learn continuously that affected competency. In this study, there were many
to achieve maximum competency was a lifelong factors that should be investigated. Factors related
learning process that should be owned by an ambulance to the competency of ambulance officer should to be
officer10. Personality characteristics which related to the studied more deeply. Assessment factors related to the
competency such as socializing and being easy to believe competency such as organizational culture, policy,
made the working environment in a team being good and professionalism factor, level of education and critical
related to the competency of ambulance officers29. thinking also should be studied further9.
The improvement competency through the building Keep in mind that attitudes, knowledge and practices
of good character for ambulance officers should to was a major aspect forming competency and different
be conducted. Building the value of responsibility, studies was needed33. Limitation of this study was to
friendliness, precision, emotional stability, and assess the competency only of the aspects of respondents’
innovation were required. The improvement was knowledge. That assessment only be based on the
accomplished by the addition of training, discussion perspective of the service provider, so the result was
and motivation in the formation of officers30. Building less holisticaly. The research was conducted in several
the passion for self-respect was the beginning of the different places, so that it had different policies Although
enhancement characteristics. Giving suggestions to every month they conduct communication, coordination,
always think positively also could be done. Building to evaluation and regular training spot differences provide
the individual and organization to be enthusiastic, not different perspectives ambulance officers.
afraid of being wrong and the spirit of finding solutions
could also be carried out. The last thing that should Conclusion
be conducted was the improvement the knowledge
The competency development could relate to
of ambulance officers, that being the key to improve
two things, they were personality characteristics and
personality characteristics31.
experience. As an ambulance officer, high competency
Most related factor: According in multivariate analysis, was needed in providing services. These competencies
was found that personality characteristic was only one were needed to improve pre-hospital services and reduce
variable that related to the competency of ambulance deaths experienced by patients. Personality characteristics
officers. Adjusted r square of multivariate analysis has a were more dominant factors when compared with
value of 23,2%, it can be interpreted there was still other experience as factors related to competency. Efforts to
variables that affect competency by 78,6%. study and establish ambulance staff competencies should
continue to be improved, especially in countries with
This study shown that inner characteristic of relatively new pre-hospital services.
ambulance officers had a stronger correlation. Motivation
to work that was more optimally, confidence and positive Conflict of Interest: None
thinking should be improved in order to improve the
characteristics of ambulance officer33i. Building the right
Ethical Clearance: Ethics of clearance was taken from 10. Khomeiran RT, Yekta ZP, Kiger AM, Kiger AM.
the Hospital of Iskak ethics commission under number Professional competence factors described by
070/785/407.206/2019. nurses as influencing their development.pdf. Int
Nurs Rev. 2006;53(1):66–72.
Reference 11.
Leary JO. Comparison of self-assessed
1. Pitt E, PusponegoroA. Prehospital care in Indonesia. competence and experience among critical care
Emerg Med J [Internet]. 2005;22(2):144–7. nurses. 2012;(Letvak 2002):1–8.
Available from: http://www.pubmedcentral.nih. 12. Qiantori A, Sutiono AB, Hariyanto H, Suwa H,
gov/articlerender.fcgi? artid = 1726665 & tool = Ohta T. An emergency medical communications
pmcentrez & rendertype = abstract
system by low altitude platform at the early stages
2. Menteri Kesehatan. Peraturan Menteri Kesehatan of a natural disaster in Indonesia. J Med Syst.
Republik Indonesia Nomor 19 Tahun 2016 2012;36(1):41–52.
Tentang Sistem Penanggulangan Gawat Darurat
13. Larsen R, Buss DM. Personality Psychology:
Terpadu. Jakarta: Kementrian Kesehatan Republik
Domain of Knowledge About Human Nature.
Indonesia; 2016. 1-18 p.
Ney York: McGraw-Hill; 2002.
3. Boyle M, Wallis J, Suryanto. Time to improve
pre-hospital care in developing countries. Vol. 13, 14. Widiyanto MA. Statistika Terapan. Jakarta: Elek
Austalasian Journal of Paramedicine. 2016. p. 1–3. Media Komputindo; 2013. 102 p.
4. Suryanto, Plummer V, Boyle M. EMS systems 15. Notoatmojo S. Metodologi Penelitian Kesehatan.
in lower-middle income countries: A literature Jakarta: Rineka Cipta; 2012.
review. Prehosp Disaster Med. 2017;32(1):64–70. 16. Ratnamiasih I, Govindaraju R, Prihartono B,
5. Soekarno, Rasmini. Sistem Costom Made dan Sudirman I. Kompetensi SDM dan Kualitas
Tailoring Tingkat Terampil. Jakarta: Grasindo; Pelayanan Rumah Sakit. Trikonomika.
2014. 31 p. 2012;11(1):49–57.
6. Castrèn M, Mäkinen M, Nilsson J, Lindström 17. Menteri Kesehatan. Peraturan Menteri Kesehatan
V. The effects of interprofessional education – no 75. Jakarta: Kementrian Kesehatan Republik
Self-reported professional competence among Indonesia; 2011. 3 p.
prehospital emergency care nursing students on
18. Ma L, Zhang H, Yan X, Wang J, Song Z, Xiong
the point of graduation – A cross-sectional study.
H. Smooth associations between the emergency
Int Emerg Nurs. 2017;32:50–5.
medical services response time and the risk of
7.
Paramedics Australasia. Australasian death in road traffic crashes. pdf. J Transp Heal J.
Competency Standards for Paramedics [Internet]. 2018;1–13.
Ballarat: Paramedics Australasia; 2011. 1-11
p. Available from: http://www.paramedics.org/ 19. Kementrian Kesehatan. PERATURAN MENTRI
content/2011/10/PA_Australasian-Competency- KESEHATAN NO 19 TAHUN 2016 TENTANG
Standards-for-paramedics_July-20111.pdf SISTEM PENANGGULANGAN GAWAT
DARURAT TERPADU. Jakarta: Kementrian
8.
Darmadi. Manajemen Sumber Daya
Kesehatan; 2016. 1-18 p.
Manusia Kekepalasekolahan “Melejitkan
Produktivitas Kepala Sekolah dan Faktro yang 20. Suryanto, M. B. The pre-hospital and healthcare
Mempengaruhinya”. Deepublist. Yogyakarta; system in Malang, Indonesia. Australas J
2018. 72 p. Paramed [Internet]. 2017;14(2):no pagination.
Available from: https://ajp.paramedics.org/index.
9. Rizany I, Hariyati RTS, Handayani H. Factors that
affect the development of nurses’ competencies: php/ajp/article/download/554/616%5Cnhttp://
a systematic review. Enferm Clin [Internet]. ovidsp.ovid.com/ovidweb.cgi?T = JS&PAGE
2018;28:154–7. Available from: http://dx.doi. = reference&D = emex & NEWS = N&AN =
org/10.1016/S1130-8621(18)30057-3 615883910
21. Tsutsumi K, Sekido K. Relationship of Clinical 28. Schröder E, Schmitt-rodermund E. Crystallizing

Nursing Competence to Nursing Occupational enterprising interests among adolescents through
Experience in Hospice/Palliative Care Nurses in a career development program : The role of
Japan. Sci Res Publ. 2015;(February):279–88. personality and family background. J Vocat
Behav. 2006;69:494–509.
22. Schmid S, Altfeld F. International work experience
and compensation : Is more always better for 29. Choi M, Kim J. Relationships Between Clinical
CFOs ? Eur Manag J [Internet]. 2018;36(4):530– Decision-Making Patterns and Self-Efficacy and
43. Available from: https://doi.org/10.1016/j. Nursing Professionalism in Korean Pediatric
emj.2017.11.001 Nurses. J Pediatr Nurs [Internet]. 2015;
Available from: http://dx.doi.org/10.1016/j.
23. Steigerwald D, Nolan C, Loux T, Baskin CR,
pedn.2015.07.001
Scharff DP. Improving public health competencies
through required practice experience. Public Health 30. Manganti F. Pengaruh karakteristik kepribadian,
[Internet]. 2016;140:265–7. Available from: motivasi dan komitmen terhadap sikap pegawai. J
http://dx.doi.org/10.1016/j.puhe.2016.07.001 Ekon Manaj Sumber Daya. 2015;17(2):88–97.
24. Lawrence K, Messias DKH, Cason ML. The 31. Surya H. Jadilah Pribadi Yang Unggul. Jakarta:
Influence of Simulation Experiences on New Elek Media Komputindo; 2010. 54 p.
Nurses ’ Clinical Judgment. Clin Simul Nurs
32. Williams G, Berthelsen J, Baker D. Employment of
[Internet]. 2018;25:22–7. Available from: https://
ambulance officers in the emergency department:
doi.org/10.1016/j.ecns.2018.10.008
a short-term strategy for a nursing shortage.
25. Christensen EF, Larsen TM, Jensen FB, Bendtsen Aust Emerg Nurs J [Internet]. 2004;7(2):5–12
MD, Hansen PA, Johnsen SP, et al. Diagnosis 8p. Available from: http://ezproxy.library.dal.ca/
and mortality in prehospital emergency patients login?url=http://search.ebscohost.com/login.aspx
transported to hospital: A population-based ?direct=true&db=c8h&AN=106518957&site=eh
and registry-based cohort study. BMJ Open. ost-live
2016;6(7):1–8.
33. Suryanto, Plummer V, Boyle M. Knowledge,
26. Supriyono. Akuntansi Keperilakuan. Yogyakarta: attitude, and practice of ambulance nurses in
UGM press; 2018. prehospital care in Malang, Indonesia. Australas
Emerg Care [Internet]. 2018;21(1):8–12. Available
27. Ulrich D. Human Resource Champions: The Next
from: https://doi.org/10.1016/j.auec.2017.12.001
Agenda for Adding Value and Delivering Results.
Boston: Havard Busines School Press; 1997. 68 p.
Empowerment of Coastal Communities Through Systems

Approach in the Field of Environmental Health in Kendari
City, Southeast Sulawesi Province, Indonesia
La Dupai1, Nani Yuniar1, Ruslan Majid1, Arum Dian Pratiwi1, Syawal Kamuluddin Saptaputra1, Rahman1
1
Faculty of Public Health, Univercity Halu Oleo,Green Campus Bumi Tridharma, Anduonohu Kendari,
Southeast Sulawesi, Indonesia
ABSTRACT
One of the health problems faced by coastal communities is community behavior in the management and
utilization of environmental resources. Coastal area has problems like the limitations of environmental health
facilities that cause the health status low. The study aimed to know the Coastal Community Empowerment
with a environmental health systems approach of Kendari. The type of study was qualitative. The informants
was 12 people. Data collection uses in-depth interviews and Focus Group Discussion. Results of the
implementation program appeared in three dimensions: a) Development of local communities through
cross training sectors: agriculture and food, fisheries, private institutions, finance lending institutions and
academics; and empowering youth groups through social activities. Empowerment through health village
was carried out with: environmental cleanliness, family education, clean and healthy behavior, increasing
family income, hydroponic planting methods, and utilizing plastic waste. b) Judging from the aspect of
social policy, there was already the KOTAKU program (city without slums). c) Social action: Initiation of
Movement 1 house 1 hand-washing, family medicinal plants, mobilizing to cleanliness the house yard, waste
transportation services, coordinating with the Government to provide environmental health education, made
a healthy smoke-free village. Conclusion: Community empowerment in order to improve environmental
health behaviors can be more effective if using all potential stakeholders, education and training, local
community development, social action and social policy. Recommendation: needin for socialization,
education and training for the community, advocacy and collaboration across sectors of government
agencies, and continuous supervision.
Keywords: Empowerment, Coastal Community, Environmental Health.
Introduction The Regulation of the Minister of Health of the

Republic of Indonesia mandates the restructuring of
The environment in coastal areas is generally an area various steps in the field of management of natural
that has very complex health problems like the limited of resources, human resources, environment and
health facilities, the clean water, drainage, and sanitation institutions so that the Indonesian nation can catch up
services, as well as limited of infrastructure and facilities and have a parallel position and strong competitiveness
to create an environment and healthy behaviour in order in the international community association1. Therefore,
to live productively. community empowerment is very important, as stated
in Law Number 36 of 2009 concerning Health. In the
Health regulation stated that: 1) 70% of the national
Corrensponding Author: development resources come from community
Ruslan Majid contributions; 2) Community empowerment based on
Faculty of Public Helath, Univercity, mutual cooperation, as a culture of Indonesian society;
Halu Oleo Kendari, Southeast Sulawesi, Indonesia 3) Community behavior is the main factor in the
Phone:+62811402644 occurrence of health problems, therefore the community
Email: ruslanmajid777@gmail.com itself can solve the problem through government
guidance; 4) The government has limited resources in housewives in the form of working groups hoping
overcoming increasingly complex health problems in to increase household income to help the income of
the community, while the community has considerable households. Likewise, the Fisheries Service provides
potential to be mobilized in prevention efforts in its area; training in the cultivation of sea fish and catfish by
5) The potential of the community includes community forming work groups to facilitate supervision and control
leadership, community organizations, community of their development.
financing, community material, community knowledge, “For many years, the company has now planted
community technology, community decision making live coral nurseries, the corals are cultivated,
processes, in efforts to improve health, this potential after four months, they are seen, not corals,
needs to be optimized; 6) Prevention efforts are more a gathering place for fish, ornamental fish,
effective and efficient than treatment efforts, and the and also some of employees here is from
community also has the ability to make preventive community... . “(Key Informant 2.52).
efforts if efforts are made to empower the community,
Coral reef cultivation activities involve coastal
especially for clean and healthy life behavior.
communities. The cultivation activities are intended to
safeguard coral reef ecosystems and how to catch legal
Method fish and so that the marine ecosystem is maintained. This
The type of study was qualitative study. The cultivation activity is carried out by private companies
instrument was the researchers themselves using while still involving the community in the cultivation
interview guidelines. Qualitative study is intended to of coral reefs. The existence of these private companies
explore social or human problems where community provides positive value for the local area in reducing
empowerment has interactions between individual unemployment.
communities and environmental health as a result of
Social Policy: The policy and implementation of the
program objectives2. This study was conducted in
“KOTAKU” program was promoted by the government
2017 in the Coastal Region of Kendari City, Southeast
is an effort to improve the quality of the residential
Sulawesi Province.
environment.The program is very important and strategic
to realize the commitment of all elements both government
Results and community as development actors especially to create
Local Community Development: This research seeks a clean housing environment and healthy.
to gather information on the forms of local community “There are those who are running this KOTAKU
development carried out by the local government and program, this city is 100-0-100, 100 is for
the involvement of stakeholders in developing the sanitation, 0 is slum housing, 100 percent is
capabilities of individual communities in the research for water, irrigation, clean water ...” (Informant
locations so that they have the ability to maintain health. Key 1, 47).
Efforts to develop local communities focus more on the
economic, education and health improvement sectors. Based on the interview results of the KOTAKU
In the economic sector, the development of local program, it is important to optimize sanitation because
communities in the form of training and mentoring of it is integrated in 3 program indicators, namely 100-0-
working groups to improve the income sector includes: 100. 100 percent for the provision of proper sanitation
for residents, 0 percent for reducing slum areas and 100
“Here it is the usual training provided by the
percent access to clean drinking water. Therefore, there
Food Service are groups of mothers, like the
is a need for awareness and active role of all parties
making of fish meatballs. Fish farming, catfish
by prioritizing the local wisdom of community both
farming. Here there are already several working
groups, but some have already succeeded in the government, religious leaders, community leaders
harvesting ... “(Key Informant, 47). and other components involved to make the program
a success. Through this activity the standard of living
To increase community income, fishermen were of the community can be better, especially on health
given training fish meatballs production from the aspects by ensuring that all local communities are free
Food Security Service. The training was attended by from slums.
One indicator related to the “KOTAKU” Program government and community participation4.Community
is the problem of uninhabitable homes. Efforts are participation in development can be demonstrated in
being made to change behavior through programs that participation in the implementation of activities and in
are launched such as home renovation program for the decision-making and monitoring and evaluation. The
poor community. This effort is one form of effort to involvement of the community in this program as a
get a decent place to live. Through this assistance, the village facilitator who overseeing program activities by
involvement and active participation of the community being given training by professional trainers from the
is very much needed. Government4.
“Yes, if there is a government program, many The results of this study found that home renovation
of these home renovation program were carried program is one of the assistance provided to disadvantaged
out yesterday, there were also several houses that communities in the region. Determination of assistance
were repaired ...” (Community Leader L, 46). through the local government discussion and proposed
Another form of the “KOTAKU” program activity, in accordance with the level of needs desired5. The
which is 100 clean water, is to ensure clean and healthy directive approach is based on the assumption that
water concessions. To meet the needs of clean water, community workers as actors of change already know
residents rely on one water source provided by the NGO what is needed and what is best for the community, in
called SINTESA. The Abeli District Government stated this case the fulfillment of needs according to appropriate
that the existence of the SINTESA greatly helped the standards applies to the community.
community in providing clean water.
The KOTAKU program activities is to increase
Social Action: Changing the culture of coastal the participation of the community in maintaining
communities to behave healthy is very difficult because environmental health, so that the program will be
of the many factors that influence it, so that specific effective if it conducts strategic socialization by
approaches are needed by understanding the conditions prioritizing the community as the main actors4.
of the local community. Therefore, the involvement of
Social Action: The involvement of community leaders
the local government is very important in understanding
are able to mobilize communities, provide motivation
the conditions of the local community. The stakeholders
and desire to do something desired by these leaders,
made a number of breakthrough actions both initiated by
namely implementing healthy behaviors to realize
the City government and the local Government.
the vision and mission of Healthy City. Exemplary,
persuasion, and control from the community encourage
Discussion people to act6.
Local Community Development: Based on the Various approaches taken by stakeholders and
results of this study, to improve the participation of the community components involved in policy making
community in maintaining environmental health, it is
made by the local government so as to produce a garbage
necessary to revive community institutions such as local
transportation service and create a clean and healthy
youth organization, one of the organizations that involve
environment include: First step, social enthusiasm7.
easy generation that serves to accommodate aspirations,
Giving social enthusiasm is an important component
as a place to cultivate nationalism, develop self-potential
of community work practices to increase inspiration,
and become a moving community organization in the
enthusiasm, stimulate, mobilize and motivate others to
field of social welfare3.
do behavior. Second Step, negotiating and mediating
Social Policy: The KOTAKU program is one of the with community leaders, religious leaders, RT/RW and
policies of the Central Government to accelerate slum mothers organization to convey related ideas so that the
settlement with 3 program indicator focuses which are community environment is healthy. Through negotiation
the main concerns, namely access to livable sanitation, and mediation, local stakeholders convey the intent
access to clean water and slum-free settlements. The and purpose of the need to maintain environmental
program is in dealing with slums so that it builds a health, need to organize structured waste transportation
collaboration platform through increasing the role of the services7. The therd Step, make consensus. The consensus
was generated after mediation, sociliation. The intended of the community in the field of environmental health
consensus is in the form of a joint agreement between appears in three main dimensions: a) Development
the community, community elements and stakeholders of local communities through cross training sectors:
to agree on a clean Friday/Saturday service, and garbage agriculture and food, fisheries, private institutions,
transportation services with community self-help. finance lending institutions and academics; and
Therefore an organized committee was formed through empowering youth groups through social activities.
an agreement in order to have policy power. This is Empowerment through health village was carried out
because the possibility of society not obeying the agreed with: environmental cleanliness, family education,
rulesby not paying self-help contributions due to various clean and healthy behavior, increasing family income,
factors, especially economic factors7. hydroponic planting methods, and utilizing plastic
waste. b) Judging from the aspect of social policy,
To make the village smoke-free, there are several
there was already the KOTAKU program (city without
approaches taken. First step, coordinating with health
slums). c) Social action: Initiation of Movement 1 house
agencies to provide health education related to PHBS,
1 hand-washing, family medicinal plants, mobilizing
one of the indicators is smoking behavior. Counseling
to cleanliness the house yard, waste transportation
is intended to increase public knowledge and awareness
regarding PHBS in general and specifically smoking services, coordinating with the Government to provide
behavior4. The Second Step, conduct socialization to environmental health education, made a healthy smoke-
the public regarding policies that will be implemented free village. Conclusion: Community empowerment in
with all the consequences. The essence of giving order to improve environmental health behaviors can
socialization is to increase community participation be more effective if using all potential stakeholders,
together to maintain health, especially the practice of education and training, local community development,
PHBS. Through the socialization, a response and conflict social action and social policy. Recommendation:
reaction will be seen that might arise and a solution to needin for socialization, education and training for the
overcome it4. community, advocacy and collaboration across sectors
of government agencies, and continuous supervision.
Community empowerment through a healthy green
In enhancing the role of community empowerment, it is
environment system and a waste free environment can
necessary to provide assistance, education and training
be seen from the aspects of input, process, output, and
continuously by paying attention to aspects of socio-
impact. In Kendari City, basically there have been efforts
cultural conditions and financial capacity of coastal
by regional governments to develop hydroponic planting
communities so that the support of the City Government
methods. In addition to having a relationship with the
environment, it also makes the environment greener like strong policies and regulations needend to improve
because it uses the yard so that it obtains economic value environmental health.
for the local community. The program is also an inventory
Ethical Clearance: The ethical clearance was taken
of PKK through the planting of family medicine which
was later developed by the local Government because from Faculty Committee and community agreement.
it became capital to familiarize the community to
Source of Funding: The funding of this research comes
organize a clean and healthy green environment. In
terms of environmental health aspects, the government’s from all authors’ Contribution.
efforts to develop hydroponic planting methods will
Confflict of Interest: Authors declares that there is no
help household-generated waste such as plastic bottles
and others be recycled for planting media8. Ecosystems any confflict of interest within this research.
relating to natural resource management, humans are
directly involved in a series of activity processes that REFERENCES
contain ecological processes.
1. MOH Regulation of Republic of Indonesian,
Number 65 of concerning Guidelines for
Conclution and Suggestion
Implementation and Development of Community
The implementation of the coastal community Empowerment in the Field of Health. Jakarta. (In
empowerment program in enhancing the participation Indonesia). 2013.
2. Creswell, Jhon W. Research Design Qualitative, 6. Tanto, D. S. Revitalizing the Role of Community
Quantitative, and Mixed Methods Approaches, Leaders in Increasing Political Stability.(In
Third Edition, (c) SAGE Publications, California. Indonesia). 2012.
2009
7. 10. Ife, Jim & Frank Tosaizero. Community
3.
Nasdian, Fredian Tonny. Community Development: Alternative Community
Development. Indonesian Torch Library Development in the Era of Globalization
Foundation: Jakarta. (In Indonesia). 2014 (translation). Pustaka Pelajar: Yogyakarta. (In
Indonesia). 2008.
4.
Mardikanto, Totok and Soebiato Poerwoko.
Community Empowerment in the Public Policy 8. Widayati, Weka. Human Ecology: Concepts,
Perspective. Alfabeta: Bandung. (In Indonesia). Implementation and Development. Unhalu Press:
2012. Kendari. (In Indonesia). 2011.
5. Adi, Isbandi, R. Community Intervention and
Community Development as Empowerment
Efforts. Rajawali Press: Jakarta. (In Indonesia).
2012
Study the Level of Interlukin-2 During and after Treatment in

Sputum of Iraqi Patients with Pulmonary Tuberculosis
Liqa K. A. Alzubaidi1, Nisreen Sherif Alyasiri2, Luma yousif Mehdi3

Department of Community Health Techniques, Mosul Technical Institute, Northern Technical University,
1
Mosul, Iraq; 2Department of Nursing, AL-Suwaira Technical Institute, 3Department of Medical Laboratory
Technologies, College of Health and Medical Technology, Middle Technical University, Baghdad, Iraq
Abstract
The role of IL-2 as a biomarker for tuberculosis disease has been assessed. Lung infection with Mycobacterium
tuberculosis induce T cell responses which is mainly regulated by interleukin-2 (IL-2). recombinant
human (rhIL-2) was administered with adjunctive immunotherapy to 30 patients diagnosed with primary
tuberculosis (PTB), IL-2 level was observed in sputa at different intervals during treatment and at the mean
time it was microscopically examined for acid fast bacilli (AFB). Thirty patients with latent tuberculosis
after treatment (LTBat) in whom sputum production was successfully induced were also included. Placebo
controlled trial patients were accredited twice injections of IL-2 on daily basis or placebo for the first 30
days of treatment. Subjects were followed for six months. The levels of IL-2 were increased in all patients
compared to the control. Raised IL-2 level among LTBat patients was age dependent. Conversely, decreased
IL-2 levels occur at the age 37 years and above. Increased IL-2 level in sputum enhanced bacillary smear
clearance of patients with tuberculosis.
Keywords: Tuberculosis; IL-2; immunotherapy; Sputum
Introduction world health organization3-5. However, conflicting

affairs (e.g., prolonged uptake, intolerantness, and
Globally, Pulmonary Tuberculosis (TB) is the most toxicity) are characterized compliance in patients under
unceasing life-threatening health issue that mainly chemotherapeutic treatment. Nevertheless, Multi-drug-
attacks the lungs. and spread through the air via droplets resistant tuberculosis has increased in rate not only in
of cough or sneeze carrying infectious M. tuberculosis third world countries but also in developed countries6,7.
or M. bovis. The World Health Organization (WHO)
published many reports in this concern and narrated Interleukin 2 primarily produced by active T cells
million cases come about every year, causing high and its main function is to stimulate the differentiation
morbidity rate especially among HIV patients and and expand population of lymphocytes and plays central
more than 1.8 million deaths per annum1,2. For long role in cell mediated immunity to infectious diseases8
time, TB has been controlled adequately and treated Accordingly, administration of IL-2 was applied as
using dual chemotherapy of pyrazinamide isoniazid, a complementary biologic therapy to control many
ethambutol, and rifampicin, as recommended by the bacterial and viral infections, like leprosy, AIDS and
leishmaniasis9-11.
Meantime, administration of rhIL-2 in addition

to conventional treatment to patients with pulmonary
Corresponding Author: tuberculosis could elicit the antimicrobial immune
Nisreen Sherif Alyasiri response, and betterment of sputum smear recognition
Department of Nursing, for diagnosis of acid-fast bacteria12. Conversely rhIL-
AL-Suwaira Technical Institute, 2 administration may increase T-cell activity vis a vis
Middle Technical University, Baghdad, Iraq enhances bacilli reproduction and spread11. Therefore,
Email: dr-nisreensherif@mtu.edu.iq we aimed to evaluate the level of IL-2 in sputa, other than
serum, of primary and latent TB patients and whether it week four, and after six weeks, and then monthly as long
can be used as indicator for disease progress. as the sputum can be effectively induced. For IL-2 level
measurements sputum was processed after two weeks
Material and Method and six weeks of treatment. Subjects were followed for
6 months from day one of receiving treatment.
Subjects: Eighty-five subjects, aged 17 to 50 years, thirty
subjects with Primary Diagnosed TB, 30 subjects’ high Sputum Processing: Collected sputum sample was
sputum bacillary with latent TB, and 25 subjects as control processed without delay and as described13,14. Smear
were enrolled in this study. Tuberculosis patients were for AFB was prepared and processed for examination.
recruited from Merjan Teaching Hospital in Babylon. The volume of remaining samples was measured
and weighed as well. 0.1% of freshly prepared DTT
Cases that we had failed to induce sputum production
(dithiothreitol) solution was added in twice the volume
effectively were excluded from the study. Patients with
of sputum, followed by vortexing for fifteen minutes.
AFB-positive sputum of primary tuberculosis and AFB-
The mixture was filtered using sterile gauze and
negative sputum of latent tuberculosis were considered.
centrifuged for ten minutes at 900 g. Supernatant was
Patients who show resistance to traditional treatment
collected for interleukin-2 analysis or stored at –70 ° C
were also excluded. All patients in our study group were to be processed later.
clinically examined by specialized Physicians. The study
was ethically approved by the health committee center. IL-2 Analysis: ELISA (R & D Systems) was used to
All patients gave their consent for sputum collection measure IL-2 concentration in sputum. IL-2 standard
was reconstituted in DTT-PBS dilution buffer to limit
Treatment Allocation: Patients were admitted to any possible effect of DDT on IL-2 during sputum
the hospital after being diagnosed for treatment and processing10. Serum was collected for ESR estimation as
observation. Treatment included two months of in Deice and Lewis13.
chemotherapy (once a day pyrazinamide, rifampin,
ethambutol and INH). The second course was four month Statistical Analysis: Statistical SPSS version 20
long and included once a day both INH and rifampin) software package was used for statistical study.
and twice daily injections of rhIL-2.
Results
Sputum Collection: Morning sputum was collected
after having a cup of hot water then the patients were Levels of IL-2 in primary tuberculosis (PTB), latent
asked to cough in a disposable collection cup. tuberculosis after treatment (LTBat) and control (CT)
are shown in Table 1. IL_2 levels in both disease forms
Sputum sample for acid fast bacilli smear was were higher than the control. However, the level of IL-2
collected on daily basis after two days and four days in (LTB) group was slightly higher than the (CT) group.
from day one of treatment administrations. Sputum was The mean ESR level in both disease forms were higher
collected on weekly basis as well, from week one through than the control.
Table 1: Mean level of IL-2 in samples study
Descriptive N Mean ± Std. Deviation P. Value

Primary Diagnosed TB 30 88.800 ± 11.839
ESR Latent TB after Treatment 30 33.200 ± 12.406 0.001 HS
Control 25 10.300 ± 4.462
IL- 2 level Latent TB after Treatment 30 0.490 ± 0.260 0.014 HS
Control 25 0.477 ± 0.223
Age Latent TB after Treatment 30 34.600 ± 12.010 0.132 NS
Control 25 32.100 ± 9.250
HS: Highly significant, NS:Non significant.
Thirty subjects were scanned for primary TB (PTB) in each treatment. sputum AFB counts were also conducted
during treatment. Bacillary count was reduced in patients had placebo as compared to interleukin-2 (p-value = 0.03;
0.02 and 0.01 after four days; three weeks and after four weeks respectively (Table 2).
Table 2: Bacillary count in sputum of PTB patient during anti-tuberculosis course of treatment
IL-2 BLACEBO
Date p-value (t-test)
N (%) N (%)
BASLINE 16 (53%) 14 (46%) 0.15
at 2 day 16 (53%) 14 (46%) 0.15
at 4 day 14 (46%) 12 (40%) 0.03*
at 7 day 16 (53%) 13 (43%) 0.07
at 14 day 16 (53%) 13 (43%) 0.07
at 21 day 16 (53%) 11 (36%) 0.02*
at 28 day 19 (63%) 10 (33%) 0.01*
at 60 day 12 (40%) 9 (30%) 0.1
*statistically significant p-value ≥0.05 n=number, IL-2=interleukin.
Level of IL-2 appear to be age dependant. For example, variation at age range (15-25) years was nearly double
folds, and the range (26 -35) years was one and half folds the CT group. Relevance between aging and chronicity
in LTBat group appear to be of high significance with p-value =0.002. However, at all age ranges the concentration
means of ESR were high significant as illustrated in Table 3. The LTBat sputum smear negative were of higher IL-2
levels than LTBat sputum smear positive as shown in table (4).
Table 3: Mean of IL-2 level and ESR concentration in relation to age ranges of tuberculosis patients
Parameters Age range Descriptive N Mean ± SD ANOVA P-value
15 – 25 PTB 8 0.83 ± 1.048
26 -35 PTB 6 0.515 ± 0.585
0.030 HS
36-45 PTB 10 0.440 ± 0.178
> 45 PTB 6 0.423 ± 0.178
15 – 25 LTBat 6 0.368 ± 0.087
26 -35 LTBat 10 0.590 ± 0.335
IL- 2 level 0.002HS
36-45 LTBat 8 0.450 ± 0.218
> 45 LTBat 6 0.320 ± 0.107
15 – 25 CT 6 0.4110 ± 0.028
26 -35 CT 7 0.4000 ± 0.017
0.10NS
36-45 CT 7 0.4200 ± 0.208
> 45 CT 5 0.4100 ± 0.208
15 – 25 PTB 8 87.500 ± 10.690
26 -35 PTB 6 91.667 ± 13.292
0.00HS
36-45 PTB 10 88.182 ± 12.703
> 45 PTB 6 87.152 ± 11.502
15 – 25 LTBat 6 34.167 ± 13.934
26 -35 LTBat 10 31.000 ± 11.499
ESR 0.001HS
36-45 LTBat 8 35.000 ± 13.463
> 45 LTBat 6 36.001 ± 11.522
15 – 25 CT 6 7.01 ± 3.690
26 -35 CT 7 9.667 ± 3.292
0.004HS
36-45 CT 7 10.182 ± 2.703
> 45 CT 5 11.071 ± 2.811
Table 4: Levels of IL-2 among LTB patients with TB infections with treatment program
Groups Smear negative Smear positive

Patient numbers 23 7
% of Total 64 36
IL-2 Value 0.620 0.390
Figure 1: Notable variation in the level of IL-2 for each individual subjects of the study and control group
Variation in age of each individual in relation with control cohort: A notable variation occurs in individual
distribution of age in patients as compared with control cohort. Results are shown in figure (2).
Figure 2: Distribution curve of age range
Discussion relevant with increment in the level of both CD25 &

CD4 T cells as well as increment in serum14. In current
The present study cohort involved sputa of patients study IL-2 administration with lack of clinical response
with primary Tuberculosis and sputa with positive acid- could be due to the fact that IL-2 had short term effect on
fast bacilli smear of patients with latent tuberculosis. immune criterions. However, similar studies postulated
Administration of human recombinant IL-2 were known that a sustained immune response mediated by anti– M.
to evoke clearance of sputum smear9, however that tuberculosis included CD8 & CD4 T cells14-16.
was not confirmed in Iraqi patients of the present study
either in those who receive treatment, newly diagnosed Our data show no relevance between rhIL-2 and
for TB or had TB. Previous study showed a moderate clearance of acid-fast bacilli from sputum smear and
fundamental outcome of interleukin-2 that would be release of IL-2 after 72 hours of being stimulated with
TB antigen could be useful tool to distinguish between Source of Funding: This research did not receive any
patients with LTB and those with active TB, a finding specific grant from funding agencies in the public,
in agreement with studies done using flow cytometry17. commercial, or not-for-profit sectors.
Many studies were done to evaluate IL-2 as a marker
for infection with tuberculosis and concluded that it Conflict of Interest: The authors declare no conflict of
cannot be reliable diagnostic marker alone and a second interest.
marker need to be used to strengthen diagnostic outcome Ethical Clearance: A local ethical committee approved
and they found that IFN-γ-secreting effector memory the study.
T-cells can be used as co-marker for this purpose18-19.
Other researches documented the involvement of CD8
References
& CD4 T cells in immunity against Mycobacterium
tuberculosis20-21. 1. Celli BR, MacNee W, Agusti A, Anzueto A,Berg
B, Buist AS, et al. Standards for the diagnosis and
Our data demonstrated a variable mean of IL-2 level treatment of patients with COPD:a summary of
among PTB and OTBat patients such finding analogue the ATS/ERS position paper.Eur Respir J 2004;
study done on African patients16.
23: 932–946.
It is well known that age is a key factor in immune 2. Bateman ED, Hurd SS, Barnes PJ, Bousquet J,
system activity and responses and that was emphasized Drazen JM, FitzGerald M, et al. Global strategy for
in tuberculosis patients were the decline in interleukin-2 asthma management and prevention:GINA executive
level is significantly associated with age increment as summary. Eur Respir J 2008; 31: 143–178.
shown in tables (2,3).
3. Jeffery PK: Remodeling in asthma and chronic
AFB continually shed in sputum of active old obstructive lung disease. Am J Respir Crit Care
TB patients in result of induction of monocytes by Med 2001; 164:S28–S38.
bacteria22-23.
4. Bartoli ML, Di Franco A, Vaggaggini B, Bacci E,
We studied only one dosing chart of rhIL-2 which Cianchetti S, Dente EL, et al. Biological markers in
was selected based on available information from induced sputum with phenotypes of chronic airway
published data at the time of study design. obstruction.Respiration 2009; 77: 265–272.
Previous studies found a distinctive correlation 5. Vignola AM, Paganin F, Capieu L, Scichilone
between administration of rhIL-2 treatment and N, Bellia M, Maakel L, et al. Airway remodeling
improvement of sputum smear24-26. Our data show that assessed by sputum and high-resolution computed
and during the first month of treatment, daily increased tomography in asthma and COPD. Eur Respir J
level of IL-2 did not clear bacillary bacteria from sputum 2004; 24: 910–917.
smear. Based on previously presented data, we could
conclude that immunotherapy based on administration of 6. Saha S, Mistry V, Siva R, Parker D, May R,
rhIL-2 might participate in betterment of host immunity Bradding P, et al. Induced sputum and bronchial
function and advancement of disease. A negative mucosal expression of interleukin-13 is not
acid-fast bacilli smear could be a reliable approach in increased in chronic obstructive pulmonary
determining the validity of treatment and the virulence disease. Allergy 2008; 63: 1239–1243.
of a pulmonary TB27-29. 7. Park SW, Jangm HK, An MH, Min JW, Jang AS, Lee
JH, et al. Interleukin-13 and interleukin-5 in induced
Conclusion sputum of eosinophilic bronchitis comparison with
asthma.Chest 2005; 128: 1921–1927.
Treating TB with rhuIL-2 could enhance the smear
conversion of TB. Levels of IL-2 in sputum was higher 8. Saha S, Doe C, Mistry V, Siddiqui S, Parker D,
in primary tuberculosis patients than old tuberculosis Sleeman M, et al. Granulocyte-macrophage
after treatment. Our result indicate that IL-2 level could colony-stimulating factor expression in induced
be used as indictor to determine severity of pulmonary sputum and bronchial mucosa in asthma and
tuberculosis. COPD.Thorax 2009; 64: 671–676.
9. van Eeden SF, Sin DD: Chronic obstructive 20. Jones BE, Young SM, Antoniskis D, Davidson
pulmonary disease: a chronic systemic inflammatory PT, Kramer F, Barnes PF. Relationship of the
disease. Respiration 2008; 75:224–238. manifestations of tuberculosis to CD4 cell counts
10.
Donaldson GC, Seemungal TAR, Patel IS, in patients with human immunodeficiency virus
Bhowmik A, Tom MA, Wilkinson TMA, et al. infection. Am Rev Respir Dis. 1993; 148(5):
Airway and systemic inflammation and decline in 1292-1297.
lung function in patients with COPD.Chest 2010; 21. Green AM, Difazio R, Flynn JL. IFN-gamma
128: 1995–2004. from CD4 T cells is essential for host survival
11. Yende S, Waterer GW, Tolley EA, Newman AB, and enhances CD8 T cell function during
Bauer DC, Taaffe DR, Jensen R, Crapo R,Rubin Mycobacterium tuberculosis infection. J Immunol.
S, Nevitt M, Simonsick EM, Satterfield S, et 2013; 190(1): 270-277.
al. Inflammatory markers are associated with 22. Prezzemolo T, Guggino G, La Manna MP, Di
ventilator limitation and muscle dysfunction Liberto D, Dieli F, Caccamo N. Functional
in obstructive lung disease in well-functioning
Signatures of Human CD4 and CD8 T Cell1
elderly subjects. Thorax 2006; 61: 10–16.
Responses to Mycobacterium tuberculosis. Front
12. Ibrahim M.S. Shnawa A.W., Raheem T. Obyes Immunol. 2014; 5(180).
Al-Mammori and haidaà J. Mohammed: The
23. Caccamo N, Guggino G, Joosten SA, Gelsomino
Assessment of IL-12+P40 among Primary
G, Di Carlo P, Titone L, et al. Multifunctional
pulmonary and Chronic (Old) Pulmonary
CD4(+) T cells correlate with active
Tuberculosis. International Research Journal of
Biological Sciences. 2013 ;2(12):1-4. Mycobacterium tuberculosis infection. Eur J
Immunol. 2010; 40(8): 2211-2220.
13. Lewis M., Bain J. and Bates I., Deice and
Lewis practical Hematology, 10th ed., Churchill 24. Tan Q, Min R, Dai GQ, Wang YL, Nan L, Yang
Livingstone Elsevier, P 599 (2006) Z, et al. Clinical and Immunological Effects
of rhIL-2 Therapy in Eastern Chinese Patients
14. Lalvani A. CD8 cytotoxic T cells and the
with Multidrug-resistant Tuberculosis. Sci Rep.
development of new tuberculosis vaccines. Am J
2017;7(1):17854.
Respir Crit Care Med. 2002; 166:789–790.
15. Lazarevic V, Flynn J. D8(+) T cells in tuberculosis. 25. Kurbatova EV, Gammino VM, Bayona J, Becerra
Am J Respir Crit Care Med 2002;166:1116–1121. MC, Danilovitz M, Falzon D, et al. Predictors of
sputum culture conversion among patients treated
16. Lewinsohn DA, Lines RA, Lewinsohn DM.
for multidrug-resistant tuberculosis. Int J Tuberc
Human dendritic cells presenting adenovirally
LungDis. 2012; 16(10): 1335-1343.
expressed antigen elicit mycobacterium
tuberculosis–specific CD8(+) T cells. Am J Respir 26.
Yew WW, Leung CC. Management of
Crit Care Med 2002;166:843–848. multidrug-resistant tuberculosis: Update 2007.
17. Hancock GE, Molloy A, Kiessling R, Becx- Respirology.2008; 13(1): 21-46.
Bluemink M, Cohn ZA, Kaplan G. In vivo 27. Liu Z, Shilkret KL, Ellis HM. Predictors of
administration of low-dose human interleukin-2 sputum culture conversion among patients with
induces lymphokine-activated killer cells for tuberculosis in the era of uberculosis resurgence.
enhanced cytolysis in vitro. Cell Immunol Arch Intern Med. 1999; 159(10): 1110-1116.
1991;132:277–284. 28. Guler M, Unsal E, Dursun B, Aydln O, Capan
18. Toossi Z, Kleinhenz ME, Ellner JJ. Defective N. Factors influencing sputum smear and culture
interleukin-2 production and responsiveness conversion time among patients with new case
in human pulmonary tuberculosis J Exp Med pulmonary tuberculosis. Int J Clin Pract. 2007;
1986;163:1162-1172. 61(2): 231-235.
19. Ruhwald M., Petersen J., Kofoed K., Nakaoka H., 29.
Dominguez-Castellano A, Muniain MA,
Cuevas L. E., Lawson L., et al. Improving T-cell Rodriguez-Bano J, Garcia M, Rios MJ, Galvez J,
assays for the diagnosis of latent TB infection: et al. Factors associated with time to sputum smear
potential of a diagnostic test based on IP-10. PloS. conversion in active pulmonary tuberculosis. Int J
2008;3:28-58. Tuberc Lung Dis. 2003; 7(5): 432-438.
Warm Footbath Minimize Ostheo-arthritis Joint Pain on the

Elderly in Surabaya’s Public Health Center
Muhamad Ibnu Hasan1, Elida Ulfiana1, Deni Yasmara1

1
Faculty of Nursing, Universitas Airlangga Campus C, Mulyorejo street, Surabaya (60115), Indonesia
Abstract
Background: Osteoarthritis joint pain is caused by degeneration process of cartilage bone and emphasized
on weight bearing joints such as knees, hips, feet and the back. Warm footbath is one of hydrotherapies which
used the modality of warm water to recover injury and minimize the symptoms of chronic joint problems.
Objective: This study aims to analyze the impact of warm footbath therapy to minimize osteoarthritis joint
pain on elderly.
Method: This study employed a quasi-experimental design. The research samples were the elderly from
a Mojo Public Health Center, Surabaya who suffered from osteoarthritis. The samples consisted of 20
respondents selected according to the inclusion criteria and were distributed into two groups, i.e. experimental
group (n=10) and control group (n=10) by using purposive sampling technique. The independent variable of
this research was the warm footbath while the dependent variable was the level of osteoarthritis joint pain
on elderly. The data were collected by using The Western Ontario McMaster Universities Arthritis Index
(WOMAC) questionnaire and analyzed by using Wilcoxon signed rank test and Mann-Whitney test with
deviation level of p ≤ 0.05.
Result: The result of Wilcoxon signed rank test identified that there were differences between pretest
and posttest in the experimental group (p=0.004) and the control group (p=0.011). Furthermore, the
research result provided by Mann-Whitney also illustrated that there were significant differences between
the posttest results of the experimental group and control group (p=0.035).
Conclusion: Warm footbath was proven to alleviate joint pain. The most dominantly declined osteoarthritis
joint pain after a warm footbath was the pain resulted from standing.
Keywords: Warm footbath, joint pain, elderly, osteoarthritis
Introduction knee pain and are not in the long-term care facility
become dependent in their efforts to fulfill their activity
Joint pain due to osteoarthritis causes negative daily living or ADL at home, such as bathing, putting on
impacts on the elderly’s daily life routine. Osteoarthritis clothes, and moving (2).
is a joint degenerative process, a chronic condition
which causes degeneration of bone cartilage and new To minimize osteoarthritis pain, nursing intervention
bone formation as a reaction to the degeneration in the can be conducted through a collaborative and
peripheral area and the subchondral area of the bone independent manner. The nursing intervention is carried
joint (1). The elderly who always experience osteoarthritis out through cognitive behavioral approach and physical
approach to minimize the pain. The physical approach
Corresponding Author: can be performed through relaxation techniques. Warm
Elida Ulfiana footbath is one of the relaxation techniques that induces
Faculty of Nursing, Universitas Airlangga Campus C, the body to relax, resulting in the occurrence of vascular
Mulyorejo street, Surabaya (60115), Indonesia vasodilation (3). This condition, mediated by intensified
Phone: +6287884019278 reflex axons mehcanism in the circulation, causes an
Email: elidaulfiana@yahoo.com impact on the spread of algogenic substances that will
ease nociceptive pain. Warm footbath is useful for Research Samples: In this study, the sample population
providing relaxation for the body, stretching muscles and was the elderly with osteoarthritis joint pain disorders
pain as well as inducing the effect of reducing blockages in Mojo Public Health Center, Surabaya, Indonesia. The
in the brain and visceral (2). method to determine the sample was the sample size
application. The minimum samples size required by
The study on warm footbath has been performed each group were 12 respondents or 24 respondents for
previously with warm footbath effects on the anti-spastic 2 groups. The sample determination technique applied
effect in post-stroke patients as the research object. The a method of specifying samples among the population
study observed the changes on the stiffness level of in accordance with the researcher’s needs (research
the foot triceps using the MAS (Modified Ashworth objectives/problems), so that the samples could represent
Scale) indicator and controlled the observation of the population characteristics that had previously been
electromyographic changes by measuring the changes in identified (7).
F-waves parameters before treatment, immediately after
treatment, and 30 minutes after treatment. The research The sample inclusion criteria included elderly
results stated that there were differences in MAS scores who were over 60 years old; diagnosed to suffer from
before and after treatment, as well as in the description of osteoarthritis by medical personnel; had good cognitive
the F-waves parameters comparison (4). Warm footbath function and able to take the WOMAC test; and were
is proven effective in minimizing the stiffness level in taking osteoarthritis treatment from the public health
post-stroke patients. Based on the background of the center of non-opioid NSAIDs and analgesics. The data
problem, this study observed the effect of warm footbath on osteoarthritis joint pain on the elderly were assessed
to minimize osteoarthritis pain on the elderly(3). with the WOMAC index. There were five questions
related to the pain, two questions related to joint stiffness
Material and Method and seventeen questions related to functional activities.
This instrument is the most sensitive instrument in
This study uses quasi-experiment because this assessing osteoarthritis on knee or pelvis and is widely
experiment does not have the characteristics of the used in clinical trials (8).
actual experimental design since the variables need to
be controlled or manipulated. Therefore, the research Data Analysis Method: Data of post test were analyzed
validity is insufficient to be classified as an actual by Mann-Whitney test. Mann-Whitney is a statistical
experiment (5). In this research design, the experimental test (a comparative test of 2 dependent/independent
group was treated while the control group was not. samples) with a deviation level of α ≤ 0.05. When
Both groups, the treatment group and the control group, the results indicates that the value of α ≤ 0.05, H1 is
were preceded by a pre-test and after treatment and accepted, meaning that there was a difference in the
non-treatment activities, a post-test was conducted to osteoarthritis joint pain alleviation in the elderly who
remeasure the groups(6). were treated with those who were not.
Result
Table 1: Medicines consumed by respondents
No. Consumed Medicines Experimental group (Σ) % Control group (Σ) Σ

1 Non-opioid analgesic 10 100 10 100
2 NSAIDs 8 80 7 70
3 Allupurinol 2 20 3 30
The analyis results indicated that all respondents were taking non-opioid analgesic medicines, amounting to 20
people (100%). The respondents who consumed allupurinol were 2 people (20%) in the experimental group and 3
people (30%) in the control group.
Table 2: Respondent distribution based on Body Mass Index (BMI)
No. BMI Σ % Category

1. < 14.9 0 0 Extremely thin
2. 1158.-4 1 5 Thin
3. 18.5 - 22,9 15 75 Normal
4. 2237.-5 4 20 Fat
5. 27.6 – 40 0 0 Obese
6. Over 40 0 0 Over Obese
Mean = 21.5, Median = 21.675, Modus = 19.53, SD = 1.901, Min = 17.70, Max = 25.7
The respondents’ BMI value distribution indicated that the majority of respondents were in the normal category
with 15 people (75%). The lowest BMI value of the respondent was 17.7 kg/m2 while the highest was 25.7 kg/m2.
The average BMI value of the respondents was 21.500 kg/m2 with a standard deviation of 1.901. The WOMAC joint
pain assessment on elderly with osteoarthritis was conducted before and after warm footbath for the experimental
group while for the control group, the assessment was performed directly.
Table 3: Respondent Distribution based on WOMAC joint pain score before the intervention
WOMAC joint pain score

Experimental Control
Respondent Pre-Test Post-Test Pre-Test Post-Test
Σ Σ Σ Σ
1 6 5 8 8
2 10 7 6 5
3 8 6 9 8
4 10 8 11 10
5 8 5 10 9
6 7 5 10 10
7 8 6 8 7
8 5 4 11 10
9 7 6 7 5
10 9 7 6 6
Mean 7.80 5.90 8.60 7.80
Median 8.00 6.00 8.50 8.00
SD 1.619 1.197 1.897 1.988
Min-Max 5-10 4-8 6-11 5-10
Wilcoxon Sign Rank test p = 0.011 Wilcoxon Sign Rank test p = 0.004
Mann-Whitney test p = 0.035
The results from the statistical analysis using The analysis results of Table 5 suggested that the
Wilcoxon Sign Rank Test indicated that p = 0.004 (α average pain score of the experimantal goup before the
≤ 0.05). This means that there was a decrease in the intervention was 7.80 with a standard deviation of 1.61,
joint pain scores in the experimental group before and maximum score of 10, and minimum score 5. After the
after the warm footbath intervention. The control group intervention, the average pain score in the experimental
that was not treated with a warm footbath intervention group decreased to 5.90 with a standard deviation of
showed that p = 0.011 (α ≤ 0.05) which indicated that 1.197, a maximum value of 8, and a minimum score of 4.
joint pain decrease also occured in the control group.
Prior to the test, the mean value of pain score for of endorphins. Acupuncture techniques increases local
the control group was 8.60 with a standard deviation of NO levels and cause hypervascularization. In addition,
1.89, a maximum score of 11, and a minimum score of a large increase in local NO is believed to be capable of
6. The average pain score after the test for the control releasing a number of endorphins as natural analgesic
group experienced only a slight decrease to 7.80 with compounds that can ease pain (4).
a standard deviation of 1.988, maximum score of 10,
and minimum score of 5. The results of the Wilcoxon The pain subscales at WOMAC were set in 45% of
Sign Rank test on the experimental group’s pain score 134 trials. Appropriate method reports in applying the
indicated that p score reached 0.004 (α ≤ 0.05) while WOMAC pain subscale were found in many cases. 52%
in the control group, p score reached 0.011 (α ≤ 0.05). of the study reports using the WOMAC subscale indicated
The result of the Mann-Whitney statistic Test on the pain inadequate results with ambiguous ranges of pain scores
score was that both the control and experimental groups of 38% and only 10% became completely clear (9).
indicated p score of 0.035 (α ≤ 0.05). The pain experienced when climbing up and
stepping down stairs constituted a question that had the
Discussion highest value in comparison with the other questions
with a value of 48. Joint pain when climbing up and
The posttest analysis using Mann Whitney Test
steppping down stairs was experienced as severe pain by
suggested that p score was 0.035 (α ≤ 0.05), indicating
the majority of respondents. Severe pain was described
that there was a difference between the experimental
by the respondents as pre-existing pain and it would
group and the control group on the post-intervention
increase when carrying out the activity (10).
pain score. The study results also found data on the
decrease of the total pain score in each activity, including The main cause of osteoarthritis joint pain is the
pain during walking on a flat surface, sleeping at night, cartilage bone degeneration which induces suppression
sitting or lying down, and standing. There was no of supporting bones and it gets worse with activities or
change in the pain experienced during climbing up and weight supporting positions in the body (11). Stepping
stepping stairs after a warm footbath with a total score down the stairs induces an increase in the knee joint and
of 20. A significant pain reduction occurred in the pain causing pain. The more severe the symptoms of knee
experienced when standing with the difference between osteoarthritis experienced by a person, the lesseer ability
the pretest and posttest scores reaching nine points. of the knee joint to absorb the impact of increasing body
weight, especially in the initial phase of stepping down
Furthermore, of the 24 questions on the WOMAC
the stairs (2).
index, the df score obtained was 22. At the significance
level of 5%, the r score for the table reached 0.404. The decrease in osteoarthritis pain scores in the
Meanwhile, in the statistical test, the difference between experimental and control groups were also caused by
the scores of each variable and the total r score obtained nutritional factors that could not be fully controlled by
r of all questions ranged from 0.452-0.830. This value the researchers. Nutrition is an important component in
was greater than the r table value (0.404). Thus, all the process of forming and healing an injury. Vitamin
questions were declared valid. The Cronbach Alpha test D plays a vital role in bone metabolism (12). These
for the WOMAC index reached 0.951which was above conditions may spur the emergence of the postulate
the minimum limit of 0.70. Thus, it can be concluded that consumption of vitamin D, with adverse effects on
that the WOMAC index had a good reliability. the growth of osteoarthritis bone, may be involved in
the changes in bone behavior at various stages of the
This is in accordance with the research conducted by
osteoarthritis development (11).
Matsumoto (2000) where the stimulation of warm water in
certain areas could increase the production of endorphin Consequently, other physiological effects
neuroregulators and induce an increase blood circulation induced by warm footbath are the mechanism of pain
to stimulate the release of endorphins, natural analgesic reduction through the gate control theory and intensify
compounds in the body. This concept was based on pain the production of endorphin neuroregulators. The
modulation using the acupuncture method. Acupuncture thermodynamic properties that will be received by the
is a pain modulation method that can trigger the release thermoreceptors with peripheral bermyelin fine afferent
fibers reached a speed of 30 m/s which is referred to References

as alpha beta fibers that feed on muscle spindles. This
1. Putri APS, Hidajah AC. Indicator of Dyslipidemia
thermal stimulus causes activation of the diameter
for Ischemic Stroke in Elderly with Hypertension.
widening of myelin fibers, enabling it to “close” the
Indian J Public Heal Res Dev. 2019;10(3).
nociceptive impulses gate before reaching the brain (13).
2. Suardana IW, Yusuf A, Purnomo W. Self-Help
The stimulation of warm water in the area would Group Therapy: The Enhancement of Self-Care
increase the production of endorphin neuroregulators Ability and Quality of Life Among the Elderly
and induce an increase in blood circulation so that in Bali, Indonesia. Indian J Public Heal Res Dev.
it could stimulate the release of endorphins, natural
2018;9(11).
analgesic compounds in the body. This concept is based
on pain modulation by using the acupuncture method. 3. Smyth CJ. Therapy of rheumatoid arthritis: a
Acupuncture is a pain modulation method that can pyramidal plan. Postgrad Med. 1972;51(6):31–9.
trigger the release of endorphins (4). 4. Matsumoto S, Shimodozono M, Etoh S, Noma
Warm footbath implemented for osteoarthritis T, Uema T, Ikeda K, et al. Anti-spastic effects
joints utilized thermodynamic effects (heat flow) and of footbaths in post-stroke patients: A proof-
hydrostatic pressure (buoyancy) of the warm water of-principle study. Complement Ther Med.
surface as a mechanism to ease pain. The hydrostatic 2014;22(6):1001–9.
force would relieve the joints when the feet were 5. Harymawan I, Nowland J. Political connections
soaked in the water (14). The thermodynamic effects of and earnings quality: how do connected firms
warm water surface induced an increase in core body respond to changes in political stability and
temperature, triggering a series of advanced processes
government effectiveness? Int J Account Inf
that could reduce ischemia due to cartilage degeneration
Manag. 2016;24(4):339–56.
which often caused pain (15).
6. Rasuna G, Sabila MP, Bramantoro T, Setijanto D,
Conclusion Zamzam A. Strawberry utilization empowerment
program in low-temperature environment as
Based on the last statistical test employed, the pain a dental health promotion. J Int Oral Heal.
when standing was experienced as a mild pain and often 2019;11(7):26.
occurred in the morning, accompanied by stiffness and
7. Liang C-C, Park AY, Guan J-L. In vitro scratch
can be relaxed by using warm footbath. The respondents
assay: a convenient and inexpensive method for
who were given the opportunity to relax and increase
analysis of cell migration in vitro. Nat Protoc.
body temperature through the thermodynamic effects of
warm footbath could minimize osteoarthritis joint pain 2007;2(2):329.
through the increased synovium tissue vascularization 8. Yin RK. Discovering the future of the case
and muscle relaxation. study. Method in evaluation research. Eval Pract.
1994;15(3):283–90.
Ethical Clearance: The research process involves
participants in the survey using a questionnaire that was 9. Clark DI, Downing N, Mitchell J, Coulson
accordant with the ethical research principle based on the L, Syzpryt EP, Doherty M. Physiotherapy for
regulation of research ethic committee. The present study anterior knee pain: a randomised controlled trial.
was carried out in accordance with the research principles. Ann Rheum Dis. 2000;59(9):700–4.
This study implemented the basic principle ethics of
10. Nishiwaki Y, Michikawa T, Yamada M, Eto N,
respect, beneficence, nonmaleficence, and justice.
Takebayashi T. Knee pain and future self-reliance
Conflict of Interest: The authors guarantee that there in older adults: evidence from a community-
was no conflict of interest as well as copyright conflict based 3-year cohort study in Japan. J Epidemiol.
involved with this research. 2011;21(3):184–90.
Source of Funding: This study is funded by the authors 11.

Suryadinata RV, Wirjatmadi B, Adriani M,
only and there is no external fund invloved this research. Sumarmi S. Effects of knowledge of vitamin D
on attitudes toward sun exposure among middle- 14. Reece FN, Lott BD. The effect of environmental
aged and elderly Indonesian adults. Indian J temperature on sensible and latent heat production
Public Heal Res Dev. 2018;9(11):11–5. of broiler chickens. Poult Sci. 1982;61(8):1590–3.
12. Mabey T, Honsawek S. Role of vitamin D in 15. Hannan MT, Felson DT, Pincus T. Analysis of
osteoarthritis: molecular, cellular, and clinical the discordance between radiographic changes
perspectives. Int J Endocrinol. 2015;2015. and knee pain in osteoarthritis of the knee. J
Rheumatol. 2000;27(6):1513–7.
13. Fahmi MZ, Haris A, Permana AJ, Wibowo DLN,
Purwanto B, Nikmah YL, et al. Bamboo leaf-
based carbon dots for efficient tumor imaging and
therapy. RSC Adv. 2018;8(67):38376–83.
An Epidemiological Study on Common Types of Tuberculosis

in Al-Najaf city
Murtadha M. Hameed1, Alaa S. Alattabi2, Hassan M. Abolmaali3

B.Sc. in Medical Technology, Department of Immunology, Alsader hospital, Najaf city; 2M.B.CH.B.,
1
FIMCS Path, Immunology Department of Microbiology, College of Medicine, 3Toxin and Drug
Department, College of Pharmacy, University of Kerbala
Abstract
Background: Tuberculosis is a contagious air transmitted bacterial disease caused by Mycobacterium
tuberculosis it mostly infects the lungs, but it may infect other parts of the body, It is considered a series
community health problem globally, it is the world second largest cause of death in adults between the
infectious diseases after HIV/AIDS.
Objective: This study was aimed to estimate the common types of tuberculosis in Al-Najaf city.
Materials and Method: This is a case-control study accomplished in the Advisory Clinic for Thoracic
and Respiratory Diseases in Al-Najaf city, for the period from December 2017 to August 2018. A total of
70 individuals were included in this study, 37 were diagnosed with tuberculosis by specialist respiratory
physician, and 33 were healthy controls. All data that include age, gender, residence, smoking, site of
infection and history of diabetes were collected from all participants. The data were analyzed by using the
statistical package social system (SPSS).
Results: This study show that pulmonary TB more frequent in men 11(61.1%) than in women 7(38.9%),
pleural TB also has high male to female ratio 5 (83.3%) to 1 (16.7%) respectively, and the incidence was
also higher in males in bone, peritoneum and meninges TB. In contrast lymph node tuberculosis is found to
be predominant in females.
It also found that tuberculosis was more frequent in age interval from (25-50) years old. It also shows that
out of total 37 tuberculosis cases 28 cases (75.7%) were from urban area, compared to 9 cases (24.3%) from
rural area.
Conclusion: Sex differences affect TB infection, it is significantly higher in male over female except in
lymph node TB where it more frequent in female, TB most commonly infects economically active age
groups (21-50 years old), it more frequent in urban areas than rural areas.
Keywords: M. tuberculosis, Najaf, TB
Introduction In 2014 Iraq accounts for about 25% of the global

TB burden It is predestined that Iraq which accounts 3%
Tuberculosis is a contagious air transmitted bacterial of the total number of cases in the region, there were
disease caused by Mycobacterium Tuberculosis. It is roughly 20000 TB patients and 4000 deaths yearly 2.
considered a series community health problem globally. Tuberculosis can infect both male and female and occur
In 2017 about 10 million people manifested with active in any age and can attack any organ/tissue of the body3.
tuberculosis, and almost 1.6 million persons die from TB TB bacilli generally infect the lungs in approximately
globally. It is the world second largest cause of death in 80% of the cases, which leads to primary pulmonary
adults between the infectious diseases after HIV/AIDS, tuberculosis. Extra-pulmonary tuberculosis (EPTB)
as it is results in death of about two million individuals represents nearly 20% of cases and affects many organs
annually 1. such as lymph nodes, intestine, meninges, bone and
joints4. Lymph node Tuberculosis (LNTB) represents the years with mean value (43.86), the male to female ratio
most common among other types of EPTB in multiple was 3:2 it is higher in males than in females, and 33
regions of the world representing 40% of EPTB cases 5. (47.1%) as a control group (males 22 (66.7) and females
11 (33.3)), their ages ranged from (16-72) and the mean
The pathogen that causes Tuberculosis disease is value is (42.48) as in table (1).
Mycobacterium tuberculosis (M.tb), this bacterium
included within the class Actinobacteria, and belongs The number of tuberculosis cases was more frequent
to subclass Corynebacterineae. It is rod in shape about in age interval from (25-50) years old which comprises
1-10μm in length, and nearly 0.4 µm in diameter 6. 19 patients (51%) from the total TB cases, the lowest
number of cases was in the age interval (>50) which is
Some individuals are naturally more vulnerable to only 8 cases (21.6%), while in control group it include
mycobacterial infections than others. Individuals who
8 individuals (24.2%) in (<25 years) age group, and 19
have high risk of getting mycobacterial infections include
(57.6%) in age group (25-50 years), while the age group
persons who have chronic renal failure, patients having
(>50 years) include 6 individuals (18.2%) table (1).
insulin-dependent diabetes, individuals subjecting to
immunosuppressive therapy, prisons residents and The impact of gender on the type of tuberculosis
people inhabitant homeless shelters, peoples using revealed the marked predominance of pulmonary
intravenous-drug, and HIV infected individuals 7. tuberculosis in males in compare with females 11
(61.1%) and 7 (38.9%) respectively, this dominance is
The prevalence of TB among diabetic patients was
also observed in pleural TB 5 (83.3%) in males compared
1.8–9.5 times higher than in the general population in
with 1 (16.7%) in female, and the incidence was also
some Asian countries 8.
higher in males in bone, peritoneum and meninges
TB. In contrast lymph node tuberculosis is found to be
Subjects and Method predominant in females while no males infection has
Ethically, data collection and the design of the study recorded as shown in table (1).
groups were accomplished after the approval on the It has been shown that diabetic patients represent 8
research proposal was done by Research Ethics Committee
(21.6%) of TB cases and non-diabetic patients were 29
of Najaf Health Directorate to work in its hospitals.
(78.4%) of total TB cases as illustrated in table (1).
A case-control study conducted during the period
In this experiment it has been found that 16 (43.2%)
from December 2017 to August 2018 in Al-Najaf city.
TB patients were smokers and 21 (56.8%) of TB patients
A total of seventy subjects were included. Thirty seven
were non-smokers as shown in table (1).
tuberculosis patients including 21 (56.8%) male and 16
(43.2%) female, and the male to female ratio was 3:2, As shown in table (1) there is marked dominance
those patients were diagnosed according to laboratory, of tuberculosis infection in urban than in rural area in
radiology and clinical investigations by specialist Najaf city 28 cases (75.7%) out of total 37 Tuberculosis
respiratory physician, and (33) healthy individuals cases were from urban area, whereas 9 cases (24.3%)
as control who were attended the Advisory Clinic for from rural area.
Thoracic and Respiratory Diseases in Al-Najaf city.
All data that include: age, gender, site of infection, Table 1: Description the frequency of each
history of diabetes, smoking and residence have been parameter in case and control group
collected from all participants, and appropriate statistical
and descriptive analysis were performed using IBM Frequency
Parameters
SPSS V21. Case N. (%) Control N. (%)
Age group
Results <25 years 10 (27) 8 (24.2)
25-50years 19 (51.4) 19 (57.6)
A total of 70 individuals were included in this study,
>50 years 8 (21.6) 6 (18.2)
divided into 37 (52.9 %) patients (males 21 (56.8%) and
females 16 (43.2%)), their ages ranged between (14-75) Total 37 (100) 33 (100)
Conted… by Al-Jubouri, 2010 12 and Al-Zubaidi, 2010 13 who point

out the rate of TB was higher in male than female (3:2).
Gender
World health organization reported that globally more
male 21 (56.8) 22 (66.7) men infected with TB than women, in (2017) however
female 16 (43.2) 11 (33.3) WHO mentioned that some places has more women than
Total 37 (100) 33 (100) men such as Afghanistan, Iran and some part of Pakistan
Smoking 14
. Another study mentioned that males and females has
Smokers 15 (40.5) 12 (36.4) equal TB incidence 15. In the current study, the cause
Non-smokers 22 (59.5) 21 (63.6) of high incidence of TB in men may be due to the
Total 37 (100) 33 (100) susceptibility of men to TB as a result of the nature of
DM their lifestyle that characterized of being more exposed
Diabetic 8 (21.6) 3 (9.1) to predisposing factor like tobacco smoking, drug abuse
and alcohol.
Non-diabetic 29 (78.4) 30 (90.9)
Total 37 (100) 33 (100) Pulmonary TB more frequent in men (61.1%)
Residence than in women (38.9%), pleural TB also has high male
Urban 28 (75.7) 30 (90.9) to female ratio 5 (83.3%) to 1 (16.7%), while lymph
Rural 9 (24.3) 3 (9.1) node TB found to be higher in women, these results
Total 37 (100) 33 (100) agree with study done in Tunisia 16 that mentioned the
predominance of pulmonary TB in men over women and
Site of infection
higher incidence of pleural TB in men, it also reported
Pulmonary 18 (48.6)
the predominance of lymph node TB in women. A study
Lymph node 6 (26.2) done in Hong Kong by Noertjojo et al., 2002 17 postulate
Meninges 3 (8.1) that lymph node TB occur significantly higher in women,
Bone 2 (5.4) while pleural TB was significantly higher in men.
Peritoneum 1 (2.7)
TB patients with diabetic consist of 8 (21.6%)
Pleural 6 (16.2)
while nondiabetic TB patients 29 (78.4%). This result
Fallopian tube 1 (2.7)
agrees with systematic review done by Baker et al.,
Total 37 (100) 2016 18 showing high number of hyperglycemia in TB
patients especially in Indonesia, Mexico and Iran that
Discussion reported diabetes mellitus prevalence of 13%, 35%
and 32% respectively. A cross sectional study done in
The most infected age groups are (25-50) years while
south Texas and north Mexico it found high prevalence
the lowest infected age groups were (<25) and (>50)
of diabetes in TB patients 39% in Texas and 36% in
years, and this does not mean that these age groups are
Mexico 19. The number of smokers in TB patients 16
less or not susceptible to TB infection, on the contrary
(43.2%) and nonsmoking TB patients were 21 (56.8%),
these age groups are of high susceptibility to TB infection
A study conducted in Iran by Ghasemian et al., 2009 20
as a result of their deficient or weak immune system 9. has found that smokers were 2.1 times more likely to
This result agrees with Bhatt et al., 2009 10 who suggest fell ill with pulmonary tuberculosis than non-smoker. A
that TB most commonly infect economically active age study done by Basu et al., 2011 21 predicts that smoking
groups (21-50 years old), and also agree with the global would increases the global TB cases by 18 million more
burden of TB in developing countries who reported that and 40 million deaths between 2010 and 2050.
75% of TB infected cases are within the age group (15-
54) years old which is economically active and most Tuberculosis has higher incidence among urban
productive age 11. people than rural 28 (75.7%) versus 9 (24.3%)
respectively. And this agrees with study done in Iran by
This study shows predominance of TB in males in Yazdani and Kazemnejad, 2010 has mention that 61% of
compare with females patients, with male to female ratio TB patients were urban and 39% from rural resident 22.
(3:2). This result matched with other studies done in Iraq Another study done by Zadeh et al., 2013 also reported
the higher incidence of TB in urban area 23. The low 8. Zheng C, Hu M, Gao F. Diabetes and pulmonary
number notification of TB cases in rural area probably, tuberculosis: a global overview with special
because of their limited access to health services and low focus on the situation in Asian countries with
knowledge about TB and poor health seeking 24, 25. high TB-DM burden. Global health action.
2017;10(1):1264702.
Conclusion 9. Brooks GF, Carroll KC, Butel JS, Morse SA,
TB most commonly infects economically active Mietzner TA. Medical Microbiology. 25th ed:
age groups (21-50 years old), Sex differences affect TB McGraw-Hill; 2010.
infection, it is significantly higher in males over females, 10. Bhatt CP, Bhatt A, Shrestha B. Tuberculosis
except in lymph node TB where it more frequent in patients Opinion for directly observed treatment
females, The TB situation appear to be worse in urban short-course (dots) programme of Nepal. SAARC
areas, with a significantly higher risk of infection Journal of Tuberculosis, Lung Diseases and HIV/
compared to rural areas. AIDS. 2009;6(1):39-45.
Conflict of Interest: No 11. World Health Organization. Tuberculosis control
[cited 2019 May 15]. Available from: https://www.
who.int/trade/distance_learning/gpgh/gpgh3/en/
index5.html#.
References
12. Al-Jubouri AMS. Studying the Effect of Some
1. World health organization. Tuberculosis fact Factors on Cellular Immunity in Tuberculosis
sheet 2018, September 18 Available from: https:// Patients. College of Medicine, University of
www.who.int/news-room/fact-sheets/detail/ Babylon Iraq. 2010.
tuberculosis.
13. Al-Zubaidi NAS. Diagnostic and Immunological
2. World health organization. Global tuberculosis
Study of Mycobacterium tuberculosis. College of
report 2018, October 29. Available from: http://
Medicine, University of Babylon. 2010.
apps.who.int/medicinedocs/en/d/Js23098en/.
14.
World health organization. Tuberculosis and
3. Fanning A. Tuberculosis: 6. Extrapulmonary
gender 2017. Available from: https://www.who.
disease. CMAJ: Canadian Medical Association
Journal. 1999;160(11):1597. int/tb/areas-of-work/population-groups/gender/
en/.
4.
Nwachukwu E, Peter GA. Prevalence of
Mycobacterium tuberculosis and human 15. Thorson A, Hoa N, Long N, Allebeck P, Diwan
immunodeficiency virus (HIV) infections in V. Do women with tuberculosis have a lower
Umuahia, Abia state, Nigeria. African Journal of likelihood of getting diagnosed?: Prevalence
Microbiology Research. 2010;4(14):1486-90. and case detection of sputum smear positive
pulmonary TB, a population-based study from
5. Fain O, Lortholary O, Djouab M, Amoura I, Babinet
Vietnam. Journal of Clinical Epidemiology.
P, Beaudreuil J, et al. Lymph node tuberculosis
2004;57(4):398-402.
in the suburbs of Paris: 59 cases in adults not
infected by the human immunodeficiency virus. 16. Jemaa MB, Koubaa M, Ayed HB, Marrakchi C,
The International Journal of Tuberculosis and Trigui M, Dammak J, et al., editors. 762. Sex
Lung Disease. 1999;3(2):162-5. Differences in the Epidemiology of Tuberculosis
6. Gillespie S, Hawkey PM. Principles and practice of in Tunisia. Open Forum Infectious Diseases;
clinical bacteriology: John Wiley & Sons; 2006. 2018: Oxford University Press.
7. Horsburgh Jr CR. Priorities for the treatment 17. Noertjojo K, Tam C, Chan S, Chan-Yeung M. Extra-
of latent tuberculosis infection in the United pulmonary and pulmonary tuberculosis in Hong
States. New England Journal of Medicine. Kong. The International Journal of Tuberculosis
2004;350(20):2060-7. and Lung Disease. 2002;6(10):879-86.
18. Baker M, Harries A, Jeon C, Hart J, Kapur A, 22. Yazdani CJ, Kazemnejad A. Spatial distribution
Lonnroth K, et al. The impact of diabetes on of tuberculosis in Mazandaran Province–Iran:
tuberculosis treatment outcomes: a systematic Spatiotemporal modeling. 2010.
review. Туберкульоз, легеневі хвороби, ВІЛ-
23. Zadeh JH, Nasehi M, Rezaianzadeh A, Tabatabaee
інфекція. 2016(4):66-79.
H, Rajaeifard A, Ghaderi E. Pattern of reported
19. Restrepo BI, Camerlin AJ, Rahbar MH, Wang tuberculosis cases in iran 2009–2010. Iranian
W, Restrepo MA, Zarate I, et al. Cross-sectional journal of public health. 2013;42(1):72.
assessment reveals high diabetes prevalence
24. Mushtaq MU, Shahid U, Abdullah HM, Saeed A,
among newly-diagnosed tuberculosis cases.
Omer F, Shad MA, et al. Urban-rural inequities
Bulletin of the World Health Organization.
in knowledge, attitudes and practices regarding
2011;89:352-9.
tuberculosis in two districts of Pakistan’s Punjab
20. Ghasemian R, Najafi N, YADGARINIA D, province. International journal for equity in
ALIAN S. Association between cigarette smoking health. 2011;10(1):8.
and pulmonary tuberculosis in men: A case-
25. Cambanis A, Yassin MA, Ramsay A, Bertel
control study in Mazandaran, Iran. 2009.
Squire S, Arbide I, Cuevas LE. Rural poverty
21. Basu S, Stuckler D, Bitton A, Glantz SA. Projected and delayed presentation to tuberculosis services
effects of tobacco smoking on worldwide in Ethiopia. Tropical Medicine & International
tuberculosis control: mathematical modelling Health. 2005;10(4):330-5.
analysis. Bmj. 2011;343:d5506.
The Effect of Ammuntuli BijaTianang Na Beja-Beja Model on

Knowledge, Motivation, and Attitude of Pregnant Women’s
Health Services in Jeneponto District, Indonesia
Mustamin1, Ridwan Amiruddin2, Sukri Palutturi3, Stang4, Risnah5

Student, Doctoral Program, in the Faculty of Public Health, Hasanuddin University Makassar, and Staff
1
of the Jeneponto District Health Office; 2Professor, Epidemiology Science, 3Professor, Health Policy and
Administration, 4Professor, Population, Family Planning and Biostatistics, Faculty of Public Health,
Hasanuddin University Makassar, Indonesia; 5Lecturer, Faculty of Medicine and Health Sciences State
Islamic University of Alauddin Makassar, Indonesia
ABSTRACT
Background: Maternal mortality is an important indicator to assess the level of a country’s welfare and
public health status. If the high maternal mortality rate means that the maternal health care system is still
poor. Ammuntuli Bija Teanang na Beja-Beja (home visit) is an approach or alternative solution to improve
maternal and child health.
Objective: This study was to determine the effect of the ammuntuli bija teanang na beja-beja model on the
knowledge, motivation, and attitudes of midwives in the health services of pregnant women. This study was
conducted in six health centers in Jeneponto Regency.
Method: This study used a “Pre-Experimental” design method with a “one group pre and post-test design”.
Statistical analysis used was the Wilcoxon rank test. The population was 113 midwives with a study sample
of 33 midwives in six Puskesmas in Jeneponto Regency. The sampling technique was purposive sampling.
Results: This study showed that there are differences in the knowledge, motivation, and attitudes of midwives
in the health services of pregnant women before and after the intervention of the ammuntuli bija teanang na
beja-beja model given. Significant changes occurred (p <0.05), namely; knowledge (p = 0.001), motivation
(p = 0.001) and attitude (p = 0.001).
Conclusion: The administration of the ammuntuli bija teanang na beja-beja model has been able to improve
the knowledge, motivation, and attitudes of midwives in the health services of pregnant women.
Keywords: Ammuttuli bija teanang na beja-beja, health services, midwives
Introduction 100,000 live births1. Maternal mortality in South

Sulawesi Province in 2014 was 138 people or 93.20 per
2012 Indonesian Demographic and Health Survey 100,000 live births. Jeneponto Regency (193/100,000
shows that the maternal mortality rate (related to live births) is ranked fourth after Bone (240/100,000
pregnancy, childbirth, and childbirth) was 359 per live births), Gowa (240/100,000 live births), and Luwu
(293/100,000 live births)2.
Sukri Palutturi The high maternal mortality rate in Jeneponto
Professor, Health Policy and Administration, Regency is due to bleeding, eclampsia, infectious
Faculty of Public Health, diseases, and late referrals and low competence of
Hasanuddin University Makassar, Indonesia midwives. This can be seen from a large number of
Phone: 08114453033 midwife services, health services in Jeneponto Regency
Email: sukritanatoa72@gmail.com are still low3. Health care programs for pregnant women
have not run optimally4. Low knowledge, motivation, Materials and Method
and attitudes of midwives are one of the important keys
This study used the method of “Pre-Experimental”
to the success of health services including improving
design research with the design of “one group pre and
health services for pregnant women5. The basic causes
post-test design”. Statistical analysis used was the
of maternal death can occur because 1) Too late to
Wilcoxon rank test. The population consisted of 113
recognize the danger and make decisions referring to midwives with a study sample of 33 midwives in six
health facilities; 2) Too late to reach a referral service Public Health Center (Puskesmas) in Jeneponto Regency.
facility, and 3) Too late in obtaining adequate services at The six Puskesmas includesPuskesmas Bontoramba,
the referral facility. Puskesmas Bulusibatang, Buluoe, Bontomate’ne, Tolo
dan Rumbia. The selection of Puskesmas is based on
Several studies have identified factors that influence
consideration of the low coverage of health services
the low level of health services so that maternal and and consideration of geographical location includes
newborn mortality rates are still high. These factors Puskesmas in mountainous and lowland areas.
are structural factors that lead to health inequalities of
antenatal care (ANC), low quality of health workers, Results
unavailability of potential equipment and drugs,
Table 1: Characteristics of Respondents in
ethnicity, and gender6-8
Jeneponto Regency
To improve maternal and child health, the World
Frequency Percentage
Health Organization (WHO) and UNICEF recommend Characteristics
(n = 33) %
that a home visit program is an effort that needs to be
Age (years)
carried out by community health workers to address
20-30 19 57,6
maternal and infant health problems and improve
31-40 14 42,4
maternal and infant health services. One of the African
sub-Saharan countries, Uganda, conducts home visits 41- 50 0 0
conducted by health workers (community health cadres, Domicile
also known as village health teams) as a means to Don’t stay 16 48,5
communicate health messages relevant to maternal and Stay 17 51,5
newborn health. In addition, Bangladesh, India, and Education
Pakistan have conducted home visits by community School of Health Nurses
0 0
health cadres’ programs designed to bridge public health (SPK) +Midwives
problems9. Efforts to prevent health problems have been Diploma-III 30 90,9
carried out in various cases, including cardiovascular Bachelor (Sarjana)/
2 6,1
disease in cooks10. Diploma-IV
Master 1 3,0
The home visit program on maternal and child
Job
health is a method used to provide broad results from
Civil servant 5 15,2
early prevention and service interventions to families
Temporary
in need during the prenatal period or early pregnancy. 26 78,8
employees(PTT)
Health workers strive to improve maternal services
Special Assignment
and the development of children by increasing parental 2 2
(NUGSUS)
knowledge, social support, the ability to overcome and
Training
solve health problems for pregnant women, access to the
Ever 8 24,2
community and health services11.
Never 25 75,8
The aim of this study was to determine the effect Years of service
of the current model of the ammuntuli bija teanang na 1- 3 years 1 3,0
beja-beja on the knowledge, attitudes, motivation, and 4-5years 0 0
abilities of midwives in the health services of pregnant Above 5 years 32 97,0
women in Jeneponto Regency. Source: Primary Data, 2018
Table 1 shows that the respondents in the intervention group, the most age group was the 20-30 age group with
19 people (57.6%), 17 people living in the village (51.5%) with the highest education level were Diploma-III with 30
people (90.9%). The highest number of jobs is PTT with 26 people (78.8%). Respondents who had a service period of
more than 5 years were 32 people (97.0%) and had never attended training, the highest number being 25 people (75.8%).
Table 2: Differences in knowledge, motivation, and attitudes before and after intervention in Jeneponto Regency
Variables Mean ± SD Different Mean P

Before 8,606 1,121
Knowledge 2,151 0,001
After 10,757 1,173
Before 58,036 2,855
Motivation 5,812 0,001
After 63,848 9,852
Before 65,030 3,712
Attitudes 5,515 0,001
After 70,545 4,528
Source: Primary Data, 2018
Table 2 shows that there was a change in knowledge, motivation, and attitudes before and after the intervention
where knowledge increased by 2.151 points, motivation increased by 5.812 points, the attitude changed by 5.515
points with p <0.005 knowledge (0.001), motivation (0.001) and attitude (0.001).
Figure 1: Model of the ammuntuli bija tianang na beja-beja implementation
Discussion In this study, the characteristics of the subjects were

Organizational determinants play an important role, found to be mostly good in the young age group, the
especially in providing adequate resources to support interval of 21-30 years. This greatly facilitates the transfer
teamwork, human resource management, and leadership. of information because the group is still relatively easy
As suggested by policymakers, the government must to receive knowledge and change. Age is one of the
encourage the use of these workers by updating policies, things that affect knowledge because a person’s growing
so that conditions where there is still a lack of midwives age can make changes to the physical, psychological
and facilities by implementing programs to increase staff and psychological aspects. On the psychological aspect,
and facilities4,12. a person’s level of thinking is getting more mature. In
practice, the characteristics that influence the attitudes of Although it is known that there is an influence of
nurses in service are age, education, functional positions, education (counseling) on knowledge and attitudes.
and length of work, while the doctors are age, education, Knowledge, skills, and motivation correlate
and length of work13. In this study, groups have with the performance of midwives. Meanwhile,
similarities to the dominance of subject characteristics, work time does not have a correlation with the
namely age, education and years of service. performance of midwives17. Health education is
an effort to increase one’s knowledge and abilities,
As the results of the study that a person’s beliefs by encouraging self-direction and being active in
are needed to involve themselves effectively in service. providing new information or ideas18.
Sometimes, new graduate midwives often lack confidence
in doing services, and this can interfere with safe and B. Motivation: After the Wilcoxon Rank test, the
effective health services. Therefore, an intervention is results of the study in table 2 show the value (ρ =
needed that can provide support to develop the knowledge 0.001), which means the value (p <0.05) with the
and experience of new graduates regarding the services of mean difference of 5.812. This means that there is a
pregnant women. This is very important to increase the change in the motivation of midwives in the health
confidence of new graduate nurses14. services of pregnant women before and after the
implementation of the ammuntuli bija teanang na
A. Knowledge: After the Wilcoxon Rank test, the beja-beja model. Motivation is someone’s special
results of the study in table 2 show the value (ρ readiness to carry out a series of activities aimed
= 0.001), which means the value (p <0.05) with at achieving a number of targets. Work motivation
the mean difference of 2.151. This means that is something that originates from the individual’s
there is a change in the knowledge of midwives internal (desires, hopes, needs, and preferences)
in the health services of pregnant women before which cause encouragement or enthusiasm to
and after the implementation of the ammuntuli work hard17.
bija teanang na beja-beja model. Ammuntuli
bija tenang na beja-beja is the language of the The motivation of village midwives is a condition
Makassar, it is hoped that the use of this term in the village midwives who can give strength,
will further facilitate local implementation. This enthusiasm, the courage to be honest and enjoy
is appropriate, that resolving health problems what they do in order to achieve high performance.
by taking into account the local context will be One of the factors to improve performance is
more effective than medical actions15,16. It does motivation because the presence of motivation will
not only contain home visits of a health worker to encourage work morale, inspiration from work
the home of pregnant women and/or mothers who activities of employees to work better in order
have babies, but it also contains respect for health to achieve organizational goals. Motivational
workers to them. With home visits, it means that factors are factors that are related to what they do,
they are picked up and it is hoped that they can namely the content of the work on the task that
make use of health services at the Puskesmas. encourages achievement. Motivational factors
are intrinsic originating in the individual or also
Knowledge is a continuous formation by someone called the content factor of work content.
who is experiencing reorganization at any time
because of new understanding. Knowledge in a C. Attitude: After the Wilcoxon Rank test, the
constructivist view is not a fact from a fact being results of the research in table 2 show the value
studied, but as a person’s cognitive construction (ρ = 0.001). This means that the value (p <0.05)
of objects, experiences, and environments. A with a mean difference of 5.515 means that there
person’s behavior tends to be good if his knowledge is a change in the attitude of midwives in the
is also high. Efforts to improve maternal health health services of pregnant women before and
services can be done in various ways. One of the after the implementation of the ammunition bija
strategies is training activities. In some training teanang na beja-beja model. The attitude is as an
and development of health services, it has not evaluative response. The response arises if the
been fully implemented. individual is faced with a stimulant that requires
an individual reaction. Evaluative Response effective maternal health services so that the handling of
means the evaluation process of an individual who maternal mortality can take place comprehensively and
gives a conclusion to a stimulus. In the form of sustainably
good-bad, positive-negative, pleasant, unpleasant,
which then crystallizes as a potential reaction to Acknowledgments
the object’s attitude19.
Our thanks go to various parties, namely the
The higher the attitude of supporting health
Jeneponto District Health Office, Bontoramba Health
workers, the higher the behavior of antenatal care
Center, Bulusibatang Health Center, Bululoe Health
visits. The lower the attitude of health workers
Center, BontoMatene Health Center, Tolo Health Center,
who do not support the lower the behavior of
Rumbia Health Center and all informants that help this
antenatal care visits. This is in accordance with
research.
Lawrence Green’s theory that the attitude of
health workers who are reinforcing factors can Conflict of Interest: There is no any conflict of interest
influence behavior change20. within this study and publication.
This research still has various limitations, namely
Ethitcal Clearence: This study was obtained ethical
the small number of samples that have not been
Clearence from Hasanuddin University ethics committee
able to see the overall aspects related to health
care for pregnant women. Activities in daily health with number: 965/H4.8.4.5.31/PP36-KOMETIK/2017
services at auxiliary health centers and village Source of Funding: Self
health posts provide limited intervention and
communication time when conducting research.
REFERENCES
This study only looks at how the influence of the
ammuntuli bija teanang na beja-beja model on the 1. MOH Indonesia. Indonesia Health Profile in 2016
knowledge, motivation, and cycles of maternal Jakarta: Ministry of Health; 2017.
health services does not see the overall aspects
2. Provincial Health Office of South Sulawesi. Health
that affect the health services of pregnant women
Profile of South Sulawesi Province. Makassar:
such as environmental, social, economic and
Provincial Health Office of South Sulawesi; 2015.
family support factors.
3. District Health Office of Jeneponto. Health Profile
Conclusions and Recommendations of Jeneponto District. Jeneponto: District Health
Office of Jeneponto; 2017.
This study concluded that there was an influence
of the midwifery on the knowledge, motivation, and 4. Amiruddin R, Palutturi S, Rahman SA. Increasing
attitudes of in the health services of pregnant women Midwifery Skill for Pregnancy Health Care with
in Jeneponto Regency. This study suggests that the Ammuntuli Bija Tianang Na Beja-Beja Model.
implementation of the ammuntuli bija teanang na beja- Indian Journal of Public Health Research &
beja model is very useful to be a reference for midwives Development. 2018;9(9).
in improving health services for pregnant women in 5. Kosgeroglu N, Acat MB, Ayranci U, Ozabaci N,
Jeneponto Regency and can be replicated in other areas Erkal S. An investigation on nursing, midwifery
according to local conditions. and health care students’ learning motivation
Significant Statement: This research is expected to in Turkey. Nurse education in practice.
be a recommendation for the regional government 2009;9(5):331-339.
(health office) to make regulations by implementing 6. Jackson R, Tesfay FH, Godefay H, Gebrehiwot
and developing models of ammuntuli bija teanang TG. Health extension workers’ and mothers’
na beja-beja, which are able to improve knowledge, attitudes to maternal health service utilization
motivation and attitudes of midwives in implementing and acceptance in Adwa Woreda, Tigray Region,
health services and becoming a momentum in improving Ethiopia. PLoS One. 2016;11(3):e0150747.
7.
Green BN, Johnson CD. Interprofessional 14. Pfaff KA, Baxter PE, Jack SM, Ploeg J.
collaboration in research, education, and clinical Exploring new graduate nurse confidence in
practice: working together for a better future. Journal interprofessional collaboration: A mixed methods
of Chiropractic Education. 2015;29(1):1-10. study. International journal of nursing studies.
2014;51(8):1142-1152.
8. Lowe M, Chen D-R, Huang S-L. Social and
cultural factors affecting maternal health in rural 15. Asrina A, Palutturi S, Andayanie E. Culture and
Gambia: an exploratory qualitative study. PloS health behavior of buton society of Baubau City,
one. 2016;11(9):e0163653. Southeast Sulawesi. Indian Journal of Public Health
Research & Development. 2018;9(9):315-318.
9. Ayiasi RM, Kolsteren P, Batwala V, Criel B,
Orach CG. Effect of village health team home 16. Asrina A, Palutturi S, Tenri A. Dole-Dole Tradition
visits and mobile phone consultations on maternal in Health Seeking Behavior of Buton Society,
and newborn care practices in Masindi and Southeast Sulawesi. Indian Journal of Public Health
Kiryandongo, Uganda: a community-intervention Research & Development. 2018;9(7):270-274.
trial. PloS one. 2016;11(4):e0153051.
17.
Palutturi S. Determinan Kinerja Bidan di
10. Medyati N, Amiruddin R, Russeng S, Rahman Puskesmas Tahun 2006. Jurnal Manajemen
SA. Hypertension in chefs: Prevalence and Pelayanan Kesehatan. 2007;10(04).
relationship with the characteristics of people.
18. Chen G-D, Huang C-N, Yang Y-S, Lew-Ting
EXECUTIVE EDITOR. 2018;9(11):522.
C-Y. Patient perception of understanding health
11. Nievar MA, Van Egeren LA, Pollard S. A meta‐ education and instructions has moderating
analysis of home visiting programs: Moderators effect on glycemic control. BMC public health.
of improvements in maternal behavior. Infant 2014;14(1):683.
mental health Journal. 2010;31(5):499-520.
19. Rostiati E. Evaluasi Kinerja Bidan Puskesmas
12. Amiruddin R, Palutturi S, Rahman SA. Training Dalam Pelayanan ANTENATAL CARE (ANC)
effect to the knowledge and skills of midwives in di Kecamatan Banjarsari kota Surakarta,
maternity health services at primary health care. Universitas Sebelas Maret; 2011.
International Journal Of Community Medicine
20. Erlina R, Larasati T, Kurniawan B. Faktor-
And Public Health. 2018;5(11):4651-4655.
faktor yang mempengaruhi ibu hamil terhadap
13. Baggs JG, Schmitt MH. Collaboration between kunjungan pemeriksaan kehamilan di Puskesmas
nurses and physicians. Journal of Nursing rawat inap Panjang Bandar Lampung. Jurnal
Scholarship. 1988;20(3):145-149. Majority. 2013;2(4).
A Study on New Frontier of Integrative Medicine on Social

Media with Special Reference to Chennai City
N. Manivannan1, G. Mythili2
Associate Professor, 2Assistant Professor, Department of Commerce, VELS Institute of Science,
1
Technology and Advanced Studies (VISTAS), Pallavaram, Chennai
ABSTRACT
The integrative medicine is sold on direct and also the indirect methods to the people. The public people
are ready to bought goods and services from the organisation without taking a risk. The risk less people are
choosing the social Medias recommendations, these kinds of recommendations may lead to promote the
goods in to the customers hands very easily. The easiest method may followed by the way of social media.
The social media convey one information about product to number people at single minutes of time. It
contains the need, scope, objectives of studies and also using the tools of Chi-square test for analyzing the
data. Based on the findings, appropriate suggestions have been made for increasing the number of users.
Keywords: Medicine, Customers, Media, Information, Users, Online service, product
Introduction online retailer realized that they could increase dates

by allowing visitors to their site to offer personal
The dynamism of the market has been a major area recommendation about products they were selling and of
of everyone‟s concern. The alarming shift from just course, the social media industry was very successful3.
“selling the products” to “being into the customers” has It the rise of mainstream social media has proceeds one
given marketing a different phase from „push marketing‟ thing. It may be for providing oneself with significant
to more of communicating with customers. Earlier the identification socially. But social media today captures
companies were connecting with the customers through a lot of unusual information about users. Sometimes
radio, television, print media, bill boards and other that mundane information can include on experience,
traditional advertising3. Now with a realization that the point view or negative, with your brand or with your
main conviction source are our colleagues, friends and Company. Today everyone can connect to their own
our social network, where we lend our ears and mind little social circle of usually a few hundred people4.
with a personal touch and usually get persuaded taking it
as more true and honest1. People don’t just hear about news, events, and so on
from the local TV news broadcast and/or newspapers.
At the same time, technology paved the way for People here about things from blogs, Twitter, articles,
new possibilities. TiVo & digital video recorders made casual conservation6. The term social media refers to the
it easy for us to bypass & ignore commercials in live collection of technologies that capture communication,
T.V. MPG players helped us listen to music & podcast on content, and so on across individuals, their friends, and
demand, which similarly margin zed radio advertising, their social naturals. Examples of social media include
social networking sites like Facebook and Twitter,
Corresponding Author: Blogging technologies like type pad and word press,
Dr. G. Mythili crowed sourcing products like Wikipedia, Photo &
Assistant Professor, Department of Commerce, video sharing sites like Flicker & You tube, & others.
VELS Institute of Science, These technologies help users easily create content on
Technology and Advanced Studies (VISTAS), the Internet and share it with others. Social media is the
Pallavaram, Chennai Infrastructures that helps user to become publishers of
Email: uvimyth84@gmail.com content that is interesting to them & their friends7.
Healthcare Marketing is Everywhere, Socially When a client reacts to your post or shares your links,
Speaking: A quick scroll through your Facebook your visibility goes up exponentially, opening the door
newsfeed on any given day probably turns up several to new patients who may be looking for the specialized
compelling articles about wellness and medical research6. care that can only be found in your niche6.
It’s become the norm to see cutting-edge health news
scattered throughout our social media channels with The Great Conversation: Social media marketing is
links to new studies being shared on timelines, retweeted also unique in how it brings patients and clients back
on Twitter, even posted on LinkedIn and Instagram4. into the conversation2. Traditional marketing and media
Sometimes simple wellness tips about mindfulness or such as print or commercials are a one-way messaging
exercise can take on a life of their own across the several system (pretty useless for finding out what customers
channels, going viral and then becoming water cooler are really thinking) but social media is interactive by
talk or the latest “have you heard about?” fodder. design. And since integrative medicine practitioners
prefer to encourage patients to participate in their own
Alternatives are Welcome in the Social Sphere: As a care, social media marketing and integrative health are
marketing channel social media clearly has an edge, but perfect partners5. By including the interactive streams
is it a good match for the growing field of integrative of Facebook, Twitter, and other popular outlets in our
medicine? The answer is absolutely 100% yes. marketing strategies, we can help keep our patients in
the driver’s seat of their well being.
By definition, the practitioners of integrative
medicine are open to thinking outside the box, using Advantages of Social Networking Sites8
inclusive, holistic approaches that put the patient at the
1.
Facilitates open communication, leading to
center of their own care. And the personal connection
enhanced information discovery and delivery.
from practitioner to patient on social media is instant!
Posts are presented right alongside user-generated 2. Allows employees to discuss ideas, post views,
content, taking up just as much weight and visual ask questions and share links.
space as posts from friends and family5. In addition, 3.
Provides an opportunity to widen business
integrative medicine practitioners actively listen and contacts.
rarely use a one-size-fits-all approach like mainstream
medicine often does, and on social media that personal 4. Targets a wide audience, making it a useful and
touch fits right in. More than ever it’s possible to build effective recruitment tool.
up one-on-one trust with a patient if they see reliable, 5. Improves business reputation and client base with
helpful information coming from your page directly to minimal use of advertising.
their newsfeed on a regular basis7.
Benefits of Social Networking Sites to Business6:
Positioning your practice as an authority and a
1. Increased awareness of the organization.
resource on social media goes a long way toward
building confidence in your specific brand of medicine 2. Increased traffic to website.
and promotes the positive influence of integrative
3. Greater favorable perceptions of the brand.
medicine in general3. Sharing helpful posts from fellow
integrative pioneers spreads the message even farther 4.
Able to monitor conversations about the
and positions you as a thought-leader in the larger organization.
conversation, so don’t be shy about the share button7. 5. Able to develop targeted marketing activities.
The Newsfeed: Where Patients Meet Practitioners:
By inviting the patient to take charge of their own health Objectives of the Study
(and at the same time empowering them with information zz To understand the real situation of healthcare
to do so) healthcare social media is at the forefront of product qualities
progressive medicine5. Social media also has the benefit
of directly connecting patients with specific practitioners zz To make a awareness about the social media in
that have the unique skill sets to promote their wellbeing. metropolitan cities
zz To create a real value of product at the time better health indices. These target populations have
purchasing better attitudes, better access and consequently better
utilization of health interventions. This utilization
Research Design: Descriptive Research Design was dependent upon, first people becoming aware
Sampling Method: Since the population is large in of existence of health conditions and understanding
number, the researcher undertook a sample survey. their impact. On being confronted with a specific
Convenient sampling method has been adopted to collect health condition, this general awareness would prime
data from the respondents. specific health seeking behaviours. The success of such
behaviours was crucially dependent upon access to
Sample Size: 310 corresponding health interventions. Thus a sequential
model of general awareness-specific awareness-attitudes
Method of Data Collection: Surveys questionnaire
access-utilisation is developed.
method and Personal Discussion.
Abusaleh Shariff and Geeta Singh (2007) made
Scope of the Study an attempt to discuss the issues associated with the
zz All the level of organizational performance related demand and supply of the five measures of maternity
to the customers with the efficient manner. care-antenatal care, blood pressure check up, place
of delivery, use of trained help at the time of delivery
zz The social media attract only the educated people and postnatal care. Econometric analysis is undertaken
so, they want to promote the business into the to find out the determinants of the use of reproductive
village level of people, health care services among rural Indian households. The
zz Media activities all are goes to explain the real focus on the role of education, information and economic
situation and value of the product at huge level. factors as determinants of health care accessibility
and their utilisation is the specialty of this analysis.
Limitations of the Study Analysis shows that education and information variables
significantly influence health seeking behaviour and as
zz The study only confined to Chennai city, the city
well increase the utilisation rates for prenatal, child
have so many kinds of living hoods.
delivery and postnatal health care.
zz The integrative medicine in social media is utmost
Srinivasan K. and Sharan Raka (2005) focused
developed in the study area
their attention on the various aspects of religiosity and
zz The respondents all are eagerly waited for the health It is observed by various researches that the rural
answering of his personal questions. population of India, is very much influenced by religious
beliefs. For example cultural formation of individuals
Review of Literature closely inter linked with performance of individual’s
daily routine. The study aimed to examine the impact of
B.V.L. Narayana (2012) shows that populations religious practices and rituals as aspects of religiosity on
with poor formal literacy rates show equivalent or even health with specific reference to rural individuals of India
Framework of Analysis and Analytical Tools
Chi-Square Test
Table No. 1: Medicine Requirements Versus Monthly Income
O E (O-E) (O-E)2 (O-E)2 /E

20 20 0 0 0
10 11 -1 1 0.090
25 17 8 64 3.764
30 24 6 36 1.5
Conted…
5 12 -7 49 4.083
10 16 -6 36 2.25
20 28 -8 64 2.285
15 15.40 -0.40 0.1600 0.010
10 23.80 -13.80 190.400 8.001
40 33.60 6.40 40.9600 1.219
25 16.80 8.20 67.2400 4.002
30 22.40 7.60 57.7600 2.578
30 24 6 36 1.5
15 13.20 1.80 3.2400 0.245
25 20.40 4.60 21.1600 1.037
310 310 32.564
CHI SQUARE
Df: (r-1)(c-1) (6-1)(5-1) 20.
Table value: 31.410, Calculated Value: 32.564
Result: Since the calculated value of Chi Square is greater than the table value of X2, H0 is rejected. So the Respondent
medicine requirement is influenced by the monthly income.
Hence there is evidence of association between requirement and by the monthly income.
Table No. 2: Social Media Versus Awareness of Medicine
O E (O-E) (O-E)2 (O-E)2/E

28 28.32 -0.32 0.1024 0.003
17 25.44 -8.44 71.2336 2.800
35 18.72 16.28 265.0384 14.158
30 34.56 -4.56 20.7936 0.601
10 12.96 -2.96 8.7616 0.676
52 40.12 11.88 141.1344 3.517
47 36.04 10.96 120.1216 3.333
10 26.52 -16.52 272.9104 10.290
45 48.96 -3.96 15.6816 0.320
16 18.36 -2.36 5.5696 0.303
10 14.04 -4.04 16.3216 1.162
10 18.88 -8.88 78.8544 4.176
310 310 41.339
CHI SQUARE
Df: (r-1)(c-1) (5-1)(4-1) 12.
Table value: 21.026, Calculated Value: 41.339
Result: Since the calculated value of Chi Square is greater than the table value of X2, H0 is rejected. So the respondents
social media is influenced by awareness of medicine
Hence there is evidence of association between social media respondent and awareness of medicine.
Findings partnership in addressing and advocating specific needs

of children and their families need to be explored. It will
The new frontier of the integrative medicine on social be beneficial to create new service intervention/strategies,
media with the effect of the societal people is ready to developing community-based approaches, sensitizing
accept the situational reasons. The people are believing
teachers/schoolmates about issues, facilitating social
the social information from the way of social media, the
and supportive interactions and equipping displaced
social media may goes to give a huge level of attraction.
children with life skills, which will enable them, cope
The attractive people are sharing the information to
with demands of their life in the area of resettlement.
others only on the basis of truthfulness. The truthful
There is also an urgent need for legal mandates, for
people are arrange all details about the information of
policy and institutions to address humanitarian aspects
original data. So we make one the decision from the
of those affected. Greater commitment, involvement
social media is transferred to other valuable one.
of state machinery, inter-sectoral coordination between
all ministries, and adequate representation from the
Recommendations internally displaced themselves in rehabilitation and
The number of suggestions are need to promote the resettlement will aid in effectively addressing issues that
medicinal value to the social people. The people taking concern them.
the life style of his individual life may goes to develop Ethical Clearance: Completed
the organizational performance. The social media may
ready to accept the all the related suggestions from the Source of Funding: Self
social. The medicine is one of the important source of
the ill health people, the medicine is very relative on the Conflict of Interest: Nil
decease. The deceased people are required a original
quality of medicine from the company. So, the company REFERENCES
produced a original medicine for the purpose of general 1. Dr. Biswajit Das and Jyoti Shankar Sahoo,“Social
people.
Networking Sites – A Critical Analysis of Its
Future of the Study: Schools of Social Work should Impact on Personal and Social Life”, Dam
be instrumental in training and including courses on Kheda, Madhya Pradesh: International Journal of
internally displaced child populations in the curricula. Business and Social Science Vol. 2 No. 14 (2013).
By partnering with these affected populations during Pg.No.203-240.
concurrent field work and through action research 2. P. Sri Joth, M. Neelamalar and R. Shakthi Prasad,
projects, many issues can be addressed and this “Analysis of social networking sites: A study on
vulnerable group empowered. There is an urgent need to effective communication strategy in developing
obtain baseline data on internally displaced populations, brand communication”, Guindy, Chennai: Journal
especially children. This data will facilitate planning of Media and Communication Studies Vol. 3(7),
of programmes and intervention in areas of education, July 2011. Pg.234-242
health, nutrition, child rights, career and for improving
quality of life of children in these situations. As many 3. Vivek bajpai and Dr. Sanjay Pandey, “Viral
more resettlement sites are planned, it is imperative that Marketing through Social Networking Sites with
the existing services and living conditions in resettlement Special Reference of facebook”, Ghaziabad,
sites be evaluated. Lessons learnt from experiences of UP: IOSR Journal of Business and Management
internally displaced child populations in resettlement (IOSR-JBM): IRJC International Journal of
areas need to be considered while planning rehabilitation Marketing, Financial Services & Management
and resettlement in the future. Research Vol.1 Issue 7, July 2012. Pg.No.178-196.
4. Chaffey D, “Internet Marketing, Strategy,
Conclusion Implementation and Practice”, United Kingdom:
Pearson Education Limited Publisher (2003).
There is a need for making existing services more
Pg.No.154-165.
accessible. Opportunities for service collaboration and
5. Scott DM, “The New Rules of Marketing and PR”, 7. Dave Evans with Jake McKee, “Social Media
United States: John Wiley & Sons Inc., Publisher Marketing: The Next Generation of Business
(2009). Pg.No.89-112. Engagement”, United States: John Wiley and
Sons Publisher (2012). Pg.No.230-254.
6. Weber L, “Marketing to the Social Web” Second
Edition, United States: John Wiley and Sons 8. Chris Treadaway & Mari Smith, “Facebook
Publisher (2013). Pg.No.38-74. Marketing: An Hour a Day”, United States: John
Wiley and Sons Publisher (2011). Pg.No.347-359.
Implementation of Nutrition Education to Knowledge,

Behaviour, and Performance of Junior High School Children
Nanik Suhartatik1, Sri Handayani2, Agatha Jumiati3

1
Departement of Technology and Food Industry, 2Departement of Teacher Training and Education,
3
Faculty of Law, Slamet Riyadi University, Middle Java, 57136, Indonesia
Abstract
The prevalence of obeslity increases from year to year. One of the factors that causes obesity was food
habits. Precautions need to be taken to undergo this phenomenoms. One effort that can be done was to
provide nutrition education to children. This research studied the role of nutrition education given to school-
age children (8th grade junior high school) towards knowledge, behavior, and overall performance. The
study was conducted by giving pre-test and post-test to students who were divided into 2 groups. The first
group treated with nutrition education, while the second group did not. Each group consisted of 37 students.
The results showed that nutrition education have a strong influence in to knowledge, behaviour, and also
the performance of the student. Students who are involved in research are included in the middle to lower
class of economics so there are not many opportunities to choose food. Research needs to be done in other
locations with middle to upper economic levels.
Keywords: nutrition education, school-age children, knowledge, healthy food
Introduction school children reaching 6%.2 The main factor that

causes obesity is a poor diet. The prevalence of obesity
There are 3 health problems in all countries, in elementary school children is more influenced by the
namely: malnutrition, obesity and chronic diseases. social status of parents, parental feeding that exceeds the
These problems arise mainly because of the lack of AKG, offspring (genetic), and lack of physical activity.2
public knowledge about food habits. Today’s lifestyle
is instantaneous, encouraging people to consume food One factor that causes obesity is consumption of
without regard to nutritional adequacy. Some studies “fast food”.4 Food categories that are not provided
said there is an increase in the prevalence of obesity in adequately to meet consumer nutritional needs or better
school-age children. The value was twice greater than known as junk food. “Junk food” and instant food
the previous one. 1,2,3 Obesity is a condition where body are part of today’s human lifestyle. This food has low
fat stored in adipose tissue is excessive. nutrient compounds, high calories, unbalanced nutrition,
has the potential to increase high blood pressure (due
Yaqin dan Nurhayati2 said that 75% of elementary to high levels of sodium), and high cholesterol.5 This
school children belong to normal weight, 8% are obese, consumption habits will increase the risk of obesity
and 2% suffer from obesity. Obesity is now categorized and the diabetes epidemic.6 Some types of packaging
as a disease, no longer a symptom of disease (WHO). are specifically designed to attract the interest of young
children. These foods usually delicious, contain high
Meanwhile, the prevalence of obesity will increase
sugar and fat, and low nutritional value.7
in junior high school children reaching 5% and high
Such research has been carried out in some
countries.5,8,9,10 One of the results showed that nutrition
Corresponding Author: education in elementary school children has been shown
Nanik Suhartatik to be effective in reducing consumption of “junk food”
Departement of Technology and Food Industry, and that education carried out for girls is more effective
Slamet Riyadi University, Middle Java, 57136, Indonesia than boys. This kind of study has never been conducted
Email: n_suhartatik@yahoo.com in Indonesia. Education is not only about the dangers of
consuming “junk food” but also includes the importance lower economic circles, as evidenced by the amount of
of consuming milk-based foods,11 knowledge about allowance received by each student. The first part of the
nutrition8, and oral health education. Pem et al. 9 have questionnaire were to assess the respondent knowledge
mentioned that age factors influence the effectiveness of about junk food. According to the results, group with
education, in addition to gender as well. This study aims nutrition education have a siginificant different in answer
to obtain information about the effectiveness of nutrition between pre-test and post-test while the group with no
education in school-age children in food selection, treatment were still have the same answer. This part
especially for junior high school children. of the questionnaire aimed to identifying respondents’
knowledge of healthy, unhealthy food (junk food), and
Material and Method nutritional fulfillment (Table 1). Group with treatment
have a different opinion about junk food after education,
This research was conducted in a junior high school
especially for the statement that junk food was an healthy
in Surakarta, namely Muhammadiyah 4 Surakarta Junior
food and some food may considered as unhealthy
High School. Educational techniques that applied to
because of the additive inside.
students include group discussions, asking and answering
questions, group discussions, and brainstorming methods. The second part of the questionnaire was to examine
A total of 74 students were involved in the learning session the respondent’s behavior or response to junk food. In
and divided into 2 groups. One group received additional this section, respondents were asked to give ratings for
knowledge (nutrition education) while the other group 6 types of food or drinks that are included in the junk
did not. The questionnaire was organized into 4 parts,
food category and give the reason why they choose the
including questions about demographic conditions,
food. The food category were pizza, grilled meatballs,
knowledge about junk food; questions about attitude, and
chocolate, soft drinks, energy drink, sport drink, or potato
finally about how often participants consume some junk
chips. A total of 29 respondents chose pizza as their
food. Feasibility and validity test was conducted to the
favorite food during the pre-test and this number dropped
questionnaire before used.
to number 24 at the time of the post test. Based on the
Nutrition education is given once a week with a results of statistical analysis, nutritional education did not
duration of between 45-90 minutes. Education material affect the selection of favorite foods or the frequency of
including food safety, food additive, and children consumption of foods belonging to junk food.
nutritional adequacy. Retrieval of post-test data was
conducted 1 month after giving the last material to see Most of the respondents chose to consume foods
the effectiveness and efficiency of education. The data that are included in the junk food category because they
obtained is then processed by T test (to compare the are tasty and fast, affordable, easy to find, and because
average knowledge, attitude, and performance). Data they like it, because they are served in large portions,
analysis was continued by Mann Whitney, Friedman, and because the ads are interesting (Table 1). The results
and ANOVA tests. showed that 64.9% of respondents doesn’t consume junk
food because they want to buy other people or because
Results they are served with a relatively large portion (40.7%)
or because of the influence of advertising (47.3%).
Respondents involved in this research activity Nutritional education apparently did not affect the
was 74 students with a distribution of 25 men (33.8%) respondents’ reasons for consuming junk food, except
and 49 women (66.2%) between 13-15 years old. This for questions number 3 and number 4. Between pre-test
school was dominated by students from the middle to and post-test, the results were statistically different.
Table 1: Respondents’ behavior towards the reasons for consuming junk food
Reasons for junk food Likert scale

No.
consumption 1 2 3 4 5
1. Fast and tasty
pre-test 14.9 51.4 4.1 23.0 6.8
post test 20.3 52.7 0 25.7 1.4
Conted…
2. Affordable price
pre-test 18.9 55.4 1.4 18.9 5.4
post test 10.8 51.4 1.4 31.1 5.4
3. Lovely food
pre-test 14.9 60.8 0 24.3 0
post test 14.9 47.3 2.7 35.1 0
4. Easy to find and serve
pre-test 29.7 55.4 0 13.5 1.4
post test 23.0 60.8 1.4 12.2 2.7
5. Need to be like others
pre-test 4.1 14.9 0 64.9 16.2
post test 2.7 12.2 1.4 70.3 13.5
6. Bigger portion
pre-test 5.4 40.5 5.4 40.5 8.1
post test 8.1 35.1 0 50.0 6.8
7. Interesting ads
pre-test 6.8 31.1 2.7 47.3 12.2
post test 8.1 31.1 0 47.3 13.5
Description: Based on statistical analysis, 7 questions stated in this part of the questionnaire are valid with moderate
reliability
Based on the results of a nutrition education survey, 8.1% of respondents stated strongly agree and 33.8% agreed
that consuming junk food would affect the mood. However, the number of respondents who stated that they did not
or strongly disagree with this was also relatively the same, 39.2% and 12.2%, respectively. Each of these numbers
has increased after being given nutrition education. Five students expressed doubt during the pre-test and this number
changed to 0 (zero) during the post test. Group with nutrition education have change their mind about junk food.
Especially for the reason that junk food have an affordable price and also because they want to be like someone when
they consume junk food.
The third part of the question was about how often respondents eats certain foods or drinks (Table 2 and 3). The
types of food or beverages that were asked about included fruit-flavored drinks, energy drinks, sweetened water,
sports drinks, ice cream, soft drinks, and so on. For types of food, which are asked including fast food (Pizza Hut,
McDonalds, Popeye, Olive, Fried Chicken, etc.), potato/corn chips, sweet (chocolate, candy, cupcakes), fresh fruit,
vegetables, biscuits and instant noodles. The results showed that between the post-test and pre-test. Consumption
frequency for drink category gave a significant difference between pre and post test only for energy drinks.
Table 2: Consumption frequrency for drink category
Compsumtion frequency
Drinks
Daily 3-4 times a week 1-2 times a week Rarely Infrequently
Fruity drinks
Pre-test 15 21 23 15 0
Post test 17 18 23 16 0
Energy drink
Pre-test 1 7 14 23 29
Post test 4 12 15 27 16
Conted…
Sweetened can/bottle drinks

Pre-test 20 7 23 24 0
Post test 17 15 20 21 0
Sports drink
Pre-test 1 5 10 35 23
Post test 2 10 15 22 25
Ice cream
Pre-test 7 11 17 35 4
Post test 6 6 29 27 6
Carbonated drinks
Pre-test 4 5 13 37 15
Post test 6 5 17 32 14
During the pre test, respondents had a high tendency to consume energy drinks, but at the post-test this trend
had decreased. This shows that nutrition education is said to have succeeded in changing the level of consumption
of drinks classified as energy drinks. Other types of drinks were not statistically different between pre- and post test.
Table 3: Food/snack consumption frequency
Respondent consuming frequency

Drinks
Daily 3-4 times a week 1-2 times a week Rarely Infrequently
Fast food
Pre-test 3 12 19 35 5
Post test 7 9 19 33 6
Tortilla/potato chips
Pre-test 9 10 22 30 3
Post test 14 8 22 28 2
Sweet food
Pre-test 15 16 23 19 1
Post test 17 13 18 24 2
Fresh Fruits
Pre-test 33 16 15 10 0
Post test 33 19 16 6 0
Vegetable
Pre-test 41 13 11 8 1
Post test 39 19 10 5 1
Biscuit
Pre-test 21 14 17 20 2
Post test 21 8 21 22 2
The types of food that are frequently consumed it infrequently. Three other types of food such as fast
are fresh fruit, vegetables, and biscuits. These three food, potato/corn chips, and sweet foods are included in
types of food are consumed almost every day by the category of foods that are rarely consumed, starting
most respondents. For biscuits, it is relatively varied from once a week to rare. Nutrition education did not
because there are some respondents who also consume affect to the respondent’s preference for various types of
food but most of respondent where decided to read the habits. Nutrition education could change the respondent
nutritional value from food label before buying the food. perception to some food, especially energy drink and
The category of drinks that are considered as invalid in sport drink. The reason why respondent chose some
this test and deleted from the list was tap water, while for food was just because of fast and tasty, affordable
the food category, the invalid ones was instant noodles. price, lovely, easy to find and serve, and serve in bigger
portion. Most of the respondents came from middle
Findings to lower economic circles, so they had relatively little
allowance. The limitations make the respondent have
Demographic condition were strongly influence the not many choices to buy food. Supported by a school
effect of the nutrition education to knowledge, behavior, environment in suburban areas and away from crowds or
and the performance of the student. The research was food distributors. Implementation of nutrition education
conducted at Muhammadiyah 4 Middle School in should be studied in different demographic environment.
Surakarta that are dominated from the middle to lower
economic classes and low academic abilities. In general, Conflict of Interest: There was no conflict of interest
there are evidence that urban people prefer to send the between the author and the peer reviewer and with the
children at an international junior high school or state editor.
junior high school. The school accommodates students
Source of Funding: The author would also special
in poor condition or even orphaned.
thanks to founder, Slamet Riyadi University of
It was found that there were several types of food Surakarta, Indonesia and the Head of Junior High School
and beverage preferences which declined after going of Muhammadiyah 4, Surakarta, which allow us to do
through nutritional education. Providing nutrition research in their school.
education needs to be done for children of lower age and
better education techniques.10 The type of drink that is Ethical Clearance: The ethical clearance taken from dr.
often consumed is a fruity beverage and the sweet one. Oen’s hospital committee.
Fruity drinks are often consumed compared to other
types of drinks, ranging from daily to 1-4 times a week. REFERENCES
Beverages that are rarely to infrequently consumed 1. Korespondensi A, Ayu R, Sartika D, Kesehatan
include energy drinks, sports drinks, ice cream, and soft DG. Penelitian 262 Prevalensi dan Determinan
drinks. In general, it can be seen that respondents who Kelebihan Berat Badan dan Kegemukan pada Anak
are between the ages of 13-15 years have known that Berusia 5-15 Tahun Prevalence and Determinant of
these types of drinks should be consumed if needed. Overweight and Obesity in Children Aged 5 to 15
Pem et al. 12 also reported that nutrition knowledge to Years Old. 2007; Available from: http://download.
adults increase their willingness to consume more fruits portalgaruda.org/article.php? article = 269583 &
and vegetable and reduce snack in the future. val = 7113 & title = Prevalensi dan Determinan
Considering the reason the willingness of student Kelebihan Berat Badan dan Kegemukan pada
to consume junk food, some recommendations must be Anak Berusia 5-15 Tahun
done, including reducing the number of junk food ads 2. Yaqin MK, Nurhayati F. Prevalensi Obesitas Pada
during children program, health messages in junk food Anak Usia Sd Menurut Imt/U Di Sd Negeri Ploso
label or ads, increasing the awareness of the children Ii No 173 Surabaya. J Pendidik Olahraga dan
to the health effect of junk food, highest standard for Kesehat. 2014;02(173):114–8.
nutritious food, promoting the healthier food, and etc5.
3. Kussoy K, Kepel B. Jurnal e-Biomedik (eBM),
Volume 1, Nomor 2, Juli 2013. 2013;1.
Conclusion
4. Anderson B, RaffertyAP, Lyon-Callo S, Fussman C,
Based on the results of research conducted at Imes G. Fast-food consumption and obesity among
Muhammadiyah 4 Middle School in Surakarta, it was Michigan adults. Prev Chronic Dis [Internet].
concluded that nutrition education had an effect on 2011;8(4):A71. Available from: http://www.
respondents’ knowledge, behavior, point of view, and ncbi.nlm.nih.gov/pubmed/21672395%0Ahttp://
www.pubmedcentral.nih.gov/articlerender. 2015;4(1):53. Available from: http://www.jehp.

fcgi?artid=PMC3136980 net/text.asp?2015/4/1/53/162349
5. Misra S. Evaluation of the Effect of Junk Food 9. Pem D, Bhagwant S, Jeewon R. A pre and post
on the Health of the School Children in Delhi. survey to determine effectiveness of a dietitian-
Dep Consum Aff Minist Consum Aff Food Public based nutrition education strategy on fruit and
Distrib Gov India, New Delh. 2016; vegetable intake and energy intake among adults.
Nutrients. 2016;8(3).
6. Oginsky MF, Goforth PB, Nobile CW, Lopez-
Santiago LF, Ferrario CR. Eating “Junk-Food” 10. Lee J, Jeong S, Ko G, Park H, Ko Y. Development
Produces Rapid and Long-Lasting Increases of a Food Safety and Nutrition Education Program
in NAc CP-AMPA Receptors: Implications for for Adolescents by Applying Social Cognitive
Enhanced Cue-Induced Motivation and Food Theory. Osong Public Heal Res Perspect
Addiction. Neuropsychopharmacology [Internet]. [Internet]. 2016;7(4):248–60. Available from:
2016;41(13):2977–86. Available from: http:// http://dx.doi.org/10.1016/j.phrp.2016.05.005
dx.doi.org/10.1038/npp.2016.111
11. Vakili M, Baghiani-Moghadam MH, Pirzadeh A,
7.
Missbach B, Pachschwöll C, Kuchling D, Dehghani M. Assessing the effect of education
König J. School food environment: Quality on knowledge, attitude and practice of guidance
and advertisement frequency of child-oriented school students about milk and dairy products.
packaged products within walking distance of Knowl Heal J. 2008;2(January):41–7.
public schools. Prev Med Reports [Internet].
12. Pem D, Jeewon R. Fruit and Vegetable Intake:
2017;6:307–13. Available from: http://dx.doi.
Benefits and Progress of Nutrition Education
org/10.1016/j.pmedr.2017.03.021
Interventions- Narrative Review Article. Iran
8. Tavassoli E, Vardanjani A, Reisi M, Javadzade J Public Health [Internet]. 2015;44(10):1309–
H, Pour Z. The Effect of nutrition education on 21. Available from: http://www.ncbi.nlm.
knowledge, attitude, and performance about junk nih.gov/pubmed/26576343%5Cnhttp://
food consumption among students of female www.pubmedcentral.nih.gov/articlerender.
primary schools. J Educ Health Promot [Internet]. fcgi?artid=PMC4644575
IL-18 -137G/C (rs187238) Gene Polymorphisms in Pulmonary

Tuberculosis Iraqi Arab Patients
Nawal Mohammed Utba

Department of Biology, College of Science, University of Baghdad, Al-Jaderia, Baghdad, Iraq
Abstract
Tuberculosis (TB) primarily caused by Mycobacterium tuberculosis and remains a worldwide problem
despite well documented, well publicised methods of prevention and cure. 80 pulmonary tuberculosis
(PTB) patients without HIV infection were included in this study. Patients were divided into three groups;
40 MDR (multidrug resistant), 20 RD (Recently diagnosed) and 20 OC (Old cases). While the others
89 apparently healthy subjects (control group, (HC)). IL-18 serum level was assessed by using ELISA
technique. However, polymorphism was analyzed using polymerase chain reaction-single specific primer
(PCR-SSP), at the position -137 G\C (rs187238) in the promoter of IL18 gene. The median serum level of
IL-18 for all patient groups was significantly higher than HC group. Comparing PTB patient groups to HC
group revealed that none of genotypes or alleles showed significant differences between patients groups and
HC group. The results are indicated that IL-18-137 alleles and genotypes showed no association with the
risk of PTB development in Iraqi Arab population or protection against it.
Keywords: pulmonary tuberculosis, Multidrug resistance drug, IL18 gene polymorphism, ELISA, Iraq
Introduction IL-184. IL-18 plays immunoregulatory role via the

induction of IFN-γ which exerts changes in a variety of
Tuberculosis primarily caused by Mycobacterium cell types5. Elevations of IFN-γ have been found in the
tuberculosis (MTB), continues to be one of the most affected lung and bloodstream of patients with PTB6.
important infectious causes of death and is a serious IFN-γ has been shown to be an important mediator of
public health problem that has caused 1.6 million macrophage activation involved in controlling MTB7. IL-
deaths every year over the world, especially in Asian 18 promoter gene polymorphisms have been associated
and Africa1. In Iraq, WHO reported that the incidence with various inflammatory diseases, and the functional
rate of TB was 42 per 100 000 populations in 20172. significance of the SNP at position −137 is attributed to
However, only 10% of people infected with MTB may the higher transcription and protein production of IL-
develop into clinical disease, which indicates that some 188. In order to investigate the possible role of IL18-137
factors can devote to the pathogenesis of tuberculosis, SNP in PTB Iraqi patients, the genetic polymorphisms of
including host immune response and gene environment IL-18 gene were evaluated and its impact on the serum
interactions3. levels in Iraqi PTB patients was investigated.
Many proinflammatory cytokines such as IL-1
family cytokines have been described to be elevated in Materials and Method
response to infection with MTB. This family includes
Study subjects and Blood Samples Collection: A
total of 169 individuals were included in this study, 80
Corresponding Author: individuals of them had PTB without HIV infection
Nawal Mohammed Utba (patients group); they were referred for diagnosis
Department of Biology, College of Science, and treatment to the National Reference laboratory of
University of Baghdad, Al-Jaderia, Baghdad -10071, Iraq tuberculosis in Baghdad during the period from January
Phone: +964 7901826834 2017 – April 2017. Patients were divided into three
Email: anooutba2014@yahoo.com groups; 40 MDR (multidrug resistant), 20 RD (Recently
diagnosed) and 20 OC (Old cases); their age range 12- Statistical Analysis
76 years. While the others 89 apparently healthy Iraqi
Arab subjects (control group (HC)), their age range, All statistical analysis was performed using
gender and ethnicity similar with patients group. All statistical package for social science program version
participants gave informed consent prior to participating 17 for windows (SPSS INC., Chicago IL, USA). Results
in the research, which was approved by the local were expressed as median. Comparisons between groups
ethics committee at National Reference laboratory of were performed using mann whitney u test and kruskal-
tuberculosis in accordance with the Helsinki Declaration. Wallis test for categorical data. P value of <0.05 were
A venous blood samples were collected from patients
considered to indicate statistical significance.
and control groups, and it was divided into two tubes;
the first whole blood sample was dispense in an EDTA- Genotypes of IL18 -137 were presented as
tube, this blood was mixed gently then stored placed in frequencies percentage, and significant differences
the freezer at (-20oC) until further processing for DNA between their distributions in PTB and HC were assessed
extraction. The second tube used for serum collecting by
by two-tailed Fisher’s exact probability (P). Also, odds
centrifuge at (3000 rpm) for 10 min.
ratio (OR), etiological fraction (EF) and preventive
Assessment of Interleukin-18 serum levels: Serum fraction (PF) were calculated to define the association
samples were collected from all the subjects and assessed between a genotype with the disease. These estimations
for the level of IL-18 using Human IL-18 Enzyme linked were calculated by using the WINPEPI computer
immunosorbant assay (ELISA) kit (MyBiosorce, USA) programs free online at http://www.brixtonhealth.com
according to the manufacturer’s instructions. for epidemiologists.
Detection of IL18 -137 G/C: DNA extracted by using Allele frequencies of IL18 -137 gene were estimated
the Wizard® Genomic DNA Purification Kit (Promega/
by direct gene counting methods, however, a significant
USA) and the polymorphisms were analyzed using PCR-
departure from Hardy-Weinberg (H-W) equilibrium was
SSP, at the position -137 G\C (rs187238) in the promoter
calculated using H-W calculator for two alleles, which
of IL18 gene according to9 with minor modifications.
is available free online at http://www.had2know.com/
Reactions were carried out in a Bio-Rad PCR thermal
cycler/USA. PCR reaction was performed with a final academics/hardy-weinbergequilibrium-calculator-3-
volume of 20µl consisting of 5 µl of 10ng DNA template, ale;es.html. Significant differences between the expected
1 µl of each of the reverse primer and sequence-specific and observed frequencies are assessed by Pearson’s Chi-
forward primers, and 12µl of Nuclease - free water square test.
in Accupower® PCR PreMix tube; this tube contains
DNA polymerase, dNTPs, a tracking dye and reaction Results and Discussion
buffer in a premixed format. IL18 -137 a common
reverse primer 5’-AGGAGGGCAAAATGCACTGG-3’ Serum levels of IL-18: The median of IL-18 serum
and two sequence-specific forward primers levels in PTB patient groups was 306.7 pg/ml with range
5’-CCCCAACTTTTACGGAAGAAAAG-3’ and from 133.7- 498.0 pg/ml in MDR, 310.9 pg/ml with the
5’-CCCCAACTTTTACGGAAGAAAAC-3’ were range of 134.1-488.5 pg/ml in RD and 280.5 pg/ml with
used. An amplification product of 261 bp was detected. the range of 104.2-493.0 pg/ml in OC. Il-18 serum level
Reaction conditions consisted of initial denaturation at was significantly higher in all patient groups than HC
94 ℃ for 2 min followed by 5 cycles of denaturation at group (225.9 pg/ml with range from 40.5-453.2 pg/ml).
94 ℃ for 20 sec., and annealing at 68 ℃ for 1 min. then
25 cycles of denaturation at 94 ℃ for 20 sec., annealing When the IL-18 serum level distributed according
at 62 ℃ for 40 sec. and extension at 72 ℃ at 40sec. lastly to gender, its median level in MDR, RD and OC
final extension at 72℃ at 5 min. PCR products were groups were insignificant difference between males and
visualized by 2% agarose gel electrophoresis stained by females. While in HC males were significantly higher
ethidium bromide. than females (Table 1).
Table 1: The median of IL-18 serum levels in study groups
Median IL-18 serum Median IL-18 serum Median IL-18 serum Median IL-18 serum
Subject
levels (pg/ml) in MDR levels (pg/ml) in RD levels (pg/ml) in OC levels (pg/ml) in HC
Gender
group group group group
Total 306.7 310.9 280.5 225.9
Male 305.2 300.6 298.1 230.9
Female 316.3 321.3 268.3 121.5
P value NS NS NS 0.0004 S
S: significant difference P < 0.05, NS: non significant
A functional cytokine network is a central element pulmonary involvement, revealed significantly higher
in the homeostasis of the immune response and its level for IL-18.
alteration may lead to an abnormal immune response. Allele and genotypes frequencies in subject groups:
Additionally, different pathological and infectious Testing for Hardy- Weinberg (H-W) equilibrium
situations may alter the cytokine network, and further revealed that PTB patients and HC groups showed
complicate the pathological events. Hence, studies have insignificant variation in the distribution of IL-18
focused upon genes regulating the cytokine expression; -137 genotypes (P> 0.05). The observed and expected
in particular on gene polymorphisms that may influence genotype frequencies were in a good agreement with
the levels of expression and therefore the overall immune H-W equilibrium. Comparing PTB patient groups to HC
response10. group revealed that none of genotypes or alleles showed
significant differences between patients and HC groups,
The results of this study was corroborates with6 while homozygote genotype GG and alleles G observed
results, they found that significantly higher levels of to have higher frequency in all patient and HC groups,
serum IL-18 in patients with PTB than in HC subjects Mutant homozygote CC genotypes showed insignificant
and there was no significant difference in circulating IL- increased (10% vs.7%) in both OC and RD groups than
18 between the sexes in patients with PTB in Japan. Also HC group with OR value of 1. 54, EF value of 0.035 and
with11 who found that there was significantly difference 95% C.I.: 0.30 -7.96. While heterozygote GC genotype
in the levels of serum IL-18 in patients with PTB than in showed insignificantly increased frequency in MDR
HC subjects in Saudi Arabia. And with12 who found that group than HC group, associated with OR value of 1.17
In China, IL-18 is higher in MDR-TB than in HC, as well with EF value of 0.04 and 95% C.I.: 0.53 to 2.59; as
as with13 who reported that patients with more advanced showed in Tables 2, 3 and 4.
Table 2: Statistical evaluations of associations between IL-18 -137 genotypes or allele and MDR group
MDR (N:40) Controls (N:89) Etiological Fishers

IL18-137
OR or Preventive Exact 95%CI
Genotypes or Allele N % N % Fraction Probability
Genotypes
GG 25 62.5 57 64 0.94 0.04 1 0.44 to 2.01
GC 13 32.5 26 29 1.17 0.04 0.836 0.53 to 2.59
CC 2 5 6 7 0.73 0.018 1 0.14 to 3.71
Alleles 80 -178
G 63 78.75 140 78.7 1.01 0.005 1 0.53 to 1.91
C 17 21.25 38 21.3 0.99 0.001 1 0.52 to 1.89
OR= odds ratio; 95%CI = 95% confidence interval.

Table 3: Statistical evaluations of associations between IL-18 -137 genotypes or allele and RD group
IL18-137 RD (N:20) Controls (N:89) Etiological
Fishers Exact
Genotypes or OR or Preventive 95%CI
N % N % Probability
Allele Fraction
Genotypes
GG 14 70 57 64 1.31 0.16 0.796 0.47 to 3.66
GC 4 20 26 29 0.61 0.11 0.581 0.19 to 1.93
CC 2 10 6 7 1.54 0.035 0.637 0.30 to 7.96
Alleles 40 -178
G 32 80 140 78.7 1.09 0.06 1 0.47 to 2.53
C 8 20 38 21.3 0. 92 0.017 1 0.40 to 2.14
Table 4: Statistical evaluations of associations between IL-18 -137 genotypes or allele and OC group
IL18-137 OC (N:20) Controls (N:89) Etiological Fishers
Genotypes OR or Preventive Exact 95%CI
N % N %
or Allele Fraction Probability
Genotypes
GG 12 60 57 64 0.84 0.1 0.8 0.32 to 2.23
GC 6 30 26 29 1.04 0.011 1 0.37 to 2.93
CC 2 10 6 7 1.54 0.035 0.637 0.30 to 7.96
Alleles -40 -178
G 30 75 140 78.7 0.81 0.14 0.637 0.37 to 1.80
C 10 25 38 21.3 1.23 0.046 0.637 0.56 to 2.71
The results of present study agreed with14 who reported IL-18- 137 gene polymorphism on its serum level
that Allele, genotype and haplotype frequencies did not was evaluated in patients and HC groups, because17
differ significantly between HC and patients. The results reported that it has been well documented that cytokines
suggest that the IL18 gene promoter polymorphisms are gene polymorphism have a functional importance and
not associated with susceptibility or resistance to PTB in might be associated with high or low production of the
south Indian population of Dravidian descent. But it’s not corresponding cytokines.
agree with15 who reported that with respect to the IL-18
gene polymorphisms, at -137 G>C variant, GG genotype The impact of IL18-137 gene polymorphism on its
was positively associated with tuberculosis in PTB patients serum level was determined in patients and HC groups
with co-morbid diabetes mellitus. As well as In China, (Table-5). In patient groups, GG genotype showed the
16
found that Polymorphism of the IL-18 gene promoter highest level (309.9 pg/ml) followed by genotype GC with
at position -137 is a potential host-susceptibility factor in 311.2 pg/ml and CC with 265.3 pg/ml. however, in HC, the
tuberculosis in Chongqing. The people with allele C at that GC genotype showed highest level (233.3 pg/ml) followed
position may be protected against MTB infection. by GG genotype with 225.9 pg/ml then CC genotype with
136 pg/ml, and the IL-18 serum levels reveled significant
IL-18- 137 genotypes impact on IL-18 serum variations (p <0.05) between HC genotypes. While there
levels: For advance understanding of cytokines gene were no significant variations between the three IL-18 -137
polymorphisms role in PTB patients, the impact of genotypes in PTB patients groups.
Table 5: Serum level of IL-18 in PTB patient and HC groups distributed by IL-18 - 137 genotypes
IL-18 -137 genotypes

TB P groups Control group
GG GC CC GG GC CC
Median Serum levels of IL-18 pg/ml 309.9 311.2 265.3 225.9* 233.3* 136*
*Significant differences (P< 0.05) in IL-18 serum levels between GG GC and CC genotypes in control group
The results of this study was not compatible with18 5. Troseid M, Seljeflot I, Arnesen H. The role
who found that Isolated PBMCs with IL-18 -137GC/ of interleukin‐18 in the metabolic syndrome.
CC genotype were able to produce a higher level of Cardiovasc. Diabetol. 2010; 9:11.
IL-18 than those with IL-18 -137GG genotype, either
6. Yamada G, Shijubo N, Shigehara K, Okamura
spontaneously or in response to PM acetate plus
H, Kurimoto M, Abe S. Increased Levels of
calcimycin A23187.
Circulating Interleukin-18 in Patients with
Cytokine gene polymorphisms may change the Advanced Tuberculosis. American Journal of
structure and biological function of a certain cytokine Respiratory and Critical Care Medicine, 2000.
coded by the defective gene leading to either increase 161(6):1786-9.
or decrease of cytokine production. The inheritance of 7. Schluger N, Rom W. The host immune response
SNP may render people more susceptible or resistant to to tuberculosis. American Journal of Respiratory
a certain diseases, therefore affecting cytokine secretion and Critical Care Medicine, 1998. 157:679–691.
levels, and eventually may influence the progression of
tumor19. 8. Jung A, Gerdes N, Fritzenwanger M, Figulla
H. Circulating Levels of Interleukin-1 Family
Cytokines in Overweight Adolescents. Mediators
Conclusion
Inflamm, 2010: 958403.
The results are indicated that IL-18-137 alleles 9. Giedraitis V, He B, Huang W, Hillert J. Cloning
and genotypes showed no association with the risk of and mutation analysis of the human IL-18
pulmonary tuberculosis development in Iraqi Arab promoter: a possible role of polymorphisms in
population or protection against it, and the recorded expression regulation. J Neuroimmunol, 2001.
OR, EF and PF values are in favor of such conclusion. 112:146–52.
Other studies for cytokines gene expression and
polymorphisms will be required for this disease. 10. Henao M, Montes C, París S, García L. Cytokine
gene polymorphisms in Colombian patients with
Conflict of Interest: None different clinical presentations of tuberculosis.
Tuberculosis (Edinb), 2006. 86(1):11-9.
11.
Mukhtar M. Assessment of Pathognomonic
Ethical Clearance: Not required. Markers in Tuberculosis Patients with Pulmonary
Complications for Rapid Initiation of Tuberculosis
REFERENCES Therapy. Albaha University Journal of Basic and
Applied Sciences, 2017. 1(2): 25–29.
1. Shen L, Liang Z, Xu C, Yang J, Han X,
Zhao H, Liu A, Bao F. Association between 12. Wang Y, Hu C, Wang Z, Kong H, Xie W, Wang H.
Interleukin-18-137G/C Gene Polymorphisms and Serum IL-1β and IL-18 correlate with ESR and
TuberculosisRisk in Chinese Population: A Meta- CRP in multidrug-resistant tuberculosis patients.
Analysis. J Clin Cell Immunol; 2017. 8 (4): 514. J Biomed Res. 2015. 29(5): 426–428.
2. WHO report. TB burden estimates and country- 13. Elarab A, Garrad H. Serum level of interferon
reported TB data. 2018. gamma (inf-ɣ), il-12, and il-18 in active pulmonary
tuberculosis. AAMJ, 2012. 10 (3): 21-33.
3. Azad A, Sadee W, Schlesinger L. Innate immune
gene polymorphisms in tuberculosis. Infect 14. Harishankar M, Selvaraj P, Rajeswari D, Anand
Immun; 2012. 80: 3343-3359. S, Narayanan P. Promoter polymorphism of
IL‐18 gene in pulmonary tuberculosis in South
4. Osborn O, Gram H, Zorrilla E, Conti B, Bartfai
Indian population. International Journal of
T. Insights into the roles of the inflammatory
Immunogenetic; 2007. 34, Issue 5 : 317-320.
mediators IL-1, IL-18 and PGE2 in obesity and
insulin resistance. Swiss Medical Weekly, 2008. 15. Ponnana M, Sivangala R, Joshi L, Valluri V,
138(45-46):665–673. Gaddam S. IL-6 and IL-18 cytokine gene variants
of pulmonary tuberculosis patients with co-morbid 18. Jin G, Kang H, Chen X, Dai D. Evaluation of the
diabetes mellitus and their household contacts in relationship between IL 28B and IL 28RA single
Hyderabad. Gene; 2017. 5(627):298-306. nucleotide polymorphisms and susceptibility
to hepatitis C virus in Chinese Han population.
16. Jiang L. Interleukin 18 gene polymorphism as a
Infect Genet Evol., 2014. 21: 8-14.
potential host-susceptibility factor in tuberculosis
in chongqing, china. Pediatrics, 2008. 121/ISSUE 19. Ansari M, Pedergnana V, Magri A, Von-Delft
Supplement 2, 133-134. A, Bonsall D, Chaturvedi N, Bartha I, Smith D,
Nicholson G, McVean G, Trebes A, Piazza P, Fellay
17. Zhou C, Ouyang N, Li Q, Luo S, He Q, Lei H, Liu
J, Cooke G, Foster G, Hudson E, McLauchlan J,
Q. The 137G/C Single Nucleotide Polymorphism in
Simmonds P, Bowden R, Klenerman P, Barnes E,
IL-18 Gene Promoter Contributes to Tuberculosis
Spencer C. Genometo-genome analysis highlights
Susceptibility in Chinese Han Population. j
the effect of the human innate and adaptive
Infection, genetics and evolution: journal of
immune systems on the hepatitis C virus. Nat
molecular epidemiology and evolutionary genetics
Genet, 2017. 49: 666-673.
in infectious diseases, 2015. 36.
Risk Factors Related to Diabetes Mellitus
Noor Diani1, Dhian Ririn Lestari2

1
Lecturer, Department of Medical Surgical Nursing, 2Lecturer, Department of Mental Nursing, Nursing
School, Faculty of Medicine, Lambung Mangkurat University
ABSTRACT
The efforts to control diabetes mellitus are carried out by improving the management of the main risk factors
for diabetes mellitus in primary health care facilities and community empowerment. Activities carried out
in this study, data collection in the form of primary data was carried out by filling out questionnaires about
risk factors related to diabetes mellitus which consisted of 13 items of questions which included risk factors
for gender, age, genetics/heredity, obesity/BMI, diet, pattern of exercise/activity, smoking, hypertension and
stress. Sampling technique is done by non probability sampling method through purposive sampling. The
results showed a mean age of 54.34 years. The lowest age of respondents was 34 years and the highest age
of respondents was 70 years, male sex 26% and female 74%, had a family history of diabetes mellitus 58%,
respondents who had a pattern of eating/drinking were sweet 90%, had sports activities 58%, has a normal
body mass index of 56% and who has a body weight of more than 30% and obesity 6%, has a smoking habit
of 16%, has a history of hypertension 54%, has stress in life 30%. These factors will reduce the occurrence
of diabetes mellitus and keep blood sugar levels stable.
Keywords: diabetes mellitus, risk factor, primary health care facilities, community empowerment
Introduction effective and efficient if we can identify specific diabetes

risk factors that are specific to the diamond mining
Diabetes mellitus is a metabolic disease which has community in South Kalimantan that is Cempaka sub-
a collection of symptoms since an increase of blood district in Banjarbaru. Health problems in the mining
glucose levels above normal values (hyperglycemia). It area are important to know in South Kalimantan.
is because decreasing in the body’s ability to react with
insulin, impaired insulin secretion, or both. 1,2,3 There is Specific risk factors possessed by people with
an increasing prevalence of diabetes mellitus throughout diabetes mellitus in the Cempaka Village need to be
the world related to the increasing population, increasing identified and analyzed as base developing preventive
life expectancy, urbanization that changes traditional efforts for diabetes mellitus in the community in the
lifestyle into a modern lifestyle, the prevalence of Cempaka Village area. There was no research has been
obesity increases, and physical activity are lacking. conducted on the analysis of risk factors associated with
diabetes mellitus in the community of Cempaka Village.
Efforts to control diabetes mellitus are implemented Based on the phenomena and results of previous studies,
by improving the management of the main risk factors researchers are interested to conduct research on the
for diabetes mellitus in primary health care facilities analysis of risk factors associated with diabetes mellitus
and community empowerment.4 Those efforts will be in the community of Cempaka Village.
Method
Noor Diani The research method used is research carried out on
Lecturer, Department of Medical Surgical Nursing, a set of objects that usually aim to see a picture of the
Nursing School, Faculty of Medicine, phenomena that occur within a particular population.5
Lambung Mangkurat University This study describes the risk factors associated with the
Email: noor.diani@ulm.ac.id incidence of diabetes mellitus.
The population in this study were all patients with Sudoyo, ages that have reached more than 30 years will
diabetes mellitus in the Cempaka village. Sampling experience anatomical, physiological and biochemical
is done by non-probability sampling method through changes.6 Then blood glucose levels will rise 1-2 mg/dL/
purposive sampling where this technique is used to year when fasting and will rise 5, 6-13 mg/dL/year at 2
select samples between populations according to what hours after meals. In middle adulthood various behaviors
the researcher wants (goals/problems in the study) so that often affect health such as nutrition, smoking and
that the sample can represent the characteristics of the physical activity that causes obesity so this behavior
population.5 increases the risk of developing diabetes.
Data collection in the form of primary data was Risk Factors in Diabetes Mellitus
taken on by filling out questionnaires about risk factors
related to diabetes mellitus which consisted of 13 items Table 3: Distribution of Risk Factors
of questions which included risk factors for gender, age, Risk Factors Frequency (n = 50) Percentage
genetics/heredity, obesity/BMI, diet, exercise/activity Gender
patterns, smoking, hypertension, and stress. Male 13 26 %
Female 37 74 %
Result & Discussion Total 50 100 %
Family History of Diabetes Mellitus
The result of this research are: Yes 29 58%
No 21 42 %
Table 1: Characteristics of Respondent Total 50 100%
Characteristics of Respondents
Mean Min-Maks Yes 45 90%
Weight 57,64 kg 39 – 85 kg No 5 10%
Height 155,42 cm 143 – 170 cm Total 50 100%
BMI 23,848 15,6 – 33,3
Table 3: Distribution of Risk Factors (Conts.)
20,44 times/ 15 – 25 times/
Respiration Rate
menit menit Frequency
Risk Factors Percentage
84,02 times/ 64 – 100 times/ (n = 50)
Pulse
menit menit Physical Activity
Temperature 36,760º C 36,0 – 38,0º C With Physical Exercise 29 58%
Random Plasma Without Physical Exercise 21 42%
228,26 mg/dl 109-575 mg/dl
Glucose (RPG)
Total 50 100%
Duration of
3,95 years 0-21 years Body Mass Index
Illness
Less Weight 4 8%
Age Risk Factors in Diabetes Mellitus Normal 28 56%
Over Weight 15 30%
Table 2: Distribution of Age Factors of Respondents Obesity 3 6%
Total 50 100%
Deviation
Variable Mean Min-Maxs Smoking Habit
Standard
Age (Year) 54,34 34-70 6.787 Smoking 8 16%
Not Smoking 42 84%
Based on the analysis of patients with diabetes Total 50 100%
mellitus, it is known that the average age is 54.34 Hypertension
years. The lowest age of respondents was 34 years and
With Hypertension 27 54%
the highest age of respondents was 70 years with a
Without Hypertension 23 46%
standard deviation of 6.787 years. Age affects the risk
Total 50 100%
and incidence of diabetes mellitus where according to
Conted… It can be seen that people with diabetes mellitus have

a diet that likes sweet foods and drinks as the consumption
Stress
of sweet and fatty foods is significantly associated with
Have Stress 15 30% the incidence of diabetes mellitus. This is in accordance
Have not Stress 35 70% with the research conducted by Wicaksono who reported
Total 50 100% that the habit of consuming sweet foods has a two-fold
risk of developing diabetes mellitus and makes blood
Gender Risk Factors in Diabetes Mellitus: The results
sugar levels tripled three times.12
of the data analyst respondents in table 3 were 26%
male and 74% female sex. Where women suffer from Risk Factors for Physical Activity in Diabetes
diabetes mellitus more than men. This study is the same Mellitus: In this study data (Table 3) obtained
as the results of research conducted by Isnaini which respondents who have sports activity 58% and those
shows that sex frequency tends to be greater in women who do not exercise 42%. In contrast to the research
compared to men.7 conducted by Dolongseda who got the results that the
pattern of physical activity in patients with diabetes
This research is in accordance with the research
mellitus was the respondent with a mild activity pattern
conducted by Trisnawati which shows that the number
of 96.0% and moderate activity patterns of 4.0%.13
of respondents is female more than male respondents.8 In
the study conducted by Samodra also showed the same It is found that many people with diabetes mellitus
results namely more respondents were female than male who do physical activities have very good conditions.
respondents.9 According to Irawan, women are more at This is because exercise plays a role in regulating blood
risk of developing diabetes because physically women glucose levels. The main problem in diabetes mellitus is
have a greater chance of increasing their body mass a lack of response to insulin (insulin resistance) so that
index. Post-menopausal monthly cycle (premenstrual glucose cannot enter the cell. Membrane permeability to
syndrome) syndrome that makes the distribution of body glucose increases when muscles contract because muscle
fat easily accumulated due to the hormonal process so contraction has insulin-like properties. Therefore, during
that women are at risk of developing diabetes mellitus.10 physical activities such as exercise, insulin resistance
decreases. Physical activity in the form of exercise is
Genetic or Hereditary Risk Factors in Diabetes useful as blood sugar control and weight loss in diabetes
Mellitus: The results of the analysis of the data seen in mellitus.14
table 3, found that those who had a family history of
diabetes mellitus were 58% and those without a history Risk Factors for Obesity in Diabetes Mellitus: The
of diabetes mellitus were 42%. Other factors that results of the data analysis of respondents (Table 3)
contribute greatly to the prevalence of diabetes mellitus who have a Normal Body Mass Index of 56%, and
are hereditary or genetic factors. People who have a those who weigh more than 30%, and are obese 6%.
family history of diabetes mellitus are more at risk than According to Sari, the cause of diabetes mellitus is the
people who have no history of diabetes mellitus. lack of production and availability of insulin in the body
or the occurrence of impaired insulin function, which
This is similar to previous studies that showed the is actually enough. Insulin deficiency is caused by
occurrence of type II diabetes mellitus would increase damage to a small part or most beta cells of Langerhans
two to six times if parents or siblings experience this Island in the pancreas gland which functions to produce
disease, the risk for type II diabetes in identical twins insulin. That being because of hereditary factors, viruses
is 75-90%, which indicates that the factor genetic and bacteria, toxic substances, and excessive weight
(hereditary) role in the incidence of diabetes mellitus in nutrition (obesity) that can cause diabetes mellitus due to
a person.11 insulin, those who want to spread into cells are blocked
as a result of sugar accumulating.15
Risk Factors for Diet in Diabetes Mellitus: The
respondent’s data are found in table 3 which has a sweet This study nearly 56% of respondents possessed
food/drink consumption pattern of 90% and those who Normal BMI, this could be because the ones related to
do not consume sweet foods/drinks 10%. the physical activity carried out by people with diabetes
mellitus have an effect on maintaining BMI in people are 30% and those who do not have stress in their
with diabetes mellitus. lives are 70%. In patients with diabetes mellitus when
interviewed, they said that they often think about the
Based on the interviews with patients of diabetes
disease, so that they feel disturbed according to where
mellitus, they initially had obese weight but when they
various reactions arise after patients know that they have
suffered from diabetes mellitus they lost weight. This is
diabetes, ranging from feelings of fear, anxiety, stress,
in accordance with the signs of diabetes mellitus, namely
depression, anger, and even rebellion.19
weight loss.
People with diabetes mellitus have a high level of
Risk Factors for Smoking in Diabetes Mellitus: The
stress and anxiety, which is associated with treatment
results of the data analysis of respondents (Table 3)
that must be followed and the occurrence of serious
who had a 16% smoking habit and who did not have a
complications. The stress experienced by sufferers is
smoking habit were 84%. Where all who smoke are men.
related to therapeutic or therapeutic regimens that must
Smoking is known as a risk factor for coronary heart
be undertaken such as diet or eating arrangements,
disease. However, after years, data collection research
control of blood sugar, consumption of drugs, exercise
shows that smokers who smoke for a long time/chronic
and other things that must be done throughout his life. In
have a higher risk of developing insulin resistance. In
addition, the risk of complications of the disease that can
diabetic patients, it is known that smoking exacerbates
be experienced by the sufferer will also increase stress
metabolic control. It can be proved that a larger dose
of insulin is needed for the same metabolic control in on the sufferer, which disturbs his quality of life.20
nonsmokers in diabetic patients.16 In diabetics, quality of life is the main goal of
Risk Factors for Hypertension in Diabetes Mellitus: care, as much as possible good quality of life must
Based on the respondent’s data analysts (Table 3), be maintained in people with diabetes mellitus. It is
who have a history of hypertension are 54% and those because low quality of life and psychological problems
without a history of hypertension are 46%. This is can worsen metabolic disorders, either directly through
similar to previous studies with 54 subjects with diabetes hormonal stress or indirectly through complications.21
mellitus. It is known that 66.6% of subjects suffer from
hypertension, and the rest 33.4% of subjects have Conclusion and Recommendation
normal blood pressure, people with diabetes mellitus
There are still many people who are not aware of
have hypertension.17
the risk factors for the disease to maintain blood sugar
Many studies have found an association between stability for people with diabetes mellitus.
increased hypertension in patients with diabetes mellitus.
People who suffer from diabetes mellitus, especially The need for public education is related to the factors
type 2, have a risk of 2 to 4 times more susceptible to that influence the disease and the incidence of diabetes
death due to cardiovascular disorders than people who mellitus so that people have a healthy quality of life.
do not suffer from diabetes mellitus and hypertension
occur 2 times more vulnerable in patients with diabetes Acknowledgments
mellitus than non-diabetes mellitus in the same age
The author thanks the patients and staff who
group. In addition, diabetic patients accompanied by
participated in this study. Ethical Clearance. Medical
hypertension increase the risk of coronary heart disease,
Research Ethics Committee, Faculty of Medicine,
stroke, nephropathy, and retinopathy. In fact, diabetes
University of Lambung Mangkurat (944/KEPK-FK
accompanied by hypertension increases by 75% of
UNLAM/EC/IX/2018). Funding. This research is
morbidity and mortality in people who already have
supported by PNBP University in the University of
previous risk factors.18
Lambung Mangkurat 2018 (782/UNS/KU/2018). There
Risk Factors for Stress in Diabetes Mellitus: Data is no potential conflict of interest relevant to this article
of respondents (Table 3) who have stress in their lives reported.
References 12. Wicaksono, RP. Faktor-Faktor yang berhubungan

dengan Kejadian Diabetes Mellitus Tipe 2.
1. World Health Organisation. Diabetes Mellitus:
Universitas Diponegoro:Semarang; 2011.
Report of a WHO Study Group, Geneva: World
Health Organization; 2006 13. Dolongseda, F.H. Hubungan Pola Aktivitas Fisik
dan Pola Makan dengan Kadar Gula Darah pada
2. Smeltzer, SC, Bare, BG, Hinkle, J & Cheever,
Pasien Diabetes Melitus Tipe II Di Poli Penyakit
KH. Brunner and Suddarth’s: Textbook of
Dalam Rumah Sakit Pancaran Kasih Gmim
medical-surgical nursing (12th ed.). Philadelphia:
Manado, e-journal Keperawatan (e-Kp) Volume 5
Lippincott Wiliams & Walkins; 2010.
Nomor 1; 2017.
3. Balitbangkes Kemenkes RI. Riset Kesehatan
14. Ilyas, Muh. Penatalaksanaan Diabetes Melitus
Dasar 2013. Jakarta: Ministry of Health Indoensia;
Terpadu Edisi II Cetakan ke-5. Jakarta: Fakultas
2013.
Kedokteran UI; 2004.
4. Pusdatin Kemenkes RI. Infodatin: Situasi dan
15. Sari, P. M., Arifin, H. & Murai, A. W. Hubungan
Analisis Diabetes. Jakarta: Kemenkes RI; 2014
Karakteristik dengan Mekanisme Koping dan
5. Notoatmodjo, S. Ilmu Perilaku Kesehatan. Jakarta Keteraturan Penggunaan Insulin pada Penderita
: Rineka Cipta; 2010. Diabetes Mellitus. Padang, Prosiding Seminar
6. Sudoyo, A. D. Buku Ajar Ilmu Penyakit Dalam. Nasional & Workshop “Perkembangan terkini
ed. V. Jakarta: Pusat Penerbitan Ilmu Penyakit sains farmasi & klinik; 2015.
Dalam; 2009. 16. Xie X, L. Q. W. J. d. W. M. Impact of Ciggarate
7. Isnaini, N. Faktor Resiko Mempengaruhi Kejadian Smoking in Type 2 Diabetes Mellitus. Acta
Diabetes Mellitus Tipe 2, Jurnal Kebidanan dan Pharmacol, Volume 6, p. 30; 2009.
Keperawatan Aisiyah Vol.14 No.1 ISSN; 2018. 17. SIlih, Y. Hubungan antara Diabetes Melitus
8. Trisnawati, S., Setyorogo, S. Faktor Resiko dengan Kejadian Hipertensi di Pontianak; 2012.
Kejadian Diabetes Mellitus Tipe II di Puskesmas 18. Grossman E, M. F. Hypertension and Diabetes.
Kecamatan Cengkareng Jakarta Barat Tahun s.t.: Luke’s-Roosevelt Hospital and Colombia
2012. Volume 5 (1); 2012. University; 2008.
9. Samodra, A. Evaluasi Cara Penggunaan Injeksi 19. Tandra, H. Segala Sesuatu yang Harus Anda
Insulin Pen pada Pasien Diabetes Mellitus Ketahui tentang Diabetes. Jakarta: PT Gramedia
di RSUD Dr. Moewardi Surakarta, Naskah Pustaka Utama; 2007.
Publikasi; 2013.
20. Shahab. Buku Ajar Ilmu Penyakit Dalam. IV ed.
10. Irawan, Dedi. Prevalensi dan Faktor Risiko Jakarta: Departemen Ilmu Penyakit Dalam FKUI;
Kejadian Diabetes Melitus Tipe 2 di Daerah Urban 2006.
Indonesia (Analisa Data Sekunder Riskesdas
21. Mandagi, A. M. Faktor yang berhubungan
2007). Thesis Universitas Indonesia; 2010.
dengan Status Kualitas Hidup Penderita Diabetes
11. Frankilawati D.A. Hubungan Antara Pola Makan, Mellitus. Jurnal Penelitian Kesehatan. Fakultas
Genetik dan Kebiasaan Olahraga terhadap Kesehatan Universitas Airlangga Surabaya; 2010.
Kejadian Diabetes Mellitus Tipe II di Wilayah Kerja
Puskesmas Nusukan, Surakarta, FIK UMS; 2014.
Association of Hunting Behavior and Malaria Incidence:

A Cross Sectional Study on Nuaulu Tribe Community in
Mesoendemic Area of Malaria
Nur Baharia Marasabessy1,2, Oedojo Soedirham2, Yoes Prijatna Dachlan3

1
Polytechnic of Health, Ministry of Health Maluku Province, Indonesia; 2Department of Health Promotion
and Behavioral Sciences Faculty of Public Health, 3Faculty of Medicine, Universitas Airlangga, Indonesia
Abstract
Background: The Nuaulu tribe is one of the indigenous tribes in Maluku Province, Indonesia which becomes
the area of malaria endemics. This tribe still adheres to the customs and habits of its ancestors, one of which
is hunting. It is carried out to fulfill the needs of life and the implementation of traditional rituals performed
from afternoon to morning or days in the forest, depending on the obtained sustenance. The hunting location
in a forest that is far from the residential area. Hunters are often exposed to mosquitoes from entering the
forest to returning home.
Objective: this study aims to reveal the profile of TNF-α and IL-10 related to hunting habits in tribal
community in malaria mesoendemic area.
Method: Cross sectional study was conducted in Sepa Village, Indonesia during July-August 2019. Each
subject was asked to complete a questionnaire asking about demographic and the desired study factor.
Laboratory evaluations used thick and thin blood films were prepared from venous blood, stained with
Giemsa stain, and examined by two microscopists for detection of malarial parasites and parasite species.
Inclusion criteria were being aged 18 years ≥ n ≤60 years, being a resident of Sepa Village and being willing
to participate in the study. A total of 84 subjects were included in this study.
Result: 40 subjects were with hunting activities and 44 were not. Only three subjects (3,6%) were positive
malaria. We found no significant association (p=0,243) between hunting behavior and malaria incidence,
even no malaria sufferers in subjects with hunting behavior. We found significant association (p=0,000)
between hunting behavior and gender.
Conclusion: our study showed that hunting behavior did not cause malaria incidence in the Nuaulu Tribe
community. Malaria sufferers were only found in non-hunting groups.
Keywords: hunting behavior, malaria incidence, Nuaulu, tribe
Introduction main species that cause malaria, responsible for 80%

of cases in Indonesia (1). Malaria is a complex disease
Malaria is caused by protozoa of the genus involving genetic factors inherent in parasites and hosts,
Plasmodium and is responsible for high levels of geographical and environmental aspects(2). During
morbidity which has a serious impact on socio-economic the infection, antibody-mediated and cell-mediated
development in endemic areas. Plasmodium vivax is the immunity plays an important role in achieving clinical
immunity (3,4). A research showed that the successful
completion of malaria infection depends on the hosts’
Corresponding Author: ability to induce adequate levels of pro-inflammatory and
Nur Baharia Marasabessy regulatory cytokines during the main stages of infection.
Polytechnic of Health, Thus, the adjustment between the inflammatory and
Ministry of Health Maluku Province, Indonesia anti-inflammatory response seems to be a determining
Email: nur.baharia.marasabessy-2016@fkm.unair.ac.id factor in clinical outcome of the disease(5).
Maluku Province is one of the endemic provinces sampling. Malaria examination is carried out through
of malaria in Indonesia. The Nuaulu tribe is one of microscopic examination using thin blood preparations
the isolated tribes in Seram Island, Central Maluku and thick blood. Examination of malaria slides were
Regency, Maluku Province, Indonesia. This tribe still carried out in the parasitology laboratory of the Center
adheres to the customs of its ancestors, one of which is for Environmental Health Engineering and Surabaya
hunting. It is carried out to fulfill the needs of life and Disease Control.
the needs of the implementation of traditional rituals
Data analysis was done using the IBM Statistic
performed from afternoon to morning or even days in
Package for Social Science (SPSS) version 21.0 software.
the forest that depends on the sustenance. The hunting
Variable were analyzed using the chi-square test. Etical
location is in a forest that is far from the residential
clearance was obtained from The Ethics Committee
area. This habit makes the hunters in this tribe are often
of Faculty of Public Health, Universitas Airlangga,
exposed to the mosquitoes. Support by preeliminary
Indonesia (Ref: No: 245/KEPK/22th May 2018).
data, the recognition of the public is that they are very
often bitten by mosquitoes from entering the forest to
going back to home again to the settlement. However, Findings
this is not considered a problem since there is an interest
The demographic characteristics of study subjects
in fulfilling the hunters’ needs of life and their families’.
are summarized in table 1. Of the 84 subjects, 60,7%
Acquired immunity studies of malaria in endemic were male, 54,8% were aged 18-31 years, 57,1% of
areas originally provide a greater potential for subjects had a low education level and 40% of subjects
understanding the regulation of human immune responses always carry out hunting activity.
to malaria parasites. However, little is known about
malaria-specific immunity acquisition in areas that are Table 1: Demographic characteristics of study
unstable, mesoendemic or hypo-endemic transmission subject (N = 84)
(6)
. The overall profile of cytokine production is still
Variabel Number (%)
contradictory due to differences in the study population
and the level of endemicity in the region, and other factors Gender
which require further investigation (7). this study aims to Male 51 (60,7)
reveal the profile of TNF-α and IL-10 related to hunting Female 33 (39,3)
habits in tribal community in malaria mesoendemic area. Age
18-31 46 (54,8)
Material and Method 32-46 18 (21,5)
The type of the present research is an observational 47-60 19 (22,7)
analytic study with a cross-sectional design used to Education
determine the associated of hunting behavior and malaria Low education 48 (57,1)
incidence on Nuaulu tribe community. The research Higher education 36 (42,9)
areas were Rohua Hamlet and Bonara Hamlet, Sepa Hunting behavior
Village, Amahai Subdistrict, Central Maluku Regency,
Hunting 40 (47,6)
Indonesia. The research population was the indigenous
Non-hunting 44 (52,4)
people of the Nuaulu tribe who lived in the research
areas. The sample was part of the study population that Microscopic examination of malaria. Giemsa-
met the inclusion criteria, i.e. people aged 18 to 60 years, stained thick and thin smears were showed none of the
living in the research area for at least the last 3 years hunting group (0%) was infected plasmodium in their
and were willing to be the research respondents. Age blood samples, whereas in non-hunting group showed
limitation was meant by considering that the ages of 18 that three samples out (7%) of 44 samples was found to
to 60 are adults who often carry out hunting activities. be positive for Plasmodium in their blood samples. The
The sample was determined using simple random plasmodium found in these three people was p.vivax.
Table 2: Results of Microscopic Examination of Malaria
Behavior
Laboratory
Hunting (n = 40) Non-Hunting (n = 44) ∑
Results
∑ % ∑ %
Negative 40 100 41 93 81
Positive 0 0 3 7 3
The bivariate test results no significant association forest until going home. However, this is considered
between malaria and gender (p = 0.558), malaria and normal because they think that there is something more
education (p = 1,000) and malaria and hunting behavior crucial than being bitten by mosquitoes, i.e. to fulfill the
(p = 0.243). There was a significant association between needs of the families and many people.
age and hunting behavior (p = 0.037) (table 3).
Forest ecosystems are well known to support
transmission of malaria, significantly contributing to
Table 3: Demographic characteristics of study the global disease burden. A global assessment reports
subject (N = 84) that “closed forests within areas of malaria risk cover
approximately 4.8 million km2” (9). Almost half the
Malaria, n (%) Total, N
Variabel p-value malaria risk is estimated to occur among people living
Yes No (%)
in forested areas (1.4 billion) accounting for 11.7, 18.7,
Gender 35.1 and 70.1 million population respectively from
Male 1 (2) 50 (98) 51 (60,7) 1.5 million km2 in the Amazon region, 1.4 million
0,558
Female 2 (6,1) 31 (93,9) 33 (39,3) km2 in Central Africa, 1.2 million km2 in the Western
Age Pacific, and 0.7 million km2 in South–East Asia (10).
18-31 2 (4,3) 44 (95,7) 46 (54,8) Corresponding forest areas containing these malaria
32-46 0 (0) 18 (100) 18 (21,5) 0,037 risk zones are 11.16 million to 15.71 million km2, 6.53
million– 7.80 million km2, 1.93 million– 5.19 million
47-60 1 (5,3) 18 (94,7) 19 (22,7)
km2, 2.70 million–2.72 million km2 (9,10). Controlling
Education
malaria in these forested regions of the world has been
Low a major challenge (11). Most studies of forest malaria
2 (4,2) 46 (95,8) 48 (57,1)
education are focused on local factors associated with malaria
1,000
Higher transmission. These include distance from forest, impact
1 (2,7) 37 (97,3) 36 (42,9)
education of deforestation and reforestation, effect of forest on
Hunting behavior microclimate, vector bionomics, Plasmodium species
Hunting 0 (0) 40 (100) 40 (47,6) survival, and human activities in forests (12).
Non-
3 (6,8) 41 (93,2) 44 (52,4) 0,243 The results confirmed there were no significant
hunting
association between malaria incidence with hunting
behavior. The incidence of malaria only occurred in
Discussion groups where the people did not hunt. On the other hand,
Hunting becomes one culture of the Nuaulu there were no malaria sufferers in the hunting group. It
people who are at risk of malaria infection which is was possible because while carried out hunting activities,
still maintained today. Results of the interview found the Nuaulu tribe consumed a lot of high-protein hunting
that hunting activities are carried out with the aim of foods such as pork (Sus scrofa), deer (Cervus molucencis),
fulfilling the daily needs of life and the part of traditional cuscus (Phalanger sp) and other wild foods obtained in the
rituals event according to the communitys’ trust, which forest such as reptiles and eggs, bats, maggots (including
according to Ellen (8) is classified as animism. Hunting sago worms), fruits and leaves.
activities are carried out from late afternoon to tomorrow
Infection of the human body may occur if the first
morning or depending on the sustenance obtained. Being
exposed to mosquitoes in the forest is common since defense (innate immunity) cannot block the invasion
they are always bitten by mosquitoes from entering the of pathogens to the body (13). The immune response is
very dependent on the ability of the immune system Acknowledgments

to recognize foreign molecules (antigens) contained
in potential pathogens and then generate the right The researchers deliver their gratitude to the heads
reaction to getting rid of the source of the antigen in of Ministry of Health, Ministry of Human Resources
Development and Human Resources for its funding.
question. Clinical manifestations of malaria, including
hematological changes, have been associated with
several factors, such as demographic characteristics, the References
levels of malaria endemicity (14), nutritional status (15,16) 1. World Health Organization. Treatment of Severe
and malaria immunity (17,18). The immune system is a Malaria. Guidel Treat Malar. 2015;71–88.
defense mechanism that can form a state of immunity to
infection (19), cells and molecules that are responsible for 2.
Struik, S. S. &, Riley EM. Does malaria
immunity to form the body immune system, as well as suffer from lack of memory ? Immunol Rev.
2004;201(1):268–90.
the collective and coordinated response of the immune
system to the recognition of foreign substances, is called 3. Arévalo-Herrera M, Lopez-Perez M, Dotsey E,
an immune response (20). If the immune system is exposed Jain A, Rubiano K, Felgner PL, et al. Antibody
to substances that are considered foreign, then there are Profiling in Native and Semi-immune Individuals
two types of immune responses that may occur in the Experimentally Challenged with Plasmodium
form of the response of innate and adaptive immunities. vivax Sporozoites. PLoS Negl Trop Dis.
2016;10(3):1–15.
The plasmodium examination showed that of the
84 people of the research objects, there were only three 4. Gomes LR, Martins YC, Ferreira-Da-Cruz MF,
Daniel-Ribeiro CT. Autoimmunity, phospholipid-
people who were positive for malaria, indicating that
reacting antibodies and malaria immunity. Lupus.
the immune system was good because they lived in
2014;23(12):1295–8.
an endemic area where malaria can infect them, but
with the low malaria illness. The parameters that can 5. Artavanis-Tsokanas K, Tongren JE, Riley EM.
modulate immune responses include nutritional status, The war between the malaria parasite and the
changes in circulating cytokine levels, expression of immune system : immunity, immunoregulation
adhesion molecules, chemotaxis or mobility changes and and immunopathology. Clin Exp Immunol.
generation of reactive species. The immune response is 2003;133(2):145–52.
also influenced by factors such as age, gender, biological 6. Montenegro S, Herrera S, James MA, Praba-
rhythm, and lifestyle. The search for activities during Egge AD, Arevalo-Herrera M, Hopper T. Human
hunting activities in the Nuaulu people concluded that the cytokine responses to meso-endemic malaria on
activities carried out during hunting were food gatherings, the Pacific Coast of Colombia. Ann Trop Med
exercises or physical activities, the use of herbs to prevent Parasitol. 2003;97(4):327–37.
fever and periodically being bitten by mosquitoes. 7. de Souza FSH, de Oliveira Mendes TA, Bueno
LL, Bartholomeu DC, Zanini GM, Hojo-Souza
Conclusion NS, et al. On the cytokine/chemokine network
during Plasmodium vivax malaria: new insights to
Our study showed that the incidence of malaria is not understand the disease. Malar J. 2017;16(1):1–10.
associated with hunting behavior and even the incidence
of malaria only occurs in groups that do not hunt. 8. Ellen RF. Nualu Settlement and Ecology. The
Hague - Martinus NIJHOFF; 1978.
Conflict of Interest: The researcher has no conflict of
9. Guerra, C A, Snow RW, Hay SI. A global
interest with subjects research and related parties at the
assessment of closed forests, deforestation
study site or with other parties related to this research. and malaria risk. Ann Trop Med Parasitol.
Ethical Clearance: This study is voluntary. Before 2006;100(3):189–204.
engaging in research, respondents are asked for their 10. Van Bortel W, Trung HD, Hoi LX, Van Ham N,
approval and signed informed consent. Van Chut N, Luu ND, et al. Malaria transmission
and vector behaviour in a forested malaria focus 16. Mfonkeu JBP, Gouado I, Kuate´ HF, Zambou O,
in central Vietnam and the implications for Combes V, Grau GER, et al. Biochemical markers
vector control. Malar J [Internet]. 2010;9(1):373. of nutritional status and childhood malaria severity
Available from: http://www.malariajournal.com/ in Cameroon. Br J Nutr. 2010;104(06):886–92.
content/9/1/373
17. Perkins DJ, Were T, Davenport GC, Kempaiah P,
11. Erhart A, Thang ND, Van Ky P, Tinh TT, Van Hittner JB, Ong’echa JM. Severe malarial anemia:
Overmeir C, Speybroeck N, et al. Epidemiology Innate immunity and pathogenesis. Int J Biol Sci.
of forest malaria in central Vietnam: A large scale 2011;7(9):1427–42.
cross-sectional survey. Malar J. 2005;4(58):1–11.

18.
Langhorne J. Immunology and
12. Kar NP, Kumar A, Singh OP, Carlton JM, Nanda Immunopathologenesis of Malaria. New York:
N. A Review of Malaria Transmission Dynamics Springer Berlin Heidelberg; 2005.
in Forest Ecosystems. 2014;1–12.
19. Delves PJ, Martin SJ, Burton DR, Roitt IM.
13. Stevenson MM, Riley EM. Innate immunity Roitt’s Essential Immunology. 12th Editi. British:
to malaria. Nat Rev Immunol [Internet]. Wiley-Balckwell; 2011. 3 p.
2004;4(3):169–80. Available from: http://www.
20. Abbas AK, Lichtman AH, Pillai S. Cellular and
nature.com/doifinder/10.1038/nri1311
Molecular Immunology. Ninth Edit. Philadelpia:
14. Idro R, Aloyo J, Mayende L, Bitarakwate E, John Elsevier; 2018.
CC, Kivumbi GW. Severe malaria in children in
21. Gonçalves RM, Scopel KKG, Bastos MS, Ferreira
areas with low, moderate and high transmission
MU. Cytokine Balance in Human Malaria: Does
intensity in Uganda. Trop Med Int Heal.
Plasmodium vivax Elicit More Inflammatory
2006;11(1):115–24.
Responses than Plasmodium falciparum? PLoS
15. Friedman JF, Kwena AM, Mirel LB, Kariuki One. 2012;7(9).
SK, Terlouw DJ, Phillips-Howard PA, et al.
22. Bradley JE, Jackson JA. Measuring immune
Malaria and Nutritional Status Among Pre-
system variation to help understand host-
School Children: Results From Cross-Sectional
pathogen community dynamics. Parasitology.
Surveys in Western Kenya. Am J Trop Med Hyg.
2008;135(7):807–23.
2018;73(4):698–704.
Determination of Ammonia Gas Safe Concentration in

Chicken Farm Workers in Lembak Village, South Sumatra
Indonesia
Putri Arianto1, Abdul Rohim Tualeka1, Desheila Andarini2, Pudji Rahmawati3, Syamsiar S Russeng4, Atjo
Wahyu4
Department of Occupational Health and Safety, Public Health Faculty, Airlangga University, 60115,
1
Surabaya, East Java, Indonesia; 2Department of Occupational Health and Safety, Faculty of Public
Health, Sriwiijaya University, South Sumatra, Indonesia; 3Department of Development of Islamic Society,
State Islamic University Sunan Ampel, Surabaya, Indonesia; 4Department of Occupational Health and
Safety, Public Health Faculty, Hassanudin University, Makassar, Indonesia
ABSTRACT
Ammonia is an alkaline gas with colorless and a strong odor characteristics. It can be formed naturally
in the air, soil and water. Ammonia is also produced by humans and animals as part of normal biological
processes. This study aims to determine the safe (C safe) concentration of ammonia gas in Chicken Farms
in Lembak Village, South Sumatra Indonesia. This study was an observational with a sample of 14 chicken
farm workers taken by purposive sampling. This study was analyzed based on primary and secondary data
and processed through safe C calculations by determining the weight of experimental animals (W animals),
body surface area of the
experimental animal (BSA of experimental animals), workers’ body weight (W),
workers’ body surface area (BSA), workers’ breathing rate (BR), benzene concentration in the workplace
(C), factor Km in animals (Animal Km), factor Km in humans (Human Km), highest dose of toxin without
effect (NOAEL), and reference concentration of ammonia gas on workers (RfC).
The measurement results of the highest concentration of ammonia gas in the chicken farm around Lembak
Selatan village, Sumatra was 0.006 mg/m3 (0.0086) ppm and the average concentration of ammonia gas
from 14 measurement points on the farm was 0.003214 mg/m3 (0.0046 ppm). The concentration level is
below the threshold value set by PERMENAKER No. 5 of 2018, OSHA, NIOSH and ACGIH of 25 ppm.
In contrast to these results, the manual calculation of safe (C safe) concentration of ammonia gas was 0.022
mg/m3 (0.031 ppm). With these results, the concentration of ammonia gas in the chicken farms of Desa
Lembak Sumatera Selatan Indonesia is in the safe category. Nevertheless, prevention measures are needed
to prevent the increase level of the gas.
Keywords: Ammonia gas, safe concentration, husbandry workers, husbandry
Introduction
Ammonia is an alkaline gas with characteristics
of colorless and has a strong odor. About 80% of
commercially produced ammonia is used in agricultural
Corresponding Author: fertilizers. 2. Ammonia can be formed naturally in the
Abdul Rohim Tualeka air, soil and water. It is also produced by humans and
Department of Occupational Health and Safety, animals as part of normal biological processes1. Animal
Public Health Faculty, Airlangga University husbandry contributes to the presence of dangerous
Kampus C, Jalan Mulyorejo, Surabaya, 60115, Indonesia ammonia in the environment that comes from the
Phone: +62 81 333 519 732 biological processes of animals in it. Ammonia is a
Email: abdul-r-t@fkm.unair.ac.id constituent of animal feces and urine when nitrogen-
rich proteins in feed are not fully converted into animal Material and Method
products such as meat, milk, wool, and eggs3.
This study is an observational study which aimed to
Ammonia can react directly at certain levels of determine the safe concentration of exposure to ammonia
exposure. At a level of 5 ppm it is almost undetectable. gas in chicken farm workers in Lembak Village, South
At 20 ppm ammonia can have a different odor but can Sumatra. The study population was chicken farms in
still be tolerated. 100 ppm ammonia can now be very Lembak Village, the subject sample was chicken farm
visible and somewhat uncomfortable when inhaled. At workers taken by purposive sampling which was 14
500 ppm ammonia will irritate the throat, lungs, mucous workers, and object samples was ammonia level in the
membranes, skin and eyes that breathing equipment is chicken farm air. Data collection was carried out by
needed at this level for exposure in a very short time. At interviews using questionnaires, weight measurements
1000 ppm or 0.1% ammonia becomes very toxic and a using scales, and direct measurement of ammonia
gas cartridge mask is required. At exposure rates above concentration.
2000 ppm, death can occur in less than 30 minutes5.
The variables of this study were the weight of
Based on health effects and the dangers that can experimental animals (W animals), body surface area of
arise due to exposure to ammonia, various regulations experimental animals (BSA of experimental animals),
regarding the threshold value of ammonia exposure body weight (W), body surface area of workers (BSA),
have been made through careful calculations. OSHA, workers breathing rate (BR), ammonia gas concentration
ACGIH, and NIOSH determined ammonia exposure in workplace, Km enzen in animals (Animal Km),
to workers at a maximum of 25 ppm with a duration Enzen Km in humans (Human Km), highest dose of
of 8 hours and 35 ppm for ammonia exposure for 15 toxin without effect on experimental animals (NOAEL),
minutes6. Indonesia also regulates the threshold value of enzene reference concentration on workers (RfC), and
ammonia exposure which is equal to 25ppm or 17 mg/m3 safe concentration of ammonia gas in air for workers (C
through the Peraturan Menteri Ketenagakerjaan Number is safe). Analysis of research data to determine the safe
5 of 2018 concerning Occupational Safety and Health at concentration of ammonia gas in the air for workers (C
the Work Environment7. safe) was conducted manually.
This journal draws references from the research Result
of Desheila et al (2017) on the Analysis of the Risk
of Ammonia Gas Exposure to Chicken Farm Workers A. Characteristics and Surface Area of
in Lembak Village, South Sumatra. The present study Experimental Animal Bodies: Toxicity testing
discusses Reference concentration of ammonia (NH3) of a compound is generally carried out using
of 0.028 mg/kg/day, real time intake of respondents in experimental animals. This is because the
the range 0.0020 (mg/kg)/day, and lifetime respondents’ response to toxic compounds between humans
responses in the range of 0.7671 (mg/kg)/day, as well and animals is similar. The experimental animals
as the risk received by respondents to exposure to used in this study were white mice. Below is the
ammonia gas (RQ <1). The previous research explained table of characteristics and surface area of white
that the results of the measurement of ammonia gas rats as experimental animals:
concentrations in 14 average air sample points were
0.003214 mg/m3. Compared to the threshold value stated Table 1: Distribution of Characteristics of
in PERMENAKER No. 5 of 2018, this level is still far Experimental Animals (White Mice)
below the threshold value of 25 ppm or 17.41 mg/m3 8. Experimental animals W BSA
Previous research on the Analysis of Ammonia Gas (white mice) (Kg) (m2)
Exposure Risks at Chicken Farm Workers in Lembak 1 0,1405 0,024165
Village, South Sumatra, did not explain the safe limits 2 0,1405 0,024165
of ammonia gas concentrations in chicken farm workers 3 0,1410 0,024223
and Rfc calculations using No Observed Adverse Effect 4 0,1410 0,024223
Level (NOAEL). In the present study, the authors
5 0,1395 0,024050
calculated Rfc and safe concentration of exposure to
ammonia gas in the air using No Observed Adverse 6 0,1415 0,024165
Effect Level (NOAEL). Average 0,140667 0,024165
The surface area of white mice is calculated using Based on calculations carried out on chicken farm
the following formula. workers in Lembak Village, South Sumatra, the
average body surface area of workers was 1.51
BSA = 0,09 W0,67
(m2) and the respiratory rate of workers was 0.58
Where m3/hour on average.
BSA: Body Surface Area (m2) C. Concentration of Ammonia Gas: The highest
concentration of ammonia gas in the chicken farm
W: Weight (kg)
in Lembak South Sumatra is 0.006 mg/m3 (0.0086
B. Workers’ Characteristics, Body Surface Area, ppm) and the average concentration of ammonia
and Respiratory Rate: As many as 14 workers of gas from 14 measurement points on chicken
chicken farm in Lembak Selatan Selatan Village farms was 0.003214 mg/m3 (0.0046 ppm). The
participated in this study with the lowest body mg/m3 conversion to ppm was calculated by the
weight of 14 kg, the highest body weight of 75 kg following formula.
and an average body weight of 51.85 kg. Based
C = 24,45 × C (mg/m3) ÷ molecular weight
on the results of the respondent’s questionnaire,
the exposure duration was 24 hours. This is Where:
because the workers stayed in the farm area that C : Concentration in the air (mg/m3)
they were continuously exposed to ammonia gas
produced by chickens. In the present study, the MW : Molecular Weight Amonia (17.031 g/mol)
average height used was the average height of The highest C = 24,45 × 0,006 mg/m3 ÷ 17.031
Indonesian adults of 159 cm. Body surface areas
= 0,0086 ppm
and officer breathing rate were calculated by using
the following formula. C average = 24,45 x 0.003214 mg/m3 ÷ 17.031
1. The average body surface area of the workers = 0,0046 ppm
BSA = W.h 3600 = 51, 85.159 3600 = 1,51 (m2) D. Animal Km and Human Km: Determination
Where of animal km and human km is the first step in
BSA: Body Surface Area (m2) determining the safe limit of ammonia gas toxin
dose. Calculation of animal km and human km are
W: Weight (kg)
as follows:
h: Height (cm)
1. Animal km
2. Average workers’ breathing rate
w animal
5, 3 ln W − 6, 9 5, 3 ln 51,85 − 6, 9 Animal Km =
BR = = BSA animal
24 24 Where:
= 0,58 m3/jam Animal Km: Km factor in experimental animals
where W : Weight (kg)
BR : Breathing Rate (m /hour) 3
BSA : Body Surface Area (m2)
W : Weight (kg)
Table 3: Calculation Results of Animal Km in White
Table 2: Distribution of Characteristics, Respiratory Mice
Rate, and duration of Working at Chicken Farm Experimental
Workers in Lembak Village, South Sumatra W BSA Animal Km
animal
(Kg) (m2) (W/BSA)
(white mice)
Number t
W h BSA BR (m3/ 1 0,1405 0,024165 5,814194082
of (hour/
(Kg) (cm) (m2) hour) 2 0,1405 0,024165 5,814194082
sample day)
14 51,85 159 1,51 0,58 24 3 0,1410 0,024223 5,820914007
Conted… animal Km
RfC = NOAEL
4 0,1410 0,024223 5,820914007 human Km
5 0,1395 0,024050 5,8004158 Where:
6 0,1415 0,024165 5,855576247 RfC :Inhalation Reference Concentration (mg/kg)
Average 0,1407 0,024165 5,82 Animal Km :Km factor in experimental animals
Based on the calculation of animal km above, the Human Km : Km factor in humans
average animal km yield of chicken farm workers
in Lebak Village, South Sumatra Indonesia is 5.82. Calculation of Inhalation Reference Concentration
(RfC) obtained from the NOAEL value, Animal
2. Human km s
Km average, and the Human Km average shows
w human the following results
Human Km =
BSA human
Where animal Km
RfC = NOAEL
Human Km : Km factor in humans human Km
W : Weight (kg) = 0,036
5,82
= 0,0061 mg/kg
BSA : Body Surface Area (m2) 34,3
G.
Safe Concentration of Ammonia Gas in
Chicken Farm Workers in Lembak Village,
Table 4: Human Km Calculation Results for
South Sumatra Indonesia
Chicken Farm Workers in Lembak Village, South
Sumatra Indonesia The following is a safe C calculation with
Rfc using No Observed Adverse Effect Level
Number of W BSA Human Km
(NOAEL):
sample (Kg) (m2) (W/BSA)
14 51,85 1,51 34,3
C safe (mg/m3) =
rfc ( W )
The above human km calculation is obtained from (d)( BR )(t )
Where:
the average body weight of the worker. Based on
the above calculations the results of human km C safe : concentration of toxin in the air that is
chicken farm workers in Lembak Sumatra Selatan safe for the community (mg/m3)
Indonesia are 34.3.
RfC : Inhalation Reference Concentration (mg/kg)
E. No Observed Adverse Effect Level (NOAEL):
W : Weight (kg)
NOAEL can be defined as the highest experimental
point without side effects9. According to U.S. The δ : % of substances absorbed by the lungs/if
Environmental Protection Agency (EPA), No unknown then 100% 13
Observed Adverse Effect Level (NOAEL) from BR : Human breathing rate (m3/hour)
ammonia is 4.9 mg/m3 (0.036 mg/kg). Calculation
of conversion from mg/m3 to mg/kg is as follows: t : Working duration (hour)
4, 9 × 0, 00013 × 8 MW : Molecular Weight

NOAEL ammonia (mg/m3) =
0, 1405 rfc ( W ) 0, 0061 (51,85)
= 0,036 mg/kg C safe (mg/m3) = =
(d)( BR )(t ) (100%)(0,58)( 24)
F. Inhalation Reference Concentration (RfC): = 0,022 mg/m3
Shaw et al. (2007) in Saridewi and Tualeka (2017) In ppm, the conversion calculation is as follows
also explain that the determination of reference
concentration on workers or the Inhalation # mg m3 × 24, 45 0, 022 × 24, 45
C safe (ppm) = =
Reference Concentration (RfC) can use the molecular weight 17,031
following formula12: = 0,031 ppm
Based on the above calculations, the safe Conclusion and Recommendation

concentration of exposure to ammonia gas in Lembak
Based on the results of this study, the value of safe
village, West Sumatera Indonesia chicken farm workers
concentration of ammonia gas for chicken farm workers
is 0.022 mg/m3 (0.031 ppm). in Desa Lembak, South Sumatra Indonesia is 0.022 mg/
m3 (0.031 ppm). This value is higher than the average
Discussion concentration of ammonia gas from 14 measurement
points in the Lembak Village farm in South Sumatra,
Determination of the safe concentration of ammonia which is 0.003214 mg/m3 (0.0046 ppm). Ammonia gas
gas in the chicken farm workers in Lembak South in the chicken farms of Desa Lembak, South Sumatra
Sumatra Indonesia is based on calculations involving Indonesia is in safe category for workers.
No Observed Adverse Effect Level (NOAEL) in it. No
While ammonia gas in the Lembak Village chicken
Observed Adverse Effect Level (NOAEL) used in this
farm is within safe concentration limits, an increase in
study came from U.S. The Environmental Protection the number of livestock will potentially increase the
Agency (EPA) is equal to 4.9 mg/m3 or equivalent to exposure of ammonia gas to workers. The presence of
0.036 mg/kg1. In the study conducted by Abdul Rohim ammonia gas exposure is possible to disturb the comfort
Tualeka and Juliana Jalaludin (2018) by using white of workers and local residents. Therefore, it is necessary
mice, it was determined that NOAEL ammonia was to attempt the use of personal protective equipment such
0.0154 mg/kg/weight 14. Another study by Abdul Rohim as masks to reduce the level of ammonia gas inhalation
Tualeka, Jihan Faradisha and Rizky Maharja (2018) for workers as well as cleaning livestock from urine
and manure regularly and periodically. If it is possible,
stated that NOAEL obtained from calculations with
it is necessary to check regularly for checking the
experimental animals was 0.0103 mg/kg/body weight10.
concentration of ammonia gas and checking the health
Calculation of Inhalation Reference Concentration of workers regularly.
(Rfc) was carried out by using NOAEL originating Conflict of Interest: All authors have no conflicts of
from U.S. The Environmental Protection Agency (EPA) interest to declare.
shows value of 0.0061 mg/kg. These results are smaller
than that of ammonia gas Rfc found in previous studies Source of Funding: This is an article “Determination
of Ammonia Gas Safe Concentration in Chicken Farm
on the Analysis of the Risk of Ammonia Gas Exposure
Workers in Lembak Village, South Sumatra Indonesia”
to Chicken Farm Workers in Lembak Village, South of Occupational Health and Safety Department that
Sumatra by 0.028 mg/kg. The results of ammonia Rfc was supported by Faculty of Public Health, Airlangga
gas in the present study is higher than the chronic Rfc University.
determined by U.S. Environmental Protection Agency
(EPA) of 0.5 mg/m3 (0.0037 mg/kg). Ethical Clearance: The study was approved by
the institutional Ethical Board of the Public Health,
Based on the results of this study, the value of safe Sriwijaya University.
concentration of ammonia gas for chicken farm workers
in Desa Lembak, South Sumatra Indonesia is 0.022 mg/ REFERENCE
m3 (0.031 ppm). This value is higher than the average 1.
EPA. Toxicological review of ammonia
concentration of ammonia gas from 14 measurement (noncancer inhalation): executive summary.
points in Lembak Village farm in South Sumatra by 2016;16(September):10. Available from:
0.003214 mg/m3 (0.0046 ppm). The results explained https://cfpub.epa.gov/ncea/iris/iris_documents/
that ammonia gas located in Lembak Village in South documents/subst/0422_summary.pdf
Sumatra Indonesia was safe for workers. The safe c 2.
U.S. Environmental Protection Agency.
value in this study is lower than that of OSHA,NIOSH, Toxicological review of ammonia (noncancer
ACGIH, and Peraturan Menteri Ketenagakerjaan inhalation). Epa [Internet]. 2016;(September).
Number 5 of 2018 which determined ammonia exposure Available from: https://cfpub.epa.gov/ncea/iris/
to workers at a maximum of 25 ppm. iris_documents/documents/toxreviews/0422tr.pdf
3.
Mikkelsen R. Ammonia emissions from 10.
Tualeka AR, Faradisha J, Maharja R.
agricultural operations: fertilizer. Better Determination of No-Observed-Adverse-Effect
Crop [Internet]. 2009;93(4):9–11. Available Level Ammonia in White Mice Through CD4
from: http://www.nanc.ipni.net/ppiweb/ Expression. Dose-Response. 2018;16(4):1–9.
bcrops.nsf/$webindex/8461612B20F2D0BE
11. Jakubowski M, Czerczak S. A proposal for
85257690004D7C91/$file/bc09-4p09.pdf
calculating the no-observed-adverse-effect level
4.
Agency for Toxic Substances and Disease (NOAEL) for organic compounds responsible
Registry. TOXICOLOGICAL PROFILE FOR for liver toxicity based on their physicochemical
AMMONIA. 2004;(September). properties. Int J Occup Med Environ Health.
2014;27(4):627–40.
5. LLC GAPS. AMMONIA HAZARDS. 2015;
12.
Tualeka AR. Toksikologi Industri & Risk
6. OSHA. OSHA Annotated Table Z-1 [Internet].
2018. Available from: https://www.osha.gov/dsg/
annotated-pels/tablez-1.html 13. Tualeka AR, Wibrata DA, Ahsan A, Rahmawati
P, Russeng SS, Wahyu A. Determination of
7. Menteri Ketenagakerjaan Republik Indonesia.
Highest Dose of Ammonia without Effect at
Peraturan Menteri Ketenagakerjaan Nomor 5
Work Environment through the Expression of
Tahun 2018. 2018.
Interleukin-2 Cell in Rattus Novergicus. Open
8. Andarini D, Lestari M, Bahruddin M. ANALISIS Access Maced J Med Sci. 2019;7(6):897–902.
RISIKO PAJANAN GAS AMONIA PADA
14. Tualeka AR, Jalaludin J. Observation of Adverse
PEKERJA PETERNAKAN AYAM DI
Effect on Level Ammonia through Expression of
DESA LEMBAK SUMATERA SELATAN.
CD8 Lymphocyte in Mice. Malaysian J Med Heal
2017;8(2):74–82.
Sci. 2018;
9.
Michael A. Dorato JAE. The no-observed-
adverse-effect-level in drug safety evaluations:
Use, issues, and definition(s). In Elsevier; 2005.
p. 265–74.
Body Image among Postnatal Primparous Women in

Maternity Hospitals in Baghdad City
Rafah Raad Abdul-Salam1, Suhad Hikmat Khairi2

1
MSc(C), Department of Maternal and Newborn Nursing, College of Nursing, University of Baghdad,
Baghdad, Iraq; 2Assistant Professor(PhD), Department of Maternal and Newborn Nursing, College of
Nursing, University of Baghdad, Baghdad, Iraq
Abstract
A descriptive correlational design was used. This study aims to (1) assess body image, and (2) find out the
association between body image and some sociodemographic characteristics for primiparous women. The
study included a convenience sample of 200 primiparous women who were selected from four maternity
hospitals in Baghdad City. The study instrument consists of the sociodemographic characteristics, the
reproductive information and Body Appreciation Scale. Data were collected using a self-report tool. Data
were analyzed using the statistical package for social sciences (SPSS) for windows, version 24.
The study results revealed that more than a half perceive themselves as having; from their point of view,
good body image (n= 111; 55.5%). The researcher concluded that more than a half perceive themselves as
having; from their point of view, good body image.
Keywords: Body Image, Primiparous Women
Introduction breastfeeding at birth, or if they did so, only breastfed

for a short period of time(2).
A woman’s body undergoes many transformations
during the nine months of pregnancy. Some of these Body image describes the cognitive, affective
physical changes are visible, such as an expanding belly and behavioral aspect of one’s body. Negative body
and weight gain, while others are well known, such as image is common during pregnancy and extends to the
an enlarged uterus, morning sickness and backaches. postnatal period. Women can be distressed by bodily
However, a few bodily changes may be unexpected and changes in pregnancy, although the association between
catch some women by surprise(1). breastfeeding and maternal weight and body image such
as changing shape and weight gain and breastfeeding
During pregnancy mothers reported how they duration(3).
felt about their changing shape and appearance and
their concerns for their body after the birth alongside It traditionally has focused on describing
considering how they would feed their baby after it and predicting negative body image such as body
was born. Those who held higher concerns for their dissatisfaction, body shame, and body preoccupation,
appearance or who were trying to limit their food intake body appearance has been defined as accepting, holding
during pregnancy were less likely to plan to or start favorable opinions toward, and respecting the body,
while also rejecting media-promoted appearance ideals
as the only from of human beauty (4). Body image
Corresponding Author: concerns to be high among postpartum women(5) and
Rafah Raad Abdul-Salam, MSc (C), are a source of significant psychological distress. In
Department of Maternal and Newborn Nursing, addition, body image concerns have been shown to be
College of Nursing, University of Baghdad, associated with to negative eating and feeding related
Baghdad, Iraq outcomes including maternal disordered eating, and
Email: rafah_a.salam@yahoo.com lower rates and shorter duration of breastfeeding(6).
Weight gain (within the recommended range) and in Al-karkh Maternity Hospital at (50 sample) Al-karkh
changes in body shape and appearance are an expected side and three Maternity hospitals (150 women) in Al-
and healthy element of pregnancy. However, growing Russafa side.
numbers of women appear to be concerned about their
Inclusion Criteria: The inclusion criteria included (1)
weight gain and appearance during pregnancy and may
Postnatal primiparous woman, and (2) normal vaginal
be at risk of developing a negative body image(7).
delivery or caesarean section.
Body image describes the cognitive, affective and Study Instrument: The study instrument includes
behavioral aspects of one’s body(8). Negative body women’s age, levels of education, occupation, family
image is common during pregnancy and extends to the monthly income, BMI, and residency. Body mass index
postnatal period (9). Women can be distressed by bodily was computed by dividing the weight (kg) on height
changes in pregnancy, although some report feeling (cm)2. The score of less than 18.5 is underweight, 18.5-
liberated (10). Pregnancy can trigger or intensify negative 24.9 is within normal, 25-29.9 is overweight, 30-34.9 is
feelings about the body or disordered eating(11). class I obesity, 35 or greater is class II obesity.
Body image dissatisfaction during pregnancy can Reproductive Status: This part includes woman’s age
have a negative impact on both mother and baby. It on marriage, abortion, mode of delivery, indication
can be linked to unhealthy eating, dieting and purging of CS, baby’s condition after birth, baby’s weight on
behaviors. In turn these behavior’s increase the risk delivery, and baby’s gender.
of low infant birth weight and premature delivery
The Body Appreciation Scale: The body appreciation
(12)
with higher levels of miscarriage and caesarean
scale (BAS) is based on (Avalos et al, 2005). This scale
delivery(13) amongst pregnant women with disordered
is a 5-point Likert type scale that is composed of 10
eating. Conversely, poor body image can sometimes
items. These items were measured on a 5-point Likert
be associated with increased weight gain as the woman
scale. Responses on this scale range from (Never=1) to
binges or comfort eats(14). A factor that has been
(Always=5). Total scores range from 10 to 65 degree,
associated with infant macrosomia, caesarean section
with a higher score indicating greater body appreciation
and later childhood overweight(15).
Data Collection: Data were collected for the period
An extant literature suggests that body dissatisfaction from December 30th, 2018 to February 10th, 2019. Data
may increase new mothers’ risk for depression. were collected through either a self-report or structured
These depressive symptoms may contribute to body interview during morning shift. It took 20-30 minutes.
dissatisfaction by increasing negative attributions and
evaluations related to body weight and shape, as well as Data Analyses: Data were analyzed using the statistical
decreasing the likelihood of women engaging in positive package for social science (SPSS) for windows, version
body-related activities including physical exercise and self- 24. The statistical measure of frequency, percent, Mean,
care(16). Conversely, prenatal and postpartum depression and standard deviation (SD), linear regression, ANOVA,
may contribute to body image concerns(7). This study aims and independent-sample t-test were used.
to (1) assess body image, and (2) identify the association
between body image and some sociodemographic Results
characteristics for primiparous women.
Method
Study Design: A descriptive correlational design was

used.
Setting: The study was conducted in either obstetric

ward or delivery room at stage four of labor in four
hospitals at Baghdad City.
Sample and Sampling: A purposive sample of (200)

postnatal primiparous women who were delivered in four
maternity hospitals. The (200) of study sample distribute Figure 1: Study sample body mass index
With respect to study sample BMI, the mean BMI Table 2: Mean and standard deviation of body
is 26.7 ± 4.0; less than a half are overweight (n= 94; image items
47.0%), followed by those who are within normal limit
List Items Mean (SD)
(n= 63; 31.5%), those who are obese class I (n= 36;
1. I respect my body. 3.65 ± 1.36
18.0%), those who are obese class II (n= 4; 2.0%), and
those who are underweight (n= 3; 1.5%). 2. I feel good about my body. 3.56 ± 1.32
3. I feel that my body has at least
3.70 ± 1.14
Table 1: Women’s Reproductive Profile (N = 200) some good qualities.
4. I take a positive attitude towards
Variables Frequency Percent 3.77 ± 1.18
my body.
Age on marriage: Mean (SD): 19.1 ± 0.6
5. I am attentive to my body’s
14-20 111 55.5 4.26 ± 1.08
needs.
21-27 75 37.5 6. I feel love for my body. 3.59 ± 1.35
28-34 10 5.0 7. I appreciate the different and
35-42 4 2.0 3.61 ± 1.20
unique characteristics of my body.
Abortion (n = 44): Mean (SD): 1.22 ± 4.1 8. My behavior reveals my positive
1 37 84.1 attitude toward my body; for
3.93 ± 1.24
2 5 11.3 example, I hold my head high
and smile.
3 1 2.3
9. I am comfortable in my body. 3.52 ± 1.29
4 1 2.3
10. I feel like I am beautiful even if I
Child’s weight on delivery (Gram): Mean (SD):
am different from media images
2424.4 ± 612.7 2.80 ± 1.32
of attractive people (e.g., models,
< 2000 2 1.00 actresses/actors).
2000-2.500 141 70.5
2.550-3.000 38 19.0 The highest scores for body appreciation are for the
3.050-33.500 11 5.5 items “My behavior reveals my positive attitude toward
my body; for example, I hold my head high and smile”,
> 3.500 8 4.0
“I take a positive attitude towards my body”, “I feel that
The mean of women’s age on marriage is 19.1 ± 0.6; my body has at least some good qualities”, “I respect my
more than a half reported that they get married between body” (Mean [SD] = 3.93 ± 1.24; 3.77 ± 1.18; 3.70 ±
14-20-years-old (n= 111; 55.5%), followed by those who 1.14; 3.65 ± 1.36) respectively.
get married between 21-27-years-old (n= 75; 37.5%),
those who get married between 28-34-years-old (n= 10;
5.0%0, and those who get married between 35-42-years-
old (n= 4; 2.0%).
Concerning the number of abortions, the mean

of number of abortions is 1.22 ± 4.1; the majority of
women who experienced abortion have one abortion (n=
37; 84.1%), followed by those who have two abortions
(n= 5; 11.3%), and those who have each of three and
four abortions (n= 1; 2.3%) for each of them.
Figure 2: Study sample distribution according to
Concerning child’s weight on delivery, the mean body image appreciation
weight was 2424.4 ± 612.7 gram; most of children weigh
between 2.000-2.500 gram (n= 141; 70.5%), followed More than a half perceive themselves as having;
by those who weigh 2.550=3.000 gram (n= 38; 19.0%), from their point of view, good body image (n= 111;
those who weigh 3.050-3.500 gram (n= 11; 5.5%), those 55.5%), followed by those whose body image as average
who weigh above 3.500 gram (n= 8; 4.0%), and those (n= 64; 32.0%), and those whose body image as poor
who weigh less than 2.000 gram (n= 2; 1.0%). (n= 25; 12.5%).
Table 3: Difference in body image among certain variable
Variable Sum of Squares df Mean Square F Sig.

Age groups
Between Groups 93.581 3 31.194 .285 .836
Within Groups 21447.294 196 109.425
Total 21540.875 199
Level of education
Between Groups 1228.534 6 204.756 1.946 .075
Within Groups 20312.341 193 105.245
Total 21540.875 199
Women’s occupation
Between Groups 306.071 2 153.036 1.420 .244
Within Groups 21234.804 197 107.791
Total 21540.875 199
Family’s monthly income
Between Groups 337.818 5 67.564 .618 .686
Within Groups 21203.057 194 109.294
Total 21540.875 199
BMI
Between Groups 626.162 4 156.541 1.460 .216
Within Groups 20914.713 195 107.255
Total 21540.875 199
There is no statistically significant difference in women’s body image among the groups of age, level of education,
women’s occupation, family’s monthly income, and BMI.
Table 4: Association between women’s age, BMI, age on menarche, abortion and body image
Unstandardized Coefficients Standardized Coefficients

t Sig.
B Std. Error Beta
Age .322 .602 .231 .535 .596
BMI -.093- .299 -.051- -.310- .758
Age on marriage -.067- .685 -.038- -.099- .922
Abortion -2.526- 3.250 -.186- -.777- .442
There is no association between women’s age, BMI, age on menarche, abortion and their body image.
Discussion those whose body image as average, and those whose

body image as poor.
The highest scores for body appreciation are for the
items “My behavior reveals my positive attitude toward The result shows that the higher body appreciation
my body; for example, I hold my head high and smile”, scale and the study sample satisfied in their body image.
“I take a positive attitude towards my body”, “I feel that
my body has at least some good qualities”, “I respect my There is no statistically significant difference in
body” respectively. women’s body image among the groups of age, level
of education, women’s occupation, family’s monthly
More than a half perceive themselves as having;
from their point of view, good body image, followed by income, and BMI. These findings indicate that these
women, regardless of their age, level of education, 3.

Brown A. Maternal trait personality and
women’s occupation, family’s monthly income, and BMI breastfeeding duration: the importance of
have almost invariant perception of body appreciation. confidence and social support. Journal of Advanced
Nursing (John Wiley & Sons, Inc) [Internet]. 2014
Conclusions Mar [cited 2019 May 22];70(3):587–98.
Women perceive themselves as having form their 4. Tylka TL, & Wood-Barcalow NL. The Body
point of view good body image, however body image Appreciation Scale-2: Item refinement and
has no influence on women’s breastfeeding self-efficacy. psychometric evaluation. Body Image, 2015,
12, 53–67. Available from: https://ezproxy.okcu.
edu:4744/10.1016/j.bodyim.2014.09.006
Recommendations
5. Shloim N, Rudolf M, Feltbowe, R, & Hetherington
There is a need to raising women’s awareness about M. Adjusting to mother-hood. The importance of
the importance of health, well-being, and function BMI in predicting maternal well-being, eating
of the body. This can help in improving body image behavior and feeding practice within a cross
postnatally through prenatal health centers. Also, support cultural setting. Appetite, 2014, 81, 261–268.
new mothers, family, peer, and health professional,
by focusing at body image women’s needs and de- 6.
Rodgers RF, O’Flynn JL, Bourdeau A,
Zimmerman E. A biopsychosocial model of
stigmatizing weight issues through sport classes during
body image, disordered eating, and breastfeeding
postnatal period.
among postpartum women. Appetite [Internet].
2018 Jul [cited 2019 May 22]; 126:163–
Acknowledgement
7. Skouteris H.: Body image issues in obstetrics
I’d like to thank my husband for his continuous, and gynecology. In Body image: A handbook of
incessant encouragement and support in accomplishing science, practice, and prevention. 2nd edition.
this study. Edited by Cash T, Smolak L. New York: Guilford
Press; 2011: 342–349.
Conflict of Interest: The researchers report no conflict
of interest. 8. Fuller-Tyszkiewicz M, Skouteris H, Watson BE,
Hill B. Body dissatisfaction during pregnancy:
Source of Funding: This study did not receive any A systematic review of cross-sectional and
funding from any agency. prospective correlates. Journal of Health
Ethical Clearance: A permission to conduct this study Psychology [Internet]. 2013 Nov [cited 2019 May
was obtained from the ethical committee in the College 24];18(11):1411–21.
of Nursing, University of Baghdad. 9. Rallis S, Skouteris H, Wertheim EH, Paxton
SJ. Predictors of body image during the first
References year postpartum: A prospective study. Women
& Health [Internet]. 2007 Jan [cited 2019 May
1. Bergbom I, Modh C, Lundgren I, Lindwall L.
24];45(1):87–104.
First-time pregnant women’s experiences of their
body in early pregnancy. Scandinavian Journal of 10. Dennis CE. Identifying predictors of breastfeeding
Caring Sciences [Internet]. 2017 Sep [cited 2019 self-efficacy in the immediate postpartum period.
May 22];31(3):579–86. Research in Nursing & Health [Internet]. 2006
Aug [cited 2019 May 22];29(4):256–68.
2. Fox P, Yamaguchi C. Body image change in
pregnancy: A comparison of normal weight 11. Kingston D, Dennis C, Sword W. Exploring
and overweight primigravidas. Birth: Issues in breast-feeding self-efficacy. Journal of Perinatal
Perinatal Care [Internet]. 1997 Mar [cited 2019 & Neonatal Nursing [Internet]. 2007 Jul [cited
May 22];24(1):35–40. 2019 May 22];21(3):207–15.
12. Hodgkinson EL, Smith DM, Wittkowski A. 14. Lovering ME, Rodgers RF, George JE, Franko
Women’s experiences of their pregnancy and DL. Exploring the tripartite influence model of
postpartum body image: A systematic review and body dissatisfaction in postpartum women. Body
meta-synthesis. BMC Pregnancy and Childbirth Image [Internet]. 2018 Mar [cited 2019 March
[Internet]. 2014 Sep 23 [cited 2019 May 24]; 24:44–54.
24];14:330.
15. Rodgers R, Paxton S, McLean S. A biopsychosocial
13. Franko DL, Walton BE. Pregnancy and eating model of body image concerns and disordered
disorders: A review and clinical implications. eating in early adolescent girls. Journal of Youth
International Journal of Eating Disorders & Adolescence [Internet]. 2014 May [cited 2019
[Internet]. 1993 Jan [cited 2019 March May 24];43(5):814–23.
24];13(1):41–7.
Role of Adropin in Women with Polycystic Ovary Syndrome
Rana Ali Hamdi1, Hanan Naama Abas2, Fatin Abdul Aziz Alsaeed2
1
Department of Biochemistry, Collage of Medicine, University of Baghdad; 2Infertility Center, Baghdad
Teaching Hospital
Abstract
Objective: Evaluate serum adropin levels in women with polycystic ovary syndrome (PCOS) and compare
their levels with BMI matched healthy controls. Also investigate the relation between serum adropin levels
with insulin resistance and lipid profile.
Materials and Method: A case-control study included 78 women from 21 to 40 years of age. Women
were divided into two groups: group (1) included 39 women with PCOS and group (2) included 39 healthy
women (as controls). Each serum sample was analyzed for assessing adropin, fasting glucose, fasting insulin,
HOMA-IR, and lipid profile.
Results: Mean serum adropin levels was significantly lower in women with PCOS as compared to healthy
controls (P=0.001). Additionally, significant negative correlations were found between serum adropin levels
and serum triglyceride (r= - 0.418, P=0.04), total cholesterol (r= -0.842, P=0.0001) and HOMA-IR (r=
-0.436, P=0.03) in patients group.
Conclusion: Low serum adropin may participate in the metabolic defects seen in polycystic ovary syndrome
such as dyslipidemia and insulin resistance that in turn associated with other health problems such as
hypertension, diabetes mellitus, and cardiovascular disease.
Keywords: Polycystic ovary syndrome, adropin, insulin resistance, lipid profile, insulin
Introduction Adropin is a peptide hormone 5 which has a role

in energy homeostasis and maintain the metabolism
Polycystic ovary syndrome (PCOS) is a common of glucose and fatty acid 6, 7. Previous study found that
hormonal disorder in women of reproductive adropin has a role in controlling the expression of hepatic
age characterized by irregular menstrual periods, lipogenic genes and the PPARγ receptor (peroxisome
hyperandrogenism, and polycystic ovaries defined proliferator-activated receptor gamma), which have
by ultrasound 1. Insulin resistance (IR) and metabolic important role in lipogenesis 7. Furthermore, an animal
syndrome are more prevalent in PCOS women 1. study showed that adropin affects angiogenesis, raised
Dyslipidemia is a common metabolic defects in women blood flow and capillary density, and has important role
with this syndrome which include decreased serum high in endothelial cells protection 8. According to above
density lipoprotein-cholesterol (HDL-C) and elevated information the present study aimed to evaluate serum
serum cholesterol, triglycerides (TG), low density adropin levels in women with polycystic ovary syndrome
lipoprotein-cholesterol (LDL-C), and very low- density and compare their levels with body mass index matched
lipoprotein cholesterol (VLDL-C) 2. Thus, PCOS women healthy controls. Also investigate the relation between
more prone to cardiovascular disease, hypertension, serum adropin levels with insulin resistance and lipid
diabetes mellitus type 2, and obesity 3, 4. profile in women with this syndrome.
Method
Rana Ali Hamdi
Department of Biochemistry, Collage of Medicine, This case-control study included 78 women from 21
University of Baghdad, Baghdad, Iraq to 40 years of age. Women attended to Infertility Center
Email: rana.chemist2006@yahoo.com in Baghdad Teaching Hospital during the period from
June 2017 to October 2017. Informed consent was taken Likewise, homeostasis model assessment of insulin
from each women. The present study was approved resistance (HOMA-IR) calculates the IR according to
by the Ethical Committee of the College of Medicine/ following formula:
University of Baghdad. mg
HOMA − IR= Fasting plasma glucose ×
Women were divided into two groups: group (1) Fasting plasma insulin (μU/mL)/405 dL
included 39 women with PCOS and group (2) included
39 healthy women (as controls). A HOMA-IR value of 2.5 or above were considered
as insulin resistant 10.
Diagnosis of PCOS were done according to
Rotterdam criteria 9 when two of three criteria are present, Furthermore, body mass index (BMI) was calculated
these involve oligoovulation and/or anovulation, clinical as weight in kilograms per height (square meter) [weight/
and/or biochemical hyperandrogenism and polycystic (height)2], women were considered as normal weight at
ovaries as shown by ultrasound. BMI (18.5-24.9 kg/m2), overweight women at BMI (25-
29.9 kg/m2) and obese women at BMI ≥30kg/m2
Exclusion criteria included women with
hyperprolactinemia, Cushing’s syndrome, congenital Statistical Analysis: Data were analyzed using computer
adrenal hyperplasia, androgen secreting tumors, and facility of SPSS-20 (Statistical Package for Social Science
thyroid diseases. – version 20). The results were expressed as numbers,
range, and mean ± SD (standard deviation). Significance
Serum investigations involved adropin which was of difference of quantitative data was assessed using
measured by enzyme linked immunosorbent assay Student-t test. Also, Pearson correlation was calculated
(ELISA) (Kamiya Biomedical Company), fasting for the correlation between two quantitative variables
serum insulin was measured by ELISA kit (Monobind with its t-test for testing the significance of correlation.
Company), and fasting serum glucose was measured Statistical significance was considered whenever the P
by spectrophotometer using kit provided by (Human value was equal or less than 0.05.
Company). In addition, lipid profile including total
cholesterol, triglycerides, HDL-C were measured Results
by spectrophotometer using kit supplied by (Human
Company) while LDL-C and VLDL-C were measured Patients and controls were matching for age and BMI.
by following equations: In addition, significantly higher fasting serum glucose,
insulin, HOMA-IR, total cholesterol, TG, LDL-C, and
LDL − c = Total Cholesterol − (VLDL + HDL) VLDL-C levels were found in patient’s compared to
controls. However, serum adropin and HDL-C levels
TG were significantly lower in patients compared to controls
VLDL =
5 as shown in Table 1.
Table 1: Mean value of fasting serum glucose, insulin, HOMA-IR, lipid profile and adropin for patients and
controls
Patients (n = 39) Controls (n = 39)

Parameters P value
Mean ± SD Range Mean ± SD Range
Age 30.2 ± 5.45 (21-40) 31.1 ± 5.03 (22-40) .45 (NS)
BMI (kg/m2) 28.33 ± 4.3 (22.68-38.46) 27.52 ± 3.4 (22.77-33.83) .36 (NS)
Serum total cholesterol (mg∕dl) 188.49 ± 2.72 (178.8-192.3) 152.91 ± 4.16 (143.6-158.1) .001(S)
Serum TG (mg∕dl) 140.44 ± 1.25 (138.8-143.3) 101.14 ± 3.62 (95.6-112.3) .001 (S)
Serum HDL-C (mg∕dl) 42.87 ± 1.219 (40.2-44.3) 61.04 ± 1.7 (58.6-64.6) .001 (S)
Serum LDL-C(mg∕dl) 117.53 ± 3.05 (107.14-122.9) 71.64 ± 4.74 (61.28-77.58) .001 (S)
Serum VLDL-C (mg∕dl) 28.08 ± 0.25 (27.76-28.66) 20.22 ± 0.72 (19.12-22.46) .001 (S)
Fasting serum Insulin (μU/m) 13.47 ± 1.33 (10.66-15.6) 5.81 ± 0.8 (4.1-8) .001 (S)
Conted…
Fasting serum glucose (mg∕dl) 90.69 ± 3.24 (86-97) 86.02 ± 3.91 (80-94) .001 (S)
HOMA-IR 3.01 ± 0.32 (2.5-3.6) 1.25 ± 0.22 (0.83-2.04) .001 (S)
Serum adropin (pg∕ml) 9.97 ± 1.81 (7.02-12.2) 15.85 ± 1.64 (13.06-18.8) .001 (S)
In addition, significant negative correlations were found between serum adropin levels and serum triglyceride
(r= -0.418, P=0.04), total cholesterol (r= -0.842, P=0.0001) and HOMA-IR (r= -0.436, P=0.03) in patients group as
illustrated in Figure (1-1), Figure (1-2), and Figure (1- 3), respectively.
Figure 1: Significant negative correlation between serum adropin and serum triglyceride in patients group
(r= -0.418, P=0.04).
Figure 2: Significant negative correlation between serum adropin and serum total cholesterol in patients
group (r= -0.842, P=0.0001).
Figure 3: Significant negative correlation between serum adropin and serum HOMA-IR in patients group
(r= -0.436, P=0.03).
Discussion lipogenesis, reduced clearance, decreased fatty acids

oxidation, and raised releasing of VLDL by the liver,
In the present study, higher levels of fasting leading to increased circulated TGs concentration.
serum glucose, insulin, and HOMA-IR were found in Additionally, IR may be involve in catabolism of HDL-C
women with PCOS as compared with BMI matched and formation of LDL-C particles 24.
healthy controls. This results are in agreement with
previous studies 11, 12. Hyperinsulinemia, peripheral IR,
Conclusion
and impaired glucose tolerance are major metabolic
disturbance seen in PCOS 13. Hyperinsulinemia found in Low serum adropin may participate in the metabolic
PCOS may cause by functional problems in the insulin defects seen in polycystic ovary syndrome such as
14
. Insulin receptors have been expressed in ovaries 15. dyslipidemia and insulin resistance that in turn associated
Thus, insulin has the ability for enhancing the synthesis with other health problems such as hypertension,
of sex steroid hormone and ovarian growth, leading to diabetes mellitus, and cardiovascular disease.
increased intra ovarian androgens and disrupting the
normal folliculogenesis. The resultant, development of Conflict of Interest: None
numerous ovarian cysts and ovarian enlargement 14.
Ethical Clearance: Informed written consent was
This study also revealed that higher serum levels obtained from all the participants in the study, and the
of total cholesterol, TG, LDL-C, and VLDL-C, with study and all its procedure were done in accordance with
lower levels of HDL-C in women with PCOS compared the Helsinki Declaration of 1975, as revised in 2000.
to BMI matched healthy controls similar to the results The study was approved by the College of Medicine/
of other studies 16, 17. It was shown that dyslipidemia is University of Baghdad.
common in PCOS independent to BMI. Insulin resistance
has important role by enhancing lipolysis and altered Source of Funding: The work were supported by
expression of lipoprotein lipase and hepatic lipase which authors only
are important enzymes in lipid metabolism 18.
References
In addition, our findings showed that serum adropin
levels were significantly lower in women with PCOS as 1. Sirmans SM, Pate KA. Epidemiology, diagnosis,
compared with those BMI- matched healthy controls. and management of polycystic ovary syndrome.
This result agrees with previous studies done by Yildirim Clinical epidemiology. 2013;6:1-13.10.2147/clep.
et al 19 and Sen et al 20 who showed low levels of serum s37559
adropin associated with metabolic feature of PCOS 19, 20. 2. Lath R, Shendye R, Jibhkate A. Insulin resistance
and lipid profile in polycystic ovary syndrome.
Moreover, our study found significant negative
Asian Journal of Biomedical and Pharmaceutical
correlations between serum adropin levels and serum
Sciences. 2015;5(47):30
TG, total cholesterol, and HOMA-IR in women with
PCOS which consist with previous report done by 3. Conway G, Dewailly D, Diamanti-Kandarakis
Yildirim et al 19. E, Escobar-Morreale HF, Franks S, Gambineri
A, et al. The polycystic ovary syndrome: a
In this regard, Butler et al noticed that decreased position statement from the European Society
adropin level regarded as risk factor for IR and other of Endocrinology. European Journal of
characteristics of the metabolic syndrome, such as Endocrinology. 2014;171(4):P1-P29
dyslipidemia 21. Moreover, study by Kuhla et al proposed
that increased expression of adropin gene lead to reduce 4. Alizzi FJ, Abbas WAJA, Fawzi HA. Assessment
lipogenesis in an animal’s study 22. of the role of cholecystokinin in hyperemesis
gravidarum and correlation with its severity. J
On the other hand, prior research found that Pharm Sci & Res. 2018;10(2):272-5
lipid abnormalities in PCOS were associated with IR
5. Marczuk N, Cecerska-Heryc E, Jesionowska
independent of obesity 23. Insulin resistance found in
A, Dolegowska B. Adropin - physiological
PCOS leads to raised TGs average that caused by raised
and pathophysiological role. Postepy higieny 14. Kumar AN, Naidu JN, Satyanarayana U, Anitha M,
i medycyny doswiadczalnej (Online). Ramalingam K. Association of insulin resistance
2016;70(0):981-8.10.5604/17322693.1220082 and serum 25-OH vitamin-D in indian women
with polycystic ovary syndrome. International
6. Gao S, McMillan RP, Zhu Q, Lopaschuk GD,
Journal of Clinical Biochemistry and Research.
Hulver MW, Butler AA. Therapeutic effects
2015;2(1):22-6
of adropin on glucose tolerance and substrate
utilization in diet-induced obese mice with insulin 15. Wild RA, Rizzo M, Clifton S, Carmina E.
resistance. Molecular metabolism. 2015;4(4):310- Lipid levels in polycystic ovary syndrome:
24.10.1016/j.molmet.2015.01.005 systematic review and meta-analysis. Fertility
and sterility. 2011;95(3):1073-9.e1-11.10.1016/j.
7. Kumar KG, Trevaskis JL, Lam DD, Sutton GM,
fertnstert.2010.12.027
Koza RA, Chouljenko VN, et al. Identification
of adropin as a secreted factor linking dietary 16. Valkenburg O, Steegers-Theunissen RP, Smedts
macronutrient intake with energy homeostasis HP, Dallinga-Thie GM, Fauser BC, Westerveld
and lipid metabolism. Cell Metab. 2008;8(6):468- EH, et al. A more atherogenic serum lipoprotein
81.10.1016/j.cmet.2008.10.011 profile is present in women with polycystic ovary
syndrome: a case-control study. The Journal
8. Lovren F, Pan Y, Quan A, Singh KK, Shukla
of clinical endocrinology and metabolism.
PC, Gupta M, et al. Adropin is a novel
2008;93(2):470-6.10.1210/jc.2007-1756
regulator of endothelial function. Circulation.
2010;122(11 Suppl):S185-92.10.1161/ 17. Bickerton AS, Clark N, Meeking D, Shaw KM,
circulationaha.109.931782 Crook M, Lumb P, et al. Cardiovascular risk in
women with polycystic ovarian syndrome (PCOS).
9. Revised 2003 consensus on diagnostic criteria and
Journal of clinical pathology. 2005;58(2):151-
long-term health risks related to polycystic ovary
4.10.1136/jcp.2003.015271
syndrome. Fertility and sterility. 2004;81(1):19-25
18. Teede H, Deeks A, Moran L. Polycystic ovary
10.
Aydin E, Ozkokeli M. Does homeostasis
syndrome: a complex condition with psychological,
model assessment of insulin resistance have a
reproductive and metabolic manifestations that
predictive value for post-coronary artery bypass
impacts on health across the lifespan. BMC
grafting surgery outcomes? Revista brasileira
medicine. 2010;8:41.10.1186/1741-7015-8-41
de cirurgia cardiovascular : orgao oficial da
Sociedade Brasileira de Cirurgia Cardiovascular. 19. Yildirim B, Celik O, Aydin S. Adropin: a
2014;29(3):360-6 key component and potential gatekeeper of
metabolic disturbances in policystic ovarian
11.
Hamdi RA, Abdul-Qahar ZH, Kadhum EJ,
syndrome. Clinical and experimental obstetrics &
Alsaeed FA. Assessment of Serum Vitamin
gynecology. 2014;41(3):310-2
D Levels in Women with Polycystic Ovary
Syndrome. Journal of the Faculty of Medicine 20. Sen H, Erbag G, Binnetoglu E, Eroglu M, Turkon
Baghdad. 2018;60(2):93-7 H, Tekin SZ, et al. Adropin levels in polycystic
ovary syndrome patients. J Clin Anal Med.
12. Subashree I, Valvekar UR, Prasad G. Study
2017;8(1):23-6.10.4328/JCAM.4508
of serum calcium and vitamin D levels with
hormonal profile along with biochemical profile 21. Butler AA, Tam CS, Stanhope KL, Wolfe BM,
in women with polycystic ovary syndrome. 2017. Ali MR, O’Keeffe M, et al. Low circulating
2017;6(9):6.10.18203/2320-1770.ijrcog20174065 adropin concentrations with obesity and aging
correlate with risk factors for metabolic disease
13. Naidu JN, Swapna GN, Kumar AN, Krishnamma
and increase after gastric bypass surgery in
M, Anitha M. Importance of elevated insulin
humans. The Journal of clinical endocrinology
resistance, dyslipidemia and status of antioxidant
and metabolism. 2012;97(10):3783-91.10.1210/
vitamins in polycystic ovary disease. Free
jc.2012-2194
Radicals and Antioxidants. 2013;3(1):17-9
22. Kuhla A, Hahn S, Butschkau A, Lange S, Wree A, resistance in type 2 diabetes mellitus. The Indian
Vollmar B. Lifelong caloric restriction reprograms journal of medical research. 2010;131:641-8
hepatic fat metabolism in mice. The journals of
24. Saxena P, Prakash A, Nigam A. Efficacy of 2-hour
gerontology Series A, Biological sciences and
post glucose insulin levels in predicting insulin
medical sciences. 2014;69(8):915-22.10.1093/
resistance in polycystic ovarian syndrome with
gerona/glt160
infertility. J Hum Reprod Sci. 2011;4(1):20-
23. Tangvarasittichai S, Poonsub P, Tangvarasittichai O. 2.10.4103/0974-1208.82355
Association of serum lipoprotein ratios with insulin
The Alcoholic Extract of Carrot (Daucus carota L.) Seeds as

Antioxidant in Male Albino Mice treated with H2O2
Roaa M. Al-Saadi1, Sabah A.R.Al-Obaidi2, Waleed H.Yousif3

1
The National Center of Hematology. Al-mustansiriyah University. IRAQ; 2Department of Biology, College of
Sciences for Women, University of Baghdad; 3Biotechnology Applications College, Al-Nahrain University
Abstract
This study was designed to research activity Daucus carota seeds alcoholic extract on the fertility of male
albino mice that treated with H2O2 by changing the body weight, testis, secondary sex organ weights and
sperm parameter and hormonal changes (Testosterone, FSH, and LH). This experiment used thirty-two
(8-10) weeks’ old albino male mice. These mice were separated into four sets; the first negative group
was given physiological saline, the second group was given the alcoholic extract (400mg\kg), the third
group was given H2O2 (0.05%) in the drinking water, the fourth group was given both H2O2 (0.05%) and
the alcoholic extract (400mg\kg) during (35) days. The results showed :The third group (H2O2) showed
significant (P<0.05) decrease the weight of bodies, and significant (P<0.05) increase in testes, prostate
and seminal vesicle weights by comparing with control and second group. The result shows a significant
decrease in ratios of motility, live sperms and sperm concentration. Also, the concentration of Testosterone,
FSH and LH show a significant reduction in the first group when equated with control.While fourth group
(H2O2 (0.05%) and the alcoholic extract (400mg\kg) gave significant increase in weights of body and testes,
prostate, seminal vesicle weight; this group gave results nearly that in control group result in all reproductive
parameters such as hormones concentration, sperms motility and concentration so that the alcoholic extract
could provide protection for oxidative stress of H2O2.
Keywords: Carrot seeds, sperm parameters, sex hormones, Hydrogen peroxide.
Introduction It has been demonstrated that the extract carrot seeds

and their fatty acids can identify the estrogen cycle
Carrot generally belongs to Umbelliferae, and of the adult female mice and decrease an ovary mass
it mostly limited to the moderate regions of Asia, substantially 6. They likewise originate when they used
Europe and Africa 1, 2. Distinctive parts of this plant the extract of carrot seed (CSE) that lead to the reserve
are utilized as a part of the treatment of a wide range of δ 5,3-β-hydroxysteroid dehydrogenase and glucose-
of illnesses containing kidney failure 3 asthma, dropsy, 6-phosphate dehydrogenase, both necessary primary
infection, leprosy, worm troubles, etc. In perspective enzymes complicated in ovarian steroidogenesis,
of various physiological and pharmacological activity in ovaries of mice. In an additional report, it was
of carrot extract including antibacterial, antifungal, significantly diminished after the desperate nourishing
anthelmintic 4, and, hepatoprotective 5. Pharmacological of carrots by utilizing a sequestered rabbit ovarian, and
impacts demonstrated that carrot exhibited anti-fertility it was formed from human chorionic gonadotropin-
properties in female as a contraceptive 6 the extracted induced progesterone secretions and progesterone11.
root of carrot has the activity to be hypolipidemic effect
7
, and anticancer 8. Carrot has experienced expansive
phytochemical activity by containing active ingredients
that have been isolated. These include volatile oils, Plant Collection: The carrot seeds utilized in the
steroids, triterpenes 9,10. Recently, in reproduction, the extraction were processed by drying the plant rosette and
pharmacological researches show that Daucus carota collect the seed only, washing the seed and drying in the
seeds reveal anti-fertility possessions in females 11. room temperature.
Preparation of the Alcoholic Extract: The carrot seeds Results

(100 g) were macerated ethanol (95.5%) for 6-8 hours.
The method was repeated thrice. Later the filtration, The result in tables (2), (3) refers to the effects of
and the deposit concentrated by vacuum in a rotational carrot seeds alcoholic extract (ACSE) administration
evaporator 12 yielding a 24.31% at 50°C ethanolic extract on body weight show a significant increase in the body
of carrot seeds. weight and in the (testis, prostate, seminal vesicle)
weight when related to the control. Administration of
Experimental Animals: Forty adult male albino mice H2O2 (0.05%) a negative reactive oxygen producing
weighing (30-36) g were acquired from Biotechnology aminoglycoside (15), affected a reduction in the body
Research Center, and treated mice were rendered weight and (testis, prostate, seminal vesicle) weight
with food and water ad libitum 13. Male mice were significantly at what time equated to the control. When
indiscriminately separated into four groupings in table 1, this running of H2O2 (0.05%) was administrated together
containing eight mice in each group. Which incorporate; with (ACSE 400 mg/kg) the body weight and (testis,
first negative group was given physiological saline, the prostate, seminal vesicle) weight was significantly
second group was given the alcoholic extract (400mg\ (p<0.05) elevated from (292.65 ± 14.17, 320.12 ± 50.92,
kg), the third group was given H2O2 (0.05%) in the 367.26 ± 18.61) into (329.68 ± 17.16, 267.16 ± 20.90,
drinking water, the fourth group was given both H2O2 406.02 ± 26.35).
(0.05%) and the alcoholic extract (400mg\kg) during
(35) days In each group animals were killed by vertebrate Table 2: The differences between Body weight before
disengagement. Testes fixed with Bouin fluid (BDH Inc, and after treatments
Toronto, Canada). Then obtained Spermatozoa from the
second ends of epididymides by crumbling in 500 µl Mean ± SE (gm)
TCM199, and kept at 37°C in incubatore5% CO2 and Body Body
the percentages of motility and dead and abnormalities Treatment weight weight
of spermatozoa were measured. before before
treatment treatment
Control 24.12 ± 0.78 26.12 ± 0.74
Table 1: Summary of the study design
Alcoholic extract
27.62 ± 0.94 29.75 ± 0.94
Group Treatment (400mg\kg)
The first group H2O2 (0.05%) in the
Physiological saline 27.00 ± 1.18 24.75 ± 1.13
(control) drinking water
The second group Alcoholic extract (400mg\kg) was given both H2O2
The third group H2O2 (0.05%) in the drinking water (0.05%) and the alcoholic 26.75 ± 0.75 28.37 ± 0.78
extract (400mg\kg)
was given both H2O2 (0.05%) and
The fourth group LSD value 2.773* 2.718*
the alcoholic extract (400mg\kg)
* refer to significant differences between treatment
Microscopical Examination: Spermatozoa were (P<0.05).
surveyed by WHO laboratory manual for capability,
motility rate of life to dead sperm and abnormal sperm 13. Table 4: the properties of extract administration on
motility, percentage of live sperms significant increase
Statistical analysis: The analysis was achieved to relate (p<0.05) in sperm motility, percentage of live sperms
the different groups by using ANOVA-test. That was and decrease in abnormal sperms compared to control,
determined at P<0.05 14. while there was significant reduction (p<0.05) in sperm
Hormonal Analysis: The intracardiac Blood collect motility, percentage of surviving sperms in the group
from the animals was centrifuged at 2.000 rpm to isolated receiving Hydrogen Peroxide H2O2 (0.05%) only. When
serum for measuring FSH, LH, Testosterone hormones this administration of H2O2 (0.05%) was administrated
15. The quantitative determination of hormones was together with (ACSE 400 mg/kg) that gave significantly
done by using enzyme-linked immunosorbent assay (p<0.05) elevated on sperm motility, percentage of live
(ELISA). sperms and significant (p<0.05) decrease in abnormal
sperms compared to the control group. It is indicating the was characterized as appetizing, and it was included
protective effect of (ACSE) against Hydrogen Peroxide- high protein and carbohydrate content that agree with
induced necrosis. The motility value directs the efficacy 16
, in addition the increase in (testis, prostate, seminal
of the extract in the repairs of motility of sperm in mice vesicle) weight belong to the positive relation between
as the expression of Hydrogen Peroxide running. the increase in body weight and the reproductive organs
17,
as well as this increase belong to the increase in the
Discussion Testosterone which refer to the rise in the Testosterone
levels cause increase in the reproductive organs weights
The increase of body weight belongs to the effect and size 18 while the decrease occurred by using H2O2
of (ACSE) by increasing the activity in some hormones agree with 19 that observe the rats treated with alloxan
that essential to raise the rate of metabolism include (the same effect of H2O2 as oxidative stress) cause
growth hormone and thyroid hormone, that increase absence of Insulin which effects the (Epinephrine and
the appetite, facilitate the digestion, as well as (ACSE) Glucagon)hormones were stimulated lipolysis
Table 3: The percentage of the Testis, Prostate, seminal vesicle weights in treatments and control
Mean ± SE
Treatment
Testis wt. Prostate wt. Seminal vesicle wt.
Control 205.15 ± 4.22 123.49 ± 3.74 205.15 ± 4.22
Alcoholic extract (400mg\kg) 384.41 ± 16.69 293.55 ± 8.49 472.78 ± 13.79
H2O2 (0.05%) in the drinking water 292.65 ± 14.17 320.12 ± 50.92 367.26 ± 18.61
was given both H2O2 (0.05%) and the alcoholic extract
329.68 ± 17.16 267.16 ± 20.90 406.02 ± 26.35
(400mg\kg)
LSD Value 38.138 * 270.90 * 54.701 *
* refer to significant differences between treatment (P<0.05)
Table 4: Percentage of sperms motility, live sperms and sperms abnormalities in treatments and control group
Mean ± SE
Treatment
Motility % Live sperms% Abnormal Sperms %
Control 68.75 ± 1.25 77.12 ± 1.18 13.87 ± 0.44
was given both H2O2 (0.05%) and the alcoholic extract
76.87 ± 1.87 77.27 ± 1.68 14.25 ± 0.59
(400mg\kg)
LSD Value 4.665 * 3.198 * 1.352 *
* refer to significant differences between treatment (P<0.05).
In addition the deficiency of Insulin in the blood (ACSE) belong to the same reasons such as hormonal
cause cells starvation and decrease in calories that lead effect that share in the regulation of male reproductive
to decrease in body weight 20 the deficiency of glucose system, as well as the extract, contain several materials
concentration in the cells exhaustion the energy causes like carotenoids 23, flavonoids, vitamins (A,B, C, D, E)
catabolism so that cause a decrease in body weight and and As carrot seeds are rich of antioxidants 10, 23, that
make changes in reproductive organs (testis, prostate, were pr otected the plasma membrane of sperm against
seminal vesicle) 20. The counting of sperm is a vital the oxidative
consideration for the evaluation of the properties of
Stress comes from the presence of free radicals in
chemicals on spermatogenesis 21, 22. The cause of increase
the seminal fluid, while the decrease the motility and
the motility and live sperms in the treated group with
live sperms and
Table 5: percentage of Serum (Testosterone, FSH and LH) Concentration in control and treatments
Mean ± SE
Treatment
Testosterone LH FSH
Control 1.43 ± 0.12 0.487 ± 0.037 0.512 ± 0.045
was given both H2O2 (0.05%) and the alcoholic extract (400mg\kg) 1.70 ± 0.16 0.620 ± 0.041 0.671 ± 0.028
LSD Value 0.474 * 0.133 * 0.160 *
* refer to significant diffirences between treatment (P<0.05).
Increase in abnormal sperms in the group treated Ethical Clearance: Taken from Al-mustansiriyah
with H2O2 belongs to the effect of H2O2 in the cells University, IRAQ committee
which was called oxidative stress that mean the effect of
producing the free radicals generated via metabolism in Source of Funding: Self
the presence of O2 24. The oxidation destruction raised
peroxidation of lipid and caused the modification in
the membrane possessions resulting in germ cell death
at all phases of development, and a reduction in sperm references
counting 25, the using was with H2O2 in the same time 1. Taylor, V.E. ; Brady, L.R. and Robbers, J.E.
give protective activity against H2O2 and give results Pharmacognosy. 3rd ed. Lea and Febiger.
near the normal state when compare with control Philadelphia 1988; P: 175
the extract contain several materials like carotenoids
2. Tian J.K.; Weifu,H. ; Zhang,L. ; Yi, T. A New
23
, flavonoids, vitamins (A, B, C, D, E) and other
Sesquiterpene from The fruit of Daucus carota L.
compounds work as antioxidants 10 these antioxidants
Molecules. 2009; 14: 2862-2867
can release the free radicals, prevent producing them and
make it inactive 26. Hormones elevate in the hormones 3.
Mital, P.R.; Laxman,P.J. ; Rameshvar,K.
(Testosterone, FSH and LH) level during treatment with Protective Effect of Daucus carota Root Extract
(ACSE). This reveals that extract applies its impacts Against Renal Ischemia-Reperfusion Injury in
on the male reproductive system via sex hormones 27. Rats. Pharmacologyonline. 2011; 1 :432-439
Hormones were raised after administering the extracted 4. Tydeman, E. A.; Parker, M. L.; Wickham, M.
representative, the heightening impact of the extract on S. J.; Rich, G. T.; Faulks, R. M.; Gidley, M. J.;
the hormones was very essential in spermatogenesis Fillery-Travis, A.; Waldron, K. W. Effect of
21
and positive effect on the interstitial tissues that carrot (Daucus carota) microstructure on carotene
were containing Sertoli and Leydig cell responsible of bioaccessibility in the upper gastrointestinal tract.
producing the hormone, as well as the extract containing 1. In vitro simulations of carrot digestion. J. Agric.
(choline) 28. Which consider the essential substance to Food Chem. 2010, 58: 10.1021.
produce (Acetylcholine) important in stimulating the
5.
-Bishayee A, Sarkar A, Chatterjee M..
gonads so increase the level of (FSH, LH), whereas
Hepatoprotective activity of carrot (Daucus carota
the extract containing chemical compounds such as L.) against carbon tetrachloride intoxication in
cholesterol, Ascorbic acid was necessary to produce mouse liver. J Ethnopharmacol. 1995; 47:69-74.
Testosterone from (pregnenolone and androstenedione)
29
. The presence of (Zn) in the extract has an active 6. Shweta,G. ; Jinkal,S. ; Hitech, J. ; Chanta,R. Herbal
role in Testosterone production that agrees with 30. Plants Used as Contraceptives. International
This is possible that interstitial cell necrosis crops Journal of Current Pharmaceutical Review and
up from a decrease in this hormone. The decrease the Research. (2011) 2 (1).
hormones (Testosterone, FSH and LH) in the group 7. Mani,V., Parle, M., Ramasamy, K., Majeed,A.A.
treated with H2O2 belong to the oxidative stress of H2O2 Anti-Dementia Potential of Daucus carota Seed
on the spermatogenesis and induction of apoptosis and Extract in Rats. Pharmacology online 2010; 1:
oxidative damage 31. 552-565.
8. Astorg, P. Food carotenoids and cancer prevention: 20.

Burant CF, Davidson NO. GLUT3 glucose
an overview of current research. Trends Food Sci. transporter isoform in rat testis: Localization, effect
Technol. 1997, 8, 406–413. of diabetes mellitus and comparison to human
testis. Am J physiol. 1994; 36: R1488-R1495)
9. Ahmed, A. A. ; Mohktar M.B. ; Mohamed,
E.A.; Ross, Z.E. ; Pare, W.P. Rare trisubstituted 21. Aitken, R.J. and Fisher,H. Reactive Oxygen
sesquiterpenes daucanes from the wild Daucus Species Generation and Human Spermatozoa
carota. Phytochemistry. 2005; 66: 1680-1684. : The balance of Benefit and Risks ; Bioassays.
1994; 16: 259-267.
10. Ozcan, M.M. ; Chalchat, J.C. Chemical Composition
of Carrot Seeds (Daucus carota L.) Cultivation in 22. Aitken, R.J and Romans,S.D. Antioxidant system
Turkey : Characterization of The seed oil. GRASSY and oxidative stress in the testes. Oxid.Med.Cell.
ACEITES. 2007; 58(4) : 359-365. Longev. 2006, 1(1) : 15-24.
11. Majumder PK, Dasgupta S, Mukhopadhaya RK, 23. Acharya UR, Mishra M, Patro J, Panda MK.
Mazumdar UK, Gupta M. Anti-steroidogenic Effect of vitamins C and E on spermatogenesis in
activity of the petroleum ether extract and fraction mice expose to cadmium. Reprod Toxicol. 2008;
5 (fatty acids) of carrot (Daucus carota L.) seeds 25: 84-88
in the mouse ovary. J Ethnopharmacol. 1997; 57:
24. Agarwal,A.; Saleh,R.A. and Bedaiwy,M.A Role of
209-212.
Reactive Oxygen Species in The pathophysiology
12. Hassan M.K. Using of some plant extracts to of Human Reproduction. Fertil. Steril. 2003; 79:
inhibitive toxic effect of anti-cancer drugs in mice, 829-843.
PhD thesis, science college,Babilon University
25. Agarwal,A. Prabakaran,S.and All amaneni,S. What
2002; 22.
An andrologist \ urologist should know about free
13.
Cunningham, G.. Textbook of veterinary radical and why. Urology. 2006; 67 : 2-8.
physiology. 3rd. Ed. W. B. Saunders Company.
26. Yu LL, Zhou KK, Parry J. Antioxidant properties of
The U.S.A. 2002; PP: 324-341.
cold-pressed black caraway, carrot, cranberry, and
14. SAS.. Statistical Analysis System, User’s Guide. hemp seed oils. Food Chem. 2005; 91: 723-729.
Statistical. Version 7th ed. SAS. Inst. Inc. Cary.
27. Miyzake, M. D., Lee, J. W., Kechi, M. D., Shoroa,
N.C. USA.2004;12
M. and Aono, M. D.. Wen-Jing tang, a tradition
15. S. Frances, A. Lida,B. Kathleen, Cameron H. of Chinese herbal medicine increase luteinizing
Fletcher,, GUIDE LABORATORY ANIMALS FOR hormone release in vivo, Am. J., China medvd,
THE CARE AND USE OF Eighth Edition 2010 1985; 3-4. 157.
16. Al- Bekari, A. M., Shah, A. H. and Qureshi, 28. Mani,V. ;Parle, M. ; Ramasamy, K. ; Majeed,A.A.
S.. Effect of Allium sativum on epidydimal Anti-Dementia Potential of Daucus carota Seed
spermatozoa estradiol treatment mice and general Extract in Rats. Pharmacologyonline 2010; 1:
toxicity. J. Ethnopharmacol. 1990, 27 (2): 117-25 552-565.
17. Al-Saadi, Roaa M. “The Aqueous Crude Extract 29. Yousef MI. Protective role of ascorbic acid to
of Carrot Seeds (Daucus carota L.) and its Role enhance reproductive performance of male rabbits
in Fertility of Male Albino Mice.” Iraqi Academic treated with stannous chloride. Toxicology. 2005;
scientific Journal 2013;3(11): 1083-1088. 207: 81-89.
18. Guyton, A.C.. Endocrinology and reproduction. 30. Al-chalabi,S. ;Al-wattar Y.T.. The Relationship
In textbook of medical physiology. Guyton, A. Between Serum Zinc Concentration, Serum
C. (Ed.). W.B. Saunders Company. Philadelphia, Testosterone Concentration and Semen Parameter
U.S.A. 200; 1:836-884. in Infertile Men. Tikrit Journal of Pure Science
2011; 16 (1) .
19. Al- Jaff SJK. Effect of thyme extract alone and
in combination with insulin on some biochemical 31. Reddy PS, Pushpalatha T, Reddy PS. Reduction
parameters in normal and alloxan- induced of spermatogenesis and steroidogenesis in mice
diabetic rats [ Master thesis]. Mosul: University after fentin and fenbutatin administration. Toxicol
of Mosul; 2005; 24 Lett. 2006; 166: 53-59.
The Ethanolic Extract of Ajwa Fruits Inhibits Nephrotoxicity

and Deterioration of Some Blood Biochemical Properties
Induced by Gentamicin in Male Rats
Saher Mahmood Jwad1, Wijdan Kamal Noor2, Bushra Abbas ALzubaidi2

1
Professor, 2Assist.Prof., Biology Department, Faculty of Education for Girls, University of Kufa, Iraq
Abstract
The current study was designed to assess the probable preventive influences of extract of Ajwa fruits on
the renal functional performance and some biochemical parameters of the blood, so this investigation was
performed in the Biology department animal house/Faculty of Education for Girls. Sixty male Albino rats
of Sprague–Dawley were equally divided into four groups, each group was comprised fifteen males :the
first group was(the control),that orally submitted to 0.9% normal saline solution, the second group was
intraperitoneally injected with 80 mg/kg of Gentamicin, the third group was subjected to 1 mg/kg of Ajwa
fruits alcoholic extract orally+80 mg/kg of Gentamicin antibiotic intraperitoneally, the last group was orally
treated with Ajwa dates alcoholic extract (1mg/kg). The treatments of all laboratory animals were one time
at day and continued for three weeks. Regarding the statistical analysis of study, there was a noticeable
decline in the levels of erythropoietin hormone, total protein, albumin, as well as reduced glutathione(GSH)
in serum, in the opposite, urea, creatinine and malondialdehyde (MDA) levels in serum were significantly
raised at the group that intraperitoneally injected with Gentamicin when compared with the other groups of
the experiment, the other groups, that orally given Ajwa fruits extract +gentamicin antibiotic, and the extract
of Ajwa dates only, no differences were noted in these criteria in compared with control group.
Keywords: Ajwa fruit extract, Gentamicin,Erythropoietin.
Introduction The of Ajwa dates(Phoenix dactylifera L) history

may belong to more than 5000Bc, furthermore it is
The group of antibiotic that named aminoglycosides cultivated in Saudi Arabia particularly(5,6) in(Almadinah
especially Gentamicin have been exerted potent efficacy Almonwwarah)(7). It is consumed in Arab areas for a long
against severe infections of the bacterial micro-organisms period because of its nutritional elements, and strong
which include whole gram–negative and few gram anti-oxidative ingredients, as well as it’s preventive
positive bacterial types(1,2). Many researchers reported potentialities as a nephron-protective, anti-cancer,
that both groups of antibiotics, the aminoglycosides and hepato-protective, anti-ulcerative and anti-diabetic,
aminocyclitols might cause adverse alterations in the as well as anti-hypertensive(8-10). The study aimed to
blood parameters that related to functions of the kidneys, investigate the possible preservative impacts of Ajwa
particularly the increment in the serum creatinine(3) and dates alcoholic extract against the nephrotoxic and the
extensive changes in cells of the proximal tubules, which hemotoxic effects of Gentamicin antibiotic.
diagnosed before the appearance of this modification in
the blood markers(4).
1.
Preparation of laboratory animals: Sixty
Corresponding Author: male rats from Sprague –Daley strain were
Dr. Saher Mahmood Jwad used in the study, weighing 185–224g,and
Professor, Biology Department, their ages less than three (12) weeks, had been
Faculty of Education for Girls, University of Kufa, Iraq purchased from the(National Center for Control
Email:sahar.aljammali@uokufa.edu.iq and Pharmaceutical Research)–Baghdad/Iraq,
after that they housed in special steel cages for 6. Animals sacrificing and collection of
the laboratory animals to care under the typical blood samples: The laboratory animals were
controlled laboratory conditions, moreover the anesthetized by using diethyl ether, after that the
sawdust of animal cages’ displaced for 2 to 3 blood taken from each male by the heart puncture
times at week. In relation to the water and feed to get(5 ml) blood, then the blood was put in gel
(that was enriched with protein), provided for ad tubes for the estimation.
libitum consumption.
7. The biochemical analysis of the blood
When the males became sexually matured,(their
A. Serum erythropoietin level evaluation: To
ages 12 weeks) the experiment was performed.
estimate the erythropoietin level in serum, the
2. Preparation of Gentamicin: This antibiotic Enzyme–Linked Immunosorbent assay, and
with the dose of 80mg/kg brought from Baghdad the kits that were used in this investigation
pharmacy/Alnajaf, and then each animal purchased from Biomerieux, furthermore the
intraperitoneally given the proper concentration absorbance was 450 nm(14).
according to its body weight. B. Serum urea level estimation: In relation
3. Ajwa dates: Concern to Ajwa dates, were to urea level in serum, the method of(15) was
brought from Saudi Arabia (AL-Madinah AL- depended and the kits were equipped from
Munawwarah), after that the fruits identified and Biomerieux France Company, as well as the
classified by the Biology department taxonomist absorbance was read at 580 nm.
in the Faculty of Education for girls. C.
Serum creatinine level estimation: The
4. Preparation of Ajwa dates alcoholic extract: creatinine level in serum was evaluated
The alcoholic extract of Ajwa dates was prepared according to(16) and the reagents were purchased
according to(11) from Biomerieux(France Company),
while the absorbance(490)nm by using the
5. Grouping of the study spectrophotometer.
A. The I group was a control, comprised(15) D. Serum total protein level estimation: The
of males that were orally treated 0.9% method(16) was depended to estimate the total
physiological normal saline solution(once protein level in serum, and the kits were
daily) for three weeks. equipped from Biolabo Company at(550) nm.
B. The II group was injected with Gentamicin E. Serum albumin level estimation: As regard
antibiotic(80mg/kg) intraperitoneally one with albumin level assessment, the method
time at day for the period of three weeks, of(18) was used, and the kits, as well as the
contained(15) male rats. Bromocresol green reagent. In addition, the
C. The III group was orally administrated with Ajwa absorbance carried out by spectrophotometer
dates alcoholic extract(1 mg/kg)+Gentamicin at 650 nm.
(80 mg/kg) by intraperitoneally injecting once
F. Serum reduced glutathione level estimation:
daily,for three weeks, and composed of(15)
The level of reduced glutathione was assessed
males.
according to(19) the kits and reagents were used
D. Finally the IIII group was(15) male Albino in this evaluation purchased from BLH50-USA
rats, orally subjected to (1mg/kg) of Ajwa dates Company, concerning the absorbance(405 to
alcoholic extract, one time at day, as well as for 414) nm by using the spectrophotometer.
three weeks.
G. Serum malondialdehyde level estimation:
Regarding the concentration of Ajwa dates As regard to the malondialdehyde level in the
alcoholic extract that used in the study according serum, the method of(20) used, and the kits, as
to(12), whereas the Gentamicin concentration well as the reagents were brought from Biolabo
determined by the study(13). at 530 to 540 nm
8. The statistical analysis of the study: To analyze Conted…

the results of the study, version 26 of the Statistical
4. Group of Ajwa dates 15 18.100.02 a
Package Social Sciences(that was SPSS) and
Analysis of Variance test were depended, L. S. D = 7.88
moreover the Least Significant Difference named *Values represented as M SE
L.S.D used to extract the differences between the * Similar letters mean no notable differences in P <
means, the probability level was P < 0.05(21). 0.05 level.
* Different letters mean notable differences in P <
Results 0.05 level.
The analysis of the study results, indicated to

a noticeable reduction (P < 0.05) in the following Table 3: Impact of Gentamicin and the extract of
parameters, erythropoietin, total protein and albumin, Ajwa dates on creatinine level
as well as reduced glutathione levels in contrast, urea, Number Levels of
creatinine, and malondialdehyde (MDA) levels in Experimental groups of creatinine
the serum were remarkably increased in the group samples mg/dl
that injected with Gentamicin intraperitoneally when 1. Control group 15 0.50.21 a
compared with experimental groups, as shown in the
2. Gentamicin group 15 1.44 0.36 b
tables 1 to 7 respectively.
3. Group of Ajwa dates +
15 0.43 0.25 a
Gentamicin
Table 1: Impact of Gentamicin and the extract of
Ajwa dates on erythropoietin level 4. Group of Ajwa dates 15 0.330.09 a
L. S. D = 0.45
Number Levels of
Experimental *Values represented as M SE
of erythropoietin
Groups
samples Ml U/ml * Similar letters mean no notable differences in P <
1. Control group 15 24.70.14 a 0.05 level.
2. Gentamicin group 15 13.11 0.17 b * Different letters mean notable differences in P <
Group of Ajwa dates 0.05 level.
3. 15 23.91 0.47 a
+ Gentamicin
4. Group of Ajwa dates 15 24.900.22 a Table 4: Impact of Gentamicin and the extract of
L. S. D = 3.78 Ajwa dates on total protein level
*Values represented as M SE
Number Levels of
* Similar letters mean no notable differences in P < Experimental groups of total protein
0.05 level. samples mg/dl
* Different letters mean notable differences in P < 1. Control group 15 7.60.43 a
0.05 level.
2. Gentamicin group 15 5.24 0.19 b
3. Group of Ajwa dates
Table 2: Impact of Gentamicin and the extract of 15 7.81 0.31 a
+ Gentamicin
Ajwa dates on urea level
4. Group of Ajwa dates 15 8.10.03 a
Number L. S. D = 1.56
Experimental Levels of
of
Groups urea mg/dl *Values represented as M SE
Samples
1. Control group 15 19.660.04 a * Similar letters mean no notable differences in P <
2. Gentamicin group 15 43.11 0.16 b 0.05 level.
Group of Ajwa dates * Different letters mean notable differences in P <
3. 15 20.09 0.32 a
+ Gentamicin 0.05 level.
Table 5: Impact of Gentamicin and the extract of Discussion

Ajwa dates on albumin level
According to the results, there was a remarkable
Number Levels of decline in the erythropoietin level at the group that
Experimental groups of albumin
injected with Gentamicin, this may be attributed to the
samples mg/dl
adverse effects of this type of (aminoglycosides) on the
1. Control group 15 4.360.11 a
renal tissues which is considered the primary site for
2. Gentamicin group 15 2.17 0.34 b erythropoietin bio-synthesis in the mature mammals,
Group of Ajwa dates + that confirmed by study of (22) Another study has been
3. 15 4.52 0.46 a
Gentamicin added that the mainly location(site) of erythropoietin
4. Group of Ajwa dates 15 5.010.25 a production in laboratory animals which is a specialized
L. S. D = 0.98 peritubular cell, presented in proximal tubular region of
*Values represented as M SE the kidney(23-25)Furthermore, hydroxyl radicals may be
* Similar letters mean no notable differences in P < mediated the (aminoglycosides) pathogenicity because
0.05 level. the higher activity of Gentamicin to induce inhibition in
* Different letters mean notable differences in P < both, activity of Na (+)–K (+) – ATPase pumping, and
0.05 level. the DNA replication in renal proximal tubules of rat’s
kidney, as well as a consequent renal injury(2).
Table 6: Impact of Gentamicin and the extract of
Ajwa dates on reduced glutathione level and its A study by(26) had been demonstrated that, the
impact on malondialdehyde level nephrotoxicity of this type of antibiotic characterized by
a decline in urine concentration capacity, mild glycosuria,
Number Levels of reduced tubular proteinuria, and reduced ammonia excretion,
Experimental
of glutathione in addition to the glomerular filtration rate decrement.
groups
samples µmole/ml
In relation to the observable increment in the oxidative
stress index (MDA) and in the opposite, the reduced
Gentamicin
2. 15 15.16 0.18 b level of glutathione(GSH) at the experimental group that
group
Group of intraperitoneally injected with Gentamicin in compared
3. Ajwa dates + 15 51.14 0.27 a with the other groups of study may be proposed to the
Gentamicin toxic impacts of antibiotic on all body tissues especially
Group of Ajwa the sensitive renal tissues, and consequent increased
4. 15 58.790.35 a
dates production of detrimental free radicals because potent
L. S. D = 12.16 activation of phospholipids peroxidation, which causes
Number Levels of substantial consumption of the glutathione molecules
Experimental
of malondialdehyde and responsible for detoxification process of various
groups
samples ng/ml damaging reactive species particularly the end product
of oxidative stress(MDA), thus serum glutathione levels
Gentamicin
2. 15 135.67 0.29 b accordingly decrease(27) These data could be suggested
group
to potent preventive and curative properties of Ajwa dates
Group of
3. Ajwa dates + 15 21.65 0.28 a including: antioxidant, anticancer and antiinflammatory,
Gentamicin as well as antidiabetic(28-30). Overall the effective
Group of Ajwa potentialities of Ajwa dates, may explain to it’s strong
4. 15 13.410.10 a
dates chemical ingredients like: carbohydrate constituents,
L. S. D = 20.93 different types of proteins, lipids(31,32)Ajwa fruits
*Values represented as M SE possess active antioxidants including, carotenoids and
* Similar letters mean no notable differences in P < numerous phenols(33) in addition to various necessary
0.05 level. vitamins like C, B1, B2 and A(34)].With regard to the
* Different letters mean notable differences in P < essential phenols of dates, especially vital acids like p–
0.05 level. coumaric, ferulic, and sinapic, as well as procyanidins, in
addition the bioflavonoids(35)Finally,different varieties studies on Ajwa extract: dates from AlMadinah
of dates contain amino acids (23 types), and selenium Al Monwarah, Saudia Arabia.J.Environ.Anal.
element inhibit cancer and consider vary essential for the Toxicol.,(2013),3(1): 2161–0525.
immune system functions (36,37).
8. Mallhi, T.; Qadir, M.; Ali, M.; Ahmad, B.; Khan,
Conclusions: The extract of Ajwa fruits exhibited Y.H. and Rehman. A. U. Ajwa date (Phoenix
protective and ameliorative effects on some biochemical dactylifera): an emerging plant in pharmacological
and oxidative stress parameters, it alleviated or prevented research. Pak.J.Pha.Sci.,(2014),27(3): 607– 616.
the erythropoietin level reduction that induced by 9. Yasin, B. R.; El Fawal, H. A. N. and Mousa, S.
Gentamicin antibiotic, therefore, we recommend to use Date (Phoenix dactylifera) polyphenolics and
Ajwa variety to reduce nephrotoxicity and hemotoxicity other bioactive compounds: a traditional Islamic
of aminoglycoside group because its natural, nutritional remedy’s potential in prevention of cell damage.
and strong bioactive anti-oxidative contents. Int.J.Mol.Sci.,(2015),19: 30075 – 30090.
Conflict of Interest: There is no any Conflict of Interest 10. Mallapiang, F.; As’ad, S.; Russeng, S.; Nurdin, A.
and Bahar, B. Effectiveness of Ajwa date(Phoenix
Ethical Clearance: Ethics committee refer that there is dactylifera) on blood lactate recovery in rats
no plagiarism and there is no mistakes or wrong results (Rattusnorvergicus) with induced physical activity.
in this work. Int. J. Sci. Bas. Appl. Res., (2015), 24(7): 134–142.
Source of Funding: Self funding. 11. Senhaji, O.; Faid, M; Elyachioui, M. and Dehhaoui,
M. Antifungal activity of different Cinnamon
References extract.J.de.Mycol.Med.,(2005),15(4):220-229.
1. Pistuccia, A. and Cunha, B. The aminoglycosides. 12. AlKhafaf, A. A. A.; Saher, M.J and Mazher, S. A.
Med.Clin.North.Am., (1982).,66:3-12. A comparative study for the alcoholic extract of
Ajwa dates (Phoenix dactylifera L.) in protection
2. Shahidullah, A.; Bhuiyan, M.;Hossain, I.; Islam,
of the hepatic and renal tissues from toxicity
R. and Riaz, M.. Effects of gentamicin on growth
induced by Aspergillus niger in albino rats.J.Glob.
perfor-mance and hemato-biochemical parameters
Pharma.Technol.,(2017),11(9): 102-124.
in mice.Int.J.Nat.Soc.Sci.,(2016),3(4): 43-51.
13. Abdel–Raheem, I. T.; Elsherbiny, G. and Taye,
3. De Broe, M. ; Paulus, G.; Verpooten, G.; Roels,
A. Green tea ameliorates renal oxidative damage
F.; Buyssens, N.; Wedeen, R.; Early effects of
induced by Gentamicin in rats. Pak.J.Pharm.A
gentamicin, tobramycin, and amikacin on the
cut.Sci.,(2010),21: 23–28.
human kidney.Kid.Inter.,(1984),25:643-652.
14. Kricka, L. J. Human anti – animal antibody
4.
Venkatachalam, M. Pathology of acute
interferences in immunological assays.Clin.
renal failure, in Contemporary Issues in
Chem.,(1999),45: 942–965.
nephrology, Acute Renal Failure, edited by
Brenner,B.M. and Stein,J.H. New York,Churchill 15. Tietz, N. W. Textbook of clinical chemistry.
Livingstone.,(1980),Pp:79-107. 3nded.C.A.Burtis, E.R.Ashwood, W.B.Saunders.
(1999),Pp:282-884 and 1429-1431.
5. Ali, B.H.; Ismail, T. and Bashir, A. Influence of iron,
deferoxamine and ascorbic acid on gentamicin– 16. Labbe, D. Am.Biol.Clin.,(1996),Pp:285-298.
induced nephrotoxicity in rats. Gen. Pharmacol. 17. West, J. B. Physiological basis of medical practice.
The.Vas.Sys., (1994),25(6): 1249–2252. 11thed. Williams and Wilkins,(1985),Pp:418-425.
6. Rybak, K and Ramkumar, V. Ototoxicity., Kid. 18. Doumas, B. T.; Watson, W and Biggs, H. G.
Inter.,(2007),72(8): 931-935. Albumin standard and the measurement of serum
7.
Ragab, A.; Elkablawy, M.; Sheik, B. and albumin with bromocresol green.Clin.Chem.
Baraka, H. N Antioxidant and tissue–protective Acta.,(1971),31:87-95.
19. Baker, M. A.; Cerniglia. G. J. and Zaman,A. tumor activity. Int.J.Clin.Exp.Med.,(2014),7(3):

Microtiter plate assay for the measurement 483–491.
of glutathione and glutathione disulfide in
29.
El-Mousalamy, A.; Hussein, A.; Mahmoud,
large numbers of biological samples. Anal.
S.; Abdelaziz, A. and Shaker, G. Aqueous and
Biochem.,(1990),190:360-365.
methanolic extracts of palm date seeds and fruits
20. Armstrong, D. and Browne, R. The analysis (Phoenix dactylifera) protects against diabetic
of free radical, lipid peroxide, enzymes and nephropathy in type I diabetic rats.Biochem.
compounds to oxidative stress as applied to the Physiol.,(2016),5(2): 100-205.
clinical chemistry laboratory. Free. Rad. Diag.
30. Khalid, S.; Ahmed, A. and Kaleem, M. Antioxidant
Med., (1994), 366:43-58.
activity and phenolic contents of Ajwa date and
21.
Morgan, G.; Leech, N.; Gloecner, G. and their effect on lipoprotein profile. Func.Food.
Barrett, K. SPSS for introductory statistic: use Health.Dis.,(2017),7(6): 396–410.
and interpretation. 2nd ed. Lawrenz Erlbaum
31. Khan. F.; Ahmed, F.; Pushparaj, P.; Abuenadah,
associatiates, publishers Mahwah, New Jersey.
A.; Kumosani, T.; Barbour, E.; AlQahtani, M. and
London,(2010).
Gauthamam, K. Ajwa date(Phoenix dactylifera
22. Jacobson, L. and Goldwasser, E.; Fried, W. and L)extract inhibit human breast adenocarcinoma
Plzak, L. Role of the kidney in erythropoiesis. (MCF7) cell in vitro. Plos.One.,(2016),11(7):1–17.
Nature.,(1957),139:633-634.
32.
Mushtaq, Z.; Kaucar, S.; kousar, N. and
23. Fisher, J. W.; Kouray, S.; Docey, T. and Mendel, chiragh, S. Effect of Ajwa date seed on lipid
S. Erythropoietin production by interstitial cells profile of diet induced hyperlipidemic rabbits.
of hypoxic monkey kidneys. Br.J.Haematol., Kmuj.,(2017),9(3):135–139.
(1996),95: 27-36.
33. Nasir, M.; Hussain, S.; Jabbar, S.; Rashid,
24. Hoffbrand, A.; Moss, P. A. and Pettit, J. Essential F.; Khalid, N. and Mehmood, A. A review on
hematology. 5th ed. Blackwell publishing. London, the nutritional content, functional properties
UK,(2006),PP: 12–21. and medicinal potential of dates.J.Sci.
Lett.,(2015),3(1): 17–22.
25. Laurent, G.; Carlier, M. B.; Rollman, B.; Van Hoof,P.
and Tulkens,P. Mechanisms of aminoglycoside- 34. Alfarsi, M. and Lee. C. Nutritional and functional
induced lysosomal phospholipidosis: in vitro properties of date: a review. Crit.Rev.Food.Sci.
and in vivo studies with gentamicin.Biochem. Nutr.,(2008),48(10): 877–887.
Pharmacol.,(1982),31:3861-3870.
35. Mansouri, A.; Embarek, G.; Kokkalou, E. and
26.
Kaloyanides, G.; Feldman, S; Wang and Kefalas, P. Phenolic profile and antioxidant activity
Pastoriza–Munoz. Aminoglycosides induce a of the Algerian ripe date palm fruit (Phoenix
phospholipidosis in the renal cortex of the rat: an dactylifera). Food. Chem., (2005), 89: 411–420.
early manifestation of nephrotoxicity. J. Pharmacol.
36. Aisha, A.; Nassar, Z.; Siddique, M.; Abu Salah,
Exper. Therap., (1982), 220(3): 514–520.
K.M and Alrokayan, S. Evaluation of anti
27. Ademiluyi, A.; Oboh, G.; Owoloye, T. and angiogenic, cytotoxic and antioxidant effects
Agbebi, O. Modulatory effects of dietary of Syzgium aromaticum L. extracts.Asi.J.Bio.
inclusion of garlic(Allium sativum) on gentamicin Sci.,(2011),4:282–290.
– induced hepatotoxicity in rats Asian.Pac.J.Trop.
37. Saafi, E.; Louedi, M.; Elfeki, A.; Zakhama,
Biomed.,(2013),3(6): 470-475.
A.,Najjar, M. Protective effect of date palm fruit
28. Rahmani, A. H.; Aly, S. M.; Ali, H.; Babiker, A.Y.; extract (Phoenix dactlifera L) on dimethoate
Srikar, S. and Khan, A. A. Therapeutic effects of induced–oxidative stress in rat liver. Exp.Toxicol.
date fruits (Phoenix dactylifera) in the prevention Pathol.,(2011),63:433–441.
of diseases via modulation of antioxidant and anti–
Utilization of Lactobacillus Acidophilus FNCC-0051

Microencapsulation: Potential Benefit of Giving Combination
of Sodium Alginate and Gelatin to Attributes and Role of
Probiotic Against Staphylococcus Aureus
Arumentin Diana1, Tutiek Purwanti1, Isnaeni1

Departement of Pharmacy, Faculty of Pharmacy, UniversitasAirlangga, Jl. Airlangga No.4 - 6,
1
Airlangga, Gubeng, Surabaya, East Java
Abstract
Background: The use of Lactobacillus acidophilus as an antimicrobial is still not optimal, even though this
type of probiotic has benefits for skin health. One of bacteria causesthe turnaround cause effects of the skin
is Staphylococcus aureus.
Objective: To evaluate the effect combination of sodium alginate and gelatin matrix 2.25%: 0.75% to the
characteristics, viability, and antibacterial activity of probiotic microparticles.
Method: The experimental study used the ratio of sodium alginate and gelatin 2.25%: 0.75% (FI), 3%
sodium alginate (FII) and 3% gelatin (FIII). Tests were carried out to assess viability (TPC method), making
microparticles by extrusion method and antibacterial activity (agar diffusion method). The data obtained was
analyzed by statistical tests.
Results: Particle size distribution was obtained, including 8.85 μm (FI), 9.69 μm (FII) and 5.40 μm (FIII).
The viability of probiotics after being made microparticles is still in the range of probiotic minimum
requirements despite a decrease. The lowest decrease in viability was 1.32% ± 0.06 (FI) and the highest
decrease in viability was 14.77% ± 1.21 (FIII) which was significantly different (p <0.05). The lowest
antibacterial activity test 9.27 ± 0.19 mm (FIII) and the highest antibacterial activity 10.83 ± 0.51 mm (FI)
which was significantly different from FIII.
Conclusion: Thecombination of sodium alginate and gelatin 2.25%: 0.75% can increase the role of
Lactobacillus acidophilus probiotic as antimicrobial against Staphylococcus aureus and can be an alternative
in preventing infection.
Keywords : Lactobacillus acidophilus FNCC-0051, role, attributes,sodium alginat, gelatin
Introduction
Studies of probiotics and their use in various

products have developed in recent years.1 Probiotics
provide health benefits if given in sufficient quantities. 2
Lactobacillus and Bifidobacteria are common microbes
Correspondence Author: used as probiotics. 3 Probiotics are widely used in the
Tutiek Purwanti form of nutrients and orally. 4 Probiotics can also
Departement of Pharmacy, Faculty of Pharmacy, provide health benefits such as antimicrobial activity,
UniversitasAirlangga immunomodulators, and antidiare. 5 Probiotics is used
Jl. Airlangga No.4 - 6, Airlangga, Gubeng, in the fields of dermatology, cosmetics and preventive
Surabaya, East Java 60115 or therapeutic benefits, especially Lactobacillus
Email: tutikpurwanti466@yahoo.com acidophilus as an antimicrobial.6
The probiotic suspension has more optimal + sodium alginate and gelatin combination with a ratio
antimicrobial activity compared to probiotic of 2.25%: 0.75%), formula II (Probiotics + 3% sodium
supernatants.7 In this study Lactobacillus acidophilus alginate) and formula III (Probiotics + 3% gelatin).
was used in the form of probiotic suspensions that being Sodium alginate and single gelatin were used as a
cultured on MRS media.8 In topical use, it is expected comparison, compared with a combination of sodium
that the active ingredient’s stability must be maintained, alginate and gelatin.
that last long enough in the skin, and released gradually
The procedures in this study were carried out in
by means of encapsulation in the form of microparticles.9
several stages. The first stage was the examination of the
The matrix that commonly used in materials, including probiotics, gelatin, sodium alginate
microencapsulation is alginate, carrageenan, Chitosan, and CaCl2. The second stage was carried out for the
and protein. 3 Gelatin is a matrix in the form of proteins preparation of probiotic Lactobacillus acidophilus
that are often used in making microparticles.10 Gelatin starter, optimization of growth at 0, 6, 12, 14, 18, 24 and
is biocompatible, biodegradable, non toxic, inexpensive, 48 hours. In this phase the viability test was carried out
swelling index good and easy to experience cross by the TPC (Total Plate Count) method. Probiotics were
linking.11 Sodium alginate is also common, used as mixed into the matrix (sodium alginate - gelatin) then
a microencapsulation matrix of probiotic bacteria.12 viability tests are carried out using the TPC method. The
The advantage of microencapsulation using sodium next step was the formation of formula I (Probiotics +
alginate is easy, safe and cheap.13 Microencapsulation sodium alginate and gelatin combination with a ratio
can be done by several methods, namely, emulsification, of 2.25%: 0.75%) , formula II (Probiotics + sodium
coacervation, spray drying, and extrusion. 14 alginate 3%) and formula III (Probiotics + gelatin
3%). Making microparticles with an extrusion method
Sodium alginate evidently has a disadvantage,
with cross linker CaCl2 1.5 M, pH checked at pH 8.5.
namely the particles produced were too porous to
Evaluation of the characteristics of the microparticle
protect probiotics from environmental factors15 So that
including the shape examination, viability and particle
an alternative is needed through a combination with
size distribution using an optical microscope. Activity
gelatin.16,17 The commonly used gelatin concentration is
test for Staphylococcus aureus bacteria with the agar
between 5-15% 18, the concentration of sodium alginate
well diffusion method set after preparation of S. aureus
is 0.5-4% and calcium chloride is 0.05- 1.5 M.12 In this
bacteria. Antibacterial activity tests were carried out
effort a Crosslink is needed. Crosslinking commonly
before and after microencapsulation by measuring
used in gelatin and sodium alginate is calcium chloride.11
the diameter of the inhibition zone (mm) against
The effectiveness of Lactobacillus acidophilus needs Staphylococcu aureus. Next, to find out the equivalence
to be improved as an effort to prevent skin infections in of probiotic concentrations in microparticles with
health services. This study aimed to determine the effect antibiotics, then comparing probiotic inhibitory zones
of sodium alginate and gelatin combination with a ratio that have been encapsulated with antibiotic inhibition
of 2.25%: 0.75% on particle shape and size, viability, zones (gentamicin) at various concentrations.
and antibacterial activity of Lactobacillus acidophilus
Qualitative examination carried out for the
microparticles, by extrusion method, and CaCl2 1.5M
Lactobacillus acidophilus bacteria is by gram staining.
cross linker.
Qualitative examination was also carried out an in the
sodium alginate and calcium chloride matrix including
Method organoleptic examination, FTIR and DTA, and also in a
This study was an experimental study. gelatin matrix including organoleptic examination and
Microbiological examination was carried out at the FTIR. The data obtained were then analyzed through
Health Laboratory Center in Surabaya and Lactobacillus statistical tests with the One-Way ANOVA variance
acidophilus material came from the Center for Food and analysis method, then analyzed by Tukey’s Honesty
Nutrition Studies at Universitas Gajahmada. This study Significant Difference (HSD) test with a confidence
consisted of 3 formulas namely formula I (Probiotics level of 0.95 (α = 0.05).
Results formulas, FIII (3% gelatin) has the smallest particle size
and FII (3% sodium alginate) has the largest particle
Identification results of Lactobacillus acidophilus size, while the combination between the two polymers
FNCC-0051 showed that gram-positive bacteria were causes smaller size than just single sodium alginate
formed. Sodium Alginate, Type B Gelatin and Calcium and larger from gelatin. The particle size obtained
Chloride used in this study have met the requirements from the microparticles of each formula has an unequal
as listed in the literature monograph. The results of pH distribution, the smallest particle size is 3.06 μm found
showed in the range 5,22 ± 0,08 in 48 hours and 6,49 in formula I, II, III while the largest particle size is
± 0,07 in early hours. The minimum TPC is 1,14x108 18.38μm at FI, 24.5μm at FII, and 15, 31μm on FIII.
± 0,36x108 cfu/ml while the maximum is 3,82x107
± 3,05x107. The highest log TPC of Lactobacillus The microparticle viability test results were obtained
acidophillus is 8,46 ± 0,17 log cfu/ml while the lowest is from viability percentage, which compared the TPC and
7,09 ± 0,13 log cfu/ml. Log TPC values of Lactobacillus acidophilus at Formula
I, Formula II, and Formula III before microparticles
Interactions between polymers and Crosslink CaCl2 and after microparticles. The smallest TPC value after
solutions are characterized by the wave number of C = manufacturing process of dry microparticles found in
O either shifted or disappears from alginate and gelatin. Formula III, but it still covered the required viability
Sodium alginate-gelatin combination (2.25%: 0.75%) requirements, namely 106 - 107 cfu/ml or log results
has the wave number of 3432.0 for the Sodium Alginate which was 6-7 cfu/ml.
hydroxyl group and 1633.6 for C = O Streching in
Gelatin. The measurement results of a single raw material The viability decrease of Lactobacillus acidophilus
were found that IR spectrum (cm-1) of the sodium in probiotic microparticles on the manufacturing process
alginate Hydroxyl group was 3466.38 and gelatin C = O of microparticles (extrusion and oven). The highest
is stretching was 1651.63. The results obtained from an decrease in viability was obtained in Formula III at
optical microscope of 400x magnification are presented 14.77% and the lowest decrease in viability was obtained
in Figure 1. in Formula I at 1.32%. The entrapment efficiency of
Lactobacillus acidophilus in probiotic microparticles on
the manufacturing process of microparticles (extrusion
and oven) was decreasing compared to viability before
microparticles manufacturing process. The highest
entrapment efficiency obtained in Formula III at 87.94%
and the lowest entrapment efficiency was obtained in
Formula I at 76.35%. Viability and entrapment efficiency
Formula I Formula II of Lactobacillus acidophilus against the microparticles
manufacturing process were presented in table 1.
Table 1: Viability of Lactobacillus acidophilus
Viability Entrapment
Group
decrease Efficiency
Formula I 1,32 ± 0,06 76,35 ± 0,22
Formula III Formula II 7,27 ± 0,19 84,20 ± 0,16
Figure 1: Microparticles form of probiotic Formula Formula III 14,77 ± 1,21 87,94 ± 0,43
I, II, and III with 400x magnification optical
microscope The results of the One-Way ANOVA test with Tukey
test, it can be seen that Formula III has the highest
The mean size of probiotic microparticles in each reduction in viability against the manufacturing process
formula, as follow; formula I (8.85µm), formula II (9.69 of microparticles and has a significant difference with
µm) and formula III (5.40 µm). Based on the particle Formula I and Formula II. From the results of the One
size, percentage calculation of microparticles between Way ANOVA test with post hoc Tukey, it can be seen
that Formula I produces the highest inhibitory activity Discussion

compared to other Formulas and has a significant
difference with Formula III. Table 2 presents the Tukey This study showed the effect of a sodium alginate
and gelatin combination with concentration of 2.25%:
test results of Lactobacillus acidophilus viability against
0.75%. The effect that occurs is the size difference of the
the manufacturing process of microparticles (extrusion
Lactobacillus acidophilus FNCC-0051 microparticles
and oven) and One Way ANOVA test with post hoc
and an increase in the role and effectiveness seen from
Tukey on inhibition zone diameter for each formula
the increase in viability and antibacterial activity against
against Staphylococcus aureus.
Staphylococcus aureus. This study showed that the effect
Table 2: Tukey’s test results of Lactobacillus of the matrix ratio (sodium alginate - gelatin) on the rate
acidophilus viability on the microparticles of decline percentage in the viability of Lactobacillus
manufacturing process (extrusion and oven) and acidophillus per formula and it can be seen that FIII had
One Way ANOVA test with post hoc Tukey of the highest reduction in viability which had significant
inhibition zone diameter in each formula against differences with FI and FII. Although there was a decrease
Staphylococcus aureus in the viability of probiotics during the manufacturing
process of microparticles from all three formulas, the
Group Formula I Formula II Formula III number of probiotic TPCs in the three formulas still
One-Way ANOVA with Tukey’s test met the requirements of probiotics as antibacterial. The
Formula I + + results of the microparticle entrapment efficiency test
Formula II + + were obtained from percentage data on viability, the
Formula III + + results of the viability percentage of formulas I, II, and III
were 76.35%, 84.20%, and 87.94%. This can be related
One Way ANOVA with post hoc Tukey
to the smaller particle size, the entrapment efficiency is
Formula I - +
greater because of the large surface area of the matrix.
Formula II - -
Formula III + - The reason for gelatin was chosen in this study,
because it has a good swelling index ability and is useful
Description: (+) = there is significant differences (-) =
as a thermally reversible gelling agent for encapsulation.
there is no significant differences 16
Besides the compact structure between alginate and
The highest inhibition zone produced by Formula gelatin will give small particle size and small particle
I with value of 10.83 ± 0.51 mm compared to other size because of gelatin can fill these pores when cross
formulas. The lowest inhibition zone produced by links occur with CaCl2, besides, gelatin has the ability
Formula III with value of 9.27 ± 0.19 mm. The of self-assembly, so that more compressed particles can
results of the inhibitory activity test for each probiotic be formed when compared to the use of a single alginate
microparticles formula against Staphylococcus aureus matrix that has very porous microparticle properties. 15
are presented in Table 3.
The method used in this study was the extrusion
Table 3: Diameter of inhibition zone against S. method because it is suitable for sodium alginate and
aureus (test bacteria) gelatin matrix. The method is simple and inexpensive,
does not damage probiotic cells, produces a high
Group Inhibition Zone (mm) probiotic viability, and can be carried out in aerobic
Microparticles of Formula I 10,83 ± 0,51 or anaerobic conditions.3 A few factors that affect
Microparticles of Formula II 9,80 ± 0,57 microparticles formation, including the diameter of the
Microparticles of Formula III 9,27 ± 0,19 syringe needle and the distance between the syringe
Positive Control 12.15 ± 0,05 needle and the cross-linked solution can affect the shape
and size of the microparticles12, the stirring speed also
Negative Control 0
affects the microparticles, the faster the stirring speed,
Description: The Data is the mean value of 3x the smaller the particles produced.
replication ± SD, Positive Control = Gentamicin 6 ppm,
Negative Control = Microparticles without Lactobacillus Qualitative examination of probiotic, namely gram
acidophilus staining on Lactobacillus acidophilus FNCC-0051
was obtained from gram-positive bacteria, according article: Development of microencapsulation

to the morphological characteristics of Lactobacillus delivery system for long-term preservation of
acidophilus, which were classified as gram-positive and probiotics as biotherapeutics agent. Biomed Res
rod-shaped. The results of organoleptic examination of Int. 2013;
gelatin shows that it was in the form of powder, with
4. Williams N. Probiotics. Am J Heal Syst Pharmacy,.
pale yellow granules to dark yellow, odorless and
2010;67:449–58.
tasteless19. The results of the infrared spectrum showed
the same results with the literature so that it can be 5. Mortazavian, A., Razavi, S.H., Ehsani, M.R.,
concluded that these results meet the characteristics of Sohrabvandi, Sara. Principles and Methods
gelatin. Qualitative analysis on Calcium chloride as a of Microencapsulation of Probiotic. Iran J
cross linker also carried out, namely organoleptic and Biotechnol. 2007;5:1.
thermal analysis using DTA. The organoleptic analysis
6.
Cinque, B., Torre, C.L., Melchiorre, E.,
of calcium chloride showed that it was white, crystalline
Marchesani, G., Zoccali G, Palumbo, P., Marzio,
powder, hard, odorless and hygroscopic, whereas
L.D., Masci, A., Mosca L, Mastromarino, P.,
according to literature it was white or almost white
crystalline powder, hard, odorless and hygroscopic.20 Giuliani, M., Cifone MG. Use of Probiotics for
Dermal Application. Microbiol Monoghraph 21.
2011;
Conclusion
7.
Rachmawati, I., Suranto, Setyaningsih R.
Not only there is a difference in the size characteristics Antibacterial Test of Lactic Acid Bacteria
of Lactobacillus acidophilus FNCC-0051 microparticles from Asawi Sawi on Pathogenic Bacteria.
with a combination of sodium alginate-gelatin 2.25%: Biotechnology. 2005; 2 (2): 43–8.
0.75% but there is an increase in role and efficacy that
8. Lew, L.C. and Liong M. Bioactives from probiotics
observed from increased viability and antibacterial
for dermal health: functions and benefits. J Appl
activity against Staphylococcus aureus.
Microbiol. 2013;114:1241–53.
Ethical Clearance: This research has gone through
9. Chadawar, V., Shaji J. Microsponge Delivery
ethical tests from Faculty of Pharmacy Universitas
System. Curr Drug Deliv. 2007;4:123–9.
Airlangga
10.
Gelatin Manufacturers Institute of America.
Conflict of Interest: The author reports no conflict of Gelatin handbook (GMIA). 2012;
interest of this work.
11. Elzoghby AE. Gelatin-based nanoparticles as
Source of Funding: This study is done with individual drug and gene delivery systems: Reviewing
funding. three decades of research. J Control Release.
2013;172:1075–91.
References 12.
Krasaekoopt, W., Bhandari, B., Deeth, H.
1. Lisova, Ivana, Horackova, S., Kovacova, R., Evaluation of encapsulation techniques of
Rada, V. and P, M. Emulsion Encapsulation of probiotics for yoghurt. Int Dairy J. 2003;13(1):3–
Bifidobacterium animalis subsp. lactis BB12 with 13.
the Addition of Lecithin. Vol. 31 (3), p. 270-274. 13. Lee, K. Y., David JM. Alginate : properties
Czech J Food Sci. 2013;31(3):270–4. and biomedical application. Prog Polym Sci.
2. FAO/WHO. Guideline for the Evaluation of 2012;(37):106–26.
Probiotics in Food. London, UK.: Food and 14.
P. Saravana Kumar,V.Durai pandiyan, S.
Agriculture Organization of the United Nations/ Ignacimuthua. Isolation, screening and partial
World Health Organization; 2002. purification of antimicrobial antibiotics from soil
3. Solanki, H.K., Pawar, D.D., Shah, D.A., Prajapati, Streptomyces sp. SCA 7. Kaohsiung J Med Sci.
V.D., Jani GK, Mulla, A.M., Thakar PM. Review 2014;30(9):435–46.
15. Maria Chavarri, Raquel Ares, Izaskun Maranon 18. Inostroza, E.C.., Yanez, R.B., Riquelme, M.G.,
FCI. Microencapsulation of a probiotic and Stohr DK. Formulation based on the synthesis
prebiotic in alginate-chitosan capsules improves of microspheres made from cross linked natural
survival in simulated gastro-intestinal conditions. Gelatin, used as a carrier for strain probiotic
Int J Food Microbiol. 2010;142(1–2):185–9. Lactobacillus spp. for treating skin wounds and/
or lesions. Eur Pat Appl Paris. 2012;EP 2 450 0.
16. Roy, A., Bajpai, J., Bajpai AK. Development
of calcium alginate-gelatin based microspheres 19.
Raymond C Rowe, Paul J Sheskey MEQ.
for controlled release of endosulfan as a model Handbook of Parmaceutical Excipients. 5th ed.
pesticide. Indian J Chem Technol. 2009;16:338– Washington, DC: Parmaceutical press and the
395. pharmacist association; 2006.
17. Sonone, A.P., Peter D. Studies on Accelerated 20. Sweetman SCE. Martindale the Complete Drug
Fermentation by Encapsulated Microorganism in Reference. 36th ed. London: Pharmaceutical
Porridge. Int J Adv Res. 2013;1:407–13. Press; 2009.
The Correlation of Sleep Quality Factors in Overweight

Adolescents in a Developing Country
Nur Faizah1, Elida Ulfiana1, Setho Hadisuyatmana1

1
Department of Nursing, Faculty of Nursing, Universitas Airlangga, Jl. Airlangga No.4 - 6, Airlangga,
Gubeng, Kota SBY, Jawa Timur
ABSTRACT
Introduction: Good sleep quality is a significant health indicator that needed by people, especially
overweight adolescence. The case of overweight adolescents in developing countries is quite significant
where earlier studies suggested that overweight adolescents who have poor sleep quality will increase
the risk of obesity. So an understanding of the correlation between the sleep quality factors in overweight
adolescents is needed.
Objective: This study aimed to find out the factors associated with sleep quality in overweight adolescent
in a developing country.
Method: The research used descriptive corelative design. Fifty overweight adolescences respondents were
involved using total sampling technique. The data were collected with questionnaires and analyzed using
Spearman‟s Rho test (α<0.05).
Result: The results showed that stress and diet have significant correlation with sleep quality (Pstress =0.020,
pdiet= 0.000). However, physical exercise and fatigue, environment, illness, drug and subtance and habits
before sleep (p>0.05) are not explainable because the respondents didn’t have the habits and conditions that
may be correlated with their sleep quality.
Conclusion: This study suggested the factors of sleep quality in overweight adolescents related to stress and
diet. The other related factors that examined did not show any association.
Keywords: Sleep quality, adolescence, overweight, obesity
Introduction in adolescents in developing countries 2,3, one of them

is in Indonesia. Overweight in adolescents is currently
The World Health Organization (WHO) defines evidenced by the existence of national prevalence based
obesity and overweight as two different things, but both on data from the Baseline Health Research of Indonesia,
of them mean an accumulation of excessive fat in the called Riset Kesehatan Dasar 4. The prevalence of
body, which is indicated by an increase in the value of adolescents who experience overweight are 7.3% (5.7%
the Body Mass Index (BMI) above normal. Adolescents overweight and 1.6% obese). This result is far higher than
is one group that experiences significant overweight year of 2010, which was only 1.4% of adolescents who
in decades 1 including the number of cases of obesity were overweight. Based on a previous study in a group of
adolescents at SMAN 1 Gresik, Indonesia, showed that 8
out of 10 overweight students had poor sleep quality, so
Correspondence Author: an understanding of factors which related to sleep quality
Elida Ulfiana was needed, especially for overweight adolescents.
Department of Nursing, Faculty of Nursing,
Universitas Airlangga Overweight and obesity are nutritional problems
Jl. Airlangga No.4 - 6, Airlangga, Gubeng, that can occur in all age groups including adolescents.
Kota SBY, Jawa Timur 60286 Adolescents are active individuals with a rapid growth
Email : elidaulfiana@yahoo.com rate (growth spurt), both height and weight. However,
multiple studies have shown that adolescents who The study used cross sectional approach. In this study
are overweight have a greater risk of obesity in their used total sampling technique, by taking all members
adulthood 5. Adolescents who are overweight and have of the target population into a sample so that the final
poor quality sleep can increase the risk of obesity6. number of respondents involved in this study was 50
Adolescents who are overweight tend to have poor overweight student. The overweight category calculated
sleep quality than normal-weight teens 7both submitted based on the quatelet index {weight in kilograms
to polysomnography. The samples were matched for age, divided by the square of height in meters (kg/m2)} with
sex, and apnea-hypopnea index. Body mass index (BMI. BMI based on The International Obesity Task Force,
Poor sleep quality refers to the insufficient NREM and namely> 25- <30kg/m2.
REM cycle 8,9. The NREM cycle lasts for approximately Demographic data of respondents consisted of
one hour and the person can still listen to the sounds gender, age, class, weight, and height. The instrument
around him. Meanwhile in the REM cycle, it lasts for of this study was a questionnaire containing closed
approximately 20 minutes for 6-8 hours in a night’s sleep. questions. The data was collected from respondents by
Both these cycles (NREM and REM) occur alternately 4-6 asking to answer questions and wrote the answer on
cycles. The impact on poor sleep quality in adolescents the questionnaire sheet. The study used questionnaire
will affect the learning process such as experiencing instrument 12 in which contained questions consist of
decreased concentration, drowsiness during learning, and three parts, namely: 1. Respondent data consists of
being late for school. Poor sleep quality will also have gender, age, class, weight, and height. 2. The Pittsburgh
a negative impact on physical conditions 10, especially Questionnaire Sleep Quality Index (PSQI) 13, The third
in overweight adolescents, namely excessive daytime part is a question related to the variable quality of sleep,
sleepiness and sleep-disorder breathing 11. Furthermore, namely by using The Pittsburgh Sleep Quality Index
stress, physical exercise and fatigue, environment, illness, (PSQI), to measure sleep quality. 3. Questionnaire factors
drugs and substance, habits before going to bed, and diet that affect sleep quality. Variables of factors that influence
are determinants of a person’s sleep quality 8. Therefore, sleep quality include stress, environment, physical
this study aimed to determine factors related to sleep exercise and fatigue, illness, drugs and substance,
quality in overweight adolescents in one of developing habits before going to bed, and diet.This questionnaire
countries, Indonesia. The study will evaluate factors consisted of 20 questions,while stress factors consist of
related to overweight adolescents. 14 questions using the DASS questionnaire (Depression
Anxiety Stress Scale). The dependent variable in this
Method study was the quality of sleep.The data then gathered
This study was conducted at SMAN 1 Gresik, and calculated using the Rho spearman statistical test
Indonesia. The study used descriptive correlative design. with the level of significance α = 0.05.
Results
Demographic characteristics of respondents
Tabel 1: Gender distribution
No. Variable Category Amount (N) Pecentage

Women 29 58%
1. Gender
Men 21 42%
Table 1 showed the demographic data taken on men and women with the highest percentage of sex variables,
namely women as many as 29 respondents (58%) and 21 men respondents (42%).
Variables measured: Conted…

Drugs and substance
Table 2: Sleep quality distribution in overweight Yes 3 6
adolescents No 47 94
Variable Frequency Percentage (%) Total 50 100
Habit before sleep
Sleep quality
Yes 34 68
Good 14 28
No 16 32
Poor 36 72 Total 50 100
Total 50 100 Diet
Stress Yes 40 80
Normal 22 44 No 10 20
Mild 20 40 Total 50 100
Moderate 8 16 Table 2. showed that the distribution of respondents
Total 50 100 mostly had poor sleep quality as much as 36 people
Physical exercise and fatigue (72%). A total of 20 respondents (40%) experienced
Yes 16 32 mild stress, and 8 respondents (16%) with moderate
No 34 68 levels. Most of the respondents who did not do physical
Total 50 100 exercise and did not experience fatigue were 34 people
(68%). Most respondents felt comfortable with the
Environment
environment while sleeping as many as 44 people
Comfortable 44 88 (88%). 27 people (54%) did not have the disease. A total
Not comfortable 6 12 of 47 people (94%) respondents did not consume drugs
Total 50 100 and substance. Most respondents had a habit before
Disease going to bed, which were 34 people (68%). Habit before
Yes 23 46 sleep include watching television and praying. Most of
No 27 54 the respondents consumed food and beverages such as
eating heavy foods and drinking milk and water before
Total 50 100
going to bed as many as 40 people (80%).
Relationship between sleep quality and factors that affect sleep
Table 3: Cross tabulation of the relationship between sleep quality and factors that affect sleep
Sleep Quality
Factors
Baik % Buruk % Total %
Stress
Normal 10 20 12 24 22 44
Mild 3 6 17 34 20 40
Moderate 1 2 7 14 8 16
Total 14 28 36 72 50 100
Sperman rho P=0,020 R=0,329
Physical exercise and fatigue
Yes 4 8 12 24 16 32
No 10 20 24 48 34 68
Total 14 28 36 73 50 100
Sperman rho P=0,752
Conted…
Environment
Comfortable 12 24 32 64 44 88
Not Comfortable 2 4 4 8 6 12
Total 14 28 36 72 50 100
Sperman rho P=0,762
Disease
Yes 6 12 17 34 23 46
No 8 16 19 38 27 54
Total 14 28 36 72 50 100
Sperman rho P=0,786
Drugs and Substance
Yes 0 0 3 6 3 6
No 14 28 33 66 47 94
Total 14 28 36 72 50 100
Sperman rho P=0,275
Habit before sleep
Yes 9 18 25 50 34 46
No 5 10 11 32 16 32
Total 14 28 36 72 50 100
Sperman rho P=0,372
Diet
Yes 6 12 34 68 40 80
No 8 16 2 4 10 20
Total 14 28 36 72 50 100
Sperman rho P=000 R=-0,579
Spearman Rho statistical analysis showed that there Discussions

was a relationship between stress levels and sleep quality
(p = 0.020) with a correlation coefficient r = 0.329 which The study showed stress and diet have a significant
indicated that the strength of the relationship was weak relationship with sleep quality in overweight adolescents.
and the direction of positive relationships meant that The results was supported by previous studies where
the higher the stress level the worse the quality of sleep. stress experienced 14 and eating habit or food intake
There was a relationship of diet with sleep quality (p = before going to bed can affect difficulty in going to sleep
0,000) with a correlation coefficient r = -0,579 which 15
. Most people who are under stress will eat more often
indicated that the strength of the relationship was because they believe that eating can overcome stress 16.
moderate and the direction of the negative relationship Sleep quality is very important for the body, one of which
meant the lower level of food consumption, the better is normal metabolic function and hormonal processes 17.
quality of sleep. It indicated a relationship between
stress factors and diet with sleep quality. There were Hormones play an important role in triggering stress
17 respondents (34%) who experienced mild level and appetite for sleep quality. The cortisol is a hormone
stress with poor sleep quality while respondents who that regulates stress. In someone who experiences a high
underwent moderate stress with poor sleep quality were level of stress will experience an increase in cortisol
7 respondents (14%). However, the factors of physical levels so that it will increase the level of one’s appetite
exercise and fatigue, environment, disease, medicine 18
. This condition indicates a correlation between stress
and substance, and habits before going to bed were not and weight. However, the relationship between the two
related to sleep quality (p> 0.05). factors cannot be explained through research that has
been carried out especially on the scope of sleep quality. Physical pain and discomfort can cause sleep problems 9.
Hormones have an important role in regulating one’s This indicates that physical discomfort during sleep can
appetite due to an imbalance in the hormones leptin and affect a person’s sleep quality. However, the presence
ghrelin. The hormone leptin functions to capture the of other factors such as diet and stress that more affect
signal of how much fat is in the body so that it can be sleep quality in respondents so that the disease factor
regulated in the breakdown of fat metabolism and the does not prove to have a relationship with sleep quality
hormone ghrelin serves as a regulation of appetite, if the in overweight adolescents.
quality of sleep is bad there will be a decrease in leptin
and an increase in ghrelin is likely to increase appetite Drugs and substances showed no correlation
19
. This indicates that adolescents who have poor quality to sleep quality in overweight adolescents, given
sleep will cause an imbalance between the hormones that 94% of respondents did not consume drugs and
leptin and ghrelin, which are hormone absorbers and other substances that had good and bad sleep quality.
appetite stimulants which cause metabolic disorders in Medications can affect the sleep process. Some types of
the body. drugs that affect the sleep process are types of diuretic
drugs that cause insomnia, anti-depressants can suppress
The results also showed that physical exercise and REM, caffeine can increase sympathetic nerves that
fatigue, environment, disease, drugs and substance and cause sleep difficulties, beta blockers can have insomnia,
habits before going to bed did not have a significant and narcotics can suppress REM so easily drowsy.
relationship with the quality of sleep in overweight However, in the absence of facts about the consumption
adolescents. This is consistent with previous studies of drugs and other substances in the respondents, this
which suggested that physical exercise during the day study cannot prove the relationship between drugs and
will help a person sleep soundly at night 20. But heavy other substances with the quality of sleep in overweight
physical exercise can cause fatigue that will disrupt adolescents
someone’s sleep patterns. However, most respondents
did not do physical exercise and experience fatigue, This study also showed that there was no association
so this study could not prove the relationship between between eating habits before sleep and sleep quality in
physical exercise and fatigue with sleep quality in overweight adolescents. Based on the distribution of
overweight adolescents. data showed that as many as 68% of respondents have a
habit before going to bed that is watching television and
Based on the distribution of data shows that as many most have poor sleep quality. The theory stated earlier
as 88% of respondents have a comfortable environment that effective bedtime habits can reduce the awakening
with mostly poor quality sleep. The environment in time of someone between their sleeps. Based on the
which a person sleeps influences a person’s ability to fall theory and results of this study states that someone who
asleep 8. Sound, level of lighting, room temperature can has a habit before going to bed like watching television
affect sleep quality. Furthermore, most respondents were late at night will cause the poor sleep quality. However,
comfortable with the room environment, so that this study respondents mostly had the habits before going to bed,
could not prove the relationship between the environment but in the presence of other factors that affect sleep
and sleep quality in overweight adolescents. The disease quality such as stress and diet so this study could not
also does not have a significant relationship to the quality prove the relationship between habits before going to
of overweight adolescent sleep considering that 54% of bed and the quality of sleep in overweight adolescents
respondents did not have a disease or physical comfort
disorder both good and bad sleep quality. Based on the Conclusion
questionnaire filled out by respondents, they did not
experience physical problems, but thought of problems The results of this study indicated that the most of
before going to bed so that they were difficult to start respondents have poor sleep quality. Stress and diet have a
and wake up in the morning so that good quality sleep relationship with sleep quality in overweight adolescents
was not achieved. There is a problem before going to but physical exercise and fatigue, environment, disease,
bed like thinking about personal problems with friends drugs and substance, and bedtime habits have no
can also interfere with the quality of sleep respondents. association with sleep quality in overweight adolescents.
Ethical Consideration: This study has obtained the 9. Kozier B. Fundamentals of Nursing: Concepts,
feasibility of ethical review in the Health Research Process and Practice. Pearson Education; 2008.
Ethics Commission of the Faculty of Nursing, Airlangga
10. Meltzer LJ, Avis KT, Biggs S, Reynolds AC,
University, Surabaya, Indonesia with No. 130-KEPK.
Crabtree VM, Bevans KB. The Children’s Report
Conflict of Interest: The author reports no conflict of of Sleep Patterns (CRSP): a self-report measure of
interest of this work. sleep for school-aged children. J Clin Sleep Med.
2013;9(03):235-245.
Source of Funding: This study is done with individual
11. D.W. B, D. L, M. Z, et al. Sleep in overweight
funding
adolescents: Shorter sleep, poorer sleep quality,
sleepiness, and sleep-disordered breathing. J
References Pediatr Psychol. 2007;32(1):69-79. doi:10.1093/
1. Rivera JÁ, de Cossío TG, Pedraza LS, Aburto jpepsy/jsj104
TC, Sánchez TG, Martorell R. Childhood and 12. Nursalam N, Harsaktiningtyas K, Kurnia ID,
adolescent overweight and obesity in Latin Fadhillah H, Efendi F. Effect of bibliotherapy on
America: a systematic review. lancet Diabetes self-concept in children with mental retardation in
Endocrinol. 2014;2(4):321-332. SLB. Exec Ed. 2018;9(11):612.
2.
Organization WH. Commission on Ending 13. Bysse DJ, Reynolds III CF, Monk TH. The
Childhood Obesity. Facts and figures on childhood Pittsburgh Sleep Quality Index (PSQI): a new
obesity. World Heal Organ Geneva, Switz. 2014. instrument for psychiatric research and practice.
3. Caleyachetty R, Echouffo-Tcheugui JB, Tait CA, Psychiatry Res. 1989;28:193-213.
Schilsky S, Forrester T, Kengne AP. Prevalence 14. Service MC. Stress and Sleep. 2001.
of behavioural risk factors for cardiovascular
disease in adolescents in low-income and middle- 15. Birketvedt GS, Florholmen J, Sundsfjord J, et al.
income countries: an individual participant data Behavioral and neuroendocrine characteristics
meta-analysis. Lancet Diabetes Endocrinol. of the night-eating syndrome. Jama.
2015;3(7):535-544. 1999;282(7):657-663.
4. Kesehatan K, RI KK. Riset kesehatan dasar. 16. Gower B, Hand CE, Crooks ZK. The relationship
Jakarta Badan Penelit dan Pengemb Kesehat Dep between stress and eating in college-aged students.
Kesehat Republik Indones. 2013. Undergrad Res J Hum Sci. 2008;7:1-9.
5.
Biro FM, Wien M. Childhood obesity 17. Kim TW, Jeong J-H, Hong S-C. The impact of
and adult morbidities–. Am J Clin Nutr. sleep and circadian disturbance on hormones and
2010;91(5):1499S-1505S. metabolism. Int J Endocrinol. 2015;2015.
6. Chaput J-P, Dutil C. Lack of sleep as a contributor 18. Adam TC, Epel ES. Stress, eating and the reward
to obesity in adolescents: impacts on eating and system. Physiol Behav. 2007;91(4):449-458.
activity behaviors. Int J Behav Nutr Phys Act. 19. Taheri S, Lin L, Austin D, Young T, Mignot E.
2016;13(1):103. Short sleep duration is associated with reduced
7. Pacheco SR, Miranda AM, Coelho R, Monteiro leptin, elevated ghrelin, and increased body mass
AC, Bragança G, Loureiro HC. Overweight index. PLoS Med. 2004;1(3):e62.
in youth and sleep quality: is there a link? 20. Stassi ME, Harkreader H, Hogan MA, Thobaben
Arch Endocrinol Metab. 2017;61(4):367-373. M. Fundamentals of Nursing: Caring and Clinical
doi:10.1590/2359-3997000000265 Judgment. Saunders; 2007.
8. Potter PA, Perry AG. Buku ajar fundamental
keperawatan: konsep, proses, dan praktik. Jakarta
Egc. 2005;1.
Carbon Emission Disclosure in Manufacturing Companies in

Indonesia
Bangun Tri Saputro1, Basuki1

1
Department of Accounting, Faculty of Economics and Business, Universitas Airlangga, Jl. Airlangga 4,
Surabaya, East Java
Abstract
Background: Industries that are established in Indonesia with the materials of coal, oil, and gas are the
largest contributors to environmental pollution. Rapid industrial development in Indonesia has a negative
impact on the decline in environmental quality. Companies participation in preventing environmental
pollution creates carbon emission disclosure in contributing to reducing greenhouse gases.
Objective: This study aimed to determine the effect of firm size, media exposure, profitability, and leverage
on carbon emission disclosure in companies listed on the Indonesia Stock Exchange with PROPER criteria.
Method: This study was conducted by taking samples of 144 companies from 2011 to 2013. Company
samples were selected through a purposive sampling method with PROPER criteria obtained from the
Ministry of Environment Publication and have been listed on the Indonesia Stock Exchange from 2011
2013. This study used quantitative types of research. Data were then analyzed using regression analysis.
Results: Mean carbon emission disclosure during 2011-2013 was 0.588 which showed that there was no
extreme variation in carbon emission disclosure data. Mean total assets of the company in this study was 29.49.
Mean profitability with Return On Asset was 0.08. The mean company revealed in the media from 2011-2013
was 0.32 (32.4%). The mean value of leverage was 0.42 (42.4%), and there was no extreme value.
Conclusion: Variables that affected carbon emission disclosure are firm size, media exposure, and leverage
that significantly influence partially. However, the profitability variable did not show a significant effect on
carbon emission disclosure.
Keywords: Carbon Emission Disclosure, Company, PROPER, Environmental Pollution
Introduction have a negative impact on the environment. Retention

of carbon and greenhouse gases has always increased
Human involvement in climate change is currently from year to year 1. This happens because of industrial
a concern for some people. The Industrial Revolution activities that cause the transition of forest functions
that occurred in the 18th century in England caused and the use of non-renewable natural resources, such as
significant changes to the development of the industry natural gas and coal 2. Environmental pollution is one of
in the world, including in Indonesia. The revolution the causes of global warming until now.
succeeded in transforming the industry which initially
moved slowly into rapidly. However, these changes In 1997, a protocol was held in Japan called
the Kyoto Protocol which regulated the reduction
Corresponding Author: of greenhouse gas emissions, and also established
Basuki procedures, targets, mechanisms for reduction, and
Department of Accounting, procedures for structuring and resolving disputes. Kyoto
Faculty of Economics and Business, Protocol explained that there are three types of emission
Universitas Airlangga reductions that are flexible for industrial countries,
Jl. Airlangga 4, Surabaya, East Java, 60286 namely clean development, joint development, and
Email: basuki.basuki10@yahoo.com emission trading 3. In 2004, Indonesia signed the Kyoto
Protocol as written in Law Number 17 of 2004. This disclosure 11. In PSAK 1 of 2015 paragraph 14, it is
proves that Indonesia’s efforts to participate in protecting stated that there are reports that add to the value of the
the environment are because Indonesia has industry as company relating to the disclosure of carbon emissions3.
large as other developed countries. Disclosure of carbon emissions has a significant impact
on the business activities and operations of the company4.
Participation in protecting the environment must
also be considered by every company by reducing In this study, there were four independent variables
greenhouse gases so as to create a Carbon Emission that influence the disclosure of carbon emissions,
Disclosure 4. Disclosure of carbon emissions has been including firm size, media exposure, profitability, and
carried out in several industrial countries, such as leverage. The size of the firm or company has a positive
Australia, China, Brazil, the European Union, Mexico, influence between firm size and total assets on carbon
India, and America. Most countries that disclose carbon emission disclosure because companies that have good
emissions are developed countries 5. However, in finance will disclose information that signals that the
Indonesia, this is still rarely found because there are still company can prepare itself for certain times, especially
several factors that must be considered in the disclosure regarding environmental issues to respond more timely
of carbon emissions. There are factors that influence the and effectively 6. Submitting news about environmental
disclosure of carbon emissions, i.e. firm size, leverage, disclosures involves the role of both electronic and
company performance, market to book ratio, Kyoto printed media. The media has a positive influence on the
Protocol, Return On Assets, and Return On Equity disclosure of carbon emissions and is considered as the
3
. The independent variables are developing country driver of the emergence of several environmental groups
basis, leverage, profitability, growth, firm size, carbon 8
. Another predictor that acts as an independent variable
emission, the legal system, emission trading scheme, is profitability. Profitability using Return of Asset has
and asset newness 6. a strong influence on disclosure of carbon emission 11.
In a legitimacy perspective, the relationship between
One theory that relates to disclosure of environmental
leverage and disclosure of carbon emissions has a level
social responsibility is legitimacy theory. The theory can
that is inconsistent and is considered a constraint factor3.
disclose social and environmental information which
Based on the background above, this study aimed to
then becomes a consideration in economic, social, and
examine the factors that influence the broad disclosure
political factors in the business context 3. Legitimacy
of carbon emissions in companies in Indonesia.
is a fact that the company discloses as a reaction to
environmental, economic, social and political factors
7
. The legitimacy will be considered in the economic Method
performance of a company as long as the company The data sources were from the Indonesia Stock
produces profits 8. According to the viewpoint of Exchange which consist of the company’s annual
legitimacy theory, the higher the leverage of a company, report and sustainability report. Sampling was done by
the greater the amount of emission disclosure 9. The selecting the PROPER recipient companies. PROPER is
positive coefficient has an increase in the leverage ratio a Corporate Performance Rating Program published by
of 2.14, thus increasing the level of carbon emission the Indonesian Ministry of Environment and Forestry.
disclosure 10. The company is divided into five categories which are
represented in color, namely gold, green, blue, red, and
Stakeholder theory indicates that organizations get
black. The dependent variable used was the disclosure
differences in demand and pressure from stakeholders.
of carbon emissions which in its measurement used a
Each has different views and expectations regarding
checklist containing an information request sheet 11.
the desires of the organization that have an impact on
The checklist sheet has been developed by the Carbon
the decision-making process 5. This theory is used to
Disclosure Project, a non-profit organization that holds
determine the behavior patterns of other actors other than
information on climate change in the world.
shareholders who have an interest in each company’s
activities and obtain information related to the activities The category of companies chosen in this study
of other companies 3. Disclosure of carbon emissions is a were companies that had gold, green and blue PROPER
relatively new reporting concept and includes voluntary listed on the Indonesia Stock Exchange during the 2011-
2013 period with the category of manufacturing and ROA = Return On Asset
mining companies. The gold color indicates that the e = Error
company has demonstrated environmental excellence in
Leverage = Total debt/Total asset
production or service and has ethics and is responsible
for the surrounding community. Green indicates that the The number of samples in this study was 38
company has carried out environmental management companies for three periods so that total observations
more than is required through the implementation of were obtained as many as 114 observational data.
an environmental management system and utilizing
resources efficiently and carrying out social responsibility
Results
well. The blue color indicates that the company has
made environmental management efforts. The data In table 1, it can be seen that the disclosure of carbon
that had been collected were then analyzed using SPSS emissions that have been carried out by the company in
software using multiple linear regression analysis with the annual report and the sustainable report is at least 0.
the equation model as follows: Of the 114 samples of the company studied, there were
Y = α + β1 Size+ β2 Med_Exp + β3 ROA + β4 Leverage + e several companies that did not report or disclose carbon
emissions. Only companies with gold and green PROPER
Annotation: ratings have made ongoing reports. In the annual report,
Y = Carbon Emission Disclosure the company had actually provided information related
to Corporate Social Responsibility but had not revealed
α = Constant
the disclosure of carbon emissions that were outlined by
β1- β4 = Regression coefficient
companies that were the object of study. It can be said
Size = Firm size that the awareness of carbon emissions disclosure was
Med_Exp = Media Exposure still very low.
Table 1: Overall Variable Data
Carbon Emission Media

Size ROA Leverage N
Disclosure Exposure
Mean 0.58 29.49 0.32 0.08 0.42 114
Median 0.72 29.74 0.00 0.06 0.41 114
Maximum 1.00 32.67 1.00 04.1 1.49 114
Minimum 0.00 26.61 0.00 -0.41 0.00 114
Std. Deviasi 0.32 1.54 0.47 0.11 0.22 114
Table 2: Carbon Emission Disclosure Data for the 2011-2013 Period
Year Mean Maximum Minimum Std. Deviation Observation

2011 0.51 1.00 0.00 0.31 114
2012 0.60 1.00 0.00 0.31 114
2013 0.64 1.00 0.00 0.34 114
In table 2 it can be seen that the average disclosure of carbon emissions during the 2011-2013 period is 0.58. The
companies as the samples of this study had made disclosures of 7.64 = 7-8 of the 18 items disclosed by the Carbon
Development Program. Variations in carbon emissions disclosure data had a standard deviation value of 0.32 which
indicated that there was no extreme data because the value was below the mean. Table 3 shows that the average
is 29.49. The minimum value in table 4 shows a negative value. This is because the company’s ability to generate
profits through the assets used had a loss.
Table 3: Data on Firm size for the 2011-2013 Period
Year Mean Maximum Minimum Std. Deviasi Observasi

2011 29.35 32.67 26.61 1.58 114
2012 29.53 31.84 26.71 1.49 114
2013 29.60 31.98 26.65 1.57 114
Table 4: Data on Profitability for the 2011-2013 Period

2011 0.10 0.41 -0.03 0.10 114
2012 0.09 0.40 -0.05 0.10 114
2013 0.06 0.40 -0.41 0.13 114
Table 5 shows that in 2011 and 2012 the means are the same, which is equal to 0.28 and in 2013 the mean is 0.39.
This shows that the company revealed in the media on average from 2011-2013 was 0.32 (32.4%). Analysis with
media exposure variables is used to see the value of the role of the media in revealing every event related to carbon
emissions disclosed by the company.
Table 5: Data Exposure Media for the 2011-2013 Period

2011 0.28 1.00 0.00 0.45 114
2012 0.28 1.00 0.00 0.45 114
2013 0.39 1.00 0.00 0.49 114
Mean leverage in the 2011-2013 period in table 6 is 0.42 (42.4%) and the standard deviation is 0.22. It showed
that the mean value was higher than the standard deviation so there was no extreme value on the leverage variable.
Table 6: Leverage Data for the 2011-2013 Period

2011 0.42 1.49 0.02 0.27 114
2012 0.41 0.78 0.03 0.19 114
2013 0.43 0.90 0.03 0.20 114
Table 7: Data Panel Regression Test Results with Random Effect Models
Variable Coefficient Std. Error t-statistic Probability

CED -1.80 0.69 -2.59 0.01
Size 0.07 0.02 3.44 0.00
ROA -0.17 0.19 -0.86 0.38
Med_Exp -0.07 0.03 -2.12 0.03
Leverage 0.19 0.09 2.14 0.03
Based on table 7, the regression analysis equation is obtained as follows:
CED = -1.80 + 0.07Size - 0.17ROA - 0.07Med Exp + 0.19Lev

The carbon emissions disclosure constant was -1.80. reverse relationship with carbon emission disclosure 14.
This is because there was a considerable difference The media doesn’t overly expose companies that have
between the scale on the dependent variable and the published disclosures on carbon emissions. Companies
independent variables. The constant value of each that reveal a little will be highlighted by the media. This
variable is the intersection between the x and y-axes. is not in line with the legitimacy theory which states
The value of C is the intercept value for all existing that companies exposed to the media will tend to make
companies. The intercept value of the variables in the disclosures as a motivational basis for companies to be
model explains the intercept together on the model, better.
while the intercept value for each sample company
Profitability with a Return on Asset proxy showed a
explains the intercept for each company. To determine
non-significant effect on disclosure of carbon emissions
the value of disclosure of carbon emissions of each
disclosure 11. The condition of the study sample showed
company, the value of C is reduced by the value of each
that many companies were in a high-profit condition,
company intercept.
but there were 6 companies that suffered losses. Return
Disclosure of carbon emissions has been explained on Asset is not included in the aspect that sufficiently
by independent variables (12.87%) and other variables affects the disclosure of carbon emissions so that it is
(87.13%) which were not mentioned in the research not significant and has a negative effect 3. The higher
model. Partial panel data regression analysis on the Return On Asset, the less disclosure of carbon emissions
independent variables on the dependent variable with will be. The significance test value of the t-statistical test
a confidence level of 0.05 (α = 5%) showed that the with the Random Effect Model estimation model with
Return On Asset variable did not significantly influence a probability value of 0.03 was less than the required
the disclosure of carbon emissions for three periods. The significance of 0.05 (α = 5%). According to the theory of
size of the company, media exposure, and leverage had legitimacy, the higher the leverage ratio, the higher the
a significant effect on the disclosure of carbon emissions amount of disclosure disclosed.
for three periods.
Conclusion
Discussion
Firm size showed a significant positive effect on
The firm size had a significant positive effect on carbon emissions disclosure. Media exposure as an
disclosure of carbon emissions because the larger the assessment criterion showed a significant negative effect
size of the firm, the higher the disclosure of carbon on carbon emissions disclosure. Proxy profitability using
emissions. Large scale companies have greater social Return On Asset showed insignificant results on carbon
and political pressure compared to smaller companies. emissions disclosure. Leverage calculated by using
This pressure comes from the spotlight of stakeholders total liabilities divided by firm size showed positive
who want more relevant and reliable information, significant results. The implications of this research can
including information on the disclosure of carbon be used as consideration in choosing a place to invest in
emissions 12. Large companies will do more disclosures companies that are more concerned about environmental
to get high expectations in terms of the environment and conditions and preserving nature.
the demand from several stakeholders 6. The size of the
Ethical Clearance: This research is in accordance with
firm has a positive and significant effect on disclosure of
ethical clearance, has not been published before and is
greenhouses because large companies will be more open
not being considered for publication elsewhere.
and do more disclosures to face any criticism from the
public 13. Large companies are very aware of disclosures Conflict of Interest: There is no conflict of interest in
other than any environmental disclosures because this study.
companies with large sizes tend to be higher in disclosure
compared to small companies. Media exposure showed Source of Funding: This research was carried out by a
significant and negative influence so that it had a team and funded independently.
References 7. Guthrie J, Parker LD. Corporate social reporting:

a rebuttal of legitimacy theory. Account Bus Res.
1. Martinez LH. Post industrial revolution human
1989;19(76):343–52.
activity and climate change: Why The United
States must implement mandatory limits on 8.
Patten DM. Intra-industry environmental
industrial greenhouse gas emmissions. J L Use disclosures in response to the Alaskan oil spill:
Environ Law. 2005;403–21. a note on legitimacy theory. Accounting, Organ
Soc. 1992;17(5):471–5.
2. Sevastyanov VG, Simonenko EP, Simonenko
NP, Stolyarova VL, Lopatin SI, Kuznetsov NT. 9. Borghei Ghomi Z, Leung P. An empirical analysis
Synthesis, vaporization and thermodynamic of the determinants of greenhouse gas voluntary
properties of superfine Nd2Hf2O7 and Gd2Hf2O7. disclosure in Australia. 2013;
Eur J Inorg Chem. 2013;2013(26):4636–44.
10.
Stanny E, Ely K. Corporate environmental
3. Prado-Lorenzo J-M, Rodriguez-Dominguez L, disclosures about the effects of climate
Gallego-Alvarez I, García-Sánchez I-M. Factors change. Corp Soc Responsib Environ Manag.
influencing the disclosure of greenhouse gas 2008;15(6):338–48.
emissions in companies world-wide. Manag
11. Bae Choi B, Lee D, Psaros J. An analysis of
Decis. 2009;47(7):1133–57.
Australian company carbon emission disclosures.
4. Saka C, Oshika T. Disclosure effects, carbon Pacific Account Rev. 2013;25(1):58–79.
emissions and corporate value. Sustain
12.
Patten DM. Exposure, legitimacy, and
Accounting, Manag Policy J. 2014;5(1):22–45.
social disclosure. J Account public policy.
5.
Gonzalez-Gonzalez JM, Zamora Ramírez 1991;10(4):297–308.
C. Voluntary carbon disclosure by Spanish
13. Chithambo L, Tauringana V. Company specific
companies: an empirical analysis. Int J Clim
determinants of greenhouse gases disclosures. J
Chang Strateg Manag. 2016;8(1):57–79.
Appl Account Res. 2014;15(3):323–38.
6. Luo L, Tang Q, Lan Y-C. Comparison of propensity
14. Wang J, Song L, Yao S. The determinants of
for carbon disclosure between developing and
corporate social responsibility disclosure: evidence
developed countries: A resource constraint
from China. J Appl Bus Res. 2013;29(6):1833.
perspective. Account Res J. 2013;26(1):6–34.
The Effectivity of Brain Gym and Memory Games Therapy

for Improving Cognitive Function in Elderly People with
Dementia
Maulana Arif Murtadho1, Elida Ulfiana1, Setho Hadi Suyatmana1

1
Faculty of Nursing, Universitas Airlangga, Mulyorejo street, Surabaya (60115), Indonesia
Abstract
Background: The aging process impacts cognitive impairment can cause dementia. Elderly with dementia
will experience a disruption in daily activities. Dementia leads to spatial disorientation (indoor), resulting in
the tendency of wandering and lost. Precautions are needed to impede the negative impact of dementia, such
as an activity that can enhance the cognitive ability of elders. Brain Gym and therapeutic memory games
can become a way to reduce dementia’s effect because they can stimulate the memory and cognitive ability
of elders.
Objective: The purpose of this study was to compare the efficacy of therapy Brain Gym and memory games
against cognitive therapy elderly with dementia
Method: This study is comparative study using sample of 16 people. The sampling technique used was
total sampling. The independent variables in this study were the Brain Gym and therapeutic intervention
of Memory Games. The dependent variable in this study was the cognitive function of the elderly. The
instruments for this research used MMSE form and statistical tests Paired-Samples T-Test and Independent
Samples T-Test.
Result: The results showed the value of the cognitive function in the intervention group therapy Memory
Brain Gym and Games with the result that significant p = 1.000 p> 0.05, which means there was no difference
effectiveness of an increase in cognitive function after being trained Brain Gym and therapeutic Memory
Games. Both of them can improve the cognitive function of the elderly with dementia.
Conclusion: Brain Gym and therapeutic Memory Games equally improve cognitive function in older adults
with dementia
Keywords: Cognitive function of elderly, dementia, Brain Gym, Therapy Memory Games
Introduction that there is a tendency to wandering and (2). Dementia

occurs due to various things. First, dementia is caused
Dementia can have an impact on emotional, by amyloid mutations. Amyloid plaques come from
physical, and psychological disorders (1). Elderly with larger proteins, amyloid precursor proteins or Amyloid
dementia will experience a disruption in daily activities Precursor Proteins (APP) and cause brain tissue damage.
and result in the disorientation of spatial (room), so Secondly, dementia is caused by neurofibril tangling.
A neurofibrillary node is a group of twisted nerve cell
fibers, called helical filament pairs. Third, acetylcholine
and other neurotransmitters are chemicals that are
needed to send messages across the nervous system
Elida Ulfiana (3)
. Neurotransmitter deficits cause the breakdown of
Faculty of Nursing, Universitas Airlangga,
complex communication processes between cells in
Mulyorejo street, Surabaya (60115), Indonesia
the nervous system associated with Behavioral and
Phone: +6281999201024
Psychological Symptoms of Dementia.
Email: elidaulfiana@yahoo.com
In the elderly, memory is one of the cognitive two groups with characteristics that are more or less the
functions that are often to be declined. Long-term same in one analysis (2). This study intended to assess
memory is rarely changed, while short-term memory can the cognitive function of the elderly before and after
be instantaneously deteriorates in 0-10 minutes. Some treatment, then the results of two group were analyzed.
studies stated that brain gym and memory games therapy The design of this study is as follows:
can prevent dementia. Brain gym and memory games
can be used to stimulate cognitive function at every
Table 1: Comparative study design of the influence
stage of the game, and are proven effective in improving
of brain gym and memory games therapy on
cognitive function in the elderly (4).
improving cognitive function in the elderly
The benefits of brain gym include reducing emotional
Subject Pretest Treatment Posttest
stress and clearer mind, improving the relationship
B B₀ IB B1
between humans and learning atmosphere/work more
relaxed and happy, increasing the language and memory M M₀ IM M1
skills, causing people become more enthusiastic, more Description
creative and efficient, people will feel healthier because B: Brain gym treatment group
of reduced stress and improving their learning and
M: Memory Games treatment group
work performance (2). While Memory Games therapy
can activate sensory functions both visual, auditory B₀: first observation (before Brain gym)
and touch receptors from the body’s surface and even B1: second observation (after Brain gym)
provide psychomotor stimulation. The various sensory M₀: first observation (before Memory games)
organs become thousands of information that received
M1: second observation (after Memory games)
by the nervous system. Then integrated to determine an
immediate body reaction. The memories can be stored in IB: Brain gym intervention
the brain for minutes, weeks or years and they can help IM: Memory games therapy intervention
determine the body’s reaction in the future (5).
Sample and the population of the study: The target
Memory Games therapy is an activity that focuses population in this study were 16 elderly people with
on tasks or games that lead to cognitive (memory) dementia disorders who were in the nursing home.
in which the therapist guides members of therapy to The inclusion criterion for the elderly were aged 60-70
take the prescribed steps (6). Memory capabilities only years, experienced a decline in cognitive function at a
occur in human learning, which is a crucial process for sufficient and insufficient score, at least have ever been
humans by flowing information captured by the senses, experienced in elementary education
forwarded, reduced, collaborated, rediscovered, and
utilized (7). The purpose of this activity is to make closer Sampling Technique: This study used a total sampling
technique which means that the number of samples is the
the relationship between the participants, to stimulate
same as the population (9).
the cognition and communication in every stage of
the game, and to foster cohesiveness and sharing, and Variable of the Study: The independent variable in this
participants can socialize (8). study was Brain gym intervention and Memory Games
therapy. While the dependent variable in this study was
This study aimed to find out whether there were
the cognitive function of the elderly.
significant differences in the effectiveness of brain gym
therapy and memory games for elderly people suffering Research Instrument: The instrument in this study, in the
from dementia. Furthermore this study was also purposed intervention variable, was using a comparison between
to identify cognitive function in the elderly group of Brain gym which consists of activities stimulating the
dementia before and after therapy using both methods. right and left brain (Lateral Dimension), relaxes the front
and rear brain parts (Focusing Dimension), stimulates the
Material and Method of Research system associated with emotional or feeling, namely the
brain middle and cerebrum (Centering Dimension) with
This study was a comparative study, conducted by memory games therapy consists of stages of orientation,
comparing the conditions before and after treatment in intervention, and evaluation (10).
Whereas the dependent variable used the MMSE Data Analysis

(Mini-Mental State Examination) form, which consists of
an assessment of time and place orientation, registration, The initial analysis of the data was carried out, by
attention and calculation, recall, and language skills. editing, coding, scoring, and data entry. The data was
Patients were assessed quantitatively on these functions, processed and statistical analyzed using the Paired-
perfect values are 30 (2). Sample T-Test with a significance level of p 5 0.05
(SPSS program) with the aim of comparing between the
two sample groups. The scale of the data used is ordinal.
Results
Table 1: Cognitive function in elderly with dementia before and after Brain Gym was implemented
Before After
No. Cognitive Function
Treatment % Treatment %
1. Good (MMSE value ranged from 27-30) 0 0 0 0
2. Moderate (MMSE value ranged from 22-26) 0 0 2 25
3. Poor (MMSE value < 21) 8 100 % 6 75
Total 8 100 % 8 100 %
Table 1 shows that there is a cognitive function improvement of the elderly in the treatment group. With the
elderly interacting in an activity, cognitive abilities will be formed because of the influence of the environment in
which the surrounding environment can facilitate orientation abilities, attention to be able to stimulate a person’s
cognitive functions. Besides, social influence or social transmission can support the process of the cognitive ability
of the elderly.
Table 2: Cognitive functions before and after Memory Games therapy was implemented
Before After
No. Cognitive Function
Treatment % Treatment %
1. Good (MMSE value ranged from 27-30) 0 0 0 0
2. Moderate (MMSE value ranged from 22-26) 0 0 3 37.5 %
3. Poor (MMSE value < 21) 8 100 % 5 62.5 %
Total 8 100 % 8 100 %
Based on the table above, the cognitive function in the group before being the treatment was considered as poor.
While the post-treatment results showed an increase in the cognitive function abilities of respondents, however, did
not show an increase in cognitive function abilities as expected by researchers. This is possible because respondents
experienced dementia which was aggravated by the absence of activities that could improve the memory of the
respondents while in the nursing home (1).
Table 3: Cognitive function of the elderly with dementia before and after Brain Gym and Memory Games
were implemented
Brain Gym Terapi Memory Games

Criteria Before After Before After
S % S % S % S %
Good (27-30) 0 0 0 0 0 0 0 0
Average (22-26) 0 0 2 25 0 0 3 37.5
Poor (<21) 8 100 6 75 8 100 5 62.5
S 8 100 8 100 8 100 8 100
Table 4 shows that all groups have less cognitive function values before the intervention was implemented.
After Brain Gym and Memory Games therapy was implemented, there was an increase in the value of the cognitive
function in both groups.
Table 4: Cognitive function value of elderly with dementia before and after Brain gym and Memory Games
therapy was implemented
Cognitive Function Value

Brain Gym Memory games Therapy
No.
Pre Post Differences Pre Post Differences
1. 18 19 1 19 21 2
2. 20 22 2 18 19 1
3. 18 18 0 20 22 2
4. 20 22 2 19 20 1
5. 20 21 1 20 22 2
6. 17 17 0 19 20 1
7. 19 21 2 20 22 2
8. 19 20 1 16 16 0
Mean 18.875 20 18.875 20.25
P = 0.007 Paired-Samples T, Test (p ≤ 0.05) P = 0.001 Paired-Samples T, Test (p ≤ 0.05)
P = 1.000 (p > 0.05) Independent T Test
The results of statistical analysis using the of the respondents experienced an increase in cognitive
Independent T-Test showed that the hypothesis was function. While in the Memory Games treatment group,
rejected. That means there was no difference in the the majority of respondents had their cognitive functions
effectiveness of cognitive function improvement after increased. This is caused by severe dementia experienced
being treated by Brain Gym and Memory Games therapy. by respondents, and the lack of cognitive activity in the
Because both of Brain Gym and Memory Games therapy institution which causes a dull cognitive function of the
were improving the cognitive function of the elderly elderly. According to the results of the study, Brain Gym
with dementia. can improve cognitive function in elderly people with
dementia. In addition, brain exercise can significantly
Discussion improve the cognitive function of the elderly (11). The
positive impact of Brain Gym on the elderly, after 2
Based on the results of the study, the data shows
weeks of implementation there has been an increase in
that there was no difference in cognitive function
memory (cognitive) function, concentration, attention,
improvement effectivity after being treated by Brain
and alertness to reduce senility or dementia. The method
Gym and Memory Games therapy in the elderly with
of Brain Gym can improve brain performance to better
dementia because both Brain Gym and Memory Games
cognitive function in the elderly group of dementia
therapy improved cognitive function in the elderly.
before and after Memory Games therapy.
From the results in the Brain Gym treatment group, half
Brain Gym will stimulate brain function which Conclusion

consists of three dimensions which are interconnected
as one unit, among others: stimulating (Dimensions This research shows that there was no significant
of Laterality), alleviating (Dimension Focusing), and difference in effectivity between Brain Gym and therapy
relaxing (Dimensions of Certering) (2). Brain Gym itself of Memory Games. Because both of them also enhance
aims to maintain the optimal balance between the right the cognitive function of elders with dementia symptoms.
and the left brain. Brain Gym provides a repair stimulus Ethical Clearance: The study process involved
to the fibers in the corpus callosum that provide many participants in the survey using a questionnaire that is
two-way neural connections between the cortical areas consistent with the ethical research principle is based
of both brain hemispheres. Including several brain on the regulation of the research ethics committee. The
structures including the hippocampus and amygdala.
present study principles were carried out in accordance
Brain gym movement reactivates the neural connections
with the research principles. This basic implementation
between the body and brain so as to facilitate the flow
study of the principle ethics of respect, beneficence,
of electromagnetic energy throughout the body. These
nonmaleficence, and justice.
movements support electrical and chemical changes that
take place on all mental and physical events (12). Conflict of Interest: There is no conflict of interest in
this study.
Decreasing cognitive function in the elderly can
be inhibited by implementing Brain Gym therapy. In Source of Funding: This research was carried out by a
the application of the Brain Gym method, there is a team and funded independently.
concentration dimension for the limbic (midbrain) and
cerebral cortex systems (11). Inside the cerebral cortex, References
there is a functional area that divides the functions of
each right and left hemisphere. The brain of the left 1. Pattanayak RD, Sagar R. Depression in dementia
hemisphere is largely tasked with regulating the right patients: issues and challenges for a physician.
body which functions to think logically, rationally, JAPI. 2011;59:647.
analyze, the ability to write and read, speak, time- 2. Kurniasari SF, Ulfiana E, Efendi F. The effect of
oriented, and things that are detailed, while the left brain sleep hygiene and brain gym on increasing elderly
is also the center of mathematics (13). comfort and sleep quality. Indian J Public Heal
Res Dev. 2018;9(12):589–94.
Memory Games therapy will be able to activate
sensory functions both visual, auditory and touch 3. Yusuf A, Indarwati R, Jayanto AD. Brain Gym
receptors from the body surface and even provide Improves Cognitive Function for Elderly. J Ners.
psychomotor stimulation. The various sensory organs 2017;5(1):79–86.
become thousands of information received by the
4.
Suryadinata RV, Wirjatmadi B, Adriani M,
nervous system and then integrated to determine an
Sumarmi S. Effects of knowledge of vitamin D
immediate body reaction and memories can be stored
on attitudes toward sun exposure among middle-
in the brain for minutes, weeks or years and they can
aged and elderly Indonesian adults. Indian J
help determine the body’s reaction in the future come.
Public Heal Res Dev. 2018;9(11):11–5.
Information storage is a memory process and is a
synapse function (14). 5. Thompson C, Henry JD, Rendell PG, Withall A,
Brodaty H. Prospective memory function in mild
Memory Games therapy allows someone especially cognitive impairment and early dementia. J Int
the elderly to be able to carry out activities in a group Neuropsychol Soc. 2010;16(2):318–25.
so that it stimulates sensory abilities that will support
cognitive function for action. In addition, these activities 6. Dartigues JF, Foubert-Samier A, Le Goff M,
will be able to motivate the elderly to communicate, Viltard M, Amieva H, Orgogozo JM, et al. Playing
socialize and be more creative who will support the next board games, cognitive decline and dementia:
life process. But this is not supported by the employment a French population-based cohort study. BMJ
history of the elderly and activities in his spare time (15). Open. 2013;3(8):e002998.
7. Harvis KA. Care plan approach to dementia. 12. Doewes M. Exercise and Brain Health in Elderly.
Geriatr Nurs (Minneap). 1990;11(2):76–8. Folia Medica Indones. 2009;45(2):161.
8. McCallum S, Boletsis C. A taxonomy of serious 13. Duara R, Grady PhD C, Haxby PhD J, Ingvar
games for dementia. In: Games for Health. D, Sokoloff L, Margolin RA, et al. Human
Springer; 2013. p. 219–32. brain glucose utilization and cognitive function
in relation to age. Ann Neurol Off J Am Neurol
9. Fahmi MZ, Haris A, Permana AJ, Wibowo DLN,
Assoc Child Neurol Soc. 1984;16(6):702–13.
Purwanto B, Nikmah YL, et al. Bamboo leaf-
based carbon dots for efficient tumor imaging and 14. Im ML, Lee JI. Effects of art and music therapy on
therapy. RSC Adv. 2018;8(67):38376–83. depression and cognitive function of the elderly.
Technol Heal Care. 2014;22(3):453–8.
10. Alasuutari P. Researching culture: Qualitative
method and cultural studies. Sage; 1995. 15. Zapirain BG, Zorrilla AM, Larrañaga S. Psycho-
stimulation for elderly people using puzzle game.
11. Miller DJ, Robertson DP. Using a games console
In: 2010 2nd International IEEE Consumer
in the primary classroom: Effects of ‘Brain
Electronics Society’s Games Innovations
Training’programme on computation and self‐
Conference. IEEE; 2010. p. 1–8.
esteem. Br J Educ Technol. 2010;41(2):242–55.
Effects of Intensity of Reading Short Stories Activites and

Retelling the Story on Elderly Cognitive Impairment
Devi Ayu Kumalasari1, Hanik Endang Nihayati1, Elida Ulfiana1, Rista Fauziningtyas1
1
Department of Nursing, Faculty of Nursing, Universitas Airlangga, Jl. Airlangga No.4 - 6, Airlangga,
Gubeng, Kota SBY, Jawa Timur
ABSTRACT
Introduction: Minimizing the risk of cognitive decline in the elderly can be done by developing the brain
activity, one of them is by reading the story and retelling the story again, but little attention has been paid
to the intensity of reading short stories and retelling the story against cognitive impairment in the elderly.
Objective: This study aimed to determine the effect of the intensity of reading short story activities and
retelling the story on the elderly cognitive impairment
Method: This was a pre-experimental study with one group pre and post-test design. The sample was
determined using the purposive sampling technique, with total sampe was 14 respondents who met the
inclusion and exclusion criteria. The independent variable was a reading short story and retelling the story,
the dependent variable was the cognitive function. The data were collected using MMSE questionnaires and
analyzed using the Wilcoxon test (α<0,005).
Results: The result indicated a therapeutic effect of reading short story activities and retelling the story on
the increase of elderly cognitive function (p=0.001). Most respondent experienced an increase in cognitive
function in the aspects of material recall which is equal to +1.15.
Conclusion: Reading short story and retelling the story activities can be used as an intervention to improve
the cognitive function of elderly. Future research is needed to confirm this study and qualitatively assesed
the benefits of this study.
Keyword: reading, retelling the story, cognitive function, elderly
Introduction to recall information that has been studied, this kind

of impairment not rarely found in the elderly so that it
Impaired cognitive function is one of the health affects the quality of life of the elderly where it can often
problems that can arise in adults where the majority make the elderly feel scared, embarrassed, and have
are elderly 1. Possible cognitive function disorders can a low self-esteem 2this qualitative, grounded-theory
be in the form of forgetfulness, which is the mildest study investigated the experiences and consequences
form of cognitive impairment. In this phase a person of becoming forgetful. In-depth interviews with 32
can still function normally even though it is difficult participants were conducted and analyzed. The findings
show that forgetfulness became part of daily life through
3 strategies, conceptualized as doing forgetfulness: (1.
One of the nursing intervention that can be applied to
Correspondence Author: overcome the problem of decreasing cognitive function
Hanik Endang Nihayati is using the memory enhancement techniques that can
Department of Nursing, Faculty of Nursing, be done through the cognitive activity, so that the results
Universitas Airlangga of better functioning or quality of life of the elderly can
Jl. Airlangga No.4 - 6, Airlangga, be achieved3. In 2015, 47.5 million people worldwide
Gubeng, Kota SBY, Jawa Timur 60286 suffered from dementia, 58% of these were residents of
Email: hanikendangnihay@yahoo.com developing countries, including Indonesia, and there were
7.7 million new cases each year 4,5. Dementia patients Method
certainly experience impaired cognitive function, the
condition complained by 39% of the elderly aged 50-59 Location for data collection was at UPTD Griya
years, increased to more than 85% at the age of more Werdha Surabaya, Indonesia. In this study used a Pre-
than 80 years6. The number of 80-year-old populations Experimental design with a One-group pre-post test
will increase to approximately four times to 395 million design. This study used one of the Non Probability
between 2000 and 2050, and the majority of the elderly Sampling techniques, namely purposive sampling. The
population are living in the developing countries7,8 populations were elderly in the Griya Werdha UPTD
including Indonesia. Surabaya, Indonesia with 76 elderly. The inclusion
criteria for the study were: (1) Elderly with mini mental
Based on preliminary data obtained by the interpretation status examination (MMSE) score ≤ 24;
researchers through an interview with nurses at the (2) Elderly who is able to read. While the research
UPTD Griya Werdha Surabaya, Indonesia, in April exclusion criteria are: (1) Elderly people who experience
2016, there were 76 elderly people treated. The most impaired vision without assistive devices and hearing
common health problems in the elderly at the institution senses that have not been corrected; (2) Elderly people
are dementia and hypertension, 39% or 30 of the elderly who experience verbal communication disorders; (3)
who live in the institution experience the impaired Elderly people who experience severe psychological
cognitive function. Elderly who can read is about 50% problems when the research is still ongoing so as to
of the total number of elderly people that live in the disturb the concentration level of the client; and (4)
nursing home. The UPTD Griya Werdha has carried out Elderly people involved in other research with the
several activities to improve or maintain cognitive levels same dependent variable. The samples size after being
in the elderly but some of the activities have not shown classified according to the inclusion and exclusion
a significant increase. criteria were as many as 14 people.
Cognitive health promotion in the elderly is affected Data were gathered by demographic questionnaire
by age-related changes, namely the brain degeneration, including age, gender, last education, occupation.The
decreased reaction time, negative functional independent variable in this study was the provision
consequences, which are a mild decrease in some
of treatment in the form of reading short stories (short
cognitive functions, slower reception of information,
stories) and retelling the contents of stories carried
and several risk factors, namely myths regarding
out by the elderly. While the dependent variable in
cognitive aging, decreased vision and hearing, side
this study was cognitive function. The instrument in
effects of alcohol and drugs, and also disease (dementia,
this study used to measure the dependent variable is
depression)3.If the decline in cognitive function in the
the mini mental symptom examination status sheet
elderly is not immediately addressed, it can lead to
(MMSE) as a pre-test and post-test. Mini mental status
an increase in the number of people with dementia.
examination (MMSE) there are various questions that
Reading stories by the elderly can improve cognitive
are used to measure cognitive function in the elderly.
functions, such as memory, intellectual function, and
This questionnaire contained 11 questions consisting
attention to the elderly, because reading is one of the
cognitive activities that can stimulate the brain to think of 5 material aspects, namely orientation, registration,
9
. Storytelling can build resilience 10 and reduce stress11 attention and calculation, recall, and language. Each
in the elderly. Retelling the contents of the story will question in the questionnaire has a quantitative answer
trigger thinking process, where it is one of the cognitive in the form of a score that is if the answer is correct, then
activities that affect cognitive function. Without effective it will be given a score of 1. The score will be summed
prevention there will be an increase in the incidence of with a maximum score of 30 and a minimum score of
cognitive function disorders in the elderly that can cause 0. The scores obtained by respondents are summed
inability to carry out daily activities and dependence on and categorized into 4 categories, namely 25-30 not
others to take care of themselves. Therefore, this study experiencing cognitive or normal function disorders, the
aimed to determine the effect of the intensity of reading number of scores 18-24 had mild cognitive impairment,
and retelling the story on the elderly at the UPTD Griya the number of scores 11-17 had moderate cognitive
Werdha Surabaya, Indonesia. impairment, and the number of scores 0-10 experienced
severe cognitive impairment. The mini mental status Conted…

examination (MMSE) was measured by the researcher,
Last Education
then the respondent was asked to answer questions in the
No Education 1 7,1
order of the list of MMSE questionnaires.
Not completed in primary school 1 7,1
Other instruments needed were short stories with Elementary school 5 35,7
fable themes with 4 different titles, namely Kancil and Junior high school 3 21,4
Crocodile, Ape Becomes King, Arrogant Rabbit and High school 4 28,6
Turtles, Little Frogs and Small Snakes. The theme of Total 14 100
folklore with 4 different titles, namely Keong Mas, Previous Occupation
the Miserable Poor, Lutung Kasarung, Timun Mas. Teacher 1 7,1
Indonesian fairy-tale theme with 4 different titles namely Employee 2 14,3
Bearded Weasel, Princess Melati Wangi, Putri Warna No occupation 3 21,4
Warni, Moon that Envy Hearts. The theme that consist of Entrepreneur 6 42,9
advice with 4 different titles is Jack the Slacker, the Sick Fisherman 1 7,1
and the Fire, the Farmer and his Children, a bundle of Laborer 1 7,1
wood. The theme of legend stories with 4 different titles Total 14 100
namely Tangkuban Perahu, Telaga Pasir, Origin of the
Freetime Activities
Bali Strait, Lake Toba. International fairy-tale themes
Reading 1 7,1
with 4 different titles, Gonbe and 100 Ducks, Star
Talk with others 1 7,1
Stories, Princess Rings, Five Potatoes. The tabulated
Watching TV 6 42,9
data was then processed using statistical tests by using
Wilcoxon test with a significant level of p ≤ 0.05. Cooking 3 21,4
Sports 1 7,1
Take a walk 1 7,1
Results Take a nap 1 7,1
Demographic characteristics of respondents Total 14 100
Table 1: Demographic characteristics of respondents Based on table 1 it shows the characteristics of 14

at UPTD Griya Werdha Surabaya, Indonesia respondents in the Griya Werdha UPTD based on the
age category, the majority of respondents aged 60-74
Demographic Data N % years, namely as many as 10 people (71.4%). Based on
Age gender, most of them are female, that is as many as 10
Elderly (60-74 years old) 10 71,4 people (71.4%). Based on the last education level most
Elderly (75-89 years old) 4 28,6 of them have elementary education, that is as many as 5
Total 14 100 people (35.7%). Based on previous work, most of them
Gender previously worked as entrepreneurs, as many as 6 people
Male 4 28,6 (42.9%). Based on free time activities, most of them are
Female 10 71,4 prefer to watch TV to spent their free time as many as 6
Total 14 100 people (42.9%).
Cognitive functions before and after an intervention was given in the form of reading short story and retell
the story.
Table 2: Distribution of respondents based on the level of cognitive function at UPTD Griya Werdha
Surabaya, Indonesia
Level Category PRETEST POSTTEST

Cognitive Function n % n %
Severe 0 0 0 0
Moderate 8 57,14 4 28,57
Conted…
Mild 6 42,86 8 57,14

Normal 0 0 2 14,29
Total 14 100 14 100
SD 3,245 4,159
WILCOXON test P = 0,001
Based on table 2, it can be seen that most cognitive functions before intervention are moderate as many as 8
elderly (57.14%). After being given an intervention to read short stories and retell the contents of the story, most of the
respondent’s cognitive functions were improved to the mild category as many as 8 elderly (57.14%). Analysis with
the Wilcoxon statistical test shows that p = 0.001 so that the value of p <0.05, this value shows that the intervention
given in this study was effective in improving cognitive function in the elderly.
Tabel 3: The results of pre-test and post-test on the elderly cognitive function at the Griya Werdha UPTD
Surabaya, Indonesia, based on MMSE material
Attention
Aspect Memory Language and
Orientation Registration and ∑
Material Recall Understanding
Calculation
Total Pre 70,00 23,00 60,00 10,00 72,00 234,00
Assesment Post 81,00 37,00 63,00 26,00 83,00 290,00
14 Resp. Pre 5,00 1,64 4,29 0,71 5,14 16,71
MEAN Post 5,79 2,64 4,50 1,86 5,93 20,71
∆ +0,79 +1 +0,21 +1,15 +0,79 +4
Based on table 3 shows that most of the respondents contents considered as an activity to train the brain that
experienced an increase in cognitive function, especially can improve memory or prevent dementia as well as
in memory recall, which is equal to +1.15. stimulate the mental to increase brain capacity which
can result in reorganization of neuro cognitive tissue,
Discussion suppress the detrimental effects of stress hormones on the
brain. Engaging in cognitive activities can improve brain
Reading short stories and retelling the contents of compensation for pathology condition by increasing
the story had a significant influence to the improvement brain reserves so as to protect or slow the clinical onset
of cognitive function in elderly, this is evidenced by of cognitive disorders and dementia 12.
an increase in cognitive function after intervention in
respondents. The result is in line with previous studies Improved cognitive function shows a significant
which showed that reading activities had an effect on relationship to aspect of material recall, material
cognitive function of the elderly 12. aspect that included in the cognitive aspects of verbal
memory. Memory is a storage of the knowledge that
A high cognitive function score will prevent the has been obtained and to be recalled. Memory enters
elderly from experiencing a decline in cognitive function the brain through synapse (information flow). The
which if it continues can lead to dementia. Dementia is three basic processes of memory are encoding (entering
not a natural thing, but it is a pathological condition information), storage (storage) and retrieval (generating
caused by the death or damage of brain cells so that returns) 16.
intellectual ability decreases. Decreasing cognitive
function always involves memory, usually in the form of Based on the theory of Carol A. Miller that focused
impairment of working memory (WM), abstract thinking on the role of nurses in slowing down the decline or
disorder, focusing-execution, poor decision making, and improving cognitive function of the elderly by giving
mood disorder 13–15. Reading and retelling the story’s intervention in reading short stories and retelling the
contents of the story to improve the health status of the Ethical Clearance: This study had obtained the ethical
elderly 3. Observations at the time of the intervention feasibility in the Health Research Ethics Committee of
showed that there were some respondents who showed the Faculty of Nursing, Airlangga University, Surabaya,
lack of enthusiasm and were a little inferior to other Indonesia with No. 131-KEPK.
respondents because the process of reading it was long,
unable to tell the story completely. One of the tasks Conflict of Interest: The author reports no conflict of
of author as nurses is to encourage the elderly and interest of this work.
provide motivation to the elderly to continue to follow Source of Funding: This study is done with individual
interventions with other respondents. The patient’s funding
demographics also affect the scope of significance of
reading and retelling the story’s content of the cognitive
References
function of the elderly.The incidence of impaired
cognitive function increases with age, every 5 years of 1. Centers for Disease Control and Prevention.
age progression the risk will be increased 2 times than Behavioral Risk Factor Surveillance System
normal 6 Gender is considered to affect one’s memory Questionnaire (English version). 2009. https://
even though there is no certainty between men and w w w. c d c . g o v / b r f s s / q u e s t i o n n a i r e s / p d f -
women. Women are thought to be more numerous and ques/2009brfss.pdf.
tend to be forgetful due to hormonal influences, namely 2. Imhof L, Wallhagen MI, Mahrer-Imhof R, Monsch
a decrease of estrogen in menopausal women, thus AU. Becoming forgetful: How elderly people
increasing neuro degenerative disease, because estrogen deal with forgetfulness in everyday life. Am J
is known to play an important role in maintaining brain Alzheimers Dis Other Demen. 2006;21(5):347-
function. In addition, the life expectancy of women 353. doi:10.1177/1533317506292499
is higher than the life expectancy of men, so that the
3. Miller CA. Nursing for Wellness in Older Adults.
population of older women is greater than men 17.
Lippincott Williams & Wilkins; 2009.
Then, most of the respondents were only educated
up to elementary level wherein education is a very 4.
Organization WH. DEMENTIA A PUBLIC
important factor in preventing cognitive impairment18. HEALTH PRIORITY. 2015:1-4.
Based on the research that has been done, most of the 5. Prince M, Guerchet M, Prina M. Policy Brief:
respondents previously worked as entrepreneurs. Work The Global Impact of Dementia 2013–2050.
that emphasizes thinking skills like an entrepreneur Alzheimer’s Dis Inter. 2013:1-8. https://www.alz.
who has a major influence on the neuropathology of co.uk/research/GlobalImpactDementia2013.pdf.
cognitive function disorders7. Most of the respondents
spend their free time by watching television. Watching 6. Wreksoatmodjo BR. Beberapa Kondisi Fisik dan
television such as entertainment programs can stimulate Penyakit yang Merupakan Faktor Risiko Gangguan
Fungsi Kognitif. Cdk-212. 2014;41(1):25-31.
the audience to think, it can actually slow down the
cognitive function impairment than those who watch 7. Mongisidi R, Tumewah R, Kembuan MAHN.
broadcasted news12. Profil penurunan fungsi kognitif pada lansia
di yayasan-yayasan manula di Kecamatan
Conclusion Kawangkoan. e-CliniC. 2013;1(1).
Based on the results of the study that conducted at 8. Hartono R, Ipa A, Wirjatmadi B, Amir A, Kapoor
Griya Werdha UPTD Surabaya, Indonesia, it can be G, Nugroho HSW. Elderly immunity improvement
concluded that there was an increase in cognitive function after getting sinbiotic and zinc combinations.
assessment scores in the elderly who experienced impaired Exec Ed. 2018;9(11):380.
cognitive function before and after the intervention by 9. Suzuki H, Kuraoka M, Yasunaga M, et al.
reading short stories and retelling the contents of stories. Cognitive intervention through a training program
The intensity of the activity had an effect on reducing for picture book reading in community-dwelling
or slowing down a cognitive function impairment in the older adults: a randomized controlled trial. BMC
elderly and especially in the memory recall aspect. Geriatr. 2014;14(1):122.
10. Gunnarsson AB, Peterson K, Leufstadius C, depression: validation by 2-year follow-up. Br J

Jansson J-Å, Eklund M. Client perceptions of the Psychiatry. 1984;144(5):488-492.
Tree Theme MethodTM: a structured intervention
15. Bazanis E, Rogers RD, Dowson JH, et al.
based on storytelling and creative activities.
Neurocognitive deficits in decision-making
Scand J Occup Ther. 2010;17(3):200-208.
and planning of patients with DSM-III-R
11. Crogan NL, Evans BC, Bendel R. Storytelling borderline personality disorder. Psychol Med.
Intervention for Patients With Cancer: Part 2— 2002;32(8):1395-1405.
Pilot Testing. In: Oncology Nursing Forum. Vol
16. Sherwood L. Fundamentals of Human Physiology.
35. ; 2008.
Cengage Learning; 2011.
12.
Wreksoatmodjo BR. Aktivitas Kognitif
17. Barford A, Dorling D, Smith GD, Shaw M. Life
Mempengaruhi Fungsi Kognitif Lanjut Usia di
expectancy: women now on top everywhere.
Jakarta. Cdk-224. 2015;42(1):7-13.
2006.
13. Ferrier IN, Stanton BR, Kelly TP, Scott J.
18. Ardila A, Ostrosky-Solis F, Rosselli M, Gómez
Neuropsychological function in euthymic
C. Age-related cognitive decline during normal
patients with bipolar disorder. Br J Psychiatry.
aging: the complex effect of education. Arch Clin
1999;175(3):246-251.
Neuropsychol. 2000;15(6):495-513.
14. Rabins P V, Merchant A, Nestadt G. Criteria
for diagnosing reversible dementia caused by
The Influence of Dhakonan Games to Impede Dementia in

Elders
Mita Nur Lathifah1, Joni Haryanto1, Rista Fauziningtyas1

1
Faculty of Nursing, Universitas Airlangga, Mulyorejo street, Surabaya (60115), Indonesia
Abstract
Background: Dementia can interfere the elderly in their daily activities. One of therapy that suitable for
people with dementia is memory therapy using a traditional game, known as dhakonan.
Objective: The purpose of this study was to explain the influence of traditional dhakonan games on the level
of dementia severity in the elderly.
Method: The research uses quasy-experimental design. The total sample was 20 respondents who met the
inclusion criteria, namely the elderly with symptoms of dementia. The sampling technique used simple
random sampling. The independent variable was a traditional dhakonan game, the dependent variable
was cognitive function, depression level, and dementia level. Data were collected using a Mini Mental
State Examination (MMSE) design questionnaire, Geriatric Depression Scale (GDS) questionnaire, and
Functional Assessment Staging Tool (FAST). Data analysis was carried out using the Wilcoxon Sign Rank
Test and Mann Whitney Test with a significance level of α <0.05.
Result: Wilcoxon Sign Rank Test obtained p value <0.05 for cognitive function, depression level, and
dementia level in the treatment group (cognitive function, p = 0.005; depression level, p = 0.005; dementia
level, p = 0.014). There was the influence of traditional dhakonan games on the level of dementia in the
elderly.
Conclusion: Traditional dhakonan games can significantly improve cognitive function, reduce depression,
and prevent the progression of dementia.
Keywords: traditional dhakonan games, elderly, cognitive function, depression, dementia
Introduction emotional, behavioral and motivational control. Risk

factors that can cause dementia include vascular disease
Dementia is a neurodegenerative syndrome that in the brain, coronary artery disease and atherosclerosis
arises due to chronic abnormalities and a progressive (2). The more the number of elderly people, the more
degradation in intellectual ability which results in a likely the incidence rate of dementia, because age is one
decrease in cognitive function, causing disruption of of the factors causing dementia (3)
social functioning, work, and daily activities (1). There
is no disorder of consciousness but there are impaired Dementia can be overcome with a variety of therapies,
cognitive functions accompanied by worsening one of them is memory therapy with cognitive stimulation
to improve cognitive function in patients (3). Cognitive
stimulation can be in the form of activity therapy, one of
which is the dhakonan game. The dhakonan game will
Corresponding Author: stimulate motor, cognitive, and emotion simultaneously,
Joni Haryanto so that it will train one’s intellectual intelligence and
Faculty of Nursing, Universitas Airlangga, emotional intelligence. Problems faced by elderly people
Mulyorejo street, Surabaya (60115), Indonesia with dementia include changes in cognitive function,
Email: joniharyanto375@yahoo.com behavior, decreased physical activity, mental, social
Phone: +6281999201024 function and decreased quality of life (4).
Decreasing cognitive function in dementia causes the game intervention, so that it could compare the changes
elderly to forget easily and is not even able to maintain in dementia levels in both groups. In both groups the
the newly received information. Disturbed memory pretest was given before the intervention, then post-test
can lead to a decrease in the ability to remember time, was given after intervention (10).
recognize people, objects, and places. Not only that,
dementia also causes behavioral disorders such as easily Population and Sample: In this study the target
suspicious, stubbornness, anger, depression and crying population was elderly people with dementia in Wedoro
for no apparent reason and also unable to carry out daily Village, Waru District, Sidoarjo Regency. Respondents
activities independently so that the quality of life of the in this study were elderly who had dementia and met the
elderly becomes decreased (5). If this happens then there inclusion criteria, namely the elderly aged 60-74 years
is no one who meets the needs of the elderly, such as who had premensia, mild dementia, moderate dementia
fulfillment of nutrition, personal hygiene, and others. This and severe dementia. According to Chen & Lin in their
will have an impact on reducing the health of the elderly. reserach (2009), ages 60-74 years are classified in the
Another impact is caused if dementia is not handled elderly group (2). Elderly with Clock Test score <4 at
properly, including behavioral changes in the elderly, such screening. Elderly who has played dhakonan in young
as forgetting oneself, opposing people around, and often age, elderly who lives with family, and the elderly who
wandering at night so that it is easily lost(6). is cooperative and wants to be respondents to the study.
Dementia can be overcome by pharmacological Sampling Technique: In this study, a multistage

therapy using anxiolytic agents, antipsychotic drugs, sampling technique was used from the district level to
acetylcholinesterase inhibitors such as rivastigmine, the village level. The next step was to determine the
donepezil, galantamine, and memantin (7). However, sample using a simple random sampling technique. The
pharmacological therapy is considered detrimental number of respondents per group was 10 people. The
because the elderly consume a lot of drugs for their next stage was added with a drop out criterion sample
physical and psychological illnesses so that other therapies of 10%. This was used to anticipate if someone as a
need to be developed, namely nonpharmacological respondent drop out during research (6).
therapy. One of the nonpharmacological therapies is
reminiscence therapy (8). Memory therapy can also Variable Identification: In this study, the independent
improve cognitive function and mood in someone with variable was the game of dhakonan. While the dependent
dementia (9). variables in this study were cognitive function,
depression level and dementia level.
Dhakonan game is one of memory therapy that
causes pleasure and trains cognitive brain. The dhakonan Research Instrument: In this study, the instruments
game trains the brain to make strategies, improve used to measure the independent variables were Mini
intelligence, exercise patience and honesty (3). Based Mental State Examination (MMSE) and Geriatric
on the statements above, the purpose of this study was Depression Scale questionnaire 30 items as pre-test and
to identify the level of dementia that can be indicated post-test on respondents, and Functional Assessment
by observing at cognitive function and the level of Staging Tool (FAST) used by researchers to determine
depression in the elderly, before and after being given the level of dementia. On the MMSE there are several
traditional dhakonan games. questions that are used to assess cognitive function in
the elderly. This study used GDS as an instrument to
measure the level of depression which is one of the
Method emotional/mood disorders in the elderly with dementia.
This research was a quantitative study with quasy In determining the stage of dementia researchers used
experimental design and using a pre post test to the the Functional Assessment Staging Test (FAST) (3). The
groups. In this study involved two groups, namely the level of dementia was determined using the Functional
control group and the treatment group (6). The treatment Assessment Staging Tool (FAST) by looking at the
group was given an intervention of the dhakonan game, MMSE score and the characteristics of each stage of
while the control group was not given the dhakonan dementia set by Reisberg (11).
Data Analysis: The data collected by the researcher Result

was analyzed to measure the influence between the
independent and dependent variables using the Wilcoxon Table 1: Characteristics of respondents based on
Signed Rank Test statistical test significant level α ≤ 0.05. their coffee consumption habits
This test was used to determine changes in cognitive
function, depression levels and dementia levels before Coffee Control group Treatment group
and after dhakonan game intervention in the treatment consumption f(x) (%) f(x) (%)
and control groups. Data was analyzed using Mann Yes 6 60 5 50
Whitney Test with a significant level of α ≤ 0.05. No 4 40 5 50
Total 10 100 10 100
Research Ethics: Researchers was conducting this
research through research ethical procedures. Researcher Based on table 1, it can be seen that most of the
did not include the respondent’s name on the data respondents in control group had coffee consumption
collection sheet to maintain identity confidentiality, and habits of as much as 60% and in the treatment group by
the researcher treats all respondents fairly and well and 50%.
gives the become the right of the respondent.
Table 2: The results of the cognitive function of pre test and post test in the control and treatment groups
Control group Treatment group

Cognitive function Pre Post Pre Post
f (x) % f (x) % f (x) % f (x) %
Normal 0 0 0 0 0 0 3 30
Mild cognitive disorders 7 70 4 40 5 50 7 70
Moderate cognitive Disorders 3 30 6 60 5 50 0 0
Severe cognitive Disorders 0 0 0 0 0 0 0 0
∑ 10 100 10 100 10 100 10 100
Wilcoxon Test p = 0.183 p = 0.005
Signed Rank Test α = 0.05 α = 0.05
Mann Whitney Test of pre intervention p = 0.704 α = 0.05
Mann Whitney Test of post intervention p = 0.002 α = 0.05
Table 2 shows that the results obtained p = 0.005, causing p <0.05. This result shows that there were significant
differences between the results of the pre test and post test. In the pre test control group and treatment the Mann
Whitney Test results obtained p = 0.704, which means there was no difference between the two groups, while in the
post test results obtained p = 0.002 which means there were significant differences between the control group and the
treatment group. It can be concluded that there is an influence of traditional dhakonan games on cognitive function
of the elderly.
Table 3: Results of the dementia level in the pre test and post test in the control and treatment groups
Control group Treatment group

Level of dementia Pre Post Pre Post
f(x) % f(x) % f(x) % f(x) %
Stadium1 (normal) 0 0 0 0 0 0 0 0
Stadium 2 (subjective cognitive impairment 0 0 0 0 0 0 1 10
Stadium 3 (early cognitive impairment/mild dementia) 7 70 4 40 5 50 9 90
Stadium 4 (mild dementia) 2 20 4 40 5 50 0 0
Stadium 5 (moderate dementia) 1 10 2 20 0 0 0 0
Conted…
Stadium 6 (severe dementia) 0 0 0 0 0 0 0 0

Stadium 7 (severe dementia) 0 0 0 0 0 0 0 0
∑ 10 10010 100 10 100 10 100
Wilcoxon test P = 0.157 P = 0.014
signed rank test α = 0.05 α = 0.05
Mann Whitney Test of pre intervention p = 0.579
Mann Whitney Test of post intervention p = 0.004
Table 3 shows that the results in the control group and norepinephrine, which will have a fresh effect and
obtained p = 0.157 which means there was no difference increase concentration (13). Caffeine also functions to
between the results of the pretest and posttest. In the inhibit some of the negative effects of cholesterol which
pre-test control group and treatment the Mann Whitney can make brain blood vessels break and inhibit the
Test results obtained p = 0.579, which means there activity of the enzyme acetylcholinesterase which can
were no differences between the two groups, while the break down neurotransmitters and acetylcholine (14)
post-test results showed p = 0.004 which means there
The lower a person’s education level, the higher
was a significant difference between the control group
the prevalence of dementia. The more often training
and the treatment group. When posttest, the majority
and using the brain, it can slow cognitive decline. High
of respondents experienced stage 3 dementia or early
intelligence will be able to compensate for intellectual
dementia and 1 person experienced stage 2 or Subjective
deficits (15). Intellectual stimulation, social involvement
Cognitive Impairment (SCI).
or adequate physical activity increases neural
synaptogenesis which can reduce the risk of dementia (3).
Discussion
Memory therapy will give impulses to memory.
Based on the results of the Mann Whitney test, there Memory therapy also aims to provide opportunities
were significant differences in the two groups after being for socialization, transfer, pleasure, communication,
given a treatment of dhakonan game intervention. In the reducing depression and social isolation and increasing
treatment group, it was found that there were significant self-esteem and life satisfaction of the elderly based on
differences before and after being given traditional self-assessment and achievements (6). Memories therapy
dhakonan games. Most respondents who are depressed affects cognitive, psychological, social habits and the
were respondents who have low cognitive function health level of the elderly (8). Memories therapy will have
values (12). Based on table 2, the data of cognitive function a happy effect on a person, reduce the level of depression
values in the two groups did not show differences. The and improve cognitive abilities (2).
results showed that the majority of the pre-test results in
Cognitive function is the ability to process
the control group experienced mild cognitive impairment
information, apply knowledge, change tendencies,
and a small proportion experienced moderate cognitive
beliefs obtained from thought processes, and in the form
impairment. Most of the respondents were unable to
of mental activities such as thinking, remembering,
repeat words and imitate images correctly at the MMSE
analyzing, understanding, learning, imagining, and
test. This includes disorders in the region of the language
speaking (15). Cognitive function consists of several
and visuospatial functions.
aspects including attention, memory, visuospatial,
From the results of the study, it was obtained language, and executive abilities such as planning,
that the majority of the control group who had coffee assessing, monitoring, and evaluating (7). Cognitive
consumption habits. While in the treatment group the function is influenced by age, education level and
respondents who consumed coffee and those who did one’s occupation. Most of the elderly who experience a
not consume coffee had the same percentage. Caffeine cognitive increase in their depression rates will decline.
in coffee can block adenosine receptors so that there is Vice versa, the lower the cognitive function of the
an increase in brain neurotransmitters, namely dopamine elderly, the more severe the depression rate will be (6).
Dhakonan games can improve mood, besides being 5. Hendrijantini N, Kusumaningsih T, Rostiny R,
seen from the social aspect, this game makes the elderly Mulawardhana P, Danudiningrat CP, Rantam
establish interaction with fellow elderly people so that FA. A potential therapy of human umbilical cord
it can create a sense of comfort. If the stimulation of mesenchymal stem cells for bone regeneration
the dhakonan game is done repeatedly it will have an on osteoporotic mandibular bone. Eur J Dent.
effect on the brain which will automatically deliver 2018;12(3):358.
impulses through the same synapse so that memory can
6. Kurniasari SF, Ulfiana E, Efendi F. The effect of
be easily remembered and will prevent the development
sleep hygiene and brain gym on increasing elderly
of dementia levels and reduce the level of depression (4).
comfort and sleep quality. Indian J Public Heal
Res Dev. 2018;9(12):589–94.
Conclusion
7. Harvis KA. Care plan approach to dementia.
Based on the results of this study, the traditional Geriatr Nurs (Minneap). 1990;11(2):76–8.
dhakonan game intervention can improve the cognitive
8. Dartigues JF, Foubert-Samier A, Le Goff M,
function of the elderly through analyzing exercises, thinking
Viltard M, Amieva H, Orgogozo JM, et al. Playing
strategies, counting, and motoric training. The effects
board games, cognitive decline and dementia:
of traditional dhakonan games can maintain dementia
a French population-based cohort study. BMJ
levels or prevent the progression of dementia because in
traditional dhakonan games, depression can be reduced to Open. 2013;3(8):e002998.
normal levels by having social interactions with playing 9. Thompson C, Henry JD, Rendell PG, Withall A,
partners and being able to recall a pleasant past. Brodaty H. Prospective memory function in mild
cognitive impairment and early dementia. J Int
Ethical Clearance: This research is in accordance with
Neuropsychol Soc. 2010;16(2):318–25.
ethical clearance, has not been published before and is
not being considered for publication elsewhere. 10. Widyowati R, Agil M. Chemical constituents and
bioactivities of several Indonesian plants typically
Conflict of Interest: The authors guarantee that there is used in jamu. Chem Pharm Bull. 2018;66(5):506–
no conflict of interest related with thsi study so far. 18.
Source of Funding: This research was carried out by a 11. Nirwana I, Rianti D, Soekartono RH, Listyorini
team and funded independently. RD, Basuki DP. Antibacterial activity of fig leaf
(Ficus carica Linn.) extract against Enterococcus
References faecalis and its cytotoxicity effects on fibroblast
cells. Vet world. 2018;11(3):342.
1.
Nordström P, Nordström A, Eriksson M,
Wahlund L-O, Gustafson Y. Risk factors in late 12. Pattanayak RD, Sagar R. Depression in dementia
adolescence for young-onset dementia in men: patients: issues and challenges for a physician.
a nationwide cohort study. JAMA Intern Med. JAPI. 2011;59:647.
2013;173(17):1612–8. 13. Chen X, Ghribi O, Geiger JD. Caffeine protects
2. Chen J-H, Lin K-P, Chen Y-C. Risk factors against disruptions of the blood-brain barrier in
for dementia. J Formos Med Assoc. animal models of Alzheimer’s and Parkinson’s
2009;108(10):754–64. diseases. J Alzheimer’s Dis. 2010;20(s1):S127–41.
3. Suardana IW, Yusuf A, Purnomo W. Self-Help 14. Cappelletti S, Daria P, Sani G, Aromatario M.
Group Therapy: The Enhancement of Self-Care Caffeine: cognitive and physical performance
Ability and Quality of Life Among the Elderly enhancer or psychoactive drug? Curr
in Bali, Indonesia. Indian J Public Heal Res Dev. Neuropharmacol. 2015;13(1):71–88.
2018;9(11).
15. Crooks VC, Lubben J, Petitti DB, Little D, Chiu V.
4. Zheng J, Chen X, Yu P. Game-based interventions Social network, cognitive function, and dementia
and their impact on dementia: a narrative review. incidence among elderly women. Am J Public
Australas Psychiatry. 2017;25(6):562–5. Health. 2008;98(7):1221–7.
The Effect of Indomethacin and Ambon Banana Stem Extract

(Musa paradisiaca var. sapientum) on Ileum Histopathology of
Indomethacin-induced Rats (Rattus novergicus)
Dian Afikasari1, Kadek Rachmawati1, Romziah Sidik1

1
Faculty of Veterinary Medicine, Universitas Airlangga, Mulyorejo Street, Surabaya, East Java, Indonesia
Abstract
Background: Indomethacin belongs to Non-Steroidal Anti Inflammatory Drug (NSAID), used for fever,
rheumatoid arthritis, and post-surgical medicaments. Indomethacin is known to have an inflammatory
side-effect on the ileum. The flavonoid in ethanol extract of Ambon banana stem (Musa paradisiaca var.
sapientum) had the possibility to be used as a therapy.
Aim: This research was aimed to analyze the effect of combining indomethacin and banana stem extract
Ambon in the improvement of histopathological imaging of the white rat ileum.
Method: A dose of 3.15 mg/kg indomethacin was given per oral. This experiment used male rats (Rattus
norvegicus) aged 8-12 weeks, weighing 150 grams, that were divided into five experimental groups, those
were control-rats, Indomethacin-induced rats, and a group of Ambon banana stem extract with a dose of
P1=100 mg/kg, P2=300 mg/kg, P3=400 mg/kg. Each ileum specimen was processed and the histopathological
changes were observed. A score of submucosal edema, PMN infiltration, the number of goblet cell, epithelial
integrity as qualitative data were analyzed with Kruskal Wallis test continued by Mann Whitney test.
Result: The result of the study showed that ethanol extract of Ambon banana stem could repair the damage
of ileum histopathology (p<0,05). The administration of indomethacin at 400mg/kg dose showed the best
result of histopathological imaging of ileum improvement.
Conclusion: Ambon banana stem extract can repair damage due to indomethacin side-effect of the ileum.
Ileum histopathological repair was marked by improvements in epithelial cells of the ileum.
Keywords: Inflammatory, Indomethacin, ambon banana stem (Musa paradisiaca var.sapientum),

histopathology ileum.
Introduction treatment of indomethacin may induce its side-effects on

the digestive tract, namely damage and inflammation in
Non-Steroidal Anti-inflammatory Drugs (NSAIDs) the small intestine, including ileum2.
is an active ingredient that has a pharmacological
characteristic to work heterogeneously inhibiting Indomethacin belongs to NSAID drug that works
prostaglandin production. This drug family is used for by inhibiting Cyclooksiganese-1 (COX-1), an enzyme
the treatment of acute and chronic pain, which has the functioning in prostaglandin synthesis. The decrease of
ability to reduce pain, fever, and inflammation1. One prostaglandin synthesis will reduce the amount of mucus
kind of NSAIDs drug is indomethacin. The long-term production that protects the mucosa against pathogenic
bacteria. This may lead to a weaken ileum immunity
thus increasing the risk of inflammation due to the
Correspondence Author: high level of Reactive Oxygen Species (ROS) that may
Kadek Rachmawati trigger oxidative stress, characterized by the appearance
Faculty of Veterinary Medicine, Universitas Airlangga, of mucosal damage in ileum histopathology2. To
Mulyorejo Street, Surabaya, East Java, Indonesia 60115 maintain the ileum functioning properly, the therapeutic
Email: kadekrachmawatifkhunair@gmail.com alternatives are needed. Cases of inflammation of
the digestive tract usually treated with drugs derived banana stem extract with a dose of 400 mg/kg per oral
from chemicals and have a side effect that aggravates followed by indomethacin at a dose of 3.15 mg/kg per
inflammatory conditions3,4, so that anti-inflammatory oral as much as 2 ml each substance. The treatments were
therapy that based on natural is needed5. administered regularly on each experimental animal
for 5 days. On the 6th day, the rats were sacrificed by
Indonesia has many types of plants that have the means of neck dislocation and were dissected to isolate
potential as medicinal plants. Treatment with medicinal the ileum. The organ was put into a pot containing 10%
plants is one alternative to meet the basic needs of formalin solution, then prepared into histopathological
the community in the health sector, one of which is preparations7.
Ambon banana plant. The stem of Ambon banana is
known to contain several types of phytochemicals, The degree of ileum damage at this examination
namely saponins, flavonoids, and tannins that function determined by scoring the ileum histopathological slides,
as antibiotics, rapidly growing new cells, stimulating including submucosal edema, infiltration of PMN in the
fibroblast formation, inhibiting bacterial growth, lamina propia, number of goblet cells, and epithelial
and also antifungal6. Ambon stem banana extract is integrity8. The degree of damage from each sample was
believed to be effective in reducing inflammatory pain determined by Barthel methods8.
in post-tooth extraction of the white rat. Against the
foregoing background, this study is aiming to analyze The data obtained then analyzed by nonparametric
the effect of indomethacin and extract of Ambon banana statistical tests, Kruskal-Wallis. If there were significant
stems administration in improving the white rat ileum differences, then proceed with the Mann-Whitney test.
histopathological imaging. The entire analysis process was carried out with the
Statistical Product and Service Solution (SPSS) program
Material and Method for Windows.
This study was conducted in the Laboratory of

Results
Biochemistry, Veterinary Pathology laboratory, and
Department of Veterinary Basic Medicine at the Faculty of Submucous edema
Medicine, Universitas Airlangga, Surabaya, Indonesia. The
experimental animals in this study were 20 Wistar male
rats (Rattus norvegicus), aged 8-12 weeks with an average
body weight of 150-200 grams. The therapeutic dose of
indomethacin for white rats in this study was 3.15 mg/kg.
The specimen taken from the experimental animals is part
of the ileum by excision from ± 4 cm before the caecum, up
to 2 cm before the caecum (length = 2 cm).
The study was divided into five treatment groups

with one negative (-) control and one positive (+)
control, namely: The negative control group was given
a 2 ml suspension of CMC Na as much as 2ml per oral.
The positive control group was given indomethacin at a
dose of 3.15 mg/kg as much as 2 ml per oral. The first
treatment group was given banana stem extract dose of
100 mg/kg per oral and followed by indomethacin at
a dose of 3.15 mg/kg as much as 2 ml each substance.
The second treatment group was given banana stem
extract with a dose of 300 mg/kg per oral, followed by Figure 1: Differences in ileum mucosal
indomethacin at a dose of 3.15 mg/kg as much as 2 ml histopathological. (H.E staining; 200x enlargement;
each substance. The third treatment group was given Olympus microscope; Opti Lab).
Figure 1 shows that edema in the K+ group is the Figure 2 shows that PMN infiltration in the K+
worst, where almost all surface was submucosal edema group is the worst (arrow), whereas in P3 there were
(arrows). The results of the mean observation and fewer PMN inflammatory cells compared to P1 and P2
scoring of submucosal edema are presented in Table 1. (arrows). The results of the average observation and
scoring of PMN infiltration are presented in Table 2.
Table 1: The average histopathological observation
of ileum edema Table 2: The average histopathological observation
of PMN infiltration in Ileum
Treatment Mean Rank ± SD
K- 4.50b ± 0.38 Treatment Mean Rank ± SD
K- 5.50b ± 0.37
K+ 16.38a ± 0.09
K+ 16.88a ± 0.41
P1 13.62a ± 0.25
P1 13.50b ± 0.43
P2 9.25b ± 0.27 P2 9.50b ± 0.14
P3 8.75b ± 0.35 P3 7.12b ± 0.16
The different a; b; c superscript in the same column The different a; b; c superscript in the same column
shows a significant difference between treatments (p shows a significant difference between treatments (p
<0.05). <0.05).
Based on the results with the Kruskal-Wallis Based on the results with the Kruskal-Wallis
test showed that there were significant results in each test showed that there were significant results in each
treatment group (p <0.05). The Mann-Whitney test treatment group (p <0.05). The Mann-Whitney test
found that K- was not significantly different from P2 and found that K- was not significantly different from P1, P2
P3 (p> 0.05). However, K- was significantly different and P3 (p <0.05). However, K- is significantly different
from K+ and P1 (p <0.05). from K+ (p> 0.05).
PMN Infiltration at Lamina Propia Number of Goblet Cells
Figure 2: Differences in histopathological features. Figure 3: Differences in histopathological features

(H.E staining; 400x enlargement; Olympus (H.E staining; 400x enlargement; Olympus
microscope; Opti Lab). microscope; Opti Lab)
Figure 3 shows that the number of goblet cells in the Figure 4 shows that villi integrity in the K+ group is
K+ group is the least (arrow), while in P2 the number the worst (arrow), whereas in the P3 group the epithelium
increased especially in P3 which showed the highest had improved although there was still mild epithelial
number of goblet cells (arrow). The average results of necrosis (arrow). The results of the average observation
observation and scoring of the number of goblet cells are and scoring of Epithelial Integrity are presented in Table 4.
presented as in Table 3.
Table 4: Average histopathological observation of
Table 3: The average histopathological observation epithelial integrity of ileum
of the number of goblet cells in the ileum
Treatment Mean Rank ± SD
Treatment Mean Rank ± SD K- 4.62b ± 0.26
K- 4.25b ± 0.30 K+ 14.88a ± 0.33
K+ 14.38a ± 0.31
P1 14.12a ± 0.34
P1 14.38a ± 0.30
P2 12.50b ± 0.57 P2 13.25a ± 0.28
P3 7.00b ± 0.14 P3 5.62b ± 0.16
The different a; b; c superscript in the same column The different a; b; c superscript in the same column
shows a significant difference between treatments (p shows a significant difference between treatments (p
<0.05). <0.05).
Based on the results with the Kruskal-Wallis Based on the results with the Kruskal-Wallis
test showed that there were significant results in each test showed that there were significant results in each
treatment group (p <0.05). The Mann-Whitney test treatment group (p <0.05). The Mann-Whitney test
found that K- was not significantly different from P2 and found that K- was not significantly different from P3 (p>
P3 (p> 0.05). However, K- was significantly different 0.05). However, K- is significantly different from K+,
from K+, and P1 (p <0.05). P1, P2 (p<0.05).
Epithelial Integrity
Discussion
This study showed the negative control group (K-)

had mild damage, this was due to uncontrolled external
variables, initial intestinal conditions especially the
ileum, poor ideal cage conditions, and stress factors
during the study. This study revealed a significant
difference between the K-group and K+. The daily
administration of indomethacin at a dose of 3.15 mg/kg
that was given to the K+ group resulted in submucosal
edema in the histopathology of the ileum. Indomethacin
works by inhibiting Cyclooxygenase-1 (COX-1) which
plays a role in the formation of prostaglandins2. Inhibition
of COX-1 has an impact on decreasing prostaglandin
synthesis in the ileum which results in decreased
protection of the mucous barrier which facilitates the
invasion of pathogenic bacteria.
There was a significant difference between the

treatment group K- and P1. The daily dosage of Ambon
Figure 4: Differences between villi histopathological banana stem extract 100 mg/kg has not been able
features were treated (H.E staining; 400x to minimize edema in the ileum of white rats given
enlargement; Olympus microscope; Opti Lab) indomethacin. In the other treatment, groups showed that
K- with P2 and P3 did not have a significant difference. in the improvement of ileum epithelial damage, in the
The daily dose of Ambon banana stem extract 300 mg/ white ileum histopathology there were still necrosis and
kg and 400 mg/kg could minimize submucosal edema epithelial erosion. In the P3 treatment group, the results
in white rat ileum histopathology. This shows that the were not significantly different from the K-group. These
protection of the ileum is getting better in accordance results indicate that the dose of banana stem extract
with increase the dosage of Ambon banana stem extract. 300 mg/kg/day provides optimal improvement in ileum
The flavonoid content of Ambon banana stem extract epithelial damage. This happens because in the extract
functions as an anti-inflammatory and antioxidant9. of Ambon banana stem there are flavonoids which act as
antioxidants and anti-inflammatory.
PMN Infiltration at Lamina Propia: The results
of statistical tests show that between K- and K+ have Flavonoid as an antioxidant in Ambon banana stem
significant differences. This shows that indomethacin extract functions as an excess free radical scavenger
has side effects in the digestive tract, one of which is in the ileum due to indomethacin administration.
the ileum. In the treatment group the results showed Free radicals that have been suppressed by flavonoids
that between K- with P1, P2, and P3, there were no can also suppress the formation of Nf-Kβ. NF-kβ
significant differences. This shows that a dose of 100 cannot occupy an element response that should be
mg/kg body weight/day, 300 mg/kg body weight/ able to trigger transcription and translation of pro-
day and 400 mg/kg body weight/day can minimize inflammatory cytokines (TNF-α). Pro-inflammatory
infiltration of inflammatory PMN cells in the ileum cytokines that are not formed will reduce the activity
lamina propia because the flavanoid effects in the form of inflammatory cells13. This causes an improvement
of quercetin which works by inhibiting T cell activation
in the histopathological picture of the ileum which is
results in TNF-α inactivation which causes a decrease in
characterized by the regeneration of epithelial cells so
the presence of neutrophils10,11,12.
that the distance of the villi is seen to recur, necrosis and
Number of Goblet Cells: The results showed that villous erosion decrease. Intestinal mucosal epithelial
between K- and K+ and P1 showed significant cells are known to have a rapid rate of regeneration,
differences. This shows that the treatment group with a which is about 3 to 6 days14. Cells in the mucosa of the
dose of 100 mg/kg/day has not been able to maintain the ileum include labile cells. Unstable cells are cells that
presence of goblet cells in the ileum epithelium. In this have high regeneration ability, occur continuously and
study, the optimum dose below 100 mg/kg/day has not have a short G0 phase (resting phase). Damaged cells
been able to overcome inflammation in the ileum which are stimuli for cells that in a resting phase to undergo the
is characterized by a continued reduction in the number
mitotic phase so that there is an improvement in ileum
of goblet cells in the ileum villous epithelium.
tissue damage.
In group P3 the result was not significantly different
from the K- group. This shows that in the treatment group Conclusion
at a dose of 400 mg/kg/day can maintain the presence of
goblet cells in the ileum villous epithelium. The ileum The administration of indomethacin and Ambon
histopathology in the P3 group showed that in the ileum banana stem extract at a dose of 400 mg/kg/day was
villi there was no necrosis that led to erosion so that the the optimum dose in providing improvements to the
number of goblet cells could be maintained properly. This histopathology of the ileum.
happens because the ambon banana stem has an active
content of flavonoids which it quercetin. This flavonoids Ethical Clearance: The research process involves
can inhibit the activation of T cells (Th 1). participants in the survey using a questionnaire that was
accordant with the ethical research principle based on
Epithel Integrity: The results showed that between K-, the regulation of research ethic committee.
K+, P1, and P2, there were significant differences. The
study in the K- group with the treatment groups P1 and Conflict of Interest: The author reports no conflict of
P2 showed significant differences even though there had interest of this work.
been a slight improvement in the ileum epithelium. This
shows that the dose of Ambon banana extract given 100 Source of Funding: This study is done with individual
mg/kg/day and 200 mg/kg/day has not worked optimally funding.
References Pretreatment of mice with streptomycin provides

a Salmonella enterica serovar Typhimurium colitis
1. Matsui H, Shimokawa O, Kaneko T, Nagano Y, Rai
model that allows analysis of both pathogen and
K, Hyodo I. The pathophysiology of non-steroidal
host. Infect Immun. 2003;71(5):2839–58.
anti-inflammatory drug (NSAID)-induced mucosal
injuries in stomach and small intestine. J Clin 9. Pal D, Verma P. Flavonoids: A powerful and
Biochem Nutr. 2011;48(2):107–11. abundant source of antioxidants. Int J Pharm
Pharm Sci. 2013;5(3):95–8.
2. Takeuchi K, Tanaka A, Ohno R, Yokota A. Role of
COX Inhibition in Patogenesis of NSAID-induced 10. Zhang H-Y. Structure-activity relationships and
Small Intestinal Damage. J Physiol Pharmacol. rational design strategies for radical-scavenging
2003;54(4):165–82. antioxidants. Curr Comput Aided Drug Des.
2005;1(3):257–73.
3. Lanas Á, Scarpignato C. Microbial flora in NSAID-
induced intestinal damage: a role for antibiotics? 11. Budi HS, Kriswandini IL, Iswara AD. Antioxidant
Digestion. 2006;73(Suppl. 1):136–50. activity test on ambonese banana stem sap (Musa
parasidiaca var. sapientum). Dent J (Majalah
4. Laudanno OM, Vasconcelos L, Catalana J, Cesolari
Kedokt Gigi) [Internet]. 2015 Dec 1;48(4):188.
JA. Anti-inflammatory effect of bioflora probiotic
Available from: http://e-journal.unair.ac.id/index.
administered orally or subcutaneously with live or
php/MKG/article/view/1351
dead bacteria. Dig Dis Sci. 2006;51(12):2180–3.
12. Kumaran A, Karunakaran RJ. In vitro antioxidant
5.
Awang DVC. Tyler’s herbs of choice: the
activities of methanol extracts of five Phyllanthus
therapeutic use of phytomedicinals. CRC Press;
species from India. LWT-Food Sci Technol.
2009.
2007;40(2):344–52.
6.
Karadi R V, Shah A, Parekh P, Azmi P.
13. Yilmaz H, Guzel Y, Onal Z, Altiparmak G,
Antimicrobial activities of Musa paradisiaca and
Kocakaya SO. 4D-QSAR Study of p56 Ick Protein
Cocos nucifera. Int J Res Pharm Biomed Sci.
Tyrosine Kinase Inhibitory Activity of Flavonoid
2011;2(1):264–7.
Derivatives Using MCET Method. Bull Korean
7. Nassar, M., Endarjo, S., dan Handjani, R D. Chem Soc. 2011;32(12):4352–60.
Pedoman penanganan bahan pemeriksaan untuk
14. Junqueira LC, Carneiro J, Kelly I. Basic Histology,
histopatologi. Perhimpun Dr Spes Patol Indones
McGraw-Hil l Co. Medical Publishing Division,
(IAPI), Jakarta. 2008;9–13.
NY, Chicago; 2007.
8. Barthel M, Hapfelmeier S, Quintanilla-Martínez
L, Kremer M, Rohde M, Hogardt M, et al.
Attenuation of Eimeria tenella with Immersion Various

Concentration of Formaldehyde in Inducing Protective
Immunity after Challenge Test by Featuring Macroscopic and
Microscopic Caecum
Rizki Rohmah Armiani1, Muchammad Yunus1, Chairul Anwar Nidom1

1
Faculty of Veterinary Medicine, Universitas Airlangga, Mulyorejo Street, Surabaya, Indonesia
Abstract
Background: Eimeria tenella parasite is one of the most pathogenic coccidia that can infect chickens. The
strategy for prevention and control of coccidiosis is done by administering anticoxidia drugs and live oocyst
vaccines. However, anticoxidia can cause resistance to coccidiosis. So it is necessary to make vaccines
(attenuation) using formalin or formaldehyde.
Aim: The purpose of this study was to determine whether the attenuation of the pathogenicity E. tenella with
immersion various concentrations of formaldehyde can induce protective immunity and the concentration of
formaldehyde that is most effective in inducing protective immunity for attenuation of E. tenella in featuring
cecal macroscopic and microscopic (lesion score).
Method: Twenty-five chickens at three weeks old were divided randomly into five groups. Challenge test did
after the first infection. The first infection was inoculated tenella by divided the first group (P0) is chicken
group was inoculated with 0% formaldehyde soaked E. tenella at 1 x 104 doses as control, the 2nd, 3rd and
4th groups (P1; P2, P3 and P4) were inoculated 0.15%, 0.3%, 0.6% and 1.2% of formaldehyde soaked E.
tenella at the same doses, respectively. On challenge test performed two weeks after the first infection by
inoculated 15x103 infective oocysts of E. tenella.
Result: The results showed that the attenuation of E. tenella with immersion various concentrations of
formaldehyde can induce protective immunity by featuring cecal macroscopic and microscopic (lesion
score).
Conclusion: The most effective concentration of formaldehyde in inducing protective immunity of the
attenuation pathogenicity E. tenella was 1.2%.
Keywords: attenuation, E. tenella, formaldehyde, protective immunity
Introduction thereby reducing the efficiency of feed use, body weight,

decreased endurance, and decreased egg production3.
Poultry coccidiosis is an intestinal disease caused by Coccidiosis in chickens is located in two places, namely
Genus Eimeria parasitic protozoa1. Eimeria multiplies in the caecal (cecal coccidiosis) caused by Eimeria
the digestive tract and causes damage to the intestinal tenella4. Eimeria tenella parasites develop in cecum
mucous tissue2. Eimeria causes damage to the intestine cells, which are two dead end sacs near the back end
of the small intestine. Eimeria tenella parasite is one of
the most pathogenic coccidia to infect chickens. Acute
Correspondence Author: infections often occur in young chickens. Infection
Muchammad Yunus can be characterized by blood in the stool and with
Faculty of Veterinary Medicine, Universitas Airlangga, high morbidity and mortality5. In addition, the immune
Mulyorejo Street, Surabaya, Indonesia, 60115 response for Eimeria involves many aspects of both the
Email: muchammadyunusfkhunair@yahoo.com cellular and humoral immune mechanisms6,7.
So far, strategies to prevent and control coccidiosis Calculation of Dosage: Calculation of dosages of
are carried out by anticoxidia and live oocyst E. tenella oocysts was carried out using micro pipets
vaccine8,9. However, anticoxidia can cause resistance to measuring 1-10 μl and white chips. The suspension of
coccidiosis1. The development of increasing anticoxidia E. tenella oocysts was diluted using distilled water then
drug resistance has stimulated the search for biological the diluted liquid was vortexed so that both materials
control methods by vaccination. Some vaccines have are homogeneous. The oocyst calculation was carried
been tried in the form of whole attenuated oocysts10,11. out by dripping 1 mL oocyst into a glass object with 5
One potential explored vaccine material is a live vaccine replications and then calculating the number of oocysts
from oocysts that can be developed, produced and found in all replications with a 100x ratio and looking
applied in the field12. The development of live vaccines for an average. From the results of calculations in the
using low virulence lines from Eimeria oocysts can be average can be 15,000 oocysts/ml.
used as an alternative for more efficient and effective
Formula: This research was an experimental laboratory
protection compared to other coccidiosis vaccines, such research with the Completely Randomize Design
as vaccines containing switched off microorganisms (CRD). The chicken grouping is based on the treatment
and subunit vaccines. Vaccine making can be done by given, namely:
activating or weakening the organism (attenuation)13. A
simple way of attenuation can expose the organism to Treatment 0: As a control, oocysts were not soaked in
active chemicals to the limits of sublethal concentrations formalin
such as the use of formaldehyde or formalin.
Treatment I: E. tenella was soaked in formalin with a
Giving vaccines can stimulate the body to form concentration of 0.15%
antibodies to the Eimeria antigen so that the chicken is Treatment II: E. tenella was soaked in formalin with a
able to deal with new infections (challenge tests). The concentration of 0.3%
use of separated Eimeria types in vaccines makes it easy
for users to apply vaccines according to the prevention Treatment III: E. tenella was soaked in formalin with a
of the desired disease. Based on this, the purpose of concentration of 0.6%
this study was to determine whether the attenuation of Treatment IV: E. tenella was soaked in formalin with a
the pathogenicity E. tenella with immersion various concentration of 1.2%
concentrations of formaldehyde can induce protective
immunity and the concentration of formaldehyde that After E. tenella was soaked, then chicken were
is most effective in inducing protective immunity for inoculated as many as 10,000 oocysts orally. After 14
attenuation of E. tenella in featuring cecal macroscopic days, a challenging test was carried out by re-inoculating
and microscopic (lesion score). E. tenella without immersing 15,000 formaldehyde as a
formalin.
Materials and Method Chicken and Eimeria tenella infections: Twenty-five
21-day old chickens were inoculated with 10,000 E.
This research was conducted at the Laboratory
tenella oocysts that were patented using formalin with
of Parasitology, Faculty of Veterinary Medicine,
various levels of concentration (0.15%, 0.3%, 0.6% and
Universitas Airlangga, Surabaya, Indonesia, from
1.2%) for 96 hours. Chickens were inoculated using E.
August to September 2016. The experimental animals
tenella orally which had been washed using distilled
used in this study were 25 broiler chickens strain CP 707
water and centrifuged at a speed of 1500 rpm for 10
produced by Charoen Pokphand. The chickens were two
minutes at five times. After two weeks, twenty-five
weeks old and breed in a battery cage in Besah Village,
34-day-old chickens were re-inoculated with 15,000
Kasiman District, Bojonegoro Regency, Indonesia.
E. tenella oocysts without formaldehyde immersion.
Eimeria tenella inoculation was performed on 3 weeks
Chicken is inoculated with E. tenella orally.
old chickens after being adapted for 1 week by ad
libitum feeding and drinking. Feed which given, it does Cecum Lesion Scoring: Scoring of cecal lesions
not contain koksidiostat. was carried out on the fifth day after inoculation,
macroscopically. The cecal abnormalities were recorded Macroscopic description of chicken serum
and the degree of damage to the mucosal surface of the
chicken cecum was calculated based on a score of 0-414.
Histopathology observation: Histopathology

observation was carried out at the Pathology
Laboratory of the Faculty of Veterinary Medicine,
Universitas Airlangga, Surabaya, Indonesia.
Microscopic examination was carried out based on the
histopathological changes that occurred in the cecum
which had previously been made histopathological
preparations, assessed by scoring seen based on the
Goodwin method 15.
Challenge Test: The challenge test was carried out

14 days after the first E. tenella inoculation, E. tenella
which was soaked with various formalin concentrations.
The challenge test was carried out by re-inoculating E.
tenella without immersing as much as 15,000 oocysts
formally. The indicator that shows the success of
protective immunity is the reduced scoring of cecum
lesions observed macroscopically and microscopically.
Data Analysis: Data to be obtained was macroscopic

lesion scoring and microscopic lesion scoring. Data were
arranged in table form using Kruskal Wallis analysis, if
there are differences data, then proceed with the Mann
Whitney test.
Results
Macroscopic Scores of Chicken Fecal Lesions
Figure 2: Macroscopic description of chicken cecum
Figure 1: Macroscopic score of Chicken Fecal Lesions The figure above is a macroscopic picture of chicken
cecum which has been challenged by inoculating E.
The figure above is a comparison of the scores tenella infective in each group of chickens with a dose
of chicken cecal lesions macroscopically after being of 15 x 103 oocyst E. tenella. The intensity of petechiae
challenged with E. tenella infective in each group of is reduced by E. tenella infection which is soaked in
chickens with a dose of 15 x 103 oocyst E. tenella. formalin with higher concentration. A small circle
Each shows mean ± SD (N = 5). NS, not significantly shows bleeding in the cecal mucosa, the arrow shows
different; *, p <0, 05. thickening of the cecum wall.
Microscopic score of Chicken Fecal Lesions Microscopic description of chicken cecum which
have been challenged by inoculating E. tenella infective
in each group of chickens with a dose of 15 x 103 oocyst
E. tenella with various magnifications (A (100x) and B
(400x)). The small circle shows the Eimeria distribution
in the cecum and the black line shows the cecum mucosa.
Discussion
Macroscopic description of chicken cecum: From

the macroscopic observation of the cecum, data were
obtained based on histopathological abnormalities
Figure 3: Cecum lesion microscopically in chickens assessed based on a score of 0-414. At P0 it shows a
normal condition because there is no damage to the
Figure 3 is a comparison of the scores of chicken
caecal lesions macroscopically and there is no thickening
cecal lesions macroscopically after being challenged
of the cecum wall. P1 shows the degree of damage to
with E. tenella infective in each group of chickens with
mild level cecal lesions, characterized by bleeding spots
a dose of 15 x 103 oocyst E. tenella. Each shows mean
(ptechie) that spread on the surface of the mucosal
± SD (N = 5). NS, not significantly different; *, p <0.05.
mucosa with slight changes in the color of the wall or
Microscopic description of chicken serum the contents of the digestive tract. P2 shows the degree
of damage to moderate cecal lesions, characterized
by more bleeding and lesions with a slight thickening
of the cecum wall. P3 shows the degree of damage to
mild cecal lesions, there are several bleeding spots that
spread to the mucosal surface of the cecum with slight
changes in the color of the wall or the contents of the
digestive tract. P4 shows a normal condition because
macroscopically there is no damage to cecum lesions
and there is no thickening of the cecum wall 14. These
changes are due to the administration of E. tenella
infective oocysts when the challenge test has no effect
on cecal damage macroscopically, which means that
the administration of oocysts that have been soaked in
formalin before the challenge test can induce protective
immunity seen macroscopically from chicken cecum.
The results of the statistical analysis using the Kruskal

Wallis test also did not show significant differences in
each treatment. It can be explained that macroscopically,
the challenging test by inoculating as many as 15,000 E.
tenella infective oocysts did not affect the damage to the
cecum which had been inoculated with E. tenella with

soaking various formalin concentrations (0.3%, 0.6%,
0.9 %, 1.2%). So it can be concluded that immersion
of E. tenella in various concentrations of formaldehyde
can induce protective immunity seen from the results
of scoring and the results of macroscopic examination
statistics after the challenge test which shows the results
Figure 4: Microscopic description of chicken cecum are not significantly different. The optimal formalin
concentration in patenting E. tenella is 1.2% indicating appears compact and only a few villi rupture, when it
a normal state because macroscopically there is no compared with P0, P2 suffers more damage, it suspected
damage to cecum lesions and there is no thickening of that P2 has a low immune system that is lowered by its
the cecum wall14. parent.
Microscopic description of chicken cecum: At P3 it showed almost no abnormalities in the

Histopathological observations on cecum, data obtained histopathology of the cecum, the cecal epithelium
based on histopathological abnormalities contained in appeared to be compact and rarely found in ruptured
the preparations were assessed by scores seen based cecum villi. If vaccines are used to better control
on summations of A and B, where A represents the disease in an animal population and not individually,
distribution of E. tenella development stages found the concept of group immunity should be considered. If
throughout the caecum, while B represents the severity
group immunity is carried out by reducing the likelihood
of damage caused by E. tenella15.
of sensitive animals meeting the infected, there will be
The results of statistical analysis using the no spread of disease13. In P4 there is no abnormality in
Kruskal Wallis test showed no significant differences the histopathology of cecum. Microscopic observations
in microscopic examination. The results obtained by showed normal intestinal cells, the intestinal epithelium
histopathological preparations showed no significant appeared to be compact and did not show any rupture in
differences in each treatment with the average scale the cecum villi and rarely found in the development of
which tended to be the same, namely P0: 3.88, P1: 4.28, parasites.
P2: 4.22, P3: 4.04 and P4: 3.88. There are three immunity
to E. tenella, which are totally invulnerable to parasites
Conclusion
and do not develop parasites, chicken is immune to a
certain degree, where oocysts are able to complete Attenuation of Eimeria tenella through immersion
the life cycle but no lesions occur in the intestine, and in various concentrations of formalin (0.15%; 0.3%;
chickens show no clinical symptoms but lesions occur 0.6%; 1.2%) can induce protective immunity in terms
in intestine16. of macroscopic and microscopic images of the cecum.
The microscopic scoring value in figure P0 did The most potential formalin concentration for patenting
not experience abnormalities in cecum histopathology. Eimeria tenella in induces protective immunity serum
Microscopic observations showed normal intestinal in terms of macroscopic and microscopic images of
cells, the intestinal epithelium looked compact and cecum is 1.2%. Macroscopically there is no damage to
did not show any rupture in the cecum villi. The first cecal lesions and no cecum wall thickening. Whereas
infected chicken, Schizont will develop properly due to microscopically shows the intestinal epithelium looks
immunity to E. tenella infection is still in the process of compact and there is no rupture in the cecum villi.
initiation, causing damage to the cecum.
The results of the P1 scoring data indicate participants in the survey using a questionnaire that was
histopathological abnormalities with moderate degrees accordant with the ethical research principle based on
of damage to the mucosal cecum. The cecal epithelium the regulation of research ethic committee. The present
is compact and there are several villous ruptures. When
study was carried out in accordance with the research
compared with P0, P1 has a higher cecum damage. This
principles. This study implemented the basic principle
is because previously chickens were inoculated with
ethics of respect, beneficence, non-maleficence, and
E. tenella which was soaked in formaldehyde with low
justice.
concentration so it was suspected that schizont could
still damage the caecum. Tissue damage to the cecum is Conflict of Interest: The author reports no conflict of
caused by the outbreak of the schizont stage which has interest of this work.
three generations before entering the gamete stage. P2
shows histopathological abnormalities with mild degrees Source of Funding: This study is done with individual
of damage to the mucosal cecum. The cecal epithelium funding.
References of MontanideTM ISA oil-based adjuvants on

recombinant coccidia antigen vaccination against
1. Allen PC, Fetterer RH. Recent Advances in
Eimeria acervulina infection. Vet Parasitol.
Biology and Immunobiology of Eimeria Species
2010;172(3–4):221–8.
and in Diagnosis and Control of Infection with
These Coccidian Parasites of Poultry. Clin 10. Shirley MW, Bushell AC, Bushell JE, McDonald
Microbiol Rev [Internet]. 2002 Jan 1;15(1):58– V, Roberts B. A live attenuated vaccine for the
65. Available from: http://cmr.asm.org/cgi/ control of avian coccidiosis: trials in broiler
doi/10.1128/CMR.15.1.58-65.2002 breeders and replacement layer flocks in the
United Kingdom. Vet Rec. 1995;137(18):453–7.
2. Calnek B. W, Barnes H. J, Beard C.W, Mc Dougald
L.R SYM. Disease of Poultry. 10th ed. Iowa State 11.
Shierly MW. Biological principle of lives,
University Press. USA; 2001. 865–867 p. attenuated vaccines. Magy Allatorvosak Lapja.
1996;51(1):23–9.
3. Min WG, Dalloul RA, Lillehoj HS. Application
of biotechnological tools for coccidia vaccine 12. Yunus M, Suprihati E. Potency of Attenuated
development. J Vet Sci. 2004;5(4):279–88. Eimeria tenella in Protective Immunity Induction
on Homologous and Heterologous Challenges.
4. Jordan F, Pattison MA, Faragher T. Poultry
Procedia Chem. 2016;18:218–24.
Diseases. 5” Edition. WB Saunders. London; 2001.
13.
Tizard IR. Veterinary Immunology: An
5. Alberta C. Coccidiosis in chickens, Agriculture and
Introduction. 7th ed. USA: Saunders; 2004.
Rural Development,. Agdex; 2001. 663–665 p.
14. Raman M, Banu SS, Gomathinayagam S, Raj
6. Lillehoj HS, Lillehoj EP. Avian coccidiosis.
GD. Lesion scoring technique for assessing
A review of acquired intestinal immunity and
the virulence and pathogenicity of Indian field
vaccination strategies. Avian Dis. 2000;408–25.
isolates of avian Eimeria species. Vet Arh.
7.
Lillehoj H, Okamura M. Host immunity 2011;81(2):259–71.
and vaccine development to coccidia and
15. A. Goodwin M, Brown J, I. Bounous D. Use of
Salmonella infections in chickens. J Poult Sci.
microscopic lesion scores, gross lesion scores and
2003;40(3):151–93.
oocyst count scores to detect Eimeria maxima in
8. Ding X, Lillehoj HS, Dalloul RA, Min W, Sato T, chickens. Vol. 27, Avian pathology : journal of the
Yasuda A, et al. In ovo vaccination with the Eimeria W.V.P.A. 2012. 405–408 p.
tenella EtMIC2 gene induces protective immunity
16. Long PL, Johnson J, Wyatt RD. Eimeria tenella:
against coccidiosis. Vaccine. 2005;23(28):3733–40.
clinical effects in partially immune and susceptible
9. Jang SI, Lillehoj HS, Lee SH, Lee KW, Park MS, chickens. Poult Sci. 1980;59(10):2221–4.
Bauchan GR, et al. Immunoenhancing effects
The Potential of Immune Response Improvement through

Brucella abortus Outer Membrane Protein and Whole Brucella
abortus S19 Vaccinations on White Pulp Diameter of Lepus
nigricollis
Muhammad Ardiansyah1, Chairul Anwar1, Imam Mustofa1

Faculty of Veterinary, Universitas Airlangga, Jl. Airlangga No.4-6, Airlangga, Gubeng, Kota SBY, Jawa Timur
1
ABSTRACT
Background: Brucellosis is a disease that is still commonly found in developing and developed countries.
The disease can be transmitted from animals to humans through food products made from animals. One of
the efforts to control Brucellosis is by Brucella abortus S19 vaccine. However, the vaccine may still deliver
the same reaction as natural Brucella infection. Safer vaccine development is carried out by using Outer
Membrane Protein (OMP) from the infecting bacteria.
Objective: The study was established to determine the potential of immune response enhancement after
administering OMP B. abortus and whole B. abortus S19 vaccine that were observed through the white pulp
diameter of Lepus nigricollis.
Method: An enhancement in the immune response can be determined through measuring the white pulp
diameter of L. nigricollis. The measurement data of the white pulp diameter would be analyzed by conducting
one way ANOVA and Duncan statistical tests.
Results: The results suggested that the measurements of white pulp diameter experienced a significant
enhancement (p <0.01) in each treatment. The vaccine treatment by employing OMP B. abortus indicated
the highest diameter measurement results with an average value of 553.73 µm.
Conclusion: Vaccination by employing OMP B. abortus had a good potential to improve the immune
response since there was a significant enhancement in the white pulp diameter of L. nigricollis.
Keywords: white pulp diameter, OMP B. abortus, immune response, vaccine, whole B. abortus S19
Introduction In the veterinary field, at least 37% of cows are infected

by Brucellosis and causes miscarriages annually. The
Brucellosis is one of the primary zoonotic diseases prevalence varied from 1% to 40% in 20023.
that can have a negative impact on public health and
public economy 1. Brucellosis is classified in B list, as the The economic losses caused by Brucellosis include
disease transmission affects the socio-economic or public the occurrence of abortion, animal youngs born weak
health in a country and influences the trade development, and dead, sterility due to reproductive disorders, drop
especially in animals or products made from animals 2. of milk production, and drop of market access, both
nationally and internationally 4. Some efforts to reduce
these effects can be applied by conducting an early
Correspondence Author: diagnosis by a combination of two methods, i.e., Rose
Chairul Anwar Bengal Test or RBT and Complement Fixation Test
1Faculty of Veterinary, Universitas Airlangga, or RBT 5. Another effort in reducing Brucella abortus
Jl. Airlangga No.4 - 6, Airlangga, Gubeng, effects is by administering a vaccine extracted from B.
Kota SBY, Jawa Timur 60115 abortus S19 6. Each type of vaccine has its advantages
Email: chairulanwar157@yahoo.com and disadvantages. The disadvantages of B. abortus S19
vaccine is that it is an active vaccine which contains foil, microtome, staining jar, refrigerator, optical lab,
attenuated B. abortus. Thus, there are still side effects and Olympus® CX-41 microscope.
after injection 7. The injection of B. abortus S19 vaccine
The materials utilized in this study consisted of 1)
often causes a misdiagnosis which may be mistaken
the whole bacterium of B. abortus S19, heated at 800C
from B. abortus infection because there are difficulties
and then added with CFA; 2) the whole bacterium of
to differentiate the immune system formed due to
B. abortus S19, heated at 800C then added with IFA;
the vaccine injection and that by natural B. abortus
3) OMP B. abortus added with CFA; and 4) OMP
infection. In addition, the injected vaccine can deliver
B. abortus local strain added with IFA, which were
broad reactions to the tissue 8. Based on some of the
cultured in Bacteriology and Microbiology Laboratory
weaknesses of the B. abortus S19 vaccine, several efforts
at the Faculty of Veterinary Medicine, Universitas
were established to produce other types of vaccines such
Airlangga. Additional materials included ketamine,
as the Outer Membrane Protein (OMP), which is the first
acetylpromazine, 10% formalin, alcohol and cotton,
barrier exposed to the agent/host, causing the produced
and PBS. The materials utilized to treat the experiment
immune response tends to attack the outer membrane 9.
animals consisted of feed given in the form of BR II
Vaccination is one of the solutions to deal with a pellets, drinking water, and preparation staining by using
specific disease so that specific antibodies or body defense Hematoxylin-Eosin (HE).
will be formed. The immune response from vaccination
Research Procedure: The experimental animals
will activate the formation of immunity in the body
employed in this study were male rabbits (Lepus
where lymphatic tissue also plays a role. The spleen is the
nigricollis) with body weight of approximately 1-2
largest lymphatic organ in the body that filters the blood
kilograms and approximately aged eight weeks. In this
and plays an important role as the immune response site
study, 18 samples were employed to be divided into
towards antigens in the blood. The spleen consists of red
three treatment groups. The first group was the control
pulp and white pulp 10. Microscopic lymphatic organs
group (P0), administered with NaCl at a dose of 1 ml/
are indicated by the proliferation of lymphocytes and
rabbit. The second group was the treatment 1 group (P1),
white pulp diameter enhancement in the spleen 11. Based
vaccinated with B. abortus S19 at a dose of 0.5 ml/rabbit,
on these reviews, the study was established to determine
and a dose of 1.0 x 108 CFU, and Complete Freund
the immune response enhancement as indicated by
Adjuvant (CFA). The third group was the treatment 2
white pulp diameter enhancement of the spleen of Lepus
group (P2), vaccinated with OMP B. abortus at a dose
nigricollis after being vaccinated with whole B. abortus
of 0.5 ml/rabbit and Complete Freund Adjuvant (CFA).
S19 and OMP B. abortus.
The adaptation process period of L. nigricollis
Materials and Method towards the laboratory environment lasted for one week.
The first injection was subcutaneously administered
The study was an experimental research utilizing a
by using Complete Freund Adjuvant (CFA) in the
Completely Randomized Design method (CRD), and the
second week. Two weeks later, after the first injection,
data results were statistically tested. The research was
the booster was implemented by using the Incomplete
carried out at the Laboratory of the Faculty of Medicine,
Freund Adjuvant (IFA). The booster was implemented
Universitas Airlangga.
for two times per 2 weeks of injection. Then, they
Instruments and Materials: The research instruments were euthanized and necropsied to take the spleen for
to use during the trial period included wooden histopathological preparations.
experimental animal cage with wire mesh as the base,
animal feeder, and 1ml syringes. The equipment for The euthanasia and necropsy stages were carried
breeding bacteria consisted of petri dish, inoculating out five weeks after the last booster administration. Pre-
loop, Bunsen burner, and incubator. The equipment medication by administering acetyl promazine (1 mg/
utilized for necropsy and producing histopathological kgbw) was delivered subcutaneously or intramuscularly.
preparation consisted of surgical scissors, scalpel, Then, euthanasia was carried out by using acetyl
tweezer, object glass, cover glass, hot plate, small pot promazine 100 mg/kgbw, injected intramuscularly. The
and lid as organ storage, Bunsen burner, oven, aluminum necropsy in the spleen organ was carried out through
surgery, and the organ fixation was carried out by using diameter enhancement in the control group reached
formalin 10%. The histopathological preparations from 347.25 µm; the treatment 1 group reached 452.16
the animal tissue was conducted by using Hematoxylin- µm; and the treatment 2 group amounting to 553.73
Eosin staining. µm. The treatment 2 group, vaccinated with OMP B.
abortus, indicated significant different results (p <0.01)
The white pulp diameter observation was carried from the control group. Meanwhile, treatment 1 group,
out by using an Olympus microscope and equipped vaccinated with B. abortus S19, indicated relatively
with Optilab support facilities. The measurements insignificant increase from the control group. The spleen
were calibrated by using Image Raster software. The histopathology in each treatment is indicated in Figure
microscopic observation was carried out by using 100x 1 as follows.
magnification. The measurements were carried out
by drawing a straight line from the white pulp’s tip to
the other end by using Raster Image Application. The
measurements were carried out in the entire visible white
pulp on the visual field. Then, the values were averaged.
Data Analysis: The data obtained from the white

pulp diameter in this study were analyzed by F test in
ANOVA, then analyzed by using Duncan Alpha test to
determine the differences among treatments.
Result
Based on the analysis attachment by using the one-

way ANOVA method (F test), the test suggested that the
group treatment for OMP B. abortus vaccination had
significantly different results among the treatment groups
(p <0.01). The comparison of the white pulp diameter of
each treatment group can be observed in Table 1.
Tabel 1: Comparisons among the spleen white pulp

diameter of L. nigricollis vaccinated with the Outer
Membrane Protein of B. abortus and whole B.
abortus S19
Treatment White pulp diameter (µm) ± SD

P0 347.25a ± 56.4
P1 452.16ab ± 33.9
P2 553.73b ± 132.5
Notes: P0 = control group with physiological NaCl, P1 =

treatment 1 with B. abortus S19 vaccine, P2 = treatment
2 with OMP B. abortus. The letter notation indicated a
significant difference (p <0.01) among each treatment.
The same-letter notation means that the results were Figure 1: White pulp diameter in L. nigricollis
not significantly different. The different-letter notations spleen in each treatment, 100x magnification. A =
mean that the results were significantly different. control group (P0) administered with physiological
NaCl, B = treatment 1 (P1) administered with whole
Based on Table 1, the average white pulp diameter B. abortus S19, C = treatment 2 (P2) administered
had different values in each treatment group. The with the Outer Membrane Protein B. abortus
Based on Figure 1, it can be observed that the white Other studies have discovered that purified
pulp diameter of L. nigricollis spleen in the control group lipoproteins from OMP B. abortus such as L-OMP16
(P0) had the smallest diameter. The white pulp diameter and L-OMP19 can stimulate cytokine production from
at P0 was approximately 240.9 µm. The white pulp in innate immune response cells. Such stimulation occurs
treatment 1 group (P1) indicated a larger diameter size due to the interaction of OMP16, OMP19 or other B.
than that in the control group of approximately 536.7 abortus lipoproteins and cells, such as macrophages,
µm. The white pulp diameter in treatment 2 group (P2) which causes cytokine production, proliferation and the
indicated the largest diameter compared to treatment 1 fusion of other inflammatory cells, resulting in tissue
and control groups, reaching approximately 790.6 µm. inflammation 17.
Based on these results, the OMP B. abortus treatment
group had better immune enhancement compared to The immune response towards Brucellosis involves
treatment utilizing whole B. abortus S19. the humoral and cellular immune systems. The humoral
response system is formed by antibodies produced by
Discussion B lymphocytes that are located in peripheral lymphoid
tissue. Antigens will be bounded by B lymphocyte
The treatment group injected with OMP B. abortus immunoglobulin, which will stimulate proliferation of
vaccine had a significant different enhancement in the B cells into plasma cells and form antibodies to fight
immune response (p <0.01) compared to the control group. Brucella infection and neutralize the toxin 15.
The treatment group injected with whole B. abortus S19
did not have much different immune response compared B. abortus is an intracellular pathogen that can
to the control group. There was an enhancement in the survive on macrophages in a hostile environment.
treatment groups because an antigen was injected so that Previous research has been carried out on mice and
it was capable of forming antibodies. Antigens will be monkeys. It results in an important response to this
recognized earlier by macrophages and presented in the infection, i.e. the presence of IL-2 and IFN-γ secretions,
form of fragments that will stimulate B and T lymphocytes involving APC and Th1 cells. B. abortus has the
to carry out proliferation that produces antibodies 12. The capability of producing antibody response in the forms
proliferations of both lymphocytes are mostly found in of independent T helper cells and independent CD4 +
the white pulp of the spleen, causing mutual pressure on T cells. Peptides or proteins can be conjugated to B.
the lymphocytes due to its fission, causing the white pulp abortus where the conjugates are used to obtain strong
diameter became broader 11,13. antibody and CTL responses, even without the presence
of CD4 + T cells 18.
B. abortus bacterial structure is quite unique. It is
unlike other negative gram bacteria. The outer surface of The development of Brucellosis vaccine is carried
this bacterium does not have pili, and is not encapsulated. out by looking at IgG levels in vaccine administration
It has an outer membrane to protect bacterial cells from of all bacteria B. abortus S19 and OMP B. abortus. The
molecules diffusion, hydrolytic enzymes, and helps the results of this study suggested significant differences
conjugation process in controlling DNA replication 14. among treatments, in which, OMP B. abortus vaccine
The outer membrane is composed of two components
resulted the highest IgG level. IgG is the antibody result
that have been identified as potential virulence factors,
by plasma cells in the blood where plasma cells are
i.e., Outer Membrane Protein (OMP) and Lipopoly
the mature forms of lymphocyt B. Before plasma cells
Saccharide (LPS) proteins. These outer membranes
are formed in the spleen’s white pulp, proliferation of
are hydrophobic, causing them to be more resistant
lymphocytes is stimulated and ripens into plasma cells
and potential as virulence factors 15. OMP in negative
in the bloodm then producing antibodies. Therefore, it
gram bacteria is a potential immunogen that can directly
induce humoral specific immune responses, namely B can be correlated with high IgG levels in vaccination
lymphocyte cells so that it accelerates the antibodies of OMP B. abortus and lymphocyte cell proliferation in
formation faster 16. Brucella has a lipid component the spleen’s white pulp 19. The highest average spleen’s
called lipoprotein. Unmodified lipids can enhance pulp white diameter of the OMP B. abortus treatment
Brucella pathogenicity. Lipoproteins induce cytokines indicated the highest IgG level. The two results of the
associated with nonspecific immunological reactions. study suggested that the administration OMP B. abortus
The cytokines production in the immunological system vaccination is capable of providing good antibody
is closely related to the inflammatory reaction 17. formation.
Conclusion 9. Cloeckaert A, Kerkhofs P, Limet JN. Antibody

response to Brucella outer membrane proteins
This study concludes that the diameter measuring in bovine brucellosis: immunoblot analysis and
experienced different results. The vaccination by using competitive enzyme-linked immunosorbent assay
OMP B. abortus has the potential to improve immune using monoclonal antibodies. J Clin Microbiol.
response by having an enhancement in the L. nigricollis 1992;30(12):3168-3174.
white pulp diameter. It is suggested for future research
10. Eroschenko VP. Atlas histologi difiore. Jakarta
that there is a requirement to measure the formed
EGC Hal. 2010;457.
antibody levels resulted from whole B. abortus and OMP
B. abortus vaccinations. 11. Brake DA, Fedor CH, Werner BW, Miller
TJ, Taylor RL, Clare RA. Characterization of
Ethical Clearance: The research process was using immune response to Eimeria tenella antigens
experimental method that was accordant with the ethical in a natural immunity model with hosts which
research principle based on the regulation of research differ serologically at the B locus of the major
ethic committee. The present study was carried out in histocompatibility complex. Infect Immun.
accordance with the research principles. This study 1997;65(4):1204-1210.
implemented the basic principle ethics of respect, 12. Tizard I. An introduction to veterinary immunology.
beneficence, non-maleficence, and justice for animal. An Introd to Vet Immunol. 1982;(Ed. 2).
Conflict of Interest: The author reports no conflict of 13. Makiyah SNN, Iszamriach R, Nofariyandi A.
interest of this work. Paparan ultraviolet c meningkatkan diameter pulpa
alba limpa dan indeks mitotik epidermis kulit
Source of Funding: This study is done with individual mencit. J Kedokt Brawijaya. 2014;28(1):17-21.
funding. 14. Munir R, Afzal M, Hussain M, Naqvi SMS, Khanum
A. Outer membrane proteins of Brucella abortus
References vaccinal and field strains and their immune response
1. Agasthya AS, Isloor S, Prabhudas K. Brucellosis in buffaloes. Pak Vet J. 2010;30(2):110-114.
in high risk group individuals. Indian J Med 15. Quinn PJ, Markey BK, Leonard FC, Hartigan
Microbiol. 2007;25(1):28. P, Fanning S, Fitzpatrick ES i. Veterinary
2. Rovid-Spickler A. Brucellosis : Brucella abortus Microbiology and Microbial Disease. John Wiley
Brucella abortus. 2018:1-12. & Sons; 2011.
16. Forestier C, Moreno E, Pizarro-Cerda J, Gorvel
3. Bahri S, Martindah E. Kebijakan pengendalian
J-P. Lysosomal accumulation and recycling of
penyakit strategis dalam rangka mendukung
lipopolysaccharide to the cell surface of murine
program kecukupan daging sapi 2010. JITV.
macrophages, an in vitro and in vivo study. J
2014;19(3).
Immunol. 1999;162(11):6784-6791.
4. Noor SM. Brucellosis: Penyakit zoonosis yang
17. Giambartolomei GH, Zwerdling A, Cassataro J,
belum banyak dikenal di Indonesia. JITV.
Bruno L, Fossati CA, Philipp MT. Lipoproteins,
2014;19(3).
not lipopolysaccharide, are the key mediators of the
5. Padilla PF, Nielsen K, Ernesto SL, Ling YW. proinflammatory response elicited by heat-killed
Diagnosis of brucellosis. Open Vet Sci J. Brucella abortus. J Immunol. 2004;173(7):4635-
2010;4(1):46-60. 4642.
6. Subronto TI. Ilmu penyakit ternak II. 2001:27-54. 18. Golding B, Scott DE, Scharf O, et al. Immunity
7.
Siadat SD, Salmani AS, Aghasadeghi MR. and protection against Brucella abortus. Microbes
Brucellosis vaccines: an overview. In: Zoonosis. Infect. 2001;3(1):43-48. doi:10.1016/S1286-
Intech; 2012. 4579(00)01350-2
8.
Siregar EA. Pendekatan Epidemiologik 19. Rahmahani J, Handijatno D, Tyaningsih W, Suwarno
Pengendalian Bruselosis Untuk Meningkatkan S. Control and Preventive Study of Brucellosis by
Populasi Sapi Di Indonesia. 2000. Using. KnE Life Sci. 2017;3(6):234-240.
The Effect of Adding Moringa Leave (Moringa oleifera) to

Male Broiler Feed
Mien Qurrati A’yuni Muis1, Kadek Rachmawati1, Mohammad Anam Al Arif1

1
Department of Veterinary Education, Faculty of Veterinary, Universitas Airlangga, Jl. Mulyorejo,
Surabaya, East Java
Abstract
Background: Broiler chickens are popular in the community due to their inexpensive price and thick meat.
Nevertheless, its high-fat content worries consumers.
Objective: This research aims to investigate the effect of Moringa leave powder added in commercial diets
on increasing the protein level and decreasing the fat content in broiler chickens.
Method: This research employed 20 male Day-Old Chicks (DOC) of CP 707 strain, aged 21-35 days.
This research applied CRD (Complete Randomized Design) with four treatments and five replications. The
protein and fat of broiler meat were measured as the parameter in this study. After that, the data were
analyzed using Analysis of Variance (ANOVA) and continued by using the Duncan test.
Result: Moringa leaves powder as a substituent in commercial diets had a significant effect (p <0.05) on
the increase in meat protein. It was identified that P1 gained meat protein by 20.02%; P2 by 19.87%, and
last P3 by19.99% from the P0 group with 19.37% protein increase. There was also a significant influence
(p <0.05) on meat fat decrease where P1 decreased fat by 1.23%; P2 by 1.30%, P3 by 1.13% from P0 with
1.50% fat content.
Conclusion: Moringa leaves powder supplemented to chicken diets impacts on increasing protein level and
decreasing fat content of broiler chickens.
Keywords: Broiler, Meat protein, Meat fat, Moringa oleifera
Introduction hypertension, and coronary heart disease 3. Therefore,

meat companies should provide chicken meat with
Broiler chickens are the type of chicken specifically low fat and high protein content to increase consumer
raised for meat production with rapid growth as its interest in chicken meat 4.
economic characteristic. A fast harvest time, soft fibrous
meat, thicker meat, and high nutrient make broiler Amino acids are vital substances required in
chickens favorable. In addition, broilers are popular protein synthesis. Amino acids, nonetheless, are not
among the community due to their affordable price produced by the body. Hence, it must be imported in a
1
. However, the high fat contained in broiler chickens completed form. One of the amino acid sources that can
causes some people to worry 2. The high-fat content be obtained is Moringa leaves. Some active compounds
brings negative impacts on health and positively contained in Moringa leaves include saponins, leucine,
correlate with metabolic diseases such as atherosclerosis, and methionine which have benefits for the body. Fresh
Moringa leaves contain 492 mg of leucine, which is
essential for the synthesis of muscle protein and normal
Corresponding Auhtor: cell function 5. Meanwhile, saponins is a compound
Kadek Rachmawati which is capable of reducing cholesterol level in broilers
Department of Veterinary Education, due to its essential function in cholesterol metabolism
Faculty of Veterinary, Universitas Airlangga and fat accumulation decrease 6. In addition, saponins
Jl. Mulyorejo, Surabaya, East Java, 60113 are also capable of lowering lipid and blood cholesterol
Email: kadekrachmawatifkhunair@gmail.com levels by inhibiting cholesterol absorption 7.
The supplement of Moringa leaves powder in the P1: 95% commercial diets + 5% Moringa leave powder
chickens’ diet positively affects the yellow color increase P2: 90% commercial diets + 10% Moringa leave powder
of the eggs. Furthermore, green vegetables on chickens’ P3: 85% commercial diets + 15% Moringa leave powder
diet are considered to contain useful substances such as
vitamins and minerals that are essential for livestock8. The treatments above were carried out for two
Green vegetables serve as vitamins and minerals weeks, preceded by an adaptation period of 7 days.
source and are regarded as more efficient than factory-
Powdered moringa leaves were utilized as the
produced vitamins. Green vegetables are considered
ingredient of supplementary diets. In this study, the
better because of their lower price, natural ingredient,
broiler chickens were fed with commercial diets (PT.
and relatively perfect food substances such as protein,
Charoen Pokphand, Thailand). Moreover, the cages
fat, and water. These factors can improve the quality
were disinfected with Lysol. In addition, the chickens
of the food consumed 9. Based on the potential content
were administered an ND (Newcastle Disease) vaccine
of Moringa leaves, this research needs to be taken into
to prevent Newcastle disease. The ND vaccine consisted
account to examine the effect of Moringa leave powder
of 2 strains, namely Hichner B1 strain and Lasota strain.
addition in commercial diets toward meat protein and fat
The drinking water provided to the chickens was mixed
levels in male broilers.
with anti-stress vitamins. Cipro antibiotics were also
given adequately to unhealthy chickens. After that, the
Method data obtained were analyzed using the ANOVA (Analysis
This research was conducted at the Faculty of of Variance). In addition, Duncan’s Multiple Distance
Veterinary, Universitas Airlangga. The experimental Test was performed to discover the best treatment.
animals employed were 20 male broiler chickens of CP
707 strains and aged between 21 to 35 days old. This Results
research applied four treatments with a minimum of five The Protein Level of the Broiler Chicken Meat: The
replications for each treatment. addition of Moringa leaves powder in the male broiler
The treatment groups were arranged as follows: chickens’ diets suggested a significant difference (p
P0 (control): 100% commercial diets <0.05) of meat protein increase.
Table 1: Average protein levels of the broiler chicken meat supplemented with Moringa leave powder
Treatment Meat Protein Level (%) (X ± SD)
P0 (100% commercial diet) 19.37132a ± 0.36708
P1 (95% commercial diet+5% Moringa leave powder) 20.02166b ± 0.51725
The data analysis result using ANOVA on the meat protein level detected that P0 (control group) was significantly
different from P1, P2, and P3 (p<0.05). Meanwhile, P1 was not considerably different from P2 and P3 (p>0.05). The
data analysis results illustrated that the addition of Moringa leaves powder affected the protein level increase of the
male broiler meat.
The Fat Level of the Broiler Chicken Meat: The analysis results of the ANOVA test described that the Moringa
leaves powder added in the broiler chickens’ diets had a significant effect (p <0.05) on the fat level of the male broiler
chicken meat.
Table 2: Average of the fat level of the broiler chicken added with Moringa leaves powder
Treatment Meat Fat Level (%) (X ± SD)
P0 (100% commercial diet) 1.50284b ± 0.34660
P1 (95% commercial diet+ 5% Moringa leave powder) 1.23532ab ± 0.21376
P2 (90% commercial diet+10% Moringa leave powder) 1.30756ab ± 0.10908
P3 (85% commercial diet+15% Moringa leave powder) 1.13550a ± 0.14861
The average fat level of P0 (control group) differed damaged body tissue 13. One of the active compounds
significantly (p <0.05) from P3, but not significantly contained in fresh Moringa leaves is 492 mg of leucine,
different (p> 0.05) from P1 and P2. In contrast, P3 which plays a role in muscle protein synthesis and
illustrated a different result from P1 and P2. The highest normal cell function 14. The results of previous studies
fat level was identified in P0 (control), and the lowest on the benefits of Moringa leaves as a broiler chicken
level was in P3. The results of this data analysis described feed has proven that Moringa oleifera leaves could be
that the addition of Moringa leaves powder in the ration added up to 5% in feed to substitute fish powder and
could reduce the fat level of the male broiler meat. soybean 15.
The highest protein content of the broiler chickens

Discussion fed with Moringa leaves powder added in their diet was
Based on the data analysis results using the ANOVA found out in P1 with 5% Moringa powder level, resulting
test which was then followed by Duncan’s multiple in 20.02% protein increase. This result was significantly
distance test, the addition of Moringa oleifera leaves different from P0, which only reached 19.37% protein
powder in the ration significantly influenced (p<0.05) increase. The addition of 10% and 15% Moringa powder,
meat protein level increase. The lowest protein content of P2, and P3 treatment groups, produced lower protein
meat was produced by in the control group (P0), reaching content than P1, i.e., 19.87%, and 19.99% respectively.
only 19.37%. The highest protein content of meat Nevertheless, it was still higher than P0. Moreover, the
was generated from the addition of 5% Moringa leave protein content in the nutritional composition of feed
powder in treatment group 1 (P1), amounting to 20.02%. P1, P2, and P3 was not significantly different. Thus, the
Meanwhile, the protein content of meat produced with mean and standard deviations of the meat protein level
the addition of 10% Moringa leave powder (P2) reached were not significantly different as well. The results of
19.87%. This figure was not significantly distinctive this data analysis identified that the addition of Moringa
from the addition of 5% Moringa leave powder (P1) leaves powder on the chicken feed influenced the protein
reaching 20.02%, and the addition of 15% Moringa level increase of male broiler meat.
leaves powder (P3), amounting to 19.99%.
The average fat content of the broiler chickens
The meat protein level in the treatment group after being treated with the addition of Moringa leaves
experienced an increase, compared to the control powder, from each treatment group was 1.50% fat
group, despite within the normal range. The energy addition in P0 (control), 1.23% fat addition in P1, 1.30%
contained in the feed nutrient composition from P0 to fat addition in P2, and last 1.13% fat addition in P3. The
P3 decreased, namely 3,040.06 kcal/kg to 2,962.93 kcal/ highest fat content resulted in P0 (control), and the lowest
kg. The decrease in the energy contained in the ration was in P3. The statistical analysis results with ANOVA
composition caused an increase in ration consumption. test, followed by Duncan’s Multiple Distance test
It leads to more protein intake from ratio due to high identified that the addition of Moringa leaves powder on
ration consumption 10. The feed with higher energy is commercial diets had a significant effect on decreasing
less consumed. On the other hand, the feed with lower the fat content of the male broiler chickens meat. The
energy will be consumed more and more to meet their fat content in P0 (control) was significantly different
needs. The ration consumption in large amount will be from P3, which was 1.50% and 1.13% respectively.
followed by high protein intake 11. The consumption Meanwhile, P1 and P2 were not considerably different,
of high protein will also affect meat protein intake. namely 1.23% and 1.30% respectively.
Moreover, amino acids intake will be sufficient; hence,
In order to maintain the quality of the broiler
cell metabolism in the body occurs normally. It causes
chickens, the ration standard for the finisher phase
the meat protein level to increase 12.
requires crude fiber content, amounting no more than
Moringa contains essential amino acids that are 6.0%. It is found out that the crude fiber content in the
not produced by the body. Hence, it must be supplied nutrient composition of P3 feed reached 6.94%, and
into the body in a completed form. This amino acid is it increased from P0. The high crude fiber content in
highly vital in protein synthesis. Protein is essential for the ration appeared to reduce the cholesterol and fat
the growth of chickens’ body parts and for replacing level in the chickens’ body 15. Moreover, the average
and standard deviation of the meat fat level illustrated 2. Kanakri K, Carragher J, Hughes R, Muhlhausler
that P0 (control) was significantly different from P3. B, Gibson R. The effect of different dietary fats
The fat distribution in the body decreased, along with on the fatty acid composition of several tissues
the increase of crude fiber content in the diet, and the in broiler chickens. Eur J Lipid Sci Technol.
presence of probiotic addition in the body 16. 2018;120(1):1700237.
Diet is one of the factors that play a role in various 3. Naber EC. The cholesterol problem, the egg and
chemical and physiological activities, converting lipid metabolism in the laying hen. Poult Sci.
feed nutrients into animal body substances 17. Some 1976;55(1):14–30.
active substances in Moringa include saponins, 4. Kumar P, Chatli MK, Mehta N, Singh P, Malav
tannins, methionine, flavonoids, and essential oils 18. OP, Verma AK. Meat analogues: Health promising
The active substances such as saponins, vitamin C, sustainable meat substitutes. Crit Rev Food Sci
flavonoids, and tannins are also capable of reducing Nutr. 2017;57(5):923–32.
fat accumulation19. This component can be utilized to 5. Gopalakrishnan L, Doriya K, Kumar DS. Moringa
inhibit the accumulation of fat and cholesterol in the oleifera: A review on nutritive importance and its
body of livestock to improve carcass quality and reduce medicinal application. Food Sci Hum wellness.
carcass cholesterol in the broiler chickens. The addition 2016;5(2):49–56.
of alfalfa saponins is capable of lowering cholesterol and
6.
Idris A, Abubakar U. Phytochemical and
fat level in chicken’s breast meat 20.
antibacterial investigations of moringa (Moringa
Based on these reasons, the results of this study oleifera) leaf extract on selected bacterial pathogens.
are better since the fat content percentage of the broiler J Microbiol Antimicrob. 2016;8(5):28–33.
chickens was still in a low range. The results of this data 7. Marrelli M, Conforti F, Araniti F, Statti G. Effects
analysis identified that the addition of Moringa leaves of saponins on lipid metabolism: A review of
powder affected the fat content decrease in the male potential health benefits in the treatment of
broiler meat. obesity. Molecules. 2016;21(10):1404.
8. Falowo AB, Mukumbo FE, Idamokoro EM,
Conclusion Lorenzo JM, Afolayan AJ, Muchenje V. Multi-
functional application of Moringa oleifera Lam.
Moringa oleifera leave powder addition on the
in nutrition and animal food products: A review.
commercial diet can increase the protein content of male
Food Res Int. 2018;106:317–34.
broiler meat up to 15% powder addition and reduce the
fat content of the male broiler meat up to 15% powder 9. da Silva BV, Barreira JCM, Oliveira MBPP.
addition. Natural phytochemicals and probiotics as bioactive
ingredients for functional foods: Extraction,
Ethical Clearance: This research is in accordance with biochemistry and protected-delivery technologies.
ethical clearance, has not been published before and is Trends Food Sci Technol. 2016;50:144–58.
not being considered for publication elsewhere.
10. Simopoulos A. An increase in the omega-6/
Conflict of Interest: There is no conflict of interest in omega-3 fatty acid ratio increases the risk for
this study. obesity. Nutrients. 2016;8(3):128.
11. Wall BT, Gorissen SH, Pennings B, Koopman
Source of Funding: This research was carried out by a
R, Groen BBL, Verdijk LB, et al. Aging is
team and funded independently.
accompanied by a blunted muscle protein
synthetic response to protein ingestion. PLoS
References One. 2015;10(11):e0140903.
1. Petracci M, Mudalal S, Soglia F, Cavani C. Meat 12. Conlon M, Bird A. The impact of diet and lifestyle
quality in fast-growing broiler chickens. Worlds on gut microbiota and human health. Nutrients.
Poult Sci J. 2015;71(2):363–74. 2015;7(1):17–44.
13. Huber K. Invited review: resource allocation bioavailability and impacts on human health. Crit
mismatch as pathway to disproportionate growth Rev Food Sci Nutr. 2017;57(6):1280–93.
in farm animals–prerequisite for a disturbed
18. Brilhante RSN, Sales JA, Pereira VS, Castelo D
health. animal. 2018;12(3):528–36.
de SCM, de Aguiar Cordeiro R, de Souza Sampaio
14. Baptista ATA, Silva MO, Gomes RG, Bergamasco CM, et al. Research advances on the multiple uses
R, Vieira MF, Vieira AMS. Protein fractionation of of Moringa oleifera: A sustainable alternative for
seeds of Moringa oleifera lam and its application socially neglected population. Asian Pac J Trop
in superficial water treatment. Sep Purif Technol. Med. 2017;10(7):621–30.
2017;180:114–24.
19.
Suzuki-Sugihara N, Kishimoto Y, Saita E,
15. Sukria HA, Nugraha IES, Suci DM. Pengaruh Taguchi C, Kobayashi M, Ichitani M, et al. Green
proses steam pada daun kelor (Moringa oleifera) tea catechins prevent low-density lipoprotein
dan asam fulvat terhadap performa ayam broiler. J oxidation via their accumulation in low-density
Ilmu Nutr dan Teknol Pakan. 2018;16(2):1–9. lipoprotein particles in humans. Nutr Res.
2016;36(1):16–23.
16. Shoaib M, Shehzad A, Omar M, Rakha A, Raza
H, Sharif HR, et al. Inulin: Properties, health 20. Carrasco S, Wüstholz J, Hahn G, Bellof G. How
benefits and food applications. Carbohydr Polym. does feeding organic broilers high levels of
2016;147:444–54. alfalfa silage affect the meat quality? Org Agric.
2018;8(3):185–93.
17. Zaheer K, Humayoun Akhtar M. An updated
review of dietary isoflavones: nutrition, processing,
The Effect of Vitamin on Wistar Rats’ Testicle s Exposed to

Lethal Insecticide
Gabriella Ayu Pitaloka1, Kusnoto1, Thomas Valentinus Widiyatno1

1
Surabaya, East Java
Abstract
Background: Agricultural products exposed to endosulfan insecticides potentially lead to organ dysfunction
in living organisms that can cause morphological changes in the reproductive system such as a decrease in
the number of sperm cells, an inhibition on the testosterone production by the Leydig cells, and a decline in
the ascorbic acid levels in the testicles.
Purpose: This study aimed to determine the effect of vitamin C on testicle weight and the number of Leydig
cells in adult male Wistar rats exposed to endosulfan.
Method: This study used 20 male Wistar rats with an average weight of 25 grams as samples, where the
rats were equally divided into four groups, i.e., P-, P +, P1, and P2. The testicles of all Wistar rats were
harvested on day 19 and then prepared for a microscopic examination with routine H & E staining. The
results analyzed by using ANOVA and the Waller-Duncan T-test.
Results: The testicle weight of the Wistar rats administered with endosulfan suggested a significant difference
(p <0.05) and had the lowest value compared to the other treatments. The Wistar rats administered with
endosulfan and then followed by vitamin C administration did not indicate a significant difference (p <0.05).
Vitamin C administration to Wistar rats caused an increase in testicle weight. Conversely, administering
endosulfan to the Wistar rats caused a decrease in testicle weight.
Conclusion: Administering vitamin C to Wistar rats exposed to endosulfan could potentially lead to an
increase in the testicle weight and the Leydig cells.
Keywords: endosulfan, vitamin C, Wistar rats, testicle weight, Leydig cells
Introduction dysfunction if ingested. Endosulfan is a type of insecticide

classified as highly toxic and potentially cause damages
Some chemicals in recent years still need to be to the reproductive organs, especially the testicles 3.
evaluated and examined as they potentially lead to The endosulfan toxicity can lead to morphological and
toxicity in the reproductive system 1. One of the widely functional changes in the reproductive system such as a
used chemicals is endosulfan. This insecticide can enter decrease in the number of sperm cells and inhibition on
the body through various intermediaries such as food, the testosterone production by the Leydig cells 4. The
air, or skin contact can inflict several toxic effects on the endosulfan distribution is carried out through agricultural
body 2. The endosulfan contained in agricultural products lands and the surrounding aquatic environment 5. In
will enter the body of living organisms and lead to organ mammals, endosulfan disrupts the central nervous system
and the metabolic system so that it inhibits the nervous
Corresponding Author: system transmission in the brain 6, activates cholinergic,
Kusnoto dopaminergic 7, and serotonergic systems in the body
Department of Veterinary Education, mechanism 8, and causes very high gonad toxicity 9. At
Faculty of Veterinary, Universitas Airlangga a more severe level, it also causes lethal and sublethal
Jl. Mulyorejo, Surabaya, East Java, 60113 effects, which result in a high percentage of death and
Email: kusnotoo19@gmail.com disability effects on animal larvae 10.
Vitamin C is the main chain-breaking antioxidant P2: administered with 0.5 ml endosulfan at a dose of 3.2
that neutralizes hydroxyl, superoxide, and hydrogen mg/kg BW for ten days beginning on the 8th day to the
peroxide radicals and prevents sperm agglutination. 18th day, followed by vitamin C administration at a dose
The amount of vitamin C found in infertile men is quite of 50 mg/kg for seven days beginning on the 11th day to
low. At a dose of 200-1,000 mg/day, this vitamin can the 18th day
increase the sperm amount of infertile men in vivo
11
. Administering vitamin C can forestall cell lipid The dissection of the Wistar rats was carried out on
peroxidation, as evidenced by the diminishing occurrence the 19th day. The Wistar rats were euthanized by using
of cell damage 12. Vitamin C has positive effects on the chloroform PA and then dissected by using dissecting
reproductive organ weight and sperm parameters such as kits. After the scrotum was opened, the testicle organs of
motility, development, feasibility, number, and anomaly the Wistar rats were taken and then weighed using a 0.1
13
. Besides, vitamin C can also increase testosterone analytical scale to determine the testicle weight. After
levels in the blood 14. the weighing process, the testicles were washed with
a physiological solution and put into a pot containing
Based on the background above, this study aimed to
10% formalin solution for subsequent histopathological
determine whether administering endosulfan followed
preparation. The changes in the testicle weight and the
by vitamin C administration affected the testicle weight
number of Leydig cells in histopathological preparations
and the number of Leydig cells of the male Wistar rats.
This study hypothesized that vitamin C could improve were analyzed and examined by using SPSS program
the testicle morphology and increase the number of using the One-Way ANOVA method then followed with
Leydig cells of the Wistar rats exposed to endosulfan. Duncan’s Multiple Distance Test.
Method Results
This study used Federer’s formula to determine The right and left testicles of the Wistar rats
the number of samples for experimental research 15. were weighed with an analytical scale of 0.1 and then
The number of sample groups divided into 4 treatment examined using the ANOVA test. The average results
groups. The total number of samples in this study were of testicle weight in the P-, P +, P1, and P2 treatment
20 adult Wistar rats aged 2-3 months with an average groups were 0.056 grams, 0.024 grams, 0.064 grams,
weight of 25 grams. Its placed in closed plastic cages and 0.098 grams, respectively. The ANOVA test results
with a bed of husk in a ventilated room that is indirectly on the testicle weight indicated a significant difference in
illuminated to adapt to the research site for seven the existing treatments (p <0.05).
days and consisted of five Wistar rats. The amount of
endosulfan orally administered to the Wistar rats was 3.2
mg/kg BW, while the amount of vitamin C administered
was 25 mg/kg BW and 50 mg/kg BW.
There were four treatment groups of the Wistar rats

placed in cages for seven days to adapt to the research
site, namely:
P-: administered with 0.5 ml aquadest for ten days

starting on the 8th day to the 18th day
P+: with 0.5 ml endosulfan at a dose of 3.2 mg/kg for ten

days beginning on the 8th to the 18th day
Figure 1: The testicle weight chart of the Wistar rats
P1: administered with 0.5 ml endosulfan at a dose of 3.2
in four different treatments after the endosulfan and
mg/kg BW for ten days beginning on the 8th day to the
vitamin C administrations
18th day, and then followed by vitamin C administration
at a dose of 25 mg/kg for seven days beginning on the Based on the 5% Duncan’s test, the highest testicle
11th to the 18th day weight was in the P2 group and turned out to be
significantly different (p <0.05) compared to the other Wistar rats exposed to endosulfan. Endosulfan acts as a
treatment groups. It indicated that administering vitamin gamma amino butyric antagonist, which is an inhibitory
C at a dose of 50 mg/kg BW to Wistar rats caused testicle neurotransmitter in the central nervous system. Acute
weight to increase. The lowest testicle weight occurred symptoms of the endosulfan effects include motion
in the P+ group and was significantly different compared incoordination, gagging, vomiting, diarrhea, anxiety,
to the other treatment groups. This finding denoted that convulsion, and loss of consciousness. Moreover,
the endosulfan administration at a dose of 3.2 mg/kg BW endosulfan also inflicts the kidney, liver, reproductive
to Wistar rats caused testicle weight to decrease. On the organ, respiratory organ, and immune system disorders
other hand, the testicle weight in the P- and P1 groups in mammals 16.
did not differ significantly (p <0.05).
The results of the statistical analysis using ANOVA
The observation of Leydig cells in histopathological presented that the testicle weight of the Wistar rats in
preparations of the Wistar rats’ testicles using a the P+ treatment group differed significantly from the
microscope with 400x magnification in ten visual fields other treatments. In the P+ treatment, the Wistar rats
were between three to four seminiferous tubules. were given endosulfan at a dose of 3.2 mg/kg BW for
ten days. The testicle weight in the P+ treatment had
the lowest number compared to the other treatments,
which was only 0.024 cells. It indicated that the peroral
administration of 0.5 ml endosulfan at a dose of 3.2 mg/
kg BW for ten days to the Wistar rats caused the testicle
weight to decrease. In P1 treatment, where the Wistar rats
were administered with 0.5 ml endosulfan at a dose of
3.2 mg/kg BW for ten days followed by 0.5 ml vitamin C
administration at a dose of 25 mg/kg BW for seven days,
indicated a value of 0.064. Both treatments did not have
Figure 2: The chart of the Leydig cells number in a significant difference (p <0.05). It implied that vitamin
four different treatments after the endosulfan and C administration could not protect spermatogenic cells
vitamin C administration from free radicals inflicted by endosulfan, disrupting
the spermatogenic cell formation in the seminiferous
The results of the 5% Duncan test indicated that the tubules in the testicles.
highest number of Leydig cells occurred in the P- group,
reaching 296 cells, and differed significantly from the The heaviest testicle weight among all treatments
other treatment groups. The lowest number of Leydig was in P2 where the Wistar rats were administered with
cells in the P+ group, which only reached 169 cells and 0.5 ml endosulfan at a dose of 3.2 mg/kg BW for ten
differed significantly (p <0.05) from the other treatment days, followed by a 0.5 ml vitamin C administration at a
groups. It indicates that administering endosulfan at a dose of 50 mg/kg BW for seven days, reaching an amount
dose of 3.2 mg/kg BW in Wistar rats caused the number of 0.980. It showed that administering vitamin C could
of Leydig cells to decrease. The number of Leydig cells increase the number of spermatogenic cells formed so
in P1 and P2 groups that reached the amount of 210 and that there would be an increase in the epithelial thickness
269, respectively, were not significantly different (p> of the seminiferous tubules, affecting the testicle weight.
0.05). It proved that vitamin C administration to Wistar The spermatogenic cells formed in the testicles were
rats could improve the number of Leydig cells in each closely associated with an increase in the epithelial
treatment, but the most optimized Leydig cell recovery thickness of the seminiferous tubules. The abundance
was at a dose of 50 mg/kg BW. of spermatogenic cells in the seminiferous tubules in
the testicles could determine the increase in the testicle
weight itself 17. Administering vitamin C at a dose of
Discussion
50 mg/kg BW affected the number of spermatogenic
Vitamin C as an antioxidant has been proven to cells in Wistar rats exposed to endosulfan, causing the
improve the testicle morphology and weight, increase the testicle weight to increase. The results of the ANOVA
number of Leydig cells, and prevent cell damage of the test on the number of Leydig cells implied that the
endosulfan and vitamin C administration in Wistar rats signals to increase the follicle-stimulating hormone and
had a significant difference in the number of Leydig luteinizing hormone secretion by protecting the brain
cells. The highest number of Leydig cells occurred in and brain fluids. Therefore, the chain reaction of free
the P- treatment group as a control group, reaching an radicals would stop, the central nervous system would
amount of 296 cells and was significantly different from be safely protected from damage, and the pituitary
the P+ group with only 169 cells. It indicated that drug gland would typically produce hormones like follicle-
solvent administration did not lead to central nervous stimulating hormone and luteinizing hormone 20. If the
system disruption to secrete gonadotropin-releasing follicle-stimulating hormone and luteinizing hormone
hormone which stimulates the luteinizing hormone and levels became normal, the proliferation of Leydig cell
follicle-stimulating hormone secretion from the anterior development would normally run in the testicles.
pituitary gland.
Luteinizing hormone increased the activity of Conclusion

the desmolase cholesterol enzyme, stimulating the The administration of specific doses of vitamin C
testosterone secretion. On the other hand, follicle- could increase the testicle weight and the number of
stimulating hormone increased the Leydig cell responses Leydig cells in Wistar rats exposed to endosulfan.
to luteinizing hormone so that the spermatogenesis
process ran normally 18. In the P+ group, the endosulfan Ethical Clearance: This research is in accordance with
administration to the Wistar rats at a dose of 3.2 mg/kg BW ethical clearance, has not been published before and is
for ten days disrupted the hypothalamus by inhibiting the not being considered for publication elsewhere.
gonadotropin-releasing hormone performance so that the
follicle-stimulating hormone and luteinizing hormone Conflict of Interest: There is no conflict of interest in
formation became inhibited. If the levels of follicle- this study.
stimulating hormone and luteinizing hormone were
inhibited, the proliferation of Leydig cell development
team and funded independently.
in the testicles decreased. The results in P- group did not
differ significantly from P2 with 269 cells indicated that
the drug solvent and vitamin C administration at a dose References
of 50 mg/kg BW had the same function in maintaining 1. Cheng CY, Wong EWP, Lie PPY, Li MWM, Su
the number of Leydig cells. At a dose of 50 mg/kg, L, Siu ER, et al. Environmental toxicants and
vitamin C increased the luteinizing hormone secretion, male reproductive function. Spermatogenesis
which led to an increase in the number of Leydig cells [Internet]. 2011;1(1):2–13. Available from:
produced. Testosterone produced Androgen Binding https://www.ncbi.nlm.nih.gov/pubmed/21866273
Protein used in the spermatogenesis cycle to increase the
2. Dikshith TS, Raizada RB, Kumar SN, Srivastava
number of spermatozoa 19.
MK, Kaushal RA, Singh RP, et al. Effect of
The P1 and P2 treatment groups did not show a repeated dermal application of endosulfan to rats.
significant difference (p> 0.05). Whereas in P1, the Vet Hum Toxicol. 1988;30(3):219–24.
Wistar rats were administered with endosulfan at a dose 3. Wilson VS, LeBlanc GA. Endosulfan elevates
of 3.2 mg/kg BW, followed by vitamin C administration testosterone biotransformation and clearance in
at a dose of 25 mg/kg BW, and reached a total of 210 CD-1 mice. Toxicol Appl Pharmacol. 1998;158–68.
cells. In P2 group, the Wistar rats were administered
with endosulfan at a dose of 3.2 mg/kg BW, followed 4. Rahman S, Huang Y, Zhu L, Feng S, Khan I, Wu
by vitamin C administration at a dose of 50 mg/kg, and J, et al. therapeutic role of green tea polyphenols
reached a total of 269 cells. These findings implied in improving fertility: A review. Nutrients.
that vitamin C administration at a dose of both 25 mg/ 2018;10(7):834.
kg BW and 50 mg/kg could improve and maintain the 5. Kang HS, Gye MC, Kim MK. Effects of
number of Leydig cells, but the latter dose was proven endosulfan on survival and development of
to be more maximal. Vitamin C provides spontaneous Bombina orientalis (Boulenger) embryos. Bull
and rapid stimulation to the hypothalamus, arising Environ Contam Toxicol. 2008;81(3):262–5.
6. Abalis IM, Eldefrawi ME, Eldefrawi AT. Effects parameters in laboratory rats following long-term
of insecticides on GABA‐induced chloride influx exposure to cyclophosphamide. J Adv Pharm
into rat brain microsacs. J Toxicol Environ Heal Technol Res. 2017;8(2):73.
Part A Curr Issues. 1986;18(1):13–23.
14. Ashamu EA, Salawu EO, Oyewo OO, Alhassan
7. Anand M, Mehrotra S, Gopal K, Sur RN, Chandra AW, Alamu OA, Adegoke AA. Efficacy of vitamin
S V. Role of neurotransmitters in endosulfan- C and ethanolic extract of Sesamum indicum in
induced aggressive behaviour in normal and promoting fertility in male Wistar rats. J Hum
lesioned rats. Toxicol Lett. 1985;24(1):79–84. Reprod Sci. 2010;3(1):11.
8. Agrawal AK, Anand M, Zaidi NF, Seth PK. 15.
Kusriningrum RS. Perancangan Percobaan.
Involvement of serotonergic receptors in Surabaya: Airlangga University Press; 2008.
endosulfan neurotoxicity. Biochem Pharmacol.
16. Choudhary N, Joshi SC. Reproductive toxicity
1983;32(23):3591–3.
of endosulfan in male albino rats. Bull Environ
9. Singh SK, Pandey RS. Gonadal toxicity of short Contam Toxicol. 2003;70(2):285–9.
term chronic endosulfan exposure to male rats.
17. Leal MC, Becker-Silva SC, Chiarini-Garcia H,
Indian J Exp Biol. 1989;27(4):341–6.
França LR. Sertoli cell efficiency and daily sperm
10. Rohr JR, Elskus AA, Shepherd BS, Crowley PH, production in goats (Capra hircus). Anim Reprod.
McCarthy TM, Niedzwiecki JH, et al. Lethal and 2004;1(1):122–8.
sublethal effects of atrazine, carbaryl, endosulfan,
18. Legradi G, Emerson CH, Ahima RS, Rand WM,
and octylphenol on the streamside salamander
Flier JS, Lechan RM. Arcuate nucleus ablation
(Ambystoma barbouri). Environ Toxicol Chem
prevents fasting-induced suppression of ProTRH
An Int J. 2003;22(10):2385–92.
mRNA in the hypothalamic paraventricular
11. Agarwal S, Sharma S, Agrawal V, Roy N. Caloric nucleus. Neuroendocrinology. 1998;68(2):89–97.
restriction augments ROS defense in S. cerevisiae,
19. Chada M, Prusa R, Bronsky J, Kotaska K, Sidlova
by a Sir2p independent mechanism. Free Radic
K, Pechova M, et al. Inhibin B, follicle stimulating
Res. 2005;39(1):55–62.
hormone, luteinizing hormone and testosterone
12. Flora SJS, Pande M, Mehta A. Beneficial during childhood and puberty in males: changes
effect of combined administration of some in serum concentrations in relation to age and
naturally occurring antioxidants (vitamins) stage of puberty. Physiol Res. 2003;52(1):45–52.
and thiol chelators in the treatment of chronic
20. Briggs MH. Vitamins In Human Biology and
lead intoxication. Chem Biol Interact.
Medicine (1981). CRC Press; 2017.
2003;145(3):267–80.
13. Shabanian S, Farahbod F, Rafieian M, Ganji F,
Adib A. The effects of Vitamin C on sperm quality
The Potency of Formalin in Atenuation of Pathogenicity in

Eimeria Tenella at the Caecum of Broiler Chicken
Enik Setyowati1, Muchammad Yunus2, Dadik Rahardjo1

1
Faculty of Veterinary, Airlangga University, 2Departement of Parasitology Veterinary, Faculty of
Veterinary, Airlangga University, Kampus C, Mulyorejo, Kec. Mulyorejo, Kota Surabaya, Jawa Timur
Abstract
Background: Coccidiosis is a parasitic disease that disrupts digestive tract, especially in caecum. It causes a
lot of harm to chicken farms. Formalin, can be a new invention as an alternative for Eimeria tanella protozoa
attenuation in vaccines.
Aim: To determine formalin effect and optimum concentration for formalin attenuation of pathogenicity to
cecum lesions inoculated score in boiler chickens.
Method: This study was an experimental study using completely randomized design (CRD) with five
treatments. Treatment variation is formaldehyde with a concentration of 0%, 0.15%, 0.3%, 0.6%, 1.2%
Results: Results of the study showed that formalin with different concentrations resulted in a significant
decrease. Decreasing microscopic cecum lesions inoculated score in boiler chickens in each treatment 0%,
0.15%, 0.3%, 0.6% and 1.2% were 10.32; 9.86; 7.00; 5,14; 4.98 respectively. The largest decrease in lesion
score was at 1.2%.
Conclusion: Formalin with 1.2% concentration could reduce cecum lesions inoculated score in boiler
chickens
Keywords: Formalin, E. tenella, Caecum of boiler chicken, Attenuation
Introduction Various ways to control coccidiosis have been

carried out, but not yet fully successful. Maintenance
Chicken could get diseases caused by protozoa with with good sanitation can break Eimeria development
high morbidity and mortality. Coccidiosis is one parasitic cycle, but this method is still not fully able to prevent
that cause disease especially in caecum of digestive occurrence of coccidiosis. It is caused by the small
tract, resulting almost 80-90% morbidity and mortality size of the oocyst can contaminate water, feed, and
1
. In addition, this disease could also cause decreasing cage equipment. Residue in meat also could endanger
egg production, body weight and increasing in medical consumers 6. One effective action is using a vaccine that
expenses 2. Economic losses due to coccidiosis in United induce immunity. Live vaccine is giving immunity in a
States between 450 million dollars to 1.5 billion US certain range of time and protecting against infection
dollars 3. Coccidiosis is one among all diseases always with pathogenic agents 7. In coccidiosis, the best type
occurs in every period of chicken maintenance 4. of vaccine to use is an active vaccine, where vaccine
functions got protection in live vaccines form 8.
Formalin is a 37% formaldehyde gas solution and
Correspondece Author: contains methanol as a stabilizer 9. Coccidiosis vaccine
Muchammad Yunus development needs to be explored to prevent infection
Departement of Parasitology Veterinary, through various immersion concentrations of E. tenella
Faculty of Veterinary, Airlangga University with formalin as a live vaccine in chickens 10. Exploration
Kampus C, Mulyorejo, Kec. Mulyorejo, of optimum immersion time to produce attenuation
Kota Surabaya, Jawa Timur, 60115 could induce the most effective protective immunity
Email: muchammadyunusfkhunair@yahoo.com in chickens. This study aim was to determine formalin
effect and its attenuation optimum concentration on Treatment 0: As a control, oocysts was not soaked in
pathogenicity against cecum lesion scores inoculated in formalin and inoculated with 10,000 oocysts.
boiler chickens.
Treatment 1: E. tenella was soaked in formalin with a
Method concentration of 0.15% for 96 hours, then oral inoculated
with 10,000 oocysts.
This study was located in experimental cages,
parasitology laboratories and pathology laboratories Treatment II: E. tenella was soaked in formalin with a
at the Faculty of Veterinary, Universitas Airlangga, concentration of 0.3% for 96 hours, then oral inoculated
Surabaya. Method used in this study as follow (i)
with 10,000 oocysts orally.
Animals subject used in this study were 25 broiler
strains of CP 707 produced by Chaeron Pokphand and Treatment III: E. tenella was soaked in formalin with a
aged 21 days. Two-week-old chickens were kept in concentration of 0.6% for 96 hours, then oral inoculated
a battery-powered coop, fed ad libitium and did not with 10,000 oocysts.
contain coccidiostat. Saturated sugar solution, chlorine,
distilled water, formalin with concentrations of 0.15%, Treatment IV: E. tenella was soaked in formalin with a
0.3%, 0.6% and 1.2%. (iii) Research tools used were concentration of 1.2% for 96 hours, then oral inoculated
battery-powered chicken coop, feed-drink containers, with 10,000 oocysts.
microscope, object glass, cover glass, lab optics, surgical
scissors, tweezers, scalpel, centrifuge tube, centrifuge, Macroscopic and microscopic scoring was
tray, pot ointment, paper label, tissue paper, stapler, and performed on 5th day after inoculation with scoring
pipette, micropipette and white chip done macroscopically, cecal abnormalities were noted
and degree of damage to mucosal surface of chicken
Study was an experimental study using complete
cecum was calculated based on a score of 0-4 12 :
randomized design (CRD), consist of four treatments.
The treatment given is 1):
Table 1: The Degree of cecal damage in chicken that infected with E. tenella
Lession Score Description

0 Normal conditions do not indicate a presence of lesion.
Mild lesions, there is a presence of blood patch (ptechie) which spreads slightly on the mucosal
+1
surface accompanied by cecum discoloration or the contents of the digestive tract.
+2 Medium level lesions, more bleeding and lesions with a slight thickening of the cecum wall.
+3 Severe lesions, characterized by severe bleeding and blood clots.
Very severe lesions, characterized by very intense and widespread bleeding, the presence of
+4
bluish red clot in the cecum that indicates the presence of blood clots.
Histopathological observations were based on total values A and B, where A represents the distribution of E.
tenella presences found in the cecum mucosa in the histopathological preparation as described below 13,14:
Table 2: The Distribution of E. tenella presence found in the cecum mucosa in histopathological preparations

0 There are no parasites in the sub epithelial part.
+1 If in 10 visual fields in the sub-epithelium there are 1 parasite.
+2 If in 10 visual fields in the sub-epithelium there are 2 parasites.
+3 If in 10 fields of view in the sub-epithelium there are 3 parasites.
+4 If in 10 fields of view in the sub epithelium there are 4 parasites.
While B represents cecal damage severity caused by E. tenella as described below 13:
Table 3: The Severity damaged villi in caecum caused by E. tenella

0 If the severity due to parasitic infection in the villi is 0% at 10 fields of view.
+1 If the severity due to parasite infection in the villi is <25% at 10 fields of view.
+2 If the severity due to parasitic infection in the villi is 25-50% at 10 fields of view.
+3 If the severity due to parasitic infection in the villi is 51-75% at 10 fields of view.
+4 If the severity of infection of the villi parasites is> 75% at 10 fields of view.
Qantitative analysis was used in this study from scores and statistically analyzed using Spearman correlation test
Result Description: Different letter transcripts show significant

differences
Based on macroscopic and microscopic observations,
score data of cecal damage in E. tanella inoculation were Macroscopic and microscopic mean value of boiler
different between treatment groups. Calculation score chicken cecum lesions score showed a significant
lesion on boiler chicken cecum, based on average results difference. In macroscopic scoring, cecum lesion score
of macroscopic and microscopic scoring on each treatment. decreased with increasing formalin concentration.
However, treatment concentration of 0.6% and 1.2%
did not show a significant result of 0.547. The biggest
Table 4: Scores of chicken cecum lesions that decrease in the lesion score was in treatment group of
inoculated with E.tenella and were soaked using
0.6% and 1.2% with value of 0.6.
several formalin concentrations and infected with
each group of chicken with a dose of 1 x 104 oocyst Microscopic observation scoring showed a significant
of E. tenella decreasing in lesion scores between treatments on
Cecum score based Cecum Lession boiler chicken cecum along with increasing in formalin
Treatment on Macroscopic score based on concentration. Decreasing in lesion scores in treatment
group observation Macroscopic concentration of 0%, 0.15%, 0.3%, 0.6% and 1.2% were
X ± SD observation X ± SD 10.32; 9.86; 7.00; 5,14; 4.98 respectively. The biggest
decrease in lesion score was in the addition treatment
P0 1,8a ± 0,447 10,32𝑎 ± 0,487
concentration of 1.2%
P1 1,8b ± 0,447 9,86𝑏 ± 0,182
P2 1c ± 0 7,00𝑐 ± 0,339 Results of chicken cecum obtained from image
observation macroscopically. Picture showed degree
P3 0,6d ± 0,547 5,14𝑑 ± 0,207
damage of each treatment due to E.tenella inoculation
P4 0,6d ± 0,547 4,98𝑑 ± 0,239 can be seen in Figure 1.
Figure 1: Macroscopic image of chicken cecum inoculated with E. tenella soaked using several formalin
concentrations [0% (P0); 0.15% (P1); 0.3% (P2); 0.6% (P3); 1.2% (P4)]
Intensity of pteciae was reduced by immersion in Discussion

formalin with higher concentrations. Circle showed bleeding
in the mucosa and arrows for thickening of the mucous Chemicals for E.tenella attenuation in vaccines
cecum. Picture was taken using an iPhone 5s camera. usually using chemicals that can cause antigen changing
responsible for stimulating protective immunity.
Histopathological picture showed degree damage of Formalin reacts with amino and amide groups in proteins.
each treatment due to E.tenella inoculation can be seen Amino bonds are bound to non-water substances with
in Figure 2. basic ingredients of purine nucleic acids and pyrimidines
forming cross-bonds and provide structural rigidity in
the organism. Structural rigidity of organism will result
in cell death, could reduce virulence of the organism.
Organism could lives but not potent enough to cause
disease and has large influence to improve antibodies
15
. Formalin will react chemically with almost all
substances in cell thereby suppressing cell function and
causing cell death 16. Formalin is also a source of reactive
oxygen compounds (ROS) and oxygen free radicals 17.
Safe threshold of formalin in chicken bodies according
to International Program on Chemical Safety (IPCS) in
liquid form is 1 mg/l 18.
E. tenella infection phase in the cecum is at sporozoite

stage penetrates epithelial cells in cecum villi and crypta.
After in cecal epithelium, parasite develops asexually and
sexually. This development results in damage to cecal
epithelial cells due to schizont ruptured which liberated
merozoites. Larger size and increasing amount of E. tenella
that infects cecum could increase cecal epithelial erosion,
and vice versa 19. In previous study, it was resulting a decrease
in number and precocious lines 20. It caused a decrease in
the cecal epithelial erosion score in each treatment group.
Formalin could denaturate protein enzymes, and causing
enzyme structures changing. It inhibits enzyme activity
and unable to catalyze metabolic processes in cells, causing
microorganisms weaken and inhibit schizont process
21
. Inhibition of schizont process results in decreased
opportunities for reproduction and lesions will decrease.
Formalin is able to react with E. tenella oocysts because its
outer layer wall consists of protein and inner layer consists
of fat, related to protein. Formalin could easily binds
to protein 22, able to make organism cell dehydrated and
resulting in structural rigidity 23
Figure 2: Histopathological description of chicken
cecum inoculated with E. tenella and soaked using Macroscopic observation of the cecum at P0 showed
several formalin concentrations [0% (P0); 0.15% a moderate damage, characterized by more bleeding and
(P1); 0.3% (P2); 0.6% (P3); 1.2% (P4)] lesions with a slight thickening of cecum wall. This was
supported by clinical symptoms as chickens look limp,
Description: showing ruptured cecum villi,
tangled chicken feathers, decreased appetite. P1 showed
showing bleeding, showing E. tenella oocyst; (0.1 -
moderate level cecal lesions, characterized by more
4.1, 100x magnification; 0.2 - 4.2, 400x magnification).
bleeding and lesions with a slight thickening of the cecum
wall. P2 showed mild cecal lesions, some bleeding that chicken. There was a difference in the attenuation degree
spreads to mucosal surface of cecum with slight changes of E. tenella in each formalin concentration. The optimal
in wall color or digestive tract content. P3 showed mild formalin concentration for attenuate E. tenella in terms
cecal lesion, some bleeding that spreads to mucosal of macroscopic and microscopic features of broiler
surface of e cecum with slight changes in wall color or chickens was 1.2%.
contents of digestive tract. P4 showed mild cecal lesions,
some bleeding spreads to mucosal surface of cecum with Ethical Clearance: This study procedure used test
slight changes in wall color or contents of digestive tract animals were approved with the principles of ethical
12
. Conclusion of above discussion shows that optimal research based on research ethics committee rules.
formalin concentration for attenuating E. tenella in This study applied the basic principles of replacement,
terms of macroscopic aspect was 1.2%. It showed a reduction and refinement.
mild degree damage to cecum mucosa. Inoculation at Conflict of Interest: The author reports no conflict of
doses of 1000-3000 Oocysts of E.tenella could cause
bleeding and other characteristics caused by infection 24.
E. tenella infection causes lesions in cecum that cause Source of Funding: This study is done with individual
bleeding and diarrhea 25. Inoculation at treatment with funding.
1.2% formalin, there were several bleeding spreads to
mucosal surface of cecum with slight discoloration wall References
or contents of the digestive tract 12.
1. Retno, FD.,Jahja, J., Suryani T. Penyakit Penting
Histopathological observations in microscope on Pada Ayam. 4th ed. Bandung, Indonesia: Medion;
the cecum, based on P0 image, there was a lot of damage 1998.
to the cecum mucosa and development of parasites,
2. Kabbay M. Coccidiosis in Poulry. Veterinary
cecal epithelium was not compact, and many ruptured
Pathologist Animal Health Laboratories. Western
cecum villi were found. P1 showed histopathological
Australia; 2006.
abnormalities with mucosal damage and discovery
of clear parasites development in several parts. Cecal 3. Kim M-K, Lee J-A, Jo M-R, Kim M-K, Kim H-M,
epithelium did not appear to be compact, and cecum Oh J-M, et al. Cytotoxicity, Uptake Behaviors,
villi that rupture was found in several parts. P2 values and Oral Absorption of Food Grade Calcium
indicate histopathological abnormalities with mild Carbonate Nanomaterials. Nanomaterials
degrees damage to mucosal cecum. Cecal epithelium [Internet]. 2015;5(4):1938–54. Available from:
appeared to be compact, rupture of cecum villi was rarely http://www.mdpi.com/2079-4991/5/4/1938/
found and development of parasites also minimum. 4. Tabbu C. Penyakit Ayam dan Penanggulangannya.
Value of the microscopic scoring on P3 showed almost 6, editor. Yogyakarta, Indonesia: Kanisius; 2006.
no abnormalities in the histopathology of cecum. Cecal 3-25 p.
epithelium appeared to be compact and ruptured cecum
villi was rarely found. P4 shows cecum cell tend to be 5. Juandi. Patogenitas Infeksi Sporokista Eimeria
normal, cecal epithelium appeared patchy and almost tenella Ditinjau dari Skor perlakuan sekum ayam.
did not show any villi rupture 14. Other studies have Universitas Airlangga Indonesia; 2002.
obtained results on microscopic examination of chicken 6.
Harismah A. Pengaruh Pemberian Ekstrak
cecum infected with 5000 oocysts that shows cell Sambiloto Dengan Pelarut Air Dosis Bertingkat
necrosis, degeneration, thickening of the muscularis Terhadap Jumlah Skizon, Makrogamet,
layer, inflammatory cell infiltration, presence of parasites Mikrogamet Dan Ookista Eimeria Tenella Pada
surrounded by inflammatory cells and bleeding 26. Sekum Ayam. Intitut Pertanian Bogor Indonesia;
2006.
Conclusion
7. Meeusen ENT, Walker J, Peters A, Pastoret PP,
Based this result study, we can conclude that Jungersen G. Current status of veterinary vaccines.
formalin can attenuate E. tenella in cecum of broiler Clin Microbiol Rev. 2007;20(3):489–510.
8.
Yunus M. Pengaruh Berbagai Dosis Infeki 17. Mahdi, C., & Mubarak AS. Uji kandungan
Sporokista Eimeria tenella Terhadap Gambaran Formalin, Borak dan Pewarna Rhodamin pada
Sekum, Leuosit dan Produksi Ookista Pada Ayam Produk Perikanan dengan Metode Spot Test. Berk
Pedaging. Universitas Airlangga Indonesia; 2001. Ilm Perikan. 2008;62–6.
9.
Pelczar, M.J. dan Chan ECS. Dasar-dasar 18. Wisnu C. Analisis dan Aspek Kesehatan Bahan
Mikrobiologi Jilid 2. Jakarta, Indonesia: UI Press; Tambahan Pangan. Jakarta, Indonesia: Bumi
2006. Aksara; 2006. 202-205 p.
10. Proyowidodo D. Efektifitas Pemberian 19.

Quiroz-Castañeda RE, Dantán-González E.
Vaksin Koksidiosis Melalui Air Minum Dan Control of avian coccidiosis: Future and present
natural alternatives. Biomed Res Int. 2015;2015.
PakanTerhadap Infeksi Tantangan Eimeriatenella.
J Sains Vet. 2005;1:1–2. 20. Shirley MW, Bedrník P. Live Attenuated Vaccines
against Avian Coccidiosis: Parasitol Today.
11. Kadhim LI. Histopathological Changes of Broilers
1997;13(12):481–4.
Immunized With Sonicated Oocyst Against Eimeria
tenella. Int J Adv Biol Res. 2014;4(1):31–5. 21. Perkins J. Principles and Methoda Sterilization
in Health Sciences Publisher. 2nd ed. Charles C.
12. Raman M, Banu S., Gomathinayagam S, Raj Thomas, editor. Springfielld, USA: IIIionis; 1980.
GD. Lesion scoring technique for assessing
the virulence and pathogenicity of Indian field 22.
Kusumawati I. Penetapan Kadar Formalin.
isolates of avian Eimeria species. Vetrinarski Arh. Surakarta, Indonesia: Universitas Muhammadiyah
Surakarta; 2006. 163 p.
2011;81(2):259–71.
23. Kausyar A. Pengaruh Pemeberian Infus Daun
13. Goodwin, MA. JB and DI. Use of Microscopic
Andong (Cordyline Friticosa L) Terhadap Jumlah
lesion score, gross lesion score and oocyst count
Skizon, Mikrogamet, Makrogamet Dan Ookista
score to detect Eimeria maxima in Chickhens.
Pada Ayam Setelah Diinfeksi E. tenella. Institut
England; 2012. 405-408 p.
Pertanian Bogor Indonesia; 2002.
14. J.Orengo, A.J.Buendía, M.R.Ruiz-Ibáñez, 24. Hofstad, MS., BW. Calnek., CF., Helmboldt.,
J.Madrid, L.Del Río, P.Catalá-Gregori, V.García WM. Reid and H yod J. Disease of Poultry. 7th
FH. Evaluating the efficacy of cinnamaldehyde ed. London: Barllere Tidal; 1978. 759-805 p.
and Echinacea purpurea plant extract in broilers
against Eimeria acervulina. Vet Parasitol. 25. Ugurhart, GM., J. Armour. JD and FJ. Veterinary
Parasitology. Schotland: Logman Scientific and
2012;185(2–4):158–63.
Techical; 1990.
15. Tizard. Veterinary Immunologi an Introduction.
26. Suprihati, E. M dan R. W. Kajian Histopatologis
7th ed. USA: Saunders; 2004.
pada Sekum Anak Ayam Akibat Pemberian
16. Cahyadi. W. Analisis dan Aspek Kesehatan Bahan Sporokista Eimeria tenella. J Univ Airlangga
Tambahan Pangan. 2nd ed. Jakarta, Indonesia: [Internet]. 2000; Available from: http://journal.
Bumi Aksara; 2009. 134 p. unair.ac.id/filerPDF/Endang.pdf
Fasciolosis Prevalence on Several Cattle Breeds
Kurnia Winda Pratiwi1, Setiawan Koesdarto1, Nenny Harijani1

1
Faculty of Veterinary Medicine, Universitas Airlangga, Jl Mulyorejo Kampus C Universitas Airlangga,
Surabaya, Indonesia
Abstract
Background: Parasitic fluke infection diseases which affect livestock remain issues for big economic loss
in Indonesia and other parts of the world. Fasciola fluke infection is zoonotic. Hence it could infect animals
and human. Furthermore, fluke infection is hazardous and could result in big economic loss for farmers.
Purpose: This study aimed at determining the fasciolosis prevalence in cattle at an abattoir.
Method: The study applied a quantitative method with non-experimental design without any preceding
treatment. The independent variables included liver organs and cattle breeds, while the dependent variable
was fasciolosis prevalence. Cow livers and feces samples each were 100 samples examined in this study
through post-mortem and fecal examinations.
Result: From the examination, 17% of liver samples and 12% of feces samples were positively infected with
Fasciola sp. In aggregate, the total prevalence of Fasciola sp. infected cattle amounted to 27%. Viewed from
each cattle breeds, Simmental, Limousin, and Ongole cattle were positively infected with Fasciola sp. with
a prevalence of 12%, 12%, and 3%, respectively.
Conclusion: In this study, the prevalence of Fasciola sp. fluke infection was low. There was no correlation
between cattle breeds and Fasciola sp. prevalence.
Keywords: Fasciola sp., cattle, prevalence, abattoir
Introduction On the other hand, Fasciola gigantica is only found

in Africa and Asia and is rarely found in the northern
Cattle produce approximately 50% of the global part of Europe. According to a study, Fasciola hepatica
needs of meat, 95% of milk and 85% of skin needs for originated from Europe and used Galba tuncatula as its
industry 1. Nonetheless, many diseases infect cattle, intermediate host 6. Several countries, namely North
including fluke infection. Fluke infections on livestock, America, South Africa, Republic of Iran, and West
cause huge global economic loss indirectly. Many of Europe, are majorly affected 7. In several provinces
them are zoonotic and have become major community in Indonesia, Fasciolosis prevalence by F. gigantica
diseases 2–4. Fasciola sp. or liver flukes are among the reaches between 30-90% 8,9.
fluke parasites that infect cattle. It is a trematode from
Fasciola genus. F. hepatica and F. gigantica are two Fasciola sp. has a flat shape; similar to a leaf, with
species commonly reported to have the greatest impacts the anterior body wider than its posterior. Adult Fasciola
5
. Fasciola hepatica is an endemic parasite in Europe sp. has a greyish brown color, measuring 30 mm long
countries, Africa, Asia, the United States, and Oceania. and 13 mm wide. Fasciola sp. infects ruminants as its
definitive hosts that then survives and matures in the
liver and gall bladder. Several ruminants, namely bulls,
Correspondence Author: cattle, goats, and sheep, are commonly infected after
Setiawan Koesdarto swallowing F. gigantica metacercariae 8,10–12.
Faculty of Veterinary Medicine, Universitas Airlangga
Jl Mulyorejo Kampus C Universitas Airlangga, The cattle livers infected with Fasciola sp. are
Surabaya, Indonesia 60115 damaged and partly or completely rejected with chronic
Email: koesdarto@yahoo.com disease and other comorbidities causing decreased
livestock meat, milk, and skin production 2,6. Infected Table 1: Post-mortem and fecal examinations data
cattle can exhibit decreased body weight and production. of positively infected cattle
Furthermore, even though the cattle are free from the
Cattle breeds Liver Feces Infected total
adult flukes, performance disturbance remains present
prior to the slaughter process 6. Other symptoms Simmetal 7 7 12
caused by Fasciola sp. infection include poor nutrition, Limousin 8 4 12
slow growth, as well as liver and bile inflammation. Ongole 2 1 3
Moreover, the prolonged mild infection may cause cattle Total 17 12 27
unable to reach optimal body weight, exhibit weak body
Result of post-mortem and fecal examinations in
condition, decrease food appetite, inflammations on a
cattle breeds: The samples collected were cow livers
mandibular lymph node, hunger edema, and death 9,12.
and feces, each of the samples amounted to 100 items.
This study aimed at determining fasciolosis prevalence
The result indicated that there were 17% liver samples
in cattle at the abattoir.
collected through post-mortem examination and 12%
feces samples collected through fecal examination that
Method were positively infected with Fasciola sp. In aggregate,
the total percentage of infection amounted to 27%.
This study applied a quantitative approach with
non-experimental research design without any preceding Differences of Prevalence Numbers between Cattle
treatment. The field survey was conducted using random Breeds: The post-mortem and fecal examinations were
sampling. The independent variables included liver organs conducted to identify the prevalence and susceptibility
and cattle breeds. The liver organ variable was defined numbers of Fasciola sp. fluke infection among several
by the measurement of infection severity and sickness cattle breeds. The indicator was if one of the examinations
duration of the cattle breeds. The infection indicators indicated the occurrence of fluke or Fasciola sp. eggs, the
included any occurrence of inflammation, blockage of the animal was assumed to be infected with Fasciola sp. flukes.
bile ducts, and hardening tissues as the result of cirrhosis According to Table 1, twelve samples of Simmental
and atrophy. The cattle breeds included Simmental cattle, cattle, 12 samples of Limousin cattle, and 3 samples of
Limousin cattle, and Ongole cattle. Meanwhile, the Ongole cattle were positively infected with Fasciola sp.
dependent variable was fasciolosis prevalence. The data Meanwhile, 22 samples of Simmental cattle, 43 samples
were analyzed with Chi-Square by using SPSS program of Limousin cattle, and 8 samples of Ongole cattle were
for Windows (SPSS, Chicago, IL, USA). negatively infected.
Instruments: The instruments in this study included a

Discussion
camera, plastic pots, 10% formalin, scalpel, tweezers,
gloves, filters, plastic cups, centrifuge tubes, centrifuge Fasciolosis is a global health issue, causing a huge
tubes rack, stirring rod, object glass, cover glass, label economic loss for farm animals. Despite the significant
papers, pipets, optilab, and microscope. 3.6 importance to economic conditions and veterinarian
field, fasciolosis has spread globally and shown its
Feces samples examination: The fecal samples were emergency state as zoonotic parasites, which also infect
examined with native and sedimentation method to humans 13. The result of this study indicated lower
identify any existence of fluke eggs, along with its genus infection prevalence than previous studies 8.
and species that infected the cattle. The sample was
stated positively infected if there are any Fasciola sp. Fasciolosis in ruminants refers to the agents’ life
cycle which causes the infection. Adult Fasciola sp.
fluke eggs found.
flukes are capable of surviving in ruminants’ livers
for 1-3 years. The eggs were then discharged from the
Result ruminant body along with feces, and they are capable of
surviving for about 2-3 months in a humid environment3.
The post-mortem and fecal examination results of
liver and feces samples from cattle breeds in the abattoir Several aspects that influence Fasciola sp.
are presented in Table 1 as follows. development include climate and temperature conditions.
Other conditions include land altitude, rainfall, food bleeding marks spread at the organ surface with sizes
system management, and parasite distribution, as well as variations from small to big 11.
the intermediate host. Those aspects may have different
roles in Fasciola sp. development. One of the most There was no correlation between post-mortem
significant aspects in fasciolosis in certain areas is the and fecal examinations. Fasciola sp. flukes cannot be
suitable snail habitat. In addition, the cattle conditions inspected through only one examination. Therefore, two
of having poor nutrition are also susceptible to fluke examinations were conducted. Fecal examinations were
infections 8,13–15. conducted to detect the fasciolosis occurrence in cattle,
to prevent further occurrences and avoid economic
The standard temperature that Fasciola sp. needs for loss. This is the only examination that can detect safely
its development in a snail body ranges from 100 to 160 C. without having to kill animals. Meanwhile, post-mortem
The optimum humidity for the development of snail and examinations, in addition to detecting fasciolosis,
larva stage development inside the snail occurs when also serves to prove the feasibility of food in terms of
heavy rainfall takes place which increases the saturation veterinary public health 18.
and humidity 5,13. Furthermore, studies found that the
highest Fasciola sp. prevalence occurs as the result of According to the descriptions above, fasciolosis is a
increased rainfall during winter and autumn, along with widespread global occurrence and causes huge loss for
the higher infection prevalence in snails during the wet farmers and consumers in the form of liver failure, low-
season than in other months 6,9,16. quality meat, as well as growth and productivity rate
decrease. It has been mentioned that the high prevalence
Besides climate and temperature conditions, number is associated with poor management practices
other contributing factors in Fasciola sp. infection and farmers’ lack of knowledge about infection control.
include poor housing management, food and nutrition, This situation can be prevented by conducting control
grazing, sanitation, and farmers’ lack of knowledge toward intermediate hosts, therapeutic strategies, and
about infection control 17. The increase of Fasciola being supported by adequate grazing management to
sp. prevalence number is caused by the existence of control fasciolosis.
swamps and well-irrigated grass which are suitable for
the intermediate hosts’ reproduction. Since green grass Conclusion
is the habitat for flukes of metacercariae infective stage,
The result of this study indicated that the Fasciola sp.
farmers should not provide fresh grass to cattle. These
prevalence in infected cattle breeds was lower compared
external factors result in no difference in Fasciola sp.
to previous studies from other areas in Indonesia. There
infection among cattle breeds.
was no correlation between cattle breeds and Fasciola
In acute disease condition, the life cycle of flukes sp. infection prevalence. Nonetheless, the fluke infection
is not completed, and the eggs are not produced, can be prevented by proper grazing management,
resulting in the absence of Fasciola sp. eggs in the fecal intermediate host controlling, and therapeutic strategies.
examination. After 16 weeks, young flukes grow mature
and live inside the bile ducts. Then, mature flukes produce
participants in the survey using a questionnaire that was
Fasciola sp. eggs. This stage resulted in the absence of
accordant with the ethical research principle based on the
Fasciola sp. flukes in post-mortem examination because
regulation of research ethic committee. The present study
the fluke migration never reached the liver. was carried out in accordance with the research principles.
If observed through bare eyes, the appearance of This study implemented the basic principle ethics of
the infected liver organ in cattle is visible on the organ respect, beneficence, non-maleficence, and justice.
enlargement as the result of inflammation in liver Conflict of Interest: The authors report no conflict of
parenchyma and gall bladder fibrosis, which contained interest in this work.
mature flukes. In acute condition, the liver organ is
swollen or enlarged with the dull-formed liver edge, has Source of Funding: This study is done with individual
pale-colored compared to the normal state with several funding.
References 10. Abebe R, Abunna F, Berhane M, Mekuria S,

Regassa A. Fasciolosis : Prevalence, financial
1.
Aisyah S. TINGKAT PRODUKSI SUSU
losses due to liver condemnation and evaluation
DAN KESEHATAN SAPI PERAH DENGAN
of a simple sedimentation diagnostic technique in
PEMBERIAN ALOE BARBADENSIS MILLER.
cattle slaughtered at Hawassa Municipal abattoir,
GAMMA. 2011;7(September):50-60.
southern Ethiopia. Ethiop Vet J. 2014;14(1):39-51.
2. Elelu N, Ambali A, Coles GC, Eisler MC. Cross-
11. Talukder S, Bhuiyan M, Hossain M, Uddin
sectional study of Fasciola gigantica and other
M, Paul S, Howlader M. PATHOLOGICAL
trematode infections of cattle in Edu Local
INVESTIGATION OF LIVER FLUKE
Government Area, Kwara State, north-central
INFECTION OF SLAUGHTERED BLACK
Nigeria. Parasites and Vectors. 2016;9(1):1-11.
doi:10.1186/s13071-016-1737-5 BENGAL GOAT IN A SELECTED AREA
OF BANGLADESH. Bangladesh J Vet Med.
3.
Widjayanti S. Fasciolosis pada manusia: 2010;8(1):35-40. doi:10.3329/bjvm.v8i1.7717
mungkinkah terjadi di Indonesia. Wartazoa.
2004;14:65-72. 12. Phalee A, Wongsawad C, Rojanapaibul A, Chai
J. Experimental Life History and Biological
4. Mellau LSB, Nonga HE, Karimuribo ED. A Characteristics of Fasciola gigantica (Digenea :
Slaughterhouse Survey of Liver Lesions in Fasciolidae) . 2015;53(1):59-64.
Slaughtered Cattle, Sheep and Goats at Arusha,
Tanzania. Res J Vet Sci. 2010;3(3):179-188. 13. Bekele Mihreteab, Tesfay Haftom GY. Bovine
doi:10.3923/rjvs.2010.179.188 Fasciolosis: Prevalence and its economic loss due
to liver condemnation at Adwa Municipal Abattoir,
5. Abunna F, Asfaw L, Megersa B, Regassa A. North Ethiopia. Ejast 1(1). 2010;(June):39-47.
Bovine fasciolosis: Coprological, abattoir survey
and its economic impact due to liver condemnation 14. Belay E, Molla W, Amare A. Prevalence and
at Soddo municipal abattoir, Southern Ethiopia. Economic Losses of Bovine Fasciolosis in Dessie
Trop Anim Health Prod. 2010;42(2):289-292. Municipal Abattoir, South Wollo Zone, Ethiopia.
doi:10.1007/s11250-009-9419-3 Eur J Biol Sci. 2012;4(2):53-59. doi:10.5829/
idosi.ejbs.2012.4.2.63172
6.
Oryan A, Mansourian M, Moazeni M,
Nikahval B, Barband S. Liver distomatosis in 15. Ashrafi K, Mas-Coma S. Fasciola gigantica
cattle, sheep and goats of Northeastern Iran. transmission in the zoonotic fascioliasis
Glob Vet. 2011;6(3):241-246. doi:10.1016/j. endemic lowlands of Guilan, Iran: Experimental
jallcom.2009.04.147 assessment. Vet Parasitol. 2014;205(1-2):96-106.
doi:10.1016/j.vetpar.2014.07.017
7.
Mas-Coma MS, Esteban JG, Bargues MD.
Epidemiology of human fascioliasis: a review and 16. Valero MA, Bargues MD, Calderón L, Artigas P.
proposed new classification. World Heal Organ. Infection, Genetics and Evolution First phenotypic
1999;77(4):1-7. and genotypic description of Fasciola hepatica
infecting highland cattle in the state of Mexico,
8. Balqis U, Darmawi D, Aisyah S, Hambal M. Mexico. Infect Genet Evol. 2018;64(June):231-
Perubahan Patologi Anatomi Hati dan Saluran 240. doi:10.1016/j.meegid.2018.06.032
Empedu Sapi Aceh Yang Terinfeksi Fasciola
gigantica. J Agripet. 2013;13(1):53-58. 17. Mehmood K, Zhang H, Sabir AJ, et al. A
review on epidemiology, global prevalence and
9. Kardena IM, Winaya IBO, Elyda E, Adhiwitana economical losses of fasciolosis in ruminants.
IDM, Adi AAAM, Berata IK. Gambaran Microb Pathog. 2017;109:253-262. doi:10.1016/j.
Histopatologi Selaput Lendir Kantung Empedu
micpath.2017.06.006
Sapi Bali yang Terinfeksi Cacing Fasciola gigantica
(HISTOPATOLOGICAL ILLUSTRATION OF 18. Denbarga Y, Demewez G, Sheferaw D. Major
GALL BLADDER MUCOUS MEMBRANE causes of organ condemnation and financial
INFASCIOLA GIGANTICA INFECTED BALI significance of cattle slaughtered at gondar
CATTLE). J Vet. 2016;17(1):16-21. doi:10.19087/ elfora abattoir, Northern Ethiopia. Glob Vet.
jveteriner.2016.17.1.16 2011;7(5):487-490.
BPJS Kesehatan Patients Satisfaction on Pharmaceutical

Services in Community Health Center (PUSKESMAS)―South
Surabaya Area
Assyifa Ilmi Auliya1, I Nyoman Wijaya1, Catur Dian Setiawan1, Gesnita Nugraheni1
Pharmacy Department, Faculty of Pharmacy, Airlangga University, Indonesia, Jl. Airlangga No 4-6,
1
Airlangga, Gubeng, Surabaya city, Jawa Timur
ABSTRACT
Background: The implementation of health care efforts in the Puskesmas, as primary health care facility,
needs to be supported by proper pharmaceutical services through patient perceptions. The measurement
of patient satisfaction is based on five dimensions of service quality, namely reliability, responsiveness,
assurance, empathy and tangibles.
Objective: The purpose of this study was to determine satisfactory of the patient using Social Health Security
Agency (BPJS Kesehatan) Health Insurance on pharmaceutical services in the Puskesmas
Method: This was a descriptive cross-sectional study which including 120 respondents who had pharmacy
services at that time in the puskesmas. Questionnaire with a Likert scale were used in this study, which was
previously tested for validity and reliability. Data analysis was done by comparing the patient’s perception
of performance and expectations using the servqual and customer window methods.
Results: It shown that there were 18/25 items of negative statements which meant that the patients were
not satisfied. The results using the customer window method shown an illustration in 4 quadrants. Quadrant
A (indicators that are the top priority to be improved), quadrant B (indicators that need to be maintained),
quadrant C (indicators that are in low priority) and quadrant D (indicators that are perceived as excessive
by patients).
Conclusion: In general, patients were still not satisfied with the pharmacy services in the Puskesmas. This
patient’s perception was influenced by the quality of services as well as the experience they have
Keywords: Satisfaction, expectation, service performance, servqual method, customer window
Introduction receive proper health care and protection in meeting

basic health needs given to everyone who has paid
The Social Health Security Agency (BPJS contributions or fees paid by the government 1.
Kesehatan) is a legal entity established to administer
national health insurance program in Indonesia 1. Health The World Health Organization (WHO) also
insurance is a health protection in which participants explained that one of health problems are related to health
services 2. Health services in this case the health center that
should provide services include promotion, prevention,
curation 3 and rehabilitaton services including medicines
Correspondence Author: and consumable medical materials in accordance with
I Nyoman Wijaya the medical needs. The intended health services include
Pharmacy Department, Faculty of Pharmacy, all primary-level health facilities and advanced health
Airlangga University, Indonesia facilities, other health facilities determined by the
Jl. Airlangga No 4-6, Airlangga, Minister in collaboration with BPJS Health including
Gubeng, Surabaya city, Jawa Timur 60115 supporting health facilities consisting of laboratories,
Email: iwijayanyoman@gmail.com hospital pharmacy installations, pharmacies, blood
transfusion units/Red Cross Indonesia, optics, service with the inclusion and exclusion criteria, the minimum
provider for Consumable Ambulatory Peritonial Dialysis number of respondent taken on each puskesmas was as
(CAPD) and midwife/nurse practice or equivalent 1. many as 7 patients12. The instrument used in this study is
a questionnaire with a Likert scale that has been tested
The implementation of health services which are
for validity and reliability13. Likert scale was used in this
a shared responsibility of the government and the
study because there were a few aspects such as attitudes,
community is mostly carried out in health centers 4.
opinions and perceptions of a person or group of people
The responsibility of the government is to provide
about social phenomena that about to be measured.
quality health services in accordance with health service
quality standards5. Patients/communities assess quality The data validity test was carried out in this study
services as services that can meet the expectations and by using visual validity, content validity, and construct
needs, they feel. The quality of health services related validity. The visual validity test was done by comparing
to patient satisfaction can affect the degree of health between two types of instruments that have different
and community well-being, because patients who are paper sizes. In addition to validity testing, this study
satisfied will comply with the treatment and want to also carried out a reliability test. The reliability of the
come back for treatment6. questionnaire in this study was tested by the Alpha
Crohnbach technique.
Satisfaction is the feeling of being happy or
disappointed someone who appears after comparing Data analysis is performed using a customer
between impressions of the performance or results of a window derived from the concept of SERVQUAL
product and its expectations7. By knowing satisfaction (service quality) by measuring patient expectation
with the services provided, it can be known the needs, (customer expectation) associated with the performance
desires, and expectations of patients so that service should be done to produce high-quality services9. The
quality improvement can be carried out in accordance SERVQUAL method is used to measure the quality of
with patient expectations8. To find out satisfaction pharmaceutical services for each indicator, which is
with service quality can use the SERVQUAL (service satisfied or dissatisfied. In analyzing customer window,
quality) concept that measures patient expectations the average value of total performance and expectations
and is associated with what should be done to produce is used, which are described by two variables, namely
high-quality services9. The indicators used to measure X and Y.
satisfaction in this study are tangible, reliability,
responsiveness, assurance, and empathy. In organizing
Results
pharmacy staff pharmacy services use the Service
Standards guidelines that cover standard management of The results of this first study are in the form of
drugs and medical consumables material and standard demographic data. Demographic data in this study were
clinical pharmacy services10. This study aimed to not counted as patient satisfaction factors but were only
determine the patient satisfactions who were the user of used to find out visitors’ data on the health center at the
the BPJS Kesehatan health insurance on pharmaceutical time the study was conducted.
services in the puskesmas.
Table 1: Demographic data of respondents
Method
Treatment
Paramaters
This was a descriptive study, namely research that N %
describes important events 11. The study was conducted Frequency distribution of respondents in each
using cross-sectional data retrieval with data sources puskesmas
form of primary data and secondary data. Measurements Sawahan 8 6,6
can be made on subjects that are observed only once but Putat Jaya 8 6,6
do not have to be at one time. Banyu Urip 8 6,6
Data sampling in this study using non-random Jagir 8 6,6
sampling or accidental sampling method. In accordance Wonokromo 8 6,6
Conted… SERVQUAL Analysis: The calculation results with the

SERVQUAL method, 18 items of statements obtained
Ngagel Rejo 8 6,6
are negative which means the patient is not satisfied
Kedurus 8 6,6 and 7 statement items are positive which means the
Dukuh Kupang 8 6,6 patient is satisfied. The first dimension is tangibles,
Wiyung 8 6,6 three statements of patients feel dissatisfied and three
Gayungan 8 6,6 more statements are quite satisfied. For the statement
Jemursari 8 6,6 ‘Comfort of the waiting room’ the score produced is
negative (not satisfied). Then in the statement “There are
Sidosermo 8 6,6
posters/brochures/health magazines or the like for drug
Kebonsari 8 6,6
information or counseling efforts” the resulting score is
Balas Klumprik 8 6,6 also negative (not satisfied). But in the administration of
Siwalankerto 8 6,6 drugs in good condition and packaging and clear use of
Total 120 100 letters, patients have been quite satisfied as evidenced by
Age positive results.
17- 24 years 7 5,8
Almost all statements in the reliabilty dimension
25 - 44 years 70 58,3 did not meet the patient expectation. For statements
45 – 64 years 41 34,2 “Pharmacy officers give information directly or in
> 65 years 2 1,7 writing about the usage of drugs” the score produced is
Total 120 100 negative (not satisfied). The biggest dissatisfaction in
Gender this dimension is in the statement “Pharmacy officers
Male 48 40 give explanations if patients forget to take medicine”.
Only one statement “The officer gives information
Female 72 60
directly or in writing about the rules for taking drugs and
Total 120 100
when taking medication” which is positive (satisfied).
Occupation
Government Employees/Soldier/Police 12 10 The majority of the patients were not satisfied in the
Entrepreneur/Private 56 46,7 statements on assurance and responsiveness dimensions.
The biggest dissatisfaction result lies in the statement
Housewife/Not Working 45 37,5
“The pharmacy officers asks the patient to repeat the
Retired 5 4,2 explanation” then the second in the statement “The clerk
College student 2 1,7 asks the patient’s medication history” and third in the
Total 120 100 statement “The pharmacy officers asks the patient’s
Education allergy history” the score is below -0.50.
Elementary/equivalent 5 4,2
Performance–Expectation Quadrant (Customer
Middle/equivalent 28 23,3 Window): One way to observe the overall service
High school/equivalent 59 49,2 quality is to use the Customer Window. To obtain
College/equivalent 28 23,3 each coordinate of each indicator is by multiplying
Total 120 100 the frequency of each score, then calculate the average
score for each statement. X value is obtained from the
The minimum respondent number for each average performance score and Y value obtained from
puskesmas is seven patients. However, to avoid the lack the average score of expectation. Then, to obtain the
of respondents, 8 patients in each health care will be intersection of X and Y, the average performance score is
given a questionnaire to get the results of 120 respondents divided by the number of statements on the questionnaire
in one area of South Surabaya. More than 50% of for intersections on line X and the average expectations
respondents were female. The age of the respondents in
score divided by the number of item statements on the
this study varied from 17 years to 69 years old.
questionnaire for intersections on line Y.
Figure 1: Customer window of the pharmaceutical service at the Puskesmas
The greatest value of dissatisfaction is in the drug use Using the SERVQUAL method we can reveal the
monitoring by the health workers indicators, for example difference between patient preferences and experience14.
via telephone or when the patient comes back (value There are 7 positive statements and 18 negative
-1.07) which means that the patient’s expectation on these statements. The first dimension is tangible evidence.
indicators is very high but the performance of pharmacy This dimension is important to grow the image of
service officers is very low. This shows that patients service providers or in this case, The Puskesmas, for
understand the importance medication use monitoring. On patients 16. One of the patient dissatisfaction is the
the other hand, patients with the smallest dissatisfaction uncomfortable waiting room at the puskesmas. This
value were found in the using easy-to-understand patient dissatisfaction also occurs because patients do
language indicators (value 0.42) which means that the not understand the purpose of giving such media/posters/
service performance have met patient expectations. This brochures/magazines.
shows that the patient is satisfied with the performance of
pharmacy service officers on the indicator. The second dimension is reliability. This dimension
importance is that customer satisfaction will decrease
if the service provided is not in accordance with what
Discussion
was promised (on time) 16. Based on observations in the
One of the most important dimensions of quality field, there are officers who always provide information
and the main indicator of health care success is directly about the medicinal uses. Patient dissatisfaction
patient satisfaction14. Patients will feel satisfied if the can occur because the patient has repeatedly obtained
performance of health services have met or exceed their the drug and feels that he already knows the information
expectations, otherwise patient disappointment will about the drug that been given so that when the officer
arise if the performance of health services obtained is provides information related to the drug, the patient
not in line with their expectations6. Patient satisfaction does not pay too much attention. Officers also often do
is a valid indicator of the quality of services15. Service not explain this to patients because officers shorten the
quality and satisfaction are subjective for each patient. information given to patients at the time of delivering
medicines so that all patients can be served. But this Conclusion

should be explained, for example, in patients who get
antibiotics. This can increase the incidence of resistance In general, the patients were not satisfied with
due to the wrong method of using antibiotic drugs. pharmacy services in the Puskesmas based on the
SERVQUAL method. Patient satisfaction was carried
The third dimension is assurance. The importance out based on five dimensions of service quality,
of this dimension is due to the knowledge and behavior namely care (emphaty), physical evidence (tangibles),
of service providers to build trust and confidence in responsiveness, assurance, and reliability. Several
consumers to use their services 16. Observations in the pharmacy-services indicators have not yet fulfilled
field, officers only call the names on the recipe but do not patient expectation, therefore its improvement has to
make sure who take the drugs. By identifying the owner be prioritized. Other pharmacy-services indicators that
properly, swapped drugs between patients who have the have met patient expectation must be maintained so their
same name can be prevented. Patients have realized the satisfaction will generally improve.
importance of this, thus there must be an improvement
in delivering prescribed drugs by pharmacy services in Ethical Clearance: The research process involves
the puskesmas. participants in the survey using a questionnaire that was
accordant with the ethical research principle based on
The fourth dimension is responsiveness. The the regulation of research ethic committee. The present
importance of this dimension is to provide service study was carried out in accordance with the research
quickly and responsively. Responsiveness can foster principles. This study implemented the basic principle
a positive perception of the services. This dimension ethics of respect, beneficence, nonmaleficence, and
emphasizes the attention and speed of the officers justice.
involved in responding to patients’ requests, questions
and complaints16. The time needed by the officer to do the Conflict of Interest: None declared
service is not too long, but the patient’s dissatisfaction
can be due to the psychological state of the patient who
feels unwell and wants to return home quickly so that funding.
the service is felt relatively long. Another factor that can
cause long service time is because the queue piles up at REFERENCES
one period of time. 1.
BPJS Kesehatan BPJSK. Peraturan Badan
The fifth dimension is concern (empathy). The Penyelenggara Jaminan Sosial Kesehatan Nomor
importance of this dimension is to give attention to 1 Tahun 2014 tentang Penyelenggara Jaminan
customers by placing themselves in the customer’s Kesehatan. Indonesia; 2014.
situation16. Overall for this dimension the patient feels 2. Hirshon JM, Risko N, Calvello EJB, Ramirez SS
dissatisfied. Most patients consider drug use monitoring de, Narayan M, Theodosis C, et al. Health systems
via telephone is an important thing but it was never and services: the role of acute care. Bulletin of the
been done by pharmacy officers at the puskesmas. This World Health Organization. 2013;91:386–8.
proves that the patient knows that drug use needs to be
monitored by pharmacy officers to see the progress of 3. Hofmarcher MM, Quentin W. Austria: Health
treatment, especially for chronic diseases. system review. Health systems in transition.
2013;15(7):1–292.
Measurement of the gap between performance and
4. Syakhrudin S, Kristiani K. Pelayanan Kesehatan
expectations is needed to determine patient satisfaction
Dasar Gratis, Dampaknya terhadap Motivasi
for each item statement of pharmaceutical services.
Kerja Puskesmas Rawat Inap Kabupaten Banjar.
The purpose of knowing patient satisfaction on each
Yogyakarta; 2008. Report No.: 2.
statement is to know the lack of services available in the
puskesmas so that it can be used as a recommendation 5.
KEMENKES RI KKRI. Undang-Undang
to improve the performance of pharmacy services in the Republik Indonesia Nomor 36 Tahun 2009 tentang
puskesmas. Kesehatan. Indonesia; 2009.
6. Pohan IS. Jaminan mutu layanan kesehatan: 12. Hosmer DW, Lemeshow S, May S. Applied
Dasar-dasar pengertian dan penerapan. Jakarta: survival analysis: regression modeling of time-to-
EGC; 2007. 14 p. event data. 2nd ed. US: Wiley-Interscience; 2011.
7. Kotler P. Marketing Management. 11th ed. New 13. Allen IE, Seaman CA. Likert scales and data
Jersey: Prentice Hall; 2003. 138 p. analyses. Quality progress. 2007;40(7):64–5.
8. Kotler P, Gertner D. Country as brand, product, 14.
Pakdil F, Harwood TN. Patient satisfaction
and beyond: A place marketing and brand in a preoperative assessment clinic: an
management perspective. Journal of brand analysis using SERVQUAL dimensions. Total
management. 2002;9(4):249–61. Quality Management & Business Excellence.
2005;16(1):15–30.
9.
Rangkuti F. Teknik Mengukur dan Strategi
Meningkatkan Kepuasan Pelanggan. Jakarta: 15. González-Valentín A, Padín-López S, de Ramón-
Gramedia Pustaka Utama; 2006. 109–113 p. Garrido E. Patient satisfaction with nursing care
in a regional university hospital in southern Spain.
10.
KEMENKES RI KKRI. Peraturan Menteri
Journal of Nursing Care Quality. 2005;20(1):63–
Kesehatan Republik Indonesia Nomor 30 Tahun
72.
2014 tentang Standar Pelayanan Kefarmasian di
Puskesmas. Jakarta; 2014. 16. Parasuraman A, Zeithaml VA, Berry LL. Servqual:
A multiple-item scale for measuring consumer
11. Nursalam N. Konsep dan Penerapan Metodologi
perc. Journal of retailing. 1988;64(1):12–40.
Penelitian Ilmu Keperawatan. Jakarta: Salemba
Medika; 2003.
The Effect of Lower Extremity Massage with Lavender

Essential Oil on Decreasing Blood Pressure in Elderly with
Hypertension in UPTD Griya Werdha Surabaya
Fatih Haris Maulana1, Joni Haryanto1, Elida Ulfiana1

1
Community and Mental Health Department, Faculty of Nursing, Airlangga University, Jl. Mulyorejo,
Surabaya City, Jawa Timur
ABSTRACT
Introduction: Hypertension is one of the degenerative diseases that occur in almost all the elderly in the
world. The high rate of hypertension may lead to mild or severe strokes even to death. The purpose of
this study was to determine the effectiveness of lower extremity massage with lavender essential oil in the
elderly with hypertension.
Method: This study used a pre-experimental design with one group research pre-test and post-test design.
The sample in this study was 13 elderly who had hypertension who were selected according to the specified
inclusion and exclusion criteria. Thirteen respondents in this study were in accordance with inclusion and
exclusion criteria. The variables studied were administration of lower extremity massage with lavender
essential oil on elderly blood pressure. Furthermore, the data obtained were analyzed by the Shapiro Wilk
normality test.
Results: Elderly blood pressure were measured before lower extremity massage with lavender essential oil
and reaches a value of 180/100 mmHg. After being given therapy, systolic pressure has a maximum value
of 160 mmHg and for diastolic values has a maximum value of 90 mmHg. There was a significant effect of
lower extremity massage with lavender essential oil on decreasing blood pressure in hypertensive elderly
people (p≤0.05).
Conclusion: The lower extremity massage with lavender essential oil was effective in reducing blood
pressure in elderly hypertension. This therapy can be used as one of the complementary treatments in the
form of lower extremity massage with lavender essential oil.
Keywords: Hypertension in the elderly, massage, lavender essential oil
Introduction Hypertension is a persistent blood pressure with

systolic pressure above 140 mmHg and diastolic pressure
Along with the progression of age, the physiological above 90 mmHg. About 20% of the elderly population
changes will occur in the elderly accompanied by various has hypertension 3. In 2008 there were about 40% of
health problems that cause high degenerative diseases. people over the age of 25 in the world suffering from
One degenerative disease that causes high mortality hypertension and that number will continue to increase4
rates is hypertension1,2.
Di Amerika terjadi lebih dari 65 juta orang usia
dewasa keatas mengalami hipertensi dan berpotensi
Correspondence Author: terjadin infark miokard, stroke hingga gagal jantung5,6.
Joni Haryanto In Indonesia, this case increases continuesly every year
Community and Mental Health Department, and becomes the main cause of outpatient clinics in the
Faculty of Nursing, Airlangga University 45-64 age group and over 65 years of age7,8. In East Java,
Jl. Mulyorejo, Surabaya City, Jawa Timur 60115 the number of elderly people with hypertension in 2011
Email: joniharyanto375@yahoo.com was 174,041 people9. Preliminary study in Griya Werdha
UPTD in Surabaya, East Java, Indonesia. Elderly people with lavender essential oil. The dependent variable was
usually feel dizzy and after their blood pressure is blood pressure in the elderly with hypertension after
checked or their blood pressure increases. and before the massage. The research instrument used
was the SOP (Standard Operating Procedure) that was
Hypertension that mostly found in the elderly determined and the observational sheet containing the
is isolated systolic hypertension. The high rate of respondent’s data as well as the results of blood pressure
systolic pressure can cause the possibility of fatal or that had been measured with sphygmomanometer and
mild strokes10,11. In addition to strokes, isolated systolic stethoscope.
hypertension can also cause the arteries to become rigid,
this is what will cause morbidity and mortality in the The Process of Collecting Data and Statistical
elderly12,13. Analysis: The ethical clearance of this study was with
ethics certificate number 232/EC/KEPK/FKUA/2016
Massaging with lavender essential oil therapy as along with the location permits for the research from
one of the non-pharmacologic therapies that not giving various related parties. The respondent was asked to
side effects. A number of studies have shown that regular lay in a comfortable position on the bed and given a
massage therapy can reduce systolic and diastolic blood lower extremity massage with lavender essential oil by
pressure, reduce stress and cortisol levels, reduce anxiety a physiotherapist as an intervention provider. The author
so that blood pressure will decrease and body functions as observers of the interventions that were carried out
improve14. Intervention using massage to the patients 7 times a week, every day for each the respondent and
can overcome various symptoms of hypertension such duration of each intervention was 10 minutes. The data
as anxiety, depression, headache, neck pain, vertigo and were analyzed using the Shapiro Wilk normality test.
provide calm and relaxed conditions15. So that this study
was conducted which aims to determine the effectiveness
Results
of the massage therapy with lavender essential oil in the
lower extremities on elderly people with hypertension. The number of respondents in this study was 13
people representing the total population of elderly who
Method had hypertension. The characteristics of respondents
were presented in full in the table below:
This study was a pre-experimental study desing,
consisting pre-test and post-test. This study was
conducted to determine the effect of lower extremity Table 1: Characteristics of elderly participants with
massage with lavender essential oil on the reduction of hypertension (n = 13)
blood pressure in elderly people with hypertension at Sample Characteristics Elderly, N (%)
Griya Werda UPT Social Services in Surabaya City. This Age
study only used one group sample, without any control 45 – 59 years 0 (0)
group. This study was conducted by giving the initial
60 – 74 years 6 (46)
test (pre-test) and giving as many as seven treatments,
– 90 years 6 (46)
then the final test (post-test) will be carried out16.
> 90 years 1 (8)
Population, Sample, Sampling: The general population Gender
in this study were all elderly who had hypertension in the Female 7 (54)
whole world. Then the target population of the study was Male 6 (46)
all elderly in Griya Werdha who had hypertension with Smoking History
a population that consisting 17 people16. From the entire
Never smoke 10 (76.9)
population, the participant will be selected according
Ever Been, but already stopped
to the inclusion and exclusion criteria that had been 1 (7.69)
0-5 years
determined, and as a result, 13 participants were obtained.
Ever Been, but already
2 (15.41)
Variables and Instruments: The independent variable in stopped> 5 years
this study was the treatment of lower extremity massage Still smoking 0 (0)
Conted Table 1… Conted Table 1…
Anti Hypertension Drug Type of exercise

Gymnastics 12 (92.3)
1 type 13 (100)
Walk on foot 1 (7.7)
2 type 0 (0) Don’t exercise 0 (0)
Liked salty food
From the table above, the highest age of the elderly
Yes 6 (46) wass in between 60 to 74 years old and between 65 and
Not 7 (54) 90 years old. Most of the respondents were female who
consumed at least one type of hypertension drug.
1. The respondent’s blood pressure before intervention (massage) was given
Table 2: Blood pressure of respondents before intervention was given
Variable Median SD Min-Max 95%CI

Systolic pressure, before intervention 160.00 11.658 140 – 180 150.65-164.74
Diastolic pressure, before intervention 80.00 11.26601 70 - 100 77.8074 -91.4324
Blood pressure examination before being intervention was conducted. The respondents had a minimum value
for a systolic pressure of 140 mmHg and for diastolic pressure had a minimum value of 70 mmHg. The results
of the interval estimation of the study concluded that 95% were considered to be an average of diastolic blood
pressure of the respondents 150.65 - 164.74 mmHg and diastolic pressure 77.8075 - 91.4234 mmHg.
2. The respondent’s blood pressure after the intervention was given
Table 3: The respondent’s blood pressure after the intervention
Variable Median SD Min-Max 95%CI

Systolic before massage 130.00 15.484 140 – 180 150.65-164.74
Dyastolic before massage 80.00 11.26601 70 - 100 77.8074 – 91.4324
Based on table 3, it is known that after being given intervention, the respondent’s blood pressure, that is
systolic pressure had a value of at least 110 mmHg and for diastolic pressure had a value of at least 60 mmHg.
Systolic pressure after the intervention was given, it had a maximum value of 160 mmHg and for diastolic
pressure, it had a maximum value of 90 mmHg. The results of the interval estimation study concluded that
95% considered that the average blood pressure in respondents for diastolic pressure was 123.72 - 142.43
mmHg and for diastolic pressure was 69.8456 - 82.462 mmHg.
3. Differences in blood pressure before and after the lower extremity massage with lavender essential oils
were given
Table 4: Differences in blood pressure before and after the lower extremity massage with lavender essential
oils were given
Variable Mean value before the intervention Mean value after the intervention Difference P value
Systolic 157.69 133.08 24.61 0.000
Diastolic 86.6154 76.1538 8.4616 0.01
Based on the Shapiro Wilk normality test, the significant value of systolic and diastolic blood pressure before
and after treatment ≥ 0.05 so that it can be concluded that the data are normally distributed, then the data
is analyzed using paired t-test with a confidence level of 95% (α = 0.05). Fron the results of analysis data
showed that there was an influence of lower diastolic blood pressure. This study is in line with the
extremity massage with lavender essential oil on previous one that the aroma massage combination of
decreasing blood pressure in elderly people with lavender, marjoram, ylang-ylang and neroli and mixed
hypertension. with almond oil and jojoba oil can reduce blood pressure
in women aged 49 to 50 years17nonsynchronized design
Discussion to investigate the effect on home blood pressure (BP.
The classification of blood pressure chosen is in the Massage is one of the healing arts in China that
range of grade 1 with systolic blood pressure starting can suppress symptoms of hypertension, depression,
from 140 mmHg and up to 200 mmHg. Blood pressure headaches, and vertigo. This therapy is very effective
in the respondent, the highest systolic pressure was 180 as a non-pharmacological treatment for essential
hypertension (EH)15. Pain is also quite effective to
mmHg and the highest diastolic was 100 mmHg. The
overcome with massage therapy.
lowest systolic blood pressure is 140 mmHg and the
lowest diastolic is 70 mmHg. The use of massage therapy has been used for a
long time to provide comfort in all conditions14. High
Prevalence of blood pressure increased by 24.6%
blood pressure due to anxiety and stress, depression and
in women over 30 years old and increased every
catecholamines23. Massage therapy works effectively by
year17nonsynchronized design to investigate the effect overcoming anxiety so that blood pressure decreases,
on home blood pressure (BP. Women usually have higher besides that massage therapy can also overcome
blood pressure after menopause 18. At the pre-menopause depression during childbirth, pain due to multiple
stage, women begin to lose estrogen gradually which sclerosis, arthritis, fibromyalgia, asthma, some immune
has been protecting blood vessels from damage19,20. disorders such as breast cancer, and aging problems such
Menopause is one of the factors in cardiovascular as Parkinson’s and dementia14,24.
disease, because of changes in the distribution of body
fat from a gynoid to android patterns, reduced glucose Some studies also proved that essential oils as
tolerance, abnormal plasma lipids, increased blood effective therapies reduce cortisol concentration and
pressure, increased sympathetic tone, endothelial control blood pressure25,26. So that clients who get
dysfunction and vascular inflammation20. These factors lavender aromas feel comfortable so that the blood
make older women have a greater risk of hypertension. flow in the heart becomes smooth and hypertension
decreases25. Non-pharmacological therapy in the lower
The anti-hypertensive therapy given to respondents extremities massage with lavender oil can be used as an
in this study was the Calcium Channel Blocker option in hypertensive patients.
(amlodipine) group. In this study, the majority of
respondents consumed one type of antihypertensive Conclusion
drug, namely the Calcium Channel Blocker. Amlodipine
works to inhibit the entry of calcium ions through slow The lower extremity massage with lavender essential
canals in the secular muscle tissue and causes relaxation oil gave an effect on decreasing blood pressure in elderly
of deep arterioles. Calcium channel blockers work on all hypertension. This massage therapy can be used as one
degrees of hypertension21,22. of the complementary treatments with lavender essential
oil. So that given this therapy the elderly not only reduce
The elderly’s blood pressure after the intervention blood pressure but also get comfort and relaxation.
was given: The frequency distribution of respondents
showed that the lowest systolic pressure was 110 mmHg Ethical Clearance: The research process involves
and diastolic pressure with a minimum value of 60 participants in the survey using a questionnaire that was
mmHg. The systolic pressure has a maximum value of accordant with the ethical research principle based on
160 mmHg and the diastolic pressure has a maximum the regulation of research ethic committee. The present
value of 100 mmHg. study was carried out in accordance with the research
principles. This study implemented the basic principle
This study showed that the respondents experienced ethics of respect, beneficence, nonmaleficence, and
a decrease in systolic blood pressure and a decrease in justice.
Conflict of Interest: None declared 12. Staessen JA, Gasowski J, Wang JG, Thijs L, Den
Hond E, Boissel J-P, et al. Risks of untreated
and treated isolated systolic hypertension in the
funding.
elderly: meta-analysis of outcome trials. The
Lancet. 2000;355(9207):865–72.
REFERENCE
13. Ferrier KE, Muhlmann MH, Baguet J-P, Cameron
1. Kotchen TA, Hajjar I. Trends in Prevalence,
JD, Jennings GL, Dart AM, et al. Intensive
Awareness, in the United States, 1988-2000.
cholesterol reduction lowers blood pressure
Jama. 2010;290(2):199–206.
and large artery stiffness in isolated systolic
2. Group HS. Prevalence, awareness, treatment hypertension. Journal of the American College of
and control of hypertension among the elderly Cardiology [Internet]. 2002 Mar 20;39(6):1020
in Bangladesh and India: a multicentre study.
LP – 1025. Available from: http://www.onlinejacc.
Bulletin of the World Health Organization
org/content/39/6/1020.abstract
[Internet]. 2001;79(6):490–500. Available from:
https://www.ncbi.nlm.nih.gov/pubmed/11436469 14.
Field T. Massage therapy research review.
3. Smeltzer S, Bare B. Textbook of medical surgical Complementary Therapies in Clinical Practice
nursing 8th edition. Jakarta: EGC (Buku ajar [Internet]. 2016;24:19–31. Available from: http://
keperawatan medikal-bedah brunner & suddarth www.sciencedirect.com/science/article/pii/
edisi 8 volume 2). 2001; S1744388116300214
4. Organization WH, Group IS of HW. 2003 World 15. Xiong XJ, Li SJ, Zhang YQ. Massage therapy
Health Organization (WHO)/International Society for essential hypertension: a systematic review.
of Hypertension (ISH) statement on management Journal of human hypertension. 2015;29(3):143.
of hypertension. Journal of hypertension.
2003;21(11):1983–92. 16.
Nursalam. Metodologi Penelitian Ilmu
Keperawatan : Pendekatan Praktis Edisi 3.
5. Fields LE, Burt VL, Cutler JA, Hughes J, Roccella
Jakarta: Salemba Medika; 2013.
EJ, Sorlie P. The burden of adult hypertension
in the United States 1999 to 2000: a rising tide. 17. Ju M-S, Lee S, Bae I, Hur M-H, Seong K, Lee
Hypertension. 2004;44(4):398–404. MS. Effects of Aroma Massage on Home Blood
6. Ong KL, Cheung BMY, Man YB, Lau CP, Lam Pressure, Ambulatory Blood Pressure, and
KSL. Prevalence, awareness, treatment, and Sleep Quality in Middle-Aged Women with
control of hypertension among United States adults Hypertension. Evidence-Based Complementary
1999–2004. Hypertension. 2007;49(1):69–75. and Alternative Medicine. 2013;2013:1–7.
7.
Kesehatan PD dan kementrian. Gambaran 18. Berman A, Snyder SJ, Kozier B, Erb G, Levett-
Kesehatan Lanjut Usia di Indonesia. 2013. Jones T, Dwyer T, et al. Kozier and Erb’s
8. Balitbang Kemenkes RI. Riset kesehatan dasar; Fundamentals of Nursing. Vol. 1. Pearson
RISKESDAS. Jakarta: Balitbang Kemenkes RI. Australia; 2010.
2013;2013:110–9.
19. Rosenthal T, Oparil S. Hypertension in women.
9. Jatim D. Profil Kesehatan Provinsi Jawa Timur Journal of human hypertension. 2000;14(10):691.
Tahun 2012. Surabaya: Dinkes Jatim. 2012;
20. Rosano GMC, Vitale C, Marazzi G, Volterrani
10. O’rourke MF, Nichols WW. Aortic diameter, aortic
M. Menopause and cardiovascular disease: the
stiffness, and wave reflection increase with age
evidence. Climacteric. 2007;10(sup1):19–24.
and isolated systolic hypertension. Hypertension.
2005;45(4):652–8. 21. Siller-Matula JM, Lang I, Christ G, Jilma B.
11. Wang J-G, Staessen JA, Gong L, Liu L. Chinese Calcium-channel blockers reduce the antiplatelet
trial on isolated systolic hypertension in the elderly. effect of clopidogrel. Journal of the American
Archives of internal medicine. 2000;160(2):211–20. College of Cardiology. 2008;52(19):1557–63.
22. Rothwell PM, Howard SC, Dolan E, O’Brien 25. Shiina Y, Funabashi N, Lee K, Toyoda T, Sekine
E, Dobson JE, Dahlöf B, et al. Effects of β T, Honjo S, et al. Relaxation effects of lavender
blockers and calcium-channel blockers on within- aromatherapy improve coronary flow velocity
individual variability in blood pressure and risk of reserve in healthy men evaluated by transthoracic
stroke. The Lancet Neurology. 2010;9(5):469–80. Doppler echocardiography. International Journal
of Cardiology [Internet]. 2008;129(2):193–7.
23.
Hernandez-Reif M, Field T, Krasnegor J,
Available from: http://www.sciencedirect.com/
Hossain Z, Theakston H, Burman I. High blood
science/article/pii/S0167527307012612
pressure and associated symptoms were reduced
by massage therapy. Journal of bodywork and 26. Kim I-H, Kim C, Seong K, Hur M-H, Lim HM,
movement therapies. 2000;4(1):31–8. Lee MS. Essential oil inhalation on blood pressure
and salivary cortisol levels in prehypertensive
24. Field T, Hernandez-Reif M, Diego M, Schanberg
and hypertensive subjects. Evidence-Based
S, Kuhn C. Cortisol decreases and serotonin
Complementary and Alternative Medicine.
and dopamine increase following massage
2012;2012.
therapy. International Journal of Neuroscience.
2005;115(10):1397–413.
Fine Motor Skill and Cognition Development in Children with

Autism Using Finger Painting Method
Okgi Tiara1, Ah Yusuf1, Rr. Dian Tristiana1

1
Faculty of Nursing Universitas Airlangga, Jl. Dr. Ir. H. Soekarno, Mulyorejo, 60115 Surabaya, East Java,
Indonesia
Abstract
Introduction: Fine motor and cognitive delays are the things that occur in children with autism. The fine
motor activity becomes a component which supports emotional, social and cognitive development. Good
motor skill development will optimally trigger the maturity of cognitive ability.
Aims: This study analyzes the effect of finger painting on fine motor skill and cognitive changes in children
with autism.
Method: This study applies a pre-experimental one-group design. There are six children with autism without
comorbidities selected as respondents by using purposive sampling technique. The sample must be able to
receive orders while still getting ABA and BIT therapies. The independent variable of the study was finger
painting activity while the dependent variable is a fine motor and cognitive status in children with autism.
The observation format from Dr. Rudy Sutadi, SpA, MARS was applied for motor and cognitive skill
assessment. The research media used was paper and paint which were safe for children and the Wilcoxon
sign rank test was used as the result analysis of the study with a significance level p 0.05.
Result: The results of the study indicated that improvement in cognitive skill (p=0.023) and fine motor skill
(p=0.024) in children with autism after treated with finger painting intervention.
Conclusion: Finger painting is potential to be an alternative to develop cognitive and fine motor skills in
children with autism. It stimulates motoric and cognitive aspects in the process of recalling the color mix
which relates to fingers’fine muscles.
Keywords: finger painting, autism, cognitive, fine motor.
Introduction not clearly atypical. Fine motor and cognitive delays

are common in children with autism2. On the other side,
Autistic disorder is often interpreted as a good motor skill is considered necessary in physical,
developmental disorder such as social communication, social, and psychologic development in children3.
as well as limited interest and repetitive behaviour1versus Physical activity has a positive impact on the process of
behaviors that are on the borderline of being atypical or cognitive and motor development in children4-5.
rarely occur/occur in only one context. For example,
while toe walking may be an example of criterion B1, Fine motor skill and cognitive developments are
it may not be sufficient by itself to assign the criterion if the results of the nervous system and brain development
there is a physical explanation for the behavior (and thus relation, also adapting experience of the environment6.
Less optimal function of brain nerve is a factor that
affects fine motor and cognitive perspective as well as
physical damage detected7. One indicator that children
Corresponding Author: can move their smooth muscle and have the ability in
Dr. Ah Yusuf, S.Kp., M.Kes. developing their logic is using finger painting6,8.
Faculty of Nursing Universitas Airlangga, 60115
Surabaya, East Java, Indonesia Finger painting is a direct painting technique using
Email: yahmad311@yahoo.com fingers and palms9,10. This activity is expected to develop
children with autism skill to recognize color, classify, secondary colors, designate the colors they want to use,
follow the direction, also draw a pattern using fingers. distinguish simple patterns, and recall the techniques
Finger painting assessment is not about the creative taught in the intervention. In addition, fine motor
aspect but the ability to coordinate their finger movement assessment consisted of the ability to mix and stir paint
and motor muscle8,11. mixture, imitate patterns, apply creations on paper, and
capable of mimicking 1-10 finger painting techniques.
Early intervention with appropriate management is
required to get the optimal development of children with Data Collection Mechanism: After filling out the
autism12. The application of finger painting training is all informed consent sheet, the respondents worked on the
about drawing. It is also a global motor movement where pre-test before treated with the intervention. The study
it involves the entire body movement and exercises was conducted nine times within two meetings in one
cognitive function10. Finger painting is considered as week. Each respondent was observed for ± 10 minutes
a method to increase focus and attention in children13. in one meeting. The first lesson was to introduce primary
Finger painting is also capable of improving the skill colors and to teach the basic techniques of 1 spiral finger
of social interaction process in children with autism14. and point as well as one straight finger technic. Next, the
The previous study indicates that finger painting has a respondents were asked to dip their fingers into the paint
good impact on fine motor development of pre-school that had been provided to color the paper.
children15. Therefore, this study aimed to determine the
At the second meeting, the respondents were taught
impact of finger painting intervention on fine motor and
the basic techniques of 1 finger swivel, two-finger
cognitive changes in children with autism.
swivel, and three-finger swivel. On the third meeting, the
respondents were taught one-finger diagonal painting,
Method two-finger diagonal painting, the one-finger curve at the
fourth meeting.
Research Sampling: This study applied a pre-
experimental design (one-group pre-post test design) The respondents began to mix, stir, and recognize
by adjusting Constructivism theory held in Yayasan primary colors into secondary colors (orange, green,
Anak Autis in Surabaya, Indonesia on May 12 to June purple) in the fifth meeting. They were guided to imitate
25, 2015, with a population of 18 people. The samples
patterns previously made by the researchers at the fifth
were selected using a purposive sampling method.
and sixth meeting.
This technique determines the sample among the age
population by specific criteria. Children with autism with The respondents were guided to apply their
light to moderate spectrum were chosen as the research creativity to the drawing paper provided at the seventh
respondents. Children with autism who had mental meeting. The paper was not required to be full of color.
retardation, ADHD (Attention Deficit Hyperactivity Furthermore, at the eighth and ninth meeting, they were
Disorder) and other comorbidity were discarded from capable of freely coloring the paper using three primary
the sample selection. Children with autism involved colors and it must be colorful by applying three basic
must be capable of receiving the order and sufficiently
techniques which had been taught. The post-tests were
independent while still given ABA (Applied Behaviour
performed after the intervention was given in full.
Analysis) dan BIT (Biomedical Intervention Therapy)
therapies for a year or more. The result of the sampling Data Analysis: Fine motor and cognitive skills
found six children who fit in the criteria as research assessments in the respondents were categorized as
respondents. A (achieved) if they could do the given instructions;
P (prompt) if they performed the instructions with
Research Variables: Meanwhile, the dependent
assistance; and C if they were unable to do instructions16.
variables were fine motor and cognitive skills. The
The research analysis applied for SPSS Windows program
assessment of the dependent variables was measured
with Wilcoxon sign rank test with the significance or p
using Dr. Rudy Sutadi, SpA, MARS’s observation
level of lower or same as 0.05. This study had passed
format16. The observation format was adjusted to
the ethical test at the Faculty of Nursing Universitas
finger painting intervention. Children cognitive skills
Airlangga number 273-KEPK.
were assessed in their ability to recognize primary and
Result Conted…
Respondents’ Demography: All respondents had taken Housewife - - 4 66.7

ABA therapy (Applied Behavior Analysis) for more than Illness History during Pregnancy
a year. More than half of the respondents (66.67%) were Exist - - 2 66.67
diagnosed with early autism at the age of 2-3 years, and N/A 4 33.33
others (33.33%) were diagnosed at the age of more than The Effect of Finger Painting on Fine Motor and
three years. Most of the respondents (66.67%) were born Cognitive Skills: The observation results indicated a
when the gestational age was mature (see Table I). cognitive skill increase in children with autism by giving
finger painting stimulation. Before the intervention,
Tabel I: Respondent’s Demographic Data
there were no children with decent cognitive skills.
Characteristic Amount % Respondents with less cognitive skills category,
Gender amounting to 66.67%, and the rests were included
Male 4 66.67 to adequate category by 33.33%. The finger painting
Female 2 33.33 intervention was capable of increasing the cognitive
Age at Birth status of the respondents into a good category (100%)
Premature 2 33.33 (see Table III). The statistical test found a significant
Mature 4 66.67 cognitive difference (p = 0.023) in children with autism
Age at First Diagnosis after being treated with the intervention.
2-3 y.o. 4 66.67
>3 y.o. 2 33.33 The improvement also occurred in fine motor skills
Therapy Duration since there were no children with good motor status found
1 y.o. 0 0 at the beginning of the study. Fifty percent of children
>1 y.o. 6 100 were categorized into less category, and the other half
Type of Therapy were categorized into the adequate category. After the
ABA + BIT 0 0 finger painting intervention was given, all respondents
ABA 6 100 were categorized into the good category (100%) (see
Table III). The statistical test utilizing the Wilcoxon
During pregnancy, 66.67% of mothers did not
Signed Rank Test indicated p-value of 0.024, meaning
experience complications in pregnancy. However,
that the finger painting intervention caused significant
33.33% of the mothers had a disease history such as
differences in the fine motor skills of the respondents.
hyperthyroidism and herpes during pregnancy. 50%
of the respondents’ parents had their last education at Table III: The Effect of Finger Painting on Fine
Senior High School level (see Table II). The occupation Motor and Cognitive Skills
of the respondents’ parents, especially mothers, were
Pre Post
housewives (66.67%). Characteristic
Amount % Amount %
Table II: Parent’s Respondent Demographic Data Cognitive
Father Mother Good 4 66.67 0 0
Characteristic Enough 2 33.33 0 0
Amount % Amount %
Last Education Not so good 0 0 6 100
SHS 1 16.7 1 16.7 Negative ranks = 0 Positive ranks = 6 Ties = 0
JHS 3 50 3 50 Wilcoxon Signed Rank Test P = 0.023
University 2 33.3 2 33.3
Fine Motor
Parent’s Occupation
Civil Servant 3 50 0 0 Good 3 50 0 0
Private Enough 3 50 0 0
1 16.66 0 0
Employee Not so good 0 0 6 100
Enterpreneur 1 16.67 2 33.3 Negative ranks = 0 Positive ranks = 6 Ties = 0
Others 1 16.66 - - Wilcoxon Signed Rank Test P = 0.023
Discussion social influences. Parents’ educational backgrounds

are often also associated with development problems.
Stimulation is an essential part of consistently honing Education and socio-economic levels of parents are
children’s skills to produce a memory enhancement17. highly influential in providing stimulation for children.
This study found the effect of finger painting intervention The lack of knowledge in delivering positive stimuli can
on fine motor and cognitive skill improvement in children be one of the causes of problems or obstacles in children
with autism. Learning finger painting can also develop development since stimulation is necessary to improve
emotional expressions of the children18. the cognitive skills of children with autism. Besides, the
The result of cognitive observations of children with role of parents is vital to guide children in practicing
autism after nine times of finger painting intervention cognitive skills in various kinds of stimulation such as
indicated an increase with the final result of ≥80%. visual, verbal, tactile (drawing), and so forth, which will
The respondents were introduced to primary colors help the children develop. However, the parameter of the
(red, yellow and blue). Next, the respondents mixed environment effect on children growth and development
the primary colors to produce secondary colors. The depends on the children’s situation themselves as well as
respondents learned to recognize the colors in this their physical and spiritual conditions.
activity18. Most respondents experienced a significant The pre-test results indicated that all respondents’
increase (p = 0.023) based on the post-test results where fine motor skills (100%) were in the less developed
they were included in the good cognitive skills category category where the children had not been able to color
(66.67%). As previously mentioned all of the respondents paper independently. Fine motor improvement occurred
(100%) were categorized in the less cognitive skill after the finger painting intervention was conducted
category. However, the respondents still required help in where 50% of the respondents developed into the good
recalling the nine finger painting techniques.
category and the other half improved to the moderate
One of the improving parameters was knowledge category. One of the indicators were that the children
about color mixing. In the first lesson, respondents were could rub their hands independently. Motor skills do not
still confused when they were asked about color mixing. develop because of the maturity of the organ but because
The respondents began to be capable of mentioning of the need for the learning process23. Gross and fine
new colors produced after continuous and repeated motor movements are closely related to the development
interventions. This situation can develop cognitive skills of motoric center in the brain. Through proper training,
and pave the way for the respondents to utilize all their gross and smooth movements can be improved in terms
potentials. Such a cognitive development means that of flexibility and precision; thus, a child will become
the children can hone the skills on perception, attention, gradually more skilled6.
memory, thinking, concentration, focus on understanding
The Wilcoxon Signed Rank Test results indicated
symbols, problem-solving, and reasoning19.
that p=0.024 which proved that there were effects
Through finger painting, children can freely move/ of finger painting intervention on the fine motor
rotate their fingertips to make a variety of images development in the respondents. The muscles of the
according to their imagination. This intervention hands, fingers, and eyes of the respondents became
triggered the respondents to have the courage to develop trained. There was coordination of fine motor muscles
imagination both from the situations they can reach when doing finger painting and increasing courage of
or those they cannot20. The respondents’ cognitive the children to find new things, especially new drawing
improvement was significantly supported by ABA media20. When children are free to express themselves,
therapy lasting for more than a year because it was it does not necessarily mean they do not know the rules.
proven to cause persistent cognitive improvement21. Every child is expected to be able to use paper optimally
so that they can practice eye and hand functions to paint
The environmental factors indeed play a significant something proportional.
role in children’s growth and development as the level
of intelligence is determined by the experience and Through learning finger painting, children can
knowledge gained from the environment22. These freely move or rotate their fingertips to make variations
factors can be affected by parents, peer groups, and according to their wishes. Therefore, children can increase
the strength of their fingers. The next phase was how the 4. Zeng N, Ayyub M, Sun H, Wen X, Xiang P, Gao
children mix the colors by using hands to stir the paint. Z. Effects of physical activity on motor skills
The activity trains physical or touching senses, logical and cognitive development in early childhood: a
thinking, as well as a broader focus and attention13. systematic review. Biomed Res. Int.. 2017;2017:
2760716.
This study has limitations. The number of samples
was too little because of the limited number of children 5. Donnelly JE, Hillman CH, Castelli D, Etnier
with autism included in criteria. Also, the lack of active JL, Lee S, Tomporowski Q, et al. Physical
interaction with the respondents’ parents caused less activity, fitness, cognitive function, and academic
maximized information collection of information related achievement in children. Med. Sci. Sport. Exerc..
to the respondents. 2016;28(6):1197-1222.
6. Soetjiningsih. Tumbuh kembang anak. Jakarta:
Conclusion EGC; 1995.
Finger painting interventions can improve fine 7. Delphie B. Multiple intelligences mengenali dan
motor and cognitive status in children with autism. This merangsang potensi kecerdasan anak. Kalimantan
is because finger painting learning is one of the cognitive Tengah: Intan Sejati; 2009.
development stimulations to train memory from mixing
8. Gayatri R. Peranan finger painting terhadap
primary colors and the basic techniques. In addition, fine
kemampuan anak mengenal konsep warna di
motor development is triggered by the involvement of
kelompok BTK Nurul Islam Lambara kecamatan
the muscles of the hands, fingers, and eyes in the process
Tawaeli. Bungamputi. 2013;596-504.
of finger painting.
9. Pamadhi H. PAUD4403 – Seni keterampilan
Acknowledgment anak. Tangerang: Universitas Terbuka; 2014.
10. Wigati YF. Pengaruh seni finger painting terhadap
High gratitude to Dr. Rudy Sutadi, SpA, MARS who
pengetahuan warna. J. Penelit. Psikol.. 2013;4(2).
given permission to the authors to use the observation
format. The authors would also thank the head of Yayasan 11. L. Askandari, Fadillah F, Yusuf H. Peningkatan
Anak Autis in Surabaya and all of the respondent of this kemampuan motorik halus melalui pembelajaran
study. melukis dengan jari pada anak usia 5-6 tahun. J.
Pendidik. dan Pembelajaran. 2014;3(8).
Conflict of Interest: No conflict of interest was
anticipated. This research did not receive any specific 12. Bradshaw B, Steiner AM, Gengoux G, Koegel
grant from funding agencies in the public, commercial, LK. Feasibility and effectiveness of very early
or not-for-profit sectors. intervention for infants at-risk for autism spectrum
disorder: a systematic review. J. Autism Dev.
Reference Disord.. 2015;45(3):778-794.
1. Carpenter L. DSM 5 autism spectrum disorder. 13. Stanko-Kaczmarek M, Kaczmarek LD. Effects
Medical University of South Carolina. 2013. of tactile sensations during finger painting on
mindfulness, emotions, and scope of attention.
2. Rachmani F. Multiple intelligence: mengenali & Creat. Res. J.. 2016;28(3):283-288.
merangsang potensi kecerdasan anak. Jakarta:
Aspirasi Pemuda; 2003. 14. Siregar HM, Yuliyana R, Khatimah K. Effect
of approach play with finger painting on social
3. Hestbaek L, Andersen ST, Skovgaard T, Olesen interaction ability among autism childrens’s. J. Ners
LG, Elmose M, Bleses D, et al. Influence of
dan Kebidanan Indonesia. 2018;5(3):174-181.
motor skills training on children’s development
evaluated in the Motor skills in PreSchool (MiPS) 15. Maghfuroh L, Putri KC. Pengaruh finger painting
study-DK: study protocol for a randomized terhadap perkembangan motorik halus anak usia
controlled trial, nested in a cohort study. Trials. prasekolah di tk sartika i sumurgenuk kecamatan
2017; 18(1):400. babat lamongan. J. Heal. Sci.. 2017;10(1).
16. Mulyadi K, Sutadi R. Autism is curable. Jakarta: kelompok b1 TK ABA Gambrengan. J. Pendidik.
Elex Media Komputindo; 2016. Anak Usia Dini. 2016;1.
17. Nursalam, Susilaningrum R, Utami S. asuhan 21. Lovaas OI. Behavioral treatment and normal
keperawatan bayi dan anak : untuk perawat dan educational and intellectual functioning in young
bidan. Jakarta: Salemba medika; 2005. autistic children. J. Consult. Clin. Psychol.
1987;55(1):3-9.
18. Yetri YH. Meningkatkan kemampuan mengenal
warna melalui permainan finger painting bagi 22. Makharia A, Nagarajan A, Mishra A, Peddisetty
anak tunagrahita ringan. Jurnal Ilmiah Pendidikan S, Chahal D, Singh Y. Effect of environmental
Khusus. 2014;3(1):227-233. factors on intelligence quotient of children. Ind.
Psychiatry J.. 2016;25(2):189–194.
19. Santrock JW. Perkembangan anak jilid.2. Jakarta:
Salemba Medika; 2011. 23.
Hurlock EB. Perkembangan anak. Jakarta:
Erlangga; 1978.
20. Amanda Y. Peningkatan keterampilan motorik
halus melalui kegiatan finger painting pada
The Effectiveness of Afternoon Sunbath in Improving Elderly

Sleep Quality
Zaenal Abidin1, Harmayetty1, Deni Yasmara1

1
Faculty of Nursery, Universitas Airlangga, 60115, Surabaya, Jawa Timur
Abstract
Background: A decrease in sleep quality has been an issue lately which occurs in geriatric patient, including
early elderly group. One way to improve sleep quality in elderly is by afternoon sunbath.
Purpose: To explain the effectiveness of afternoon sunbath in improving sleep quality in elderly.
Method: This was a quasy experimental study with pre and post intervention. The respondents were divided
into two groups (control & intervention). Data was collected using the PSQI (Pittsburgh Sleep Quality Index)
questionnaire and analyzed using the Wilcoxon Sign Rank Test and Mann Whitney test with a significant
level of α ≤ 0.05.
Results: The results showed that afternoon sunbath significantly improve sleep quality in elderly where p
value = 0.000
Conclusion: The afternoon sunbath treatment increases serotonin and endorphin hormones, which improved
the sleep quality in the elderly.
Keywords: Elderly sleep disorders, afternoon sunbath, Pittsburgh Sleep Quality Index
Introduction and mood changes. As many as 54% of elderly who

experience sleep disorders consumed sleeping pills in
Aging is a physiological process that starts from order to overcome their sleep problems(5).
birth. The physiological process cannot be separated from
health, social, cultural and economic dimensions. The Riskesdas 2013 (Indonesian Basic Health Research
proportion of people over the age of 60 has drastically 2013) reported that 57% or 13.7 million elderly was
risen lately, compared to other groups of age, as a result experiencing some type of sleep disorders, including
of longer life expectancies and decreased fertility rates difficulty in starting or maintaining sleep (43%), waking
(1,2)
.The impact of the aging process includes a decrease up at night (30%), insomnia (29%), napping (25%),
in organ system functions and physical changes. difficulty sleeping (19%), waking up too early (19%),
These changes result in variety of problems, including and not feeling refreshed after waking up (13%) with an
disruption of sleep quality (3). Elderly only use 58% of average sleep duration between 4-5 hours per day. This
their time to sleep from the total time spent in bed, with is in line with an epidemiological survey conducted in
an average sleep duration around 4-5 hours at night Japan, reported the insomnia prevalence in elderly was
while the sleep needs for elderly is 5-6 hours per day (4). 21.4%. Insomnia was defined as experiencing at least one
It will affetc their concentration and memory, higher risk episode of difficulty in starting sleep (8.3%), difficulty
of falling, drowsiness during the day, feeling powerless, in maintaining sleep (15.0%), or getting up too early
(8.0%) (6). Sleep disorders were experienced by 50% of
elderly who lived at home and 65% of elderly who were
staying in long-term care facilities. This condition has an
Corresponding Author: impact on decreased concentration, physical weakness,
Harmayetty lack of enthusiasm, and drowsiness during the day(7).
Faculty of Nursery, Universitas Airlangga, 60115,
Surabaya, Jawa Timur Changes in sleep patterns occured in the elderly due
Email: Harmayetty123@gmail.com to changes in circadian rhythms, where the biological
clock becomes shorter and the sleep phase becomes sleep quality, sleep latency (difficulty starting to sleep),
earlier. Circadian rhythm changes are related to the nighttime sleep, sleep efficiency, sleep deprivation, using
degeneration of supra chiasmatic nucleous (SCN) cells drugs to sleep, and disruption of activity during the day.
in the hypothalamus(5). Degenerative changes occur in
both central and peripheral nervous system, slowing Data Collections: Elderly who were prospective
down nerve transmission and decreasing the rate of repondents and willing to be respondents are divided
cortisol and melatonin secretion by 25% which results in into two groups. The intervention group was treated with
disturbance in stages III and IV of sleep (NREM) which an afternoon sunbath for 20 minutes starting from 3.30-
causes frequent wakefulness and reduced REM sleep(8). 3.50 pm on the next day after measuring respondent
sleep quality. Sunbathing was conducted once every 2
Improving sleep quality can be done by doing days in 14 days. There were no intervention given to
exercise or gymnastics, relaxation techniques, stimulus the control group. After 14 days, the sleep quality was
control, sleep hygiene, light therapy, dietary supplements, remeasured using PSQI with the help of 10 sitters who
massage therapy and aromatherapy use(5). Research accompanied the both groups.
in Russian Vladyslav showed bright light therapy can
improve sleep quality in people with depression(9). Data Analysis: The SPMSQ was used to assess the
cognitive aspects of respondents, consist of 10 true or
The intensity of sunlight received by the retina false questions. 0-2 (intact intellectual function), 3-4
depends on the presence or absence of barriers or errors (intellectual functions with minor damage), 5-7
obstacles from both physical and environmental aspects. errors (intellectual functions moderate damage), and 8
Sunlight exposure at around 3.30 pm to 4 pm has 2500 or more errors (severe intellectual function).
lux intensity which can be used as a therapy to improve
The PSQI questionnaire sheet with seven parameters
sleep quality. In addition, the sun has UV rays which
measured the sleep quality. The data scale used was
can stimulate the formation of endorphins. Endorphin
ordinal. If the number of scores 0 means the fulfillment
triggers calmness and relaxation so that easy to induce
of his sleep needs is very good, 1-7 is good, 8-14 is
sleep and make sleep more comfortable(10). Therefore, lacking, 15-21 is very lacking.
this study aimed to see the effectiveness of afternoon sun
in improving sleep quality in elderly, especially those Pre and post intervention in both groups were
who lived in Indonesia since this is a tropical country analyzed using Wilcoxon signed rank test to find out
that receives sunlight most of the year. the difference of sleep quality between the control and
the intervention group that had given a evening sunbath
Method therapy. The degree of significance used in this study
was α ≤ 0.05.
This study used a quasi-experimental research
design (Quasy-experiment). The population of this study Results
was the elderly who lived in Griya Santo Yosef Surabaya,
consisting of 120 men and women, but only 33 elderly The characteristics of respondents including gender,
met the criteria for this study. The independent variable age group based on the Ministry of Health classification,
in this study was an evening sunbath and the dependent length of stay in the nursing home, habits before going
variable was sleep quality in elderly. This research was to bed, length of nap, and daytime activities. Most of
conducted from January 13th to 27th 2016. the respondents are female (54.5%), dominated by those
in 66-70 group of age (39.4%), with the most frequent
Research Instrument: The research instrument used length of stay in the nursing home around 7-13 months
were a PSQI (Pittsburgh Sleep Quality Index) and (51.5%). The activities done before going to bed and
SPMSQ (Short Portable Mental Status Questionnaire) during the daytime were mostly watching TV (57.6%
sheets to measure the independent and dependent variable and 42.4%, respectively). All of the respondents had
which includes seven components, namely subjective length of napping time 60-90 minutes per day.
Table 1: Specific data on the characteristics of respondents between each group
Intervention Group Control Group

Characteristics Indicator Pre Post Pre Post
f(x) % f(x) % f(x) % f(x) %
< 4 hours 0 0 0 0 2 13 2 13
Length of night time
sleep 4-6 hours 17 100 15 88 14 87 12 74
>6 hours 0 0 2 12 0 0 2 13
<3 times 5 29 5 29 8 50 8 50
Frequency if waking
3-4 times 9 53 9 53 7 43 7 43
up at night
>4 times 3 18 3 18 1 7 1 7
Feeling refreshed after Yes 0 0 15 88 0 0 1 7
waking up No 17 100 2 12 16 100 15 93
Table 1 showed the distribution of respondents in pre and post interventions in each groups. The length of
night time sleep duration were increased in the intervention group and there were 2 respondents on each group who
experienced sleep more than 6 hours. The frequency of waking up at night in the both groups did not change. In the
intervention group there were still 2 respondents who were not feeling refreshed after waking up while there were 15
respondents the control group who still had the same experience.
There is the change in sleep quality score. After the intervention, most of respondents’ sleep quality scores were
4, which had sleep quality score improvement compared to their pre intervention score. Meanwhile, there were
statistically constant sleep quality score in the control group, based on pre and post intervention questionnaire. In the
intervention group, the sleep quality of most respondents had been improved and categorized into good sleep quality
criteria. In the control group, there were 2 respondents experienced a decrease in PSQI scores and 2 respondents
experienced an increase in PSQI scores.
Table 2: Respondents’ sleep quality categories before and after intervention
Intervention Group Control Group

Score PSQI of
Pre-Intervention Post-Intervention Pre-Intervention Post-Intervention
sleep quality
f(x) % f(x) % f(x) % f(x) %
1 Very good 0 0 0 0 0 0 0 0
2 Good 0 0 17 100% 0 0 0 0
3 Poor 16 94% 0 0 13 81% 13 81%
4 Very poor 1 6% 0 0 3 19% 3 19%
TOTAL 17 100 17 100 16 100 16 100
p = 0,000, Wilcoxon Signed Rank Test, p ≤ 0, 05 p = 0,317, Wilcoxon Signed Rank Test, p ≤ 0, 05
p = 0,000, Mann Whitney Test, p ≤ 0, 05
Based on Table 2, 17 respondents in intervention group showed drastic changes in sleep quality from poor to
good quality of sleep. Statistical analysis using the Wilcoxon Sign Rank Test found an increase in sleep quality in
the intervention group after sunbathing with p value = 0.000, which means afternoon sunbath effectively improve the
sleep quality in elderly.
Mann Whitney statistical test showed p=0.000, which means that there are very significant differences between
the intervention group and the control group. It can be concluded that afternoon sunbath is effective in improving
sleep quality in elderly.
Discussion their sleep until 5 a.m. and the habit of going to the toilet
during night time were reduced. In addition, 5 out of
This study showed that afternoon sunbath can 17 respondents in the intervention group were able to
improved sleep quality in the elderly. In addition to light, maintain sleep duration for more than 6 hours.
the afternoon sunray also produced UV rays that able
to stimulate endorphins and serotonin formation, which There are many factors that influence sleep quality.
take part in sleep quality improvement. For example, respondents 3I and 4I stated that they
were not feel refreshed when they woke up even after
The sleep quality before giving afternoon sunbath the intervention. They stated that the nursing home
treatment environment were not as comfortable as their previous
All respondents were experiencing sleep disorders home. This condition frustate them and resulting in not
with a poor to very poor sleep quality. Most respondents feeling refreshed after they woke up in the morning.
described the disorders as lack of sleep quality, difficulty However, their sleep quality were improved from poor
in starting and maintaining sleep, recurrent urge in to good sleep quality, based on PSQI score before and
urinating during the night, daytime drowsiness, and not after intervention. The situation above oftenly occured
feel refreshed after waking up. during the adaptation stage of environmental changes.
Another factor influencing sleep quality was the daily
Decreased capacity of the bladder (urinary vesica) schedule of each individuals. For example, the earlier
and weakened bladder muscles causes many elderly bath turn they got, the earlier they had to wake up, even
experiencing recurrent wake up at night due to the though they stay up late the night before.
frequent urgency to urinate(11). 29 out of 33 respondents
were having poor sleep quality in the beginning of the The PSQI questionnaire components that did not
study, where 17 of them were female. During the day, change too much before and after the afternoon sunbath
almost all elderly in this study spent more time indoor, intervention were components 6 and 7, namely the use
and were taking a nap with 30-90 minutes duration. A of drugs and the disruption of daytime activities.
person’s daily routine affects sleep patterns (11). Comparative analysis in sleep quality before and
According to data, 17 respondents who had lived after giving afternoon sunbath treatment
for 7-13 months stated that their sleep quality was poor, After the afternoon sunbath treatment respondents
while respondents who had lived for more than 13 months felt the positive effects of intervention gradually in
had better sleep quality. The risk of sleep disorders often term of sleep patterns and quality. The difficulty to start
increased in patient during the first night of treatment, in sleeping more than 30 minutes decreased to be faster or
both hospital and long-term care places such as nursing can immediately start sleeping after being treated, with
homes(11). The difficulty of sleep in elderly is closely the length of sleep increased to 5 to 6 hours and even
related to the ability to adapt to their new environment. can reach 7 hours, sleep efficiency got better, night sleep
The sleep quality after being given afternoon disturbances subsided, no medicines used to treat their
sunbath treatment sleep problems and being able to do daytime activities
better.
The elderly sleep quality were positive after being
treated with afternoon sunbath for 14 days. In the The main concept was that sunlight is naturally
beginning, the respondents in intervention group were easy to obtain. Light stimulation has an effect in
having poor and a very poor sleep quality. By the end increasing serotonin and endorphins production(12).
of the study, all respondents in the intervention group Light that comes naturally from the sun will be received
experienced a good sleep quality after being treated with by the skin and retina. Light stimulation that enter
afternoon sunbath. through the retina can produce serotonin, GABA, and
norepinephrine(13). The high amount of serotonin during
The improvement in sleep quality happened in both the day will be converted into melatonin at night to
qualitative and quantitative ways, showed by longer induce sleep. Exposure of the afternoon sun played role
duration of sleep, less difficulty in starting sleep and in intrinsic photosensitive retinal ganglion cells (ipRGC)
not waking up too early. Most of them able to maintain which are carried forward to a system of SCN oscillation
in the hypothalamus through a special nerve, the Conflict of Interest: The author reports no conflict of
Retinohypothalamic Tract (RHT). The smooth delivery interest of this work.
through RHT will release a neurotransmitter in the form
of glutamate and Pituitary Adenylate Cyclase Activating Source of Funding: This study is completed with
Polypeptide (PACAP). The release of glutamate and individual funding.
PACAP stimulates the receptors and is expressed in
SCN which then releases humoral factors that cause References
cell modulation in the pineal gland. The combination
1. Akkuş Y, Kapucu S. Yaşlı Bireylerde uyku sorunları
of inhibitors and stimulators in the SCN will produce
[Elderly Individuals with sleep problems]. İç Hast
output in the form of multisynaptic control in serotonin
Derg [Journal Intern Med. 2008;15(3):131–5.
synthesis. When darkness comes, the pineal begins to
convert serotonin to melatonin(14). Theoretically, this 2. GÖKTAŞ K, ÖZKAN İ. Sleep disorders in the
hormone play an important role in the body including elderly. Turkish J Geriatr. 2006;9(4).
acting as a regulator of the metabolic processes occur in
3. Kozier B, Erb G, Berman A, Snyder SJ. Buku
the body, suppressing brain wave activity and preparing
Ajar Fundamental Keperawatan (Vol. VII).
for sleep, reducing the possibility of blood clots forming
E Wahyuningsih, D Yulianti, Y Yuningsih, A
which in turn protects us from strokes and heart attacks,
Lusyana, Trans) Jakarta EGC. 2011;
as antibodies and antioxidants(15).
4. Joshi S. Nonpharmacologic therapy for insomnia in
UVC lights that reach the stratum corneum will the elderly. Clin Geriatr Med. 2008;24(1):107–19.
increase the synthesis of POMC propeptide which
then processed to produce beta-endorphins and other 5. Redeker NS, McEnany GP. Sleep disorders and
biologically active peptides. The increase in continuous sleep promotion in nursing practice. Springer
beta-endorphin in plasma is able to increase signals Publishing Company; 2011.
on opioid receptors on the periphery and or the central 6. Suzuki K, Miyamoto M, Hirata K. Sleep disorders
nervous system to produce endogenous dependent in the elderly: Diagnosis and management. J
opioids. Opioid receptor signals can alter midbrain Gen Fam Med [Internet]. 2017 [cited 2019 Apr
nerve activity to produce high dopamine. Increased beta- 29];18(2):61–71. Available from: http://www.
endorphins can provide a sense of calm and relaxation, ncbi.nlm.nih.gov/pubmed/29263993
making it easier for someone to fall asleep(16).
7.
Kementerian Kesehatan Republik Indonesia,
RI KK. Riset Kesehatan Dasar (RISKESDAS).
Conclusion Jakarta: Badan Penelitian dan Pengembangan
Kesehatan, Departemen Kesehatan. Republik
In conclusion, there is a significant effect on
Indonesia. 2013.
afternoon sunbath in improving elderly sleep quality.
This can be used as a modification in nursing intervention 8. Stanley M, Beare PG. Buku ajar keperawatan
to treat sleep disorders in elderly. Afternoon sunbath gerontik. Jakarta Egc. 2006;
stimulates the formation of serotonin and endorphins
9. Gammack JK. Light therapy for insomnia in older
which triggered calmness and relaxation, thus improving
adults. Clin Geriatr Med. 2008;24(1):139–49.
sleep quality (sleep latency).
10. Kaur J, Sharma C. Exercise in sleep disorders.
Ethical Clearance: The current study was carried Delhi Psychiatry J. 2011;14(1):133–7.
out in correspondence with the research principles. It
11. Potter PA, Perry AG. Buku ajar fundamental
is implemented the basic principle ethics of respect,
keperawatan: konsep, proses, dan praktik. Jakarta
beneficence, non-maleficence, and justice. The research
Egc. 2005;1.
process entangles participants in the survey using a
compatible questionnaire that was in accordance with 12. Young SN. How to increase serotonin in the
the ethical research principle based on the research human brain without drugs. J psychiatry Neurosci
ethics committee’s regulation. JPN. 2007;32(6):394.
13. Barrett KE, Barman SM, Boitano S, Brooks 15. Bock SJ, Boyette M. Stay Young the Melatonin
H. Ganong’s Review of Medical Physiology Way: The Natural Plan for Better Sex, Better
[Internet]. 23rd ed. Mc-Graw Hill; 2010 [cited Sleep, Better Health, and Longer Life. Plume;
2019 Feb 12]. Available from: http://moscmm. 1995.
org/pdf/ganong-pdf.pdf
16. Tejeda HA, Bonci A. Shedding “UV” light
14. Wiyono J, Subekti I, Hariyanto T. PERBEDAAN on endogenous opioid dependence. Cell.
KUALITAS TIDUR PADA REMAJA PUTRI 2014;157(7):1500–1.
YANG MENGGUNAKAN LAMPU DAN
TIDAK MENGGUNAKAN LAMPU.
Family Burden and Coping in Family Caregivers of Patients

with Schizophrenia
Winda Kusumawardani1, Ah.Yusuf1, Lailatun Ni’mah1

1
Faculty of Nursing, Universitas Airlangga, 60115, Surabaya, Jawa Timur
Abstract
Background: Schizophrenia is a mental disorder that is still being a stigma and causes a conflict in the
family due to maladaptive behavior. Coping strategies are needed by the family members to dealing burden,
so that they can care patients well.
Purpose: This study aimed to determine the relationship between family burden and coping with the family
ability of caring for patients with schizophrenia.
Method: This study used a cross sectional approach. The population was a family of patients with
schizophrenic in the Wijaya Kusuma room at Menur mental hospital. The number of samples was 21
respondents. The independent variable was family burden and coping. The dependent variable was the family
ability of caring. Data were collected by questionnaires of demographic, family ability, family burden, and
family coping. Data analysis used Spearman Rho correlation test with a significance level of α = 0.05.
Results: The statistical results showed that family burden has a correlation with family ability (r = 0.656),
while family coping has a very strong correlation with family ability (r = 0.868) with family integrity better
than psychological status and communication.
Conclusion: Family with a low burden did not necessarily have a good ability in caring for patient, but
family with good coping will be able to provide good care for patient. Therefore, nurses are expected to
develop methods to improve family coping in family caregivers of patient with schizophrenia.
Keywords: Schizophrenia, family burden, family coping, family ability of caring
Introduction The arised problems in patients are lossing of ability

to be independent and a negative symptoms which will
Schizophrenia is a mental disorder that have stigma affect work and family financial conditions (3). This can
in society. The stigma in society is that schizophrenia is be a family burden that can be grouped into objective
about craziness or mental illness that needs to be shunned and subjective burdens. Objective burdens are limited
so that causes fear, misunderstanding, and punishment. social relations and work activities, financial difficulties,
Schizophrenia is included in the severe schizophrenia disrupting the physical health of family members. While
group. In the world, schizophrenia affects 21 million the subjective burdens are feeling of loss, sadness,
people and 1 of 2 people with schizophrenia do not get anxiety, shame, stress, family can blame each other and
a treatment (1). hostility between family members. The burden causes
high level of stress in families (4–7).
Effective coping is needed by families with

schizophrenia. The inability of families to create effective
coping exacerbates the needs of schizophrenic patients
Corresponding Author: at home. Treatment failure that causes recurrence in
Ah.Yusuf patients who have just returned from a mental hospital
Faculty of Nursing, Universitas Airlangga, 60115, but various studies cannot explain the relationship
Surabaya, Jawa Timur between family and family difficulties in treating patients
Email: yahmad311@yahoo.com with schizophrenia(7,8)
Schizophrenia which is not handled well will coping questionnaire was measured using a modification
worsen the patient’s condition, cause an impact in the of the 2001 McCubbin coping questionnaire which
community and family, and can be a family burden so developed a self-evaluation instrument in the form of a
that family coping become ineffective. This burden check list: copying health inventory for parents (CHIP)
will be increased when there is no internal support about specific behaviors in dealing with chronic stress
from family members. This burden easily triggers high experienced by families (8). Third questionnaire consists
emotional expression in caregivers (9). of 17 questions about three types of family coping
patterns that are (1) six questions about maintaining
In this case, the family has an important role in family integrity, cooperation, looking at everything with
treating patients with schizophrenic. Therefore, the positive things (2); six question about maintaining social
family needs to have effective coping abilities as a right support, self-esteem and psychological stability (3); and
way to overcome the perceived burden. Effective coping five question about understanding the medical situation,
ability can be achieved if the family has a sufficient communication and consultation with health workers.
The structure of coping health inventory for parents
knowledge and information in accordance with
(CHIP) questionnaire is based on the important behavior
Ajzen’s theory. (10,11). This study aimed to determine the
of the family in responding to stress (14).
relationship between family burden and coping with the
family ability of caring for patients with schizophrenia Data Analysis: This research analyzed using descriptive
and statistical analysis used Spearman Rho correlation
Method test. It is processed and analyzed with Statistical Package
for the Social Science (SPSS) software.(15).
This research was a descriptive correlation study with
a cross sectional approach. This descriptive study aimed Results
to make a general description of a situation objectively.
While the cross sectional approach is one type of study Respondents were patients with schizophrenia for at
that emphasizes the observation time of independent and least 1 and their family caregivers. Data of respondent
dependent variable data simultaneously(12). This research were obtained from the medical record of Menur mental
was conducted at Menur Mental Hospital Surabaya. hospital in Surabaya. Data collection used questionnaires
and structured interview on 21 respondents. Frequency
Sample: Determining representativeness is based on the distribution of respondents of schizophrenia patient
inclusion criteria. The inclusion criteria is a family who families based on demographic data in Wijaya Kusuma
takes care of patients with a diagnosis of mental disorders Hospital, Menur mental hospital in June 2016 shows
of at least 1 year. Selecting diagnosis criteria was based that the respondents who were siblings with patient with
on PPDGJIII include groups F20-F29 (Schizophrenia, schizophrenia are 13 people (62%), 6 people (29%) aged
Schizotipal, and wedge disorders). 20-30 years, 17 people (81%) are from the Javanese.
There was no patient’s family who do not go to school,
Sampling: The sampling technique in this study was the
almost half the number of families worked as employees
nonprobability sampling type of consecutive sampling.
(48%), had income between 500,000-1,000,000 (38%),
The chosen study object is the family of patients with
schizophrenic who met the inclusion criteria. used JKN-KIS (62%), were not discipline in giving drugs
to schizophrenia patients (81%) and were discipline in
Variable: The independent variable in this study was re-checking schizophrenia patients (67%).
the family burden and coping in treating patients with
schizophrenia mental disorders, while the dependent The frequency distribution of schizophrenia patients
variable in this study was the family’s ability of caring based on demographic data in Wijaya Kusuma Room,
patients with schizophrenic mental disorders. Menur mental hospital in June 2016 shows that 14
schizophrenia patients was treated at Menur mental
Research Instrument: Data was obtained by a hospital (67%), 7 people (33%) with educational
demographic questionnaire consists of demographics background of junior high school, 8 people (38%) in the
of patients and families. Second questionnaire was the age ranged of 21-30 years, patients with status single was
family ability questionnaire consisting of five aspects 13 people (38%), 14 people (67%) had experienced mental
and was presented in a closed form. Third questionnaire disorders for 1-10 years, more than half of the patients had
was family burden questionnaire. Finally, the family been referred to the mental hospital for the first time, 13
people (62%) were not doing treatment routinely, 7 people The table below is the result of a test of the
(33%) had experienced rejection and only 4 people (19%) relationship between family burden and family ability of
had families with a history of mental disorders. caring for patient schizophrenia.
Table 1: Relationship between family burden and family ability to care for schizophrenia patients in Wijaya
Kusuma Room, Menur mental hospital in June 2016
Family Ability of Caring

Total
Family Burden Poor Fair Good
Total % Total % Total % Total %
Low 8 38 1 4.8 1 4.8 10 47.6
Medium 0 0 9 42.8 0 0 9 42.8
High 1 4.8 0 0 1 4.8 2 9.6
Total 9 42.8 10 47.6 2 9.6 21 100
Spearman’s Rho p = 0.008
Table 1 shows the results of the Spearman correlation test between family burden and family ability of caring
for patients with schizophrenia which shows a significance value of p = 0.008 or H1 was accepted which means
that there was a relationship between family burden and family ability to treat schizophrenia patients. Correlation
coefficient interval value (r) = 0.561 which means having a moderate relationship.
The table below is the result of a test of the relationship between family coping and family ability to care for
schizophrenic patients.
Table 2: Family coping relationships with the ability of the family to care for schizophrenia patients in
Wijaya Kusuma Room, Menur mental hospital in June 2016
Family Ability of Caring

Family Total
Poor Fair Good
Coping
Total % Total % Total % Total %
Poor 7 33.3 0 0 0 0 7 33.3
Fair 2 9.5 10 47.6 0 0 12 57.1
Good 0 0 0 0 2 9.5 2 9.5
Total 9 42.8 10 47.6 2 9.5 21 100
Spearman’s Rho p = 0.000
Table 2 shows the correlation spearman statistical schizophrenia well and full of affection. However,
test of relationship between family coping with the family with less burden do not always have the ability of
family ability of caring for patient with schizophrenia caring for patient with schizophrenia properly.
which shows a significant value of p = 0.000 or H1 was
The results of descriptive data showed that family
accepted which means that there was a relationship
burden is still relatively low. Subjective burden that most
between family coping and family ability of caring
families feel is feeling stressed, confused, anxious and
for patient with schizophrenic. Interval value of the only 2 of 21 respondents felt embarrassed when taking
correlation coefficient (r) is 0.868, which means having care patients with schizophrenia. The objective burden
a very strong relationship. that most families feel is reduced income, and only 2 of
21 respondents felt a rejection from the community when
Discussion they are taking care patient with schizophrenia patients.
This research showed that family who have Families who have a high burden of taking care
better coping strategies will take care of patient with patient with schizophrenia in this study work as
employees with low income so it is difficult to take Family have a role in maintaining health, namely
medication and visit the doctor regularly. It also makes recognizing family problems, making decisions to
the families often leave the office earlier and result in determining the right actions, caring for sick family
getting reduced income. In contrast to families that have members, modifying a healthy family environment, and
health insurance facilities that are very supportive to
utilizing health service facilities around the environment
caregivers’ finances, which will reduce the burden. Most (19)
. Family efforts in carrying out maintenance duties are
respondents have and use health insurance facilities such
as JKN-KIS and ASKES. certainly influenced by several factors.
Contributing factors to the low family burden are the As already stated above, knowledge has an
length of time the patient suffers from mental disorders, important role in influencing family’s efforts in caring
history of hospitalizing in mental hospital, and history of for schizophrenic patients. Without a supportive
persecution. Data showed that most patients had suffered environment that can help the treatment process, the
mental disorders for 11-20 years. Most of patients had treatment process for schizophrenia will be ineffective
a hospitalized history in mental hospital once and there (20)
. In addition, for the occupation and social economic
was no history of persecution. It caused their family do factors, family members who do not have occupation
not need to waste long time to take care for and manage certainly have more free time to caring for patient than
patient who need continuous care, patients were less occupied family member. Socio-economic factors in this
independent and had many needs that must be fulfilled study include the level of income of the family, family
as family burden get low. with high economic level will be more supportive and
Descriptive data showed that family coping were have a better decision-making in caring for schizophrenia
quite good. The component of family integrity which patients. Family with excessively socio-economic will
consists of perceptions of schizophrenia, daily behavior have an adequate level of family support. Family income
to patients, collaboration with patients, and the ability is one manifestation of the intellectual support that will
to think positively of situation occupy the highest be used in looking for mental health services in treating
proportion in family coping rather than components of family members with a history of schizophrenia (21).
psychological stability and communication skills. The
most common component of family integrity is the As much 38 % of family with low burden had less
ability to provide care and affection to patients and few ability of caring. While 4.8% of family with low burden
respondents are able to provide good medical services had a good ability of caring. The results of this study
to patients. Families with high coping also have a indicated that families with low burden did not always
better integrity rather than psychological stability and have a good caring skills. These results are contradicted
communication skills. to the theory which explains that a low family burden
should have high family ability of caring.
Taking care a patient with schizophrenia can cause
stress for the family. It makes family need coping The cause of low-burden families with low
strategies. Coping is a process for dealing with stressors caring ability is the length of time patients suffer from
by assessing how heavy the burden and the impact that schizophrenia, work activities and family education.
might occur from the stressor experienced (16–18). Family
Eight respondents with low burden but low ability
education background influences whether family’s
because they did not have enough time to treat patients
coping abilities are good or not. This is proven by the
with schizophrenia. In the education factor, some of
higher family education, the higher their knowledge level
them are elementary school. Education that makes
and awareness in caring for patient with schizophrenia.
family awareness low will be low
Descriptive data showed that family ability of caring
for patient with schizophrenia was quite good. The duty The results showed that 7 respondents with a
of caring a patient is one of the five components of poor coping also had poor ability to treat patients with
family duties in care that are best implemented, followed schizophrenia even though caregiver activities were full of
by utilizing the health services, then environmental burdens, caregivers still wanted to care for family members
modification, making decisions for the right actions and because good coping was realized through constructive
the most rarely is the task of recognizing health problems. behavior that was full of wisdom and good values.
Conclusion J Psychol Med [Internet]. 2012;34(1):12–20.

Available from: https://www.ncbi.nlm.nih.gov/
Family burden is not a factor that influences the pubmed/22661801
family ability of caring for patient with schizophrenia
10.
Awad AG, Voruganti LNP. The burden of
due to various factors such as education and family
schizophrenia on caregivers. Pharmacoeconomics.
economic social. However, family with good coping can
2008;26(2):149–62.
provide good caring for patient with schizophrenia.
11. Ajzen I. Attitudes, Personality and Behavior,
Ethical Clearance: The study was approved by ethics Buckingham. Engl Open Press Univ. 1988;
committee of Faculty of Nursing, Universitas Airlangga, 12.
Nursalam S. Metodologi Penelitian Ilmu
Indonesia Keperawatan Pendekatan Praktis. Jakarta Salemba
Conflict of Interest: The author declared no conflict of Med. 2013;
interest. 13. Martínez-Mesa J, González-Chica DA, Duquia
RP, Bonamigo RR, Bastos JL. Sampling: how
Source of Funding: The authors have no source of to select participants in my research study? An
funding to report. Bras Dermatol [Internet]. 2016;91(3):326–30.
References pubmed/27438200
1. WHO | Schizophrenia. WHO [Internet]. 2014 14. Jones J, Passey J. Family Adaptation, Coping
[cited 2019 Feb 26]; Available from: https:// and Resources: Parents Of Children With
www.who.int/mental_health/management/ Developmental Disabilities and Behaviour
schizophrenia/en/ Problems [Internet]. Vol. 11, JOURNAL ON
2. National Institute of Mental Health. NIMH » DEVELOPMENTAL DISABILITIES. [cited
Schizophrenia [Internet]. [cited 2019 May 15]. 2019 Feb 26]. Available from: https://oadd.org/
Available from: https://www.nimh.nih.gov/health/ wp-content/uploads/2016/12/jonespassey.pdf
topics/schizophrenia/index.shtml
15.
Sugiyono. Metode penelitian
pendidikan:(pendekatan kuantitatif, kualitatif dan
3. Koujalgi S, Patil S. Family burden in patient
R & D). Alfabeta; 2008.
with schizophrenia and depressive disorder:
A comparative study. Indian J Psychol Med. 16. Lazarus RS, Folkman S. Stress, appraisal, and
2013;35(3):251. coping. Springer publishing company; 1984.
4. Nevid JS, Rathus SA, Greene B. Abnormal 17. Ogden J. Health Psychology: A Textbook: A
psychology. Prentice Hall; 1991. textbook. McGraw-Hill Education (UK); 2012.
5. Maramis WF, Maramis AA. Catatan ilmu 18. Mutoharoh I. Faktor-faktor yang berhubungan
kedokteran jiwa edisi 2. Surabaya Pus Pnb dan dengan mekanisme koping klien gagal ginjal
Percetakan. 2009; kronik yang menjalani terapi hemodialisis di
rumah sakit umum pusat (RSUP) Fatmawati
6. Lee FK. Mental health nursing. Pearson Education
Tahun 2009. 2010;
India; 2008.
19. Makhfudli EF. Keperawatan kesehatan komunitas:
7. Keliat BA. Proses keperawatan kesehatan jiwa.
Teori dan praktik dalam keperawatan. Jakarta
Cetakan I, EGC, Jakarta. 2006;
Salemba Med. 2009;101–4.
8. Yusuf A, Putra ST, Probowati Y. PENINGKATAN
20.
Fleischhacker WW, Arango C, Arteel P,
COPING KELUARGA DALAM MERAWAT
Barnes TRE, Carpenter W, Duckworth K, et al.
PASIEN GANGGUAN JIWA MELALUI TERAPI
Schizophrenia--time to commit to policy change.
SPIRITUAL DIRECTION, OBEDIENCE, DAN
Schizophr Bull [Internet]. 2014/04/28. 2014
ACCEPTANCE (DOA)(The Improvement of
Apr;40 Suppl 3(Suppl 3):S165–94. Available from:
Family Coping in Taking Care of Patient Mental
https://www.ncbi.nlm.nih.gov/pubmed/24778411
Disorder with Spiritual Therapy; Direction,
Obedience and. J Ners. 2012; 21. Friedman MM, Bowden VR, Jones EG. Family
nursing textbook: Research, theory, and practice
9. Amaresha AC, Venkatasubramanian G. Expressed
of. Interpret Akhir Yani S Hamid, Ed. 2010;5.
emotion in schizophrenia: an overview. Indian
Antibacterial Activities of Extract n-Butanol-Methanol (1:1)

Filtrat of the Fermentation Results of Streptomyces sp. B10
Against Mycobacterium tuberculosis H37Rv: An Experimental
Study
Septa Devi Adetya Putri1, Isnaeni1, M. Faris Adrianto1

Pharmaceutical Chemistry Department, Faculty of Pharmacy, Universitas Airlangga
1
ABSTRACT
Background: Streptomycessp. is one of the sources of first choice antibiotic for tuberculosis treatment.
n-butanol is the best solvent to extract antibacterial compound from fermented Streptomycessp. isolates.
Aim: To analyze anti-tuberculosis activity of extract n-butanol-methanol (1:1) filtrate of the fermentation
results of Streptomyces sp. B10 against Mycobacterium tuberculosis H37Rv.
Method: This was a laboratory experimental study. 3 comparisons of the type of solution were observed
once a week for 3 weeks. Antibacterial activity test was analyzed from morphological observations on
Ziehl-Neelsen staining, then minimum inhibitory concentration and minimum bactericidal concentration
were determined.
Result: Bacterial growth began in the second week starting from a concentration of 10,50 ppm to a
concentration of 1,31 ppm but a concentration of 43.000 ppm to a concentration of 5.375 ppm didn’t show
any bacterial growth. The results of Ziehl-Neelsen staining show a red and rod-shaped Mycobacterium
tuberculosis H37Rv colonies at a concentration of 2.687,5 ppm to a concentration of 1,31 ppm and at a
positive control. A concentration of 2.687,5 ppm was determined as minimum inhibitory concentration and
a concentration of 5.375 ppm was determined as minimum bactericidal concentration.
Conclusion: Extract n-butanol-methanol (1:1) filtrate of the fermentation results of Streptomyces sp. B10 at
a concentration of 2.687,5 ppm to 5.375 ppm has antibacterial activity against Mycobacterium tuberculosis
H37Rv. This extract can be used as an antibiotic formula for tuberculosis.
Keywords: Streptomyces sp, n-butanol, tuberculosis, antibacterial activities
Introduction In 2014, the prevalence of 660 per 100,000 population

with a case incidence of 403 per 100,000 population3.
After first-line anti-tuberculosis drugs were The characteristic of Mycobacterium tuberculosis is the
released, the number of deaths was greatly reduced1. ability to make a persistent infection that requires long-
The characteristic of tuberculosis that rapidly resistant term antibiotic therapy to cure tuberculosis patient4.
to drugs, and the ability of bacteria to survive is a Tuberculosis (TB) has become a curable disease due to
major problem for public health2. In Indonesia, the the antibiotic invention5-6.
total cases that reported in 2016 were 360.565 cases.
One genus of Actinomycetes which contributes most
of its active metabolites to antibiotics is Streptomyces,
this genus occupies the first position on several
Corresponding Author: antibiotics7. Antibiotic as anti-TB were discovered in
Isnaeni 1943,known as Streptomycin8.
Pharmaceutical Chemistry Department,
Faculty of Pharmacy, Universitas Airlangga Various strategies including bioinformatics
Email: isnaenisurabaya@yahoo.com are currently being tested to identify and improve
vaccines against TB9. The researchers are undertaking Institute of Tropical Disease Universitas Airlangga
and discovering new microorganisms which produce in 2017. Bacterial samples were Mycobacterium
secondary metabolites10-11. Domestic production of drug tuberculosis H37Rv and obtained from Tuberculosis
ingredients has not been going well, and still depends laboratory Institute of Tropical Disease Airlangga
on imports ingredients12. Five out of 15 isolates have University Surabaya. Streptomyces sp. B10 isolates
been shown to have antibacterial activity from isolation were obtained from the Microbiology laboratory
using agricultural soil in Indonesia that planted with collection, Pharmaceutical Chemistry Department,
kale, spinach, and corn. One of the isolates known as Faculty of Pharmacy Universitas Airlangga. This study
Streptomyces sp. B10 which identified as Streptomyces was conducted by researchers and expert lecturers
violaceusniger13,14. Water fraction and n-butanol fraction
The solution consists of 3 types: extract n-butanol-
from fermented Streptomyces sp. B10 has antibacterial
methanol (1:1) filtrate of the fermentation results
activities but the minimum inhibitory concentration
of Streptomyces sp. B10, 1,0 ppm rifampicin (RIF)
remains unknown13. Extract filtrate of the fermentation
solution and DMSO solvent, and positive control
results of Streptomyces sp. B10 with n-butanol as
(Middlebrook7H10 medium and Mycobacterium
solvent using KLT method with eluent methanol: water tuberculosis H37Rv). Incubation temperature, pH,
produces one stain14. Extract n-butanol-methanol (1:1) and incubation duration were controlled in this study.
filtrate of the fermentation results of Streptomyces sp. Laboratory testing procedures were carried out by
B10 showing antibacterial activity against Escherichia using Streptomyces sp. B10 culture, fermentate the
coli. n-butanol is a solvent which has been shown Streptomyces sp. B10, freeze dry the culture, extract
able to selectively extract antibiotic compounds from the crude dry powder using n-butanol-methanol (1:1),
Streptomyces isolates with a large zone of inhibition15 evaporate the extraction, extract n-butanol-methanol (1:1)
Methanol is a polar solvent that is mostly used because of filtrate of the fermentation results of Streptomyces sp.
its efficient penetration into the cell wall, so it produces B10, and dilute. Antibacterial activity test was analyzed
more endocellular secondary metabolites16. from morphological observations (shape, elevation,
and color) on Ziehl-Neelsen staining, then minimum
This study aimed to analyze the activity of extract inhibitory concentration was determined. The assessment
n-butanol-methanol (1:1) filtrate of the fermentation was determined by researchers and expert lecturers.
results of Streptomyces sp. B10 against Mycobacterium
tuberculosis H37Rv. Result
Method Extraction using n-butanol-methanol (1:1) produced

brownish yellow colored extract filtrate that has an oil-
This study was an experimental study conducted like consistency and non-distinctive smell. The summary
in the Microbiology Laboratory Faculty of Pharmacy of results from the first week to the third week can be
Universitas Airlangga and Tuberculosis Laboratory seen in table 1.
Table 1: Test results for antibacterial activity
No. Materials Lab. Code Concentration (ppm) Result Per Week Descriptions
1 2 3
1 Extract 1 43.000 - - -
2 21.500 - - - Inhibit the growth of
Mycobacterium tuberculosis
3 10.750 - - - H37Rv (no growth)
4 5.375 - - -
5 2.687,5 - - +
6 1.343,75 - - +
7 671,88 - - +
8 335,94 - - +
Conted…
9 167,97 - - +
10 83,98 - - +
11 41.99 - - +
12 21.00 - - + Not inhibit the growth of
13 10.50 - + +
H37Rv (positive growth)
14 5,25 - + +
15 2,62 - + +
16 1,31 - + +
Inhibit the growth of
2 RIF 1,0 - - - Mycobacterium tuberculosis
H37Rv (positive growth)
3 DMSO - - + Not inhibit the growth of
Control (+) Mycobacterium tuberculosis
4 - + + H37Rv (positive growth)
M. tbH37Rv
Note: (-): no growth (+) :Positive growth
On the first week, Mycobacterium tuberculosis At the third week, the inhibiting ability of extract
H37Rv still has not shown any growth on Middlebrook n-butanol-methanol (1: 1) were decreasing. In a master
7H10 medium and Middlebrook 7H10 medium that solution at a concentration of 43.000 ppm to 5.375 ppm
contain solutions at several concentrations: 43.000 ppm, on Middlebrook 7H10 medium still has not shown the
21.500 ppm, 10.750 ppm, 5.375 ppm, 2.687,5 ppm, bacterial growth, which means at a concentration of
1.343,75 ppm, 671,88 ppm, 335,94 ppm, 167,97 ppm, 43.000 ppm, 21.500 ppm, 10.750 ppm, and 5.375 ppm
83,98 ppm, 41,99 ppm, 21,00 ppm, 10,50 ppm, 5,25 ppm, has the inhibiting ability. Whereas at a concentration
2,62 ppm, 1,31 ppm, likewise positive control (media of 2.687,5 ppm to 1,31 ppm show bacterial growth.
and Mycobacterium tuberculosis H37Rv), Rifampicin Since the first week to the third week, Rifampicin
(RIF) 1,0 ppm solution, and DMSO solvent. The growth solution did not show any bacterial growth, which
of Mycobacterium tuberculosis H37Rv on Middlebrook means Rifampicin as a standard that has the ability to
7H10 medium usually occur at the 1st-2nd week, so that inhibit Mycobacterium tuberculosis H37Rv growth.
observation continue for three weeks. Whilepositive control (Middlebrook 7H10 medium
and Mycobacterium tuberculosis H37Rv) in the second
Observation at the second week shows that in a
week to the third week show bacterial growth increment,
mastersolutionata concentration of 43.000 ppm to 21,00
this shows that Mycobacterium tuberculosis H37Rv can
ppm still has not shown the growth of Mycobacterium
grow on selective Middlebrook 7H10 medium. But it
tuberculosis H37Rv. The solution at a concentration
was not yet known whether the growth appears from
of 10,50 ppm to 1,31 ppm shows slight growth. The
Mycobacterium tuberculosis H37Rv or other bacteria.
bacterial growth at a concentration of 10,50 ppm and
Therefore Ziehl-Neelsen staining was undertaken to
5,25 ppm can be seen as nebulous white dots, while at
determine the bacteria that grow in each concentration.
a concentration of 2,62 ppm the bacterial growth spread
evenly as several small dots and at a concentration of Microscopic observation on Ziehl-Neelsen staining
1,31 ppm show the most amount of growth compared did not show Mycobacterium tuberculosis H37Rv at
to other concentrations. Positive control (media and a concentration of 43.000 ppm; 21.500 ppm; 10.750
Mycobacterium tuberculosis H37Rv) show a lot of ppm; and 5.375 ppm, it was plain blue. Whereas at a
growth with a white colored and slightly rough texture, concentration of 2.687,5 ppm; 1.343,75 ppm; 671,88
in the Rifampicin (RIF) solution and DMSO still has ppm; 335,94 ppm; 167,97 ppm; 83,98 ppm; 41,99 ppm;
not shown the bacterial growth. But it is not yet known 21,00 ppm; 10,50 ppm; 5,25 ppm; 2,62 ppm; and 1,31
whether the growth appears from Mycobacterium ppm show red, straight, slim rod shapedMycobacterium
tuberculosis H37Rv or other bacteria. tuberculosis H37Rv, with blue background.
To determine the bacterial activity in quantitative colony at a concentration of 43.000 ppm; 21.500 ppm;
approaches, the lowest concentration that can inhibit 10.750 ppm and 5.375 ppm, it was plain blue. Whereas
bacterial growth was observed. At a concentration at a concentration of 2.687,5 ppm; 1.343,75 ppm; 671,88
of 10.750 ppm has not shown the bacterial growth, ppm; 335,94 ppm; 167,97 ppm; 83,98 ppm; 41,99 ppm;
which means this concentration has the ability to 21,00 ppm; 10,50 ppm; 5,25 ppm; 2,62 ppm and 1,31
inhibit Mycobacterium tuberculosis H37Rv growth. ppm show red, straight, slim rod-shaped Mycobacterium
At a concentration of 5,375 ppm also hasn’t shown tuberculosis H37Rv, with blue background. So that
any bacterial growth, so this concentration still able to the Minimum Inhibitory Concentration (MIC) from
inhibit Mycobacterium tuberculosis H37Rv growth, extract n-butanol-methanol (1:1) filtrate solution of the
but at a concentration of 2.687,5 ppm bacterial growth fermentation results of Streptomyces sp. B10 against
began to appear. Mycobacterium tuberculosis H37Rv is 2.687,7 ppm.
While the concentration of 5,375 ppm is the highest
Microscopic observation on Ziehl-Neelsen staining concentration that still able to kill the bacteria (MBC).
did not show Mycobacterium tuberculosis H37Rv
Table 2: Observation result of Minimum Inhibitory Concentration (MIC)
No. Materials Lab. Code Concentration (ppm) Result Per Week Description
1 2 3
1 Extract 1 43.000 - - -
2 21.500 - - - Inhibit the growth of
3 10.750 - - - H37Rv (no growth)
4 5.375 - - -
5 2.687,5 - - +
6 1.343,75 - - +
7 671,88 - - +
8 335,94 - - +
9 167,97 - - +
10 83,98 - - + Not inhibit the growth of
11 41.99 - - +
H37Rv (appear growth)
12 21.00 - - +
13 10.50 - + +
14 5,25 - + +
15 2,62 - + +
16 1,31 - + +
Inhibit the growth of
2 RIF 1,0 - - - Mycobacterium tuberculosis
H37Rv (no growth)
3 DMSO - - + Not inhibit the growth of
Control (+) Mycobacterium tuberculosis
4 - + + H37Rv (appear growth)
M.tbH37Rv
Note: (-) : no growth (+) : appear growth
The microscopic observation did not show Mycobacterium tuberculosis H37Rv colony at a concentration of
43.000 ppm; 21.500 ppm; 10.750 ppm and 5.375 ppm, it was plain blue. Whereas at a concentration of 2.687,5 ppm;
1.343,75 ppm; 671,88 ppm; 335,94 ppm; 167,97 ppm; 83,98 ppm; 41,99 ppm; 21,00 ppm; 10,50 ppm; 5,25 ppm; 2,62
ppm and 1,31 ppm show red, straight, slim rod-shaped Mycobacterium tuberculosis H37Rv, with blue background.
Discussion increasing extract n-butanol-methanol (1:1) filtrate

solution of the fermentation results of Streptomyces sp.
Extract n-butanol-methanol (1:1) filtrate solution B10 concentration, because the extract in this study has
of the fermentation results of Streptomyces sp. B10 not become an antibacterial pure compound.
has antibacterial activity against Mycobacterium
tuberculosis H37Rv. n-butanol is the selective solvent There are few things asconsideration for further
that can extract antibiotic compounds from Streptomyces research: further analysis with separation of active
sp. with a large zone of inhibition15. Ethanol extract has compounds from Streptomyces sp. B10 using TLC
potent ability to inhibit bacterial growth, both gram- bioautography method or other separation methods,
positive and gram-negative bacteria17. Methanol is a further identification to find out another pure compound
polar solvent that mostly used because of its efficient as antibacterial that produced by Streptomyces sp. B10,
ability to penetrate into the cell wall, so it produces and limiting concentration range from 5.375 ppm to
more endocellular secondary metabolites16. Several 2.687,5 ppm for antibacterial activity test and MIC
isozymesshows high substrate specificity and various determination.
homogeneity from Streptomyces sp. Cell extract for
several types of alcohol18. Conclusion
Dilution using this extract can support the attack Extract n-butanol-methanol (1:1) filtrate of the
against Mycobacterium tuberculosis (TB). Since fermentation results of Streptomyces sp. B10 has
Mycobacterium tuberculosis has a high acquisition antibacterial activity against Mycobacterium tuberculosis
to drug resistance, new drug discovery to put into H37Rv. This indicates that this extract can be used as an
tuberculosis regimen is required19. Streptomyces alternative antibiotic formula to fight tuberculosis.
potential for expressing foreign proteins indicate that
Streptomyces can be a useful vector in designing new Ethical Clearance: This research has gone through
TB vaccine. Streptomycin is the first antibiotic that ethical tests and permits from Faculty of Pharmacy
attacksMycobacterium tuberculosis by mootherapy, Universitas Airlangga
so it leads to generate resistance. The mechanism of
action of streptomycin is inhibiting mycobacterial Conflict of Interest: The author reports no conflict of
protein synthesis in ribosomes. Resistance arises when interest of this work.
mutations appear on rRNA and protein-encoding genes. Source of Funding: This study is done with individual
ATCC27294 strains are sensitive toward the activity funding
of streptomycin, rifampin, ethambutol, and isoniazid
and ATCC35820 strains are resistant to streptomycin.
REFERENCES
Several mutated genes are evidenced to cause drug
resistance20,21. The clinical trials of streptomycin show a 1. Departemen Kesehatan RI. “Pharmaceutical care”.
good outlook to suppress TB. Although patient improved [Internet]. 2005. Available from: http://binfar.
compared to the patient without therapy (considered as depkes.go.id/dat/lama/1309242859_YANFAR.
the first randomized controlled clinical trial), recurrence PC T%0AB_1.pdf
occurs in many patients and organisms are found to be
2. Manaf Al Matar, Husam Al Mandealb, Işıl Varc,
resistant to streptomycin22.
Begüm Kayard FK. New drugs for the treatment
The concentration ranges from 2,687.5 ppm to 5,375 of Mycobacterium tuberculosis infection. Biomed
ppm effective against Mycobacterium. Antibacterial Pharmacother. 2017;91:546–58.
activity against Mycobacterium tuberculosis H37Rv 3. WHO. Indonesian TB situation Update 2017
occurs at a concentration of 2.687,5 ppm, which is [Internet]. 2018. Available from: http://www.
determined as Minimum Inhibitory Concentration (MIC). searo.who.int/indonesia/topics/tb/en/
Whilst the concentration of 5.375 ppm is determined as
Minimal Bactericidal Concentration (MBC), which is 4. Anastasia S. Kolyva and Petros C. Karakousis.
the lowest concentration that able to kill bacteria. This Old and New TB Drugs: Mechanisms of Action
result shows that antibacterial activity increased as the and Resistance, Understanding Tuberculosis
- New Approaches to Fighting Against Drug Activity Of Streptomyces spp. Isolates From
Resistance, Pere-Joan Cardona. 2012; Vegetable Plantation Soil”. J Biol Res. 2016;2(21).
5. Tasha Smith, Kerstin A. Wolff and LN. Molecular 15. Adlhani, E., Mahsunah, A. H. Y. “Uji Aktivitas
Biology of Drug Resistance in Mycobacterium Senyawa Antibiotika Yang Dihasilkan Oleh
tuberculosis. Curr Top Microbiol Immunol. Aktinomisetes Endofit Streptomyces bacillaris
2013;374:53–80. AY999817 Dari Batang Tanaman Urang Aring”.
J Teknol Ind. 2012;2(1).
6. Sridevi, K., dan Dhevendaran K. “Streptomycetes
From Marine Seaweeds : Their Antimicrobial 16.
Hidayati N. “Isolasi Dan Penetapan Kadar
And Antibiotic Potential”. Int J Appl Biol Pharm Senyawa Antifungal PMethoxybenzylidene
Technol. 2014;5(4):74–9. P-Aminophenol Dari Akar Acacia Mangium [
Isolation And Concentration Determination Of
7. Procópio, R. E., Silva, I. R., Martins, M. K.,
Antifungal Compound P-Methoxybenzylidene
Azevedo, J. L., dan Araújo J, M. “Antibiotics
P-Aminophenol From Acacia Mangium Root ]”.
Produced by Streptomyces.” Brazilian J Infect
J Pemuliaan Tanam Hutan. 2012;6(2):117–30.
Dis. 2012;16(5):466–71.
17. U. S. Mishra, A. Mishra, R. Kumari, P. N. Murthy
8. Yassien, M. A., Abdallah, H. M., El-Halawany,
and BSN. Antibacterial Activity of Ethanol Extract
A. M., dan Fatani AAM, J. “Anti-Tuberculous
of Andrographis paniculata. Indian J Pharm Sci.
Activity of Treponemycin Produced by a
2009;71(4):436–8.
Streptomyces Strain MS-6-6 Isolated from Saudi
Arabia”. Molecules. 2015;p.2576–2590. 18. Nishimura M, Kohno K, Nishimura Y, Inagaki M
DJ. Characterization of two isozymes of coniferyl
9. Arzuaga NO, Vila Granda A, Gómez JC, San
alcohol dehydrogenase from Streptomyces sp.
Miguel ME, Bourzac JF, Hernández YL, Elías
Biosci Biotechnol Biochem. 2011;75(9):1770–7.
López AL, Pólux CR, Mesa LG, Hernández-Pando
R D. The use of Streptomyces for immunization 19. C. Sao Emani, M. J. Williams, I. J. Wiid, B. Baker
against mycobacterial infections. Hum Vaccin. CC. Compounds with Potential Activity against
2011;7(9):934–40. Mycobacterium tuberculosis. Antimicrob Agents
Chemother [Internet]. 2019;62(4). Available from:
10. Sembiring, L., dan Goodfellow M. “Ecological
https://aac.asm.org/highwire/citation/16605/
Approach to Unravel Streptomycete Diversity
download
as an Unsurpassed Sources of Natural Bioactive
Products”. J IPB. 2008;2(2):49–56. 20. Ruiz P, Rodríguez-Cano F, Zerolo FJ CM.
Investigation of the in vitro activity of streptomycin
11.
Primm, T.P. dan Franzblau, S.G. “Recent
against Mycobacterium tuberculosis. Microb
Advances in Methodologies for the Discovery of
Drug Resist. 2002;8(2):147–9.
Antimycobacterial Drugs”. Curr Bioact Compd.
2007;3(3). 21. Jagielski T, Ignatowska H, Bakuła Z, Dziewit
Ł, Napiórkowska A, Augustynowicz-Kopeć E
12.
Kementerian DJK dan AK, Kesehatan RI.
et al. Screening for Streptomycin Resistance-
Upaya Kemandirian Produksi Bahan Baku Obat
Conferring Mutations in Mycobacterium
Indonesia. Bul Infarkes Ed II Jakarta. 2016;
tuberculosis Clinical Isolates from Poland. PLoS
13. Fairuz, D., Isnaeni, Nasution, N. E. S. FMW. One. 2014;9(6).
“Antibacterial Activity Of Buthanol Extract From
22. Gillespie SH. “Evolution of Drug Resistance
Free Cell Fermentation Broth Of Streptomyces
in Mycobacterium tuberculosis: Clinical and
B-10 Against Escherichia coli ATCC 25922.”
Molecular Perspective.” Antimicrob Agents
Universitas Airlangga; 2016.
Chemother. 2019;46(2):267–74.
14.
Isnaeni, Kusumawati, I., Warsito, M. F.,
Darmawati, A., Mertaniasih NM. “Antimicrobial
The Correlation between Goat Maintenance Management to

the Incidence of Gastrointestinal Parasite Infections
Zahrotul Hurriyyah1, Nunuk Dyah Retno Lastuti1, Lianny Nangoi1

1
Faculty of veterinary medicine, Airlangga University, Surabaya 60115
Abstract
Background: Gastrointestinal parasite infection in goats is one of the diseases that lead to a poor productivity
of livestock. This infection might be caused by a poor maintenance management.
Aim: This study was to study the correlation between a goat maintenance management and the severity level
of gastrointestinal parasite infections.
Method: This study used 42 fresh feces as samples which taken randomly from a large population. Sample
examination was done by using simple sedimentation method and modified Fulleborn floating method.
The degree of parasite infection was measured using the calculation of fecal worm egg count (FEC), 0-500
gram of feces considered as mild infection. Data from the maintenance management questionnaire and the
severity of infection in goats were analyzed using the Classification and Regression Tree (CART) test.
Result: Samples examination was conducted in department of parasitology. It resulted 23 samples were
positive with worm eggs from Haemonchus contortus and Strongyloides papillosus species. The prevalence
of Helminthiasis was 54.76% with a mild degree of infection. The type of worm eggs found in the examination
of faecal samples came from the class of Nematodes, namely Haemonchus contortus species (60.87%) and
Strongyloides papillosus (39.13%). Single infection was found in 11 positive samples (47.82%) and 12
positive samples were in mixed infections (52.18%)
Conclusion: Maintenance Management is a major factor in the degree of gastrointestinal parasite infection.
Keywords: the severity level of parasite infection, goat, maintenance management
Introduction feces is not cleaned regularly, it can trigger a severe and

sustained re-infection3.
Parasite infections in goats rarely cause death,
but this disease is chronic and have an impact to adult Maintenance management in goats is influenced
goats in decreasing milk production, meat quality, and by the limited knowledge of farmers about raising
work ability, whereas in young goats can results in goats method is one of the factors causing worm
stunted growth, decreased appetite, anemia, diarrhea, infections, especially the problem of sanitation cages,
and dehydration1. Environmental conditions outside the poor environmental conditions, extreme climate, and
host’s body which greatly influence the occurrence of contaminated feed with worm eggs. Infectious larvae
helminthiasis cases, include the suitable temperature, attach to grasses then infect the goats. Furthermore, the
humidity, and the availability of oxygen2. larvae will mature in the abomasum of goats4. However,
in the effort to develop livestock production, there were
The appropriate environment will promote worm obstacles in the livestock industry, one of which was
eggs to come out through goat feces. The worms will poor livestock management among farmers.
hatch and develop into infective larvae which will
infect new hosts. This means that the more ideal the Some efforts to control parasites that exist in
environmental conditions, the higher opportunities of livestock because if the parasite is left untreated, it will
infection occurrence because the worms will grow well. become very detrimental to farmers. Good maintenance
The environmental sanitation of the host’s residence management of goat swill reduce and eradicate the
is need to be considered. Poor sanitation, especially if occurrence of parasites infections. Therefore, this study
aimed to determine the relationship between the type of was lifted and placed on the glass object to be observed
worm eggs in digestive tract, the degree of severity, and under a microscope with 100x magnification5.
maintenance management in goats.
Calculation of Fecal Egg Count (FEC): In a positive
sample infected with gastrointestinal worms, the
Method
examination was continued with the calculation of Fecal
The study was conducted in Turi Village, Lamongan Egg Count (FEC). Calculations use the Lucient Brumpt
Regency, Indonesia. Sample examination was carried out method5. One gram of faeces is mixed with water and
at the Helmintology Laboratory, Airlangga University, made a suspension with dilution 10 times, then filtered
Surabaya. The sampling period time was from May to and calculated the number of drops in 1 ml of suspension
June 2017. The time of the faecal examination at the using a pasteur pipette. Examination is carried out under
laboratory was in June to July 2017. Feces samples a microscope with 100x magnification. The results of the
were taken randomly, limited to 10% of the total FEC calculation are classified into three levels, namely
population with a total of 42 faecal samples. Feces was the degree of mild infection if FEC ranges from 0-500.
taken in moderation (approximately 10 grams) with a The degree of infection is moderate if FEC ranges from
2.5% potassium bicarbonate solution and taken to the 501 - 1000. And the degree of infection is severe if FEC
laboratory for examination. Sample examination was is more than 10001.
done by simple sedimentation method and modified
Prevalence Calculation: Prevalence calculation of goat
Fulleborn floating method.
digestive tract worms was based on the percentage of
Simple Sedimentation Method: The feces sample was positive samples that found worm eggs, divided by the
put in a plastic cup and then added water with a ratio of 1:10 number of all samples multiplied by 100% (8).
then filtered. The filter results were put into the centrifuge
Statistical Analyze: Data from the maintenance
tube then centrifuged for 2-5 minutes at a speed of 1500
management questionnaire and the severity of goats
rpm. Supernatant from the centrifuge was removed and
were analyzed by statistical tests (Classification and
the water was added again as well as the previous stage
Regression Tree (CART) test).
and then centrifuged for 2-5 minutes at a speed of 1500
rpm. This process was repeated until the supernatant is
clear. After clear, the supernatant was removed and left Results
a little, then the sedimentation was stirred with Pasteur
Laboratory results obtained 23 positive faecal
pipette and taken a little and then dropped over the
samples containing worm eggs. This shows the
glass object and covered with a glass cover after it was
prevalence and degree of gastrointestinal worm infection
examined under a 100x magnification microscope5.
in goats as much as 54.76%. From the results of the
Modified Fulleborn Floating Method: Modified examination found worm eggs from the Nematode class,
Fulleborn Floating Method was done by making feces namely from the species Haemoncus contortus and
suspension then filtered and put into a centrifuge tube to Strongyloides papillosus. Figure 1 shows Strongyloides
be centrifuged for 2-5 minutes at a speed of 1500 rpm. papillosus worm egg measures 55.58 x 25.53 μm. The
The supernatant was discarded, while the sediment was form of Strongyloides sp. eggs are elliptical, thin walled
added to the water again and then the sediment with and larva shaped like the letter S or U.
added water will be centrifuged for 2-5 minutes at the
same speed. The process was repeated to obtain a clear
supernatant. After that the supernatant was discarded and
left a little, then add the brown sugar solution to 1 cm
from the mouth of the tube and do the refining again in
the same way. The centrifuged tube was placed on a tube
rack then slowly dripped with a brown sugar solution
until the surface of the liquid looks convex on the surface
of the tube mouth. The glass cover wss placed on the Figure 1: Egg Strongyloides papillosus.
surface of the tube for 5 minutes, then the glass cover (Magnification are up to 100X).
The results of examination of faecal samples that have infection were found in 12 positive samples or equal
been done, shows the presence of Haemoncus contortus to 52.18% consisting of two worm species from
worm eggs with a size of 80.28x47.93 μm, oval-shaped the Nematode class, Haemonchus contortus and
worm eggs, and when coming out with feces already in the Strongyloides papillosus. While the incidence of a single
morula stage (in eggs containing 16-32 cells). Numerous infection was found in 11 positive samples or equal to
Haemonchus contours eggs are thin-shelled, oval shape 47, 82%.
with equal polish, edges mombate and morula is not fully
filled the eggs cavity6. This following picture in Figure 2 Based on the results, management of goat
is Haemonchus contortus eggs. maintenance showed an influence on the degree of worm
eggs infection in the digestive tract. Wastes disposed of
less than 15 meters from the cage have a mild infection
rate of 50% and a severe infection of 50%, while the
waste disposed at a distance of more than 15 meters
from the cage has a mild infection rate of 66.7% and a
severe degree of infection 0%.
Goats who had never been given worm medicine had

a greater degree of infection than goats who were given
Figure 2: Haemonchus contortus eggs. worm medicine. Goats given worm medicine had a mild
(Magnification are up to 100X). infection rate of 100% while goats who had never been
given worm medicine had a mild degree of infection of
Haemonchus contortus eggs have an oval shape and 57.1%, moderate of 14.0%, and severe of 28.6%. While
there is a clear area inside. Identification of worm eggs goat manure stored in closed sacks has a mild infection
was done by looking at the morphology of the egg shape rate of 50%, medium of 25%, and severe of 10%. Whereas
and size of the worm egg. Measurements of worm eggs the dirt deposited on the ground has a mild infection rate
were carried out using the Optilab Imageraster program. of 75%, medium 25%, and severe of 0%.
The following is the mean value of worm eggs that
infect goats. The results of research conducted on feeding
methods showed that breeders who provided feed from
inside the cage had a higher degree of infection than
Table 1: Mean Value of Worm Eggs that Infected
goats which were released to graze in the rice fields.
Goats and Its Degree of Infection
Breeders who provide feed from inside the cage have
Amount of Degree of a mild degree of infection of 65%, moderate of 25%,
No. FEC
Sample Infection and severe 10%. Whereas the goats released in the
1. 13 0-500 Small paddy fields have a mild degree of infection of 33.3%,
2. 6 501-1000 Medium moderate of 66.7%, and severe of 0%. Beside of that,
3. 3 >1000 Heavy farmers who clean their cages once a week have a mild
and moderate infection rate of 0% and severe of 100%.
From 23 positive samples, 13 samples were in mild Whereas farmers who clean their cages every day have a
degrees of infection with an average number of 0-500 mild degree of infection 60.9%, moderate of 30.4%, and
egg per gram faces (EPG). The degree of moderate severe of 8.7%.
infection with a sample size of six had been obtained
with average number of worm eggs about 501-1000 Discussion
EPG, and the degree of severe infection with a sample
number of three and the average worm eggs was more The results showed that two species of worm eggs
than 1000 EPG. from the Nematode class (Haemonchus contortus and
Strongyloides papillosus). Cattle frequently has mixed
The types of worms that infect goats was parasite infections7. From the results, mixed parasitic
Haemonchus contortus worm eggs (60.87%) and infections was more common than single infections.
Strongyloides papillosus worm egg (39.13%). Mixed Mixed infections were found in 12 positive samples or
equal to 52.18%. Whereas the single infection was found of infection than the goat manure that is piled above
in 11 positive samples or equal to 47.82%. This was the ground. This is because the dirt stored in a closed
caused by the characteristic of parasite infection does sack will cause the condition to become moist, the moist
not cause death to the host, but only causes a decrease condition that makes the growth of worms become
in host’s immune system, allowing secondary infection fast and rapid, making the degree of infection greater.
from other types of parasites. Seasonal dynamics and age Temperature and moisture are dominant influences on
of hosts are significantly influenced by the prevalence the free-living stages of Haemonchus contortus10. The
of gastro-intestinal nematode infection8. Besides, all condition of a humid climate is the best condition for the
these worm parasites spend more their life cycle in life phase of various digestive tract parasites11.
the host body9. The appropriate environment promotes
worm eggs to come out with goat’s feces, then it hatch The feeding behavior of the ruminant species is a
and develop into infective larvae which will infest new major factor in the development of parasitism12. Goats
left to graze themselves are more at risk of being infected
hosts. This means that the more ideal the condition of the
with worms than goats in cages. Animal grazed for short
environment, the more opportunities for the emergence
period (2-3 weeks) Larval reflect availability13. However,
of cases of worm infections.
in this study goats bred more at risk of being infected
The results of the FEC calculation did not show a with worms. The method of feeding in this study shows
significant effect on the incidence of gastrointestinal worm that breeders who provide feed from inside the cage had
infections in goats, so the incidence of gastrointestinal a higher degree of infection than goats that are released
worm infections in goats was classified as a mild degree to graze in the rice fields. This is because feed goats in
of infection with a range of 0-500 EPG. Differences in paddy fields containing fewer worm larvae than the feed
the number of FEC calculations on definitive hosts can given to goats in cages. Breeder clean their cages once
be influenced by several factors, namely, type of worm, a week and this condition may have a greater degree of
age of worms, time of egg production, amount of feces worm infections, especially Haemonchus contortus and
produced by definitive hosts, density or consistency of Strongyloides papillosus worms.
faeces, and spread of eggs in feces2.
Cleanliness of the cage is a major factor in the
Feces waste that discharged nearby the cage with degree of gastrointestinal worm infection where cleaning
a distance of approximately 15 meters sometimes has the cage is done every day, feeding in the cage, feces
a greater degree of infection than feces waste that is was that been stored in closed sacks, not administering
discharged at a distance of more than 15 meters from worm medicine, and removing sewage waste less than
the cage. This is affected because the waste that is thown 15 meters from the cage is an action that lacking in
away closer than the cage will make the chance of worm maintaining the cleanliness of the cage, thus showing the
eggs survive and hatch, so that they can re-contaminate high degree of reduced worm infection. Farmers should
the environment around the cage or feed of the goat. give worm medicine to goats on a regular basis to reduce
In poor sanitation, especially if feces is not cleaned the number of gastrointestinal worm infections in goats.
regularly, can be a source of severe and sustained re-
infection3. Conclusions
The location of waste disposal on the provision of From the results, it can be concluded that maintenance
worm medicine showed that goats who had never been management gave a great influences the degree of parasitic
given worm medicine had a greater degree of infection infection in gastrointestinal tract of goats.
than goats who were given worm medicine. This is
because regular administration of worm medicine to Ethical Clearance: The research process involves
livestock will reduce and cut the life cycle of worms in participants in the survey using a questionnaire that was
the body of livestock. accordant with the ethical research principle based on the
regulation of research ethic committee. The present study
The treatment of parasite medication in feces was carried out in accordance with the research principles.
waste management showed that the management of This study implemented the basic principle ethics of
manure stored in closed sacks has more severe degree respect, beneficence, non-maleficence, and justice.
Conflict of Interest: The author reports no conflict of in Sheep. Vol. 3, Advances in Animal and
interest of this work. Veterinary Sciences. 2015. 99–108 p.
Source of Funding: This study is done with individual 7. Drake D, Atwill E, Phillips R, Johnson E. Internal
funding. parasites prevalent in California’s beef cattle.
Calif Agric. 2001;55(2):28–32.
References 8. Tariq K, Chishti MZ, Bhat FA. Gastro-intestinal
nematode infections in goats relative to season,
1. Soulsby E. Helminth, Arthropods and Protozoa of
host sex and age from the Kashmir valley, India.
Domecticated Animals. 7th ed. Bailliere Tidall.
Vol. 84, Journal of helminthology. 2009. 93–97 p.
London; 1986. 214–243 p.
9. Tromp SW. Biometeorology: Proceedings of the
2. Kusumamihardja S. Parasit dan parasitosis pada
Second International Bioclimatological Congress
hewan ternak dan hewan piaraan di Indonesia.
Held at the Royal Society of Medicine, London,
Bogor Pus Antar Univ Bioteknol Inst Pertan
4–10 Sept. 1960, Organized by The International
Bogor. 1992;432.
Society of Biometeorology. Elsevier; 2013.
3.
Reinecke RK. Veterinary helminthology.
10. O’Connor LJ, Walkden-Brown SW, Kahn LP.
Butterworth & Co.(SA)(Pty.) Ltd.; 1983.
Ecology of the free-living stages of major
4. Whittier WD, Zajac A, Umberger SH. Control of trichostrongylid parasites of sheep. Vet Parasitol.
Internal Parasites in Sheep. VirginiaCooperative 2006;142(1–2):1–15.
Extension. Virginia Tech. Publication Number
11. Beriajaya PS. The Effect of Anthelmintic
410-027. 2003.
Treatment on Weight Gain of Village Sheep in
5. Mumpuni, S., S. Subekti, S. Koesdarto HP dan West Java. In: Preceding the 3rd AAAP Animal
K. Penuntun Praktikum Ilmu Penyakit Helmin Science Congress I. 1985. p. 519–21.
Veteriner. Edisi 2 Ce. Surabaya: Fakultas
12. Smith MC, Sherman DM. Goat medicine. John
Kedokteran Hewan Universitas Airlangga; 2007.
Wiley & Sons; 2009.
6. M S, Gopalakrishnan A, Latchumikanthan A,
13. Barger IA. The role of epidemiological knowledge
Arun Prince Milton A, Aravind M, Dhama K, et
and grazing management for helminth control in
al. Histopathological and Parasitological Study of
small ruminants. Int J Parasitol. 1999;29(1):41–7.
Blood-Sucking Haemonchus contortus Infection
Histopathology of Esophagus and Crop of Pigeon (Columbia

livia) Infected by Trichomonas gallinae
Aprilia Eva Widiawati1, Muchamad Yunus2, Thomas V Widijatno2

1
Department of Veterinary Medicine, Faculty of Veterinary, 2Faculty of Veterinary Medicine, Universitas
Airlangga, Surabaya
Abstract
Background: Trichomonas gallinae is a protozoa that causes trichomoniasis which is common found in
pigeons and it attacks the digestive tract of pigeons. Proper examination can be done to differentiatefrom
healthy pigeons.
Purpose: to observe the changes in histopathological images of the esophagus and the crop of pigeons
(Columba livia) that infected with Trichomonas gallinae.
Method: Observations were carried out on 20 pigeons with symptoms of presenceTrichomonas gallinae.
Swab examination in the esophagus with the Natif Test and Giemsa Staining. Esophagus and cropwas
collected through necropsy in the upper digestive tract. Then histopathological examination was performed
with Hematoxylin Eosin (HE) staining. Data was analyzed descriptively.
Result: Histopathological features of pigeons (Columba livia) infected with Trichomonas gallinae were
different from healthy pigeons. Pigeons infected with protozoa Trichomonas gallinae showed changes of
the esophagus in the form of erosion and cell necrosis in stratified non-keranitized epithelium (mucosa) and
infiltration of inflammatory cells in the mucosa layer and sub esophageal mucosa. In addition, changes in the
crop were cell necrosis in the mucosa layer, infiltration of inflammatory cells in the submucosal layer, and
congestion in the sub mucosal cavity.
Conclusion: There werehistopathological changes in the esophagus and crop of pigeonsthat infected with
Trichomonas gallinae.
Keywords: Histopathology, Esophagus, Crop, Trichomonas gallinae, pigeon.
Introduction gallinae is a flagela protozoa that causes trichomoniasis

in pigeons.4 Trichomonas gallinae is most commonly
Pigeon (Columba livia) is one type of fowl with found in pigeons and has been reported to infect 67.3% of
a well known species in the Columbidae family.It pigeons species.5 Trichomoniasis causes high mortality
is one of the fauna diversity in Indonesia which has in young pigeons and affect the pigeons mortality
a high diversity of phenotypes, both qualitative and with a percentage of 77.5% in one subpopulation.6,7
quantitative characteristics.1 Pigeons are also farmed for Trichomonas gallinae attack the digestive tract of
their meat as a source of animal protein. The problem is pigeons, mostly found in the oral cavity, pharynx,
poor maintenance management causes pigeons become esophagus, and crop of adult pigeon as carriers of the
susceptible to disease.2 One of parasitic infection that disease.8
can attack a pigeon isTrichomonas sp..3 Trichomonas
Trichomonas gallinae infection has a pathognomonic
Corresponding Author: clinical signs. The identification can be done from taking
Muchamad Yunus samples of lesion in the mouth both nichrotic and fluid
Faculty of Veterinary Medicine, lesion. Transmission can occur through milk fromparent
Universitas Airlangga,Surabaya and child of pigeons, as well as through contaminated
Email: muchammadyunusfkhunair@yahoo.com food and beverages. This infection can spread between
species such as bird and eagle, then considered risk for Method
human health. Species that infect birds and domestic
mammals have been identified in human clinical This study was an an observational study. Laboratory
samples. Several phylogenetic analyzes have identified examination were conducted at the Parasitology
trichomonas derived from animals as taxa of closed Laboratory, Department of Veterinary Parasitology,
relatives of two species of humans.9 This confirms that Faculty of Veterinary Medicine, UniversitasAirlangga,
Surabaya Indonesia for 20 weeks. The preparation of
efforts to detect disease in pigeons are an important to
esophageal and crop histopathological preparations was
improve an animal health while distinguishing infected
conducted in the Department of Veterinary Pathology,
pigeons from healthy pigeons. To reduce the risk of
Faculty of Veterinary Medicine, UniversitasAirlangga,
zoonosis more effectively from industrial food animal
Surabaya Indonesia. This study used replacement,
production, the application of biosecurity must be in
reduction and refinement. Animals were modified in
harmony with the interest of public health.10 Surveillance
research procedures in such a way that to reduce pain
of diseases, as well as in transmission model for poultry
and stress in experimental animals, and considered to the
and zoonotic diseases are the main things.11 In addition,
5 principles of freedom in animal prosperity.
the most important is rapid detection and diagnosis.12
A total of 20 pigeons (Columba livia), both male
Observation of symptom is part of the framework
and female contributing to the sample with the criteria
of detection and diagnosis. Pigeons infected with
have clinical symptoms of Trichomonas gallinae
T. gallinae will have clinical symptoms namely
infection. The symptoms were depression, weight loss,
weight loss, weakness, depression with lesion in the
hair standing like cold and gloomy color, when standing
upper gastrointestinal tract. 3 Infection Trichomonas
curled up, there were lesions with wet and sticky
gallinae causes ulceration in the crop, esophagus and
exudates in the oral cavity, especially in acute diseases
proventriculus. Microscopic examination of pigeons
and in chronic infections there are hard exudations.
infected with Trichomonas gallinae will show an
infiltration of heterophil and eosinophil cells in the Sample examination wascarried out in several
mucosal layer and submucosal lamina propria.13 Parasitic stages. The first step was a swab examination in the
infection Trichomonas gallinae can cause infected esophagus through Natif tests and Giemsa staining when
birds have clinical symptoms that similar to avian fowl the pigeons were still alive. The samples were positive if
pox, deficiency of vitamin A, poultry (fowl diptheria), found Trichomonas parasites, proven by the movement
capillariasis, candidiasis and asppergillosis, namely the of flagellars from Trichomonas gallinae with a 100-
presence of necrotic lesions or lesions in the esophagus. 400 times magnification microscope. Pigeons with a
Trichomonas gallinae infection can be established lesion in the esophagus were positively infected with
by identification of the T. gallinae parasite in the Trichomonas gallinae. Esophagus and cropcolleceting
esophageal swab examination. The method to determine was done through necropsy in the upper digestive
the presence ofTrichomonas gallinae is by examining tract, then were given formalin 10%. Afterthat making
the esophagus swab. Esophageal swab is conducted histopathological preparations with Hematoxylin Eosin
by the negative method to detect the movement of the (HE) staining for microscopic examination. Data of
parasitic Trichomonas gallina flagella. Giemsa staining changes in esophagus histopathological histories and
is used for morphological identification of Trichomonas crop was analyzed descriptively.
gallinae.5
Result
In the course of this disease, the difference from
other diseases that have similar clinical symptoms can Total of 20 pigeons (Columba livia) with clinical
be used as guidelines for management according to the symptoms of Trichomonas gallinae infection were
disease found. The information about certain organs positively infected with Trichomonas gallinae.
changes in pigeon will open up the opportunities for the Histopathological changes in the esophagus and crop
virus schemespreading. This study aimed to determine will be seen as a decrease in blood flow (congestion),
the histopathology of the esophagus and crop in pigeons irreversible tissue necrosis, partial loss mucosa
infected with Trichomonas gallinae. (erosion), and cells with a defensive reaction as a
response to injury in the form of a vascular reaction to in histopathological features included erosions of
infection (inflammatory cells). Changes in oral lesions cell mucosa necrosis due to Trichomonas gallinae
and esophagus swab results that showed infection with infection. Description of histopathological changes in
Trichomonas gallinae are shown in figure 1. the esophagus of pigeons (Columba livia) infected with
Trichomonas gallinae which h erosion and cell necrosies
can be seen in figure 2.

(A) (B)
Figure 1: Lesions in the oral cavity (A), esophagus
infected with Trichomonas gallinae (B).
The result of the esophagus swabexamination with

the natif method was obtained by the movement of flagella (A) (B)
from the parasite Trichomonas gallinae. Protozoan was Figure 2: Tropozoite Trichomonas gallinae. A:
Independent swab check (400x) without staining. B:
detected from the motility or movement of flagella and
Swab checks using Giemsa coloring (1,000x).
in Giemsa staining will leave a bluish color up to purple.
The movement of flagella Trichomonas gallinaewas Other damage that occurs due to Trichomonas
found in all samples of pigeons’ esophagus. gallinae infection was the infiltration of inflammatory
cells in the mucosal and sub mucosal layers of the
Based on the results of examination and esophagus of the pigeons which cause thickening of
microscopic observations carried out there was the esophageal mucous layer. Histopathological images
ahistopathological change in the esophagus of pigeons of the esophageal layer undergoing inflammatory cell
infected with Trichomonas gallinae. These changes infiltration can be seen in figure 3.
Figure 3: Hitopathological features fromthe esophagus of naturally infected pigeons Trichomonas gallinae
has erosion and necrosis of cells in the mucosa (H.E coloring; 100x magnification (A1 and A2) and 200x
magnification (B); Nikon microscope H600L ; camera of DS Fi megapixel) . (): Erosion and cell necrosis.
The results of examination and microscopic observation showed there were histopathological feature
changesin the cropofpigeons with Trichomonas gallinaeinfection. These changes included cell necrosis in the
mucosal layer, infiltration of inflammatory cells in the sub-mucosal layer, and there are tendons in the sub-mucosal
layer. Histopathology of cell necrosis in the mucosal lining of the crop of pigeons (Columba livia) infected with
Trichomonasgallinae can be seen in figure 4. Histopathology in the sub-mucosal layer experiencing inflammatory
cell infiltration can be seen in figure 5. Congestion in the sub-mucosal layer can be seen in figure 6.
Figure 4: Histopathological picture of pigeon esophagus which has inflammatory cell infiltration due to
Trichomonas gallinae infection (H.E staining; 100x magnification (C1) and 200x magnification (C2); Nikon
H600L microscope; Camera DS Fi megapixels).
Figure 5: Histopathological features of the crop of pigeons infected with Trichomonas gallinae. Visible cell
necrosis in the mucosal layer. (H.E coloring; 100x magnification (D1) and 200x magnification (D2); Nikon
H600L microscope; camera of DS Fi megapixel).
Figure 6: Histopathological features of the crop of pigeons infected with Trichomonas gallinae. There is an
infiltration of inflammatory cells in the sub mucosal layer. (H.E coloring; 100x magnification (E1) and 200x
magnification (E2); Nikon H600L microscope; camera of DS Fi megapixel).
Figure 7: Visible presence of congestion in the sub-mucosal layer of the bird’s nest due to Trichomonas gallinae
infection. (H.E coloring; 100x magnification); Nikon H600L microscope; camera of DS Fi megapixel).
Discussion with Trichomonas gallinae will experience infiltration of

inflammatory cells in the mucosal layer and esophagus
Based on the results of esophagus swab examination mucosa. 13 In the crop of pigeons infected with
of 20 samples of pigeons (Columba livia) suspected of Trichomona gallinae showed histopathological changes
being infected with Trichomonas gallinae by showing of necrosis in the mucous layer and inflammatory cell
clinical symptoms of depression, weight loss, feathers infiltration in the sub layer mucosal.
stands like feeling cold and gloomy color, when
standingcurled up, yellow necrotic lesions were seen Basically, Trichomonas gallinae infects the upper
in the esophagus and crop, and a greenish liquid in the digestive tract of pigeons.14 All positive samples of T.
oral cavity.8 Histopathological changes were supported gallinae detected by microscopic examination were also
by the results of a research report that pigeons infected detected as positive by the PCR test. Most of the samples
identified negatively by microscopic examination were Ethical Clearance: This research has gone through
detected as positive T. gallinae by PCR testing and ethical tests and permits from Faculty of Veterinary
confirmed in sequence. Positive samples of T. gallinae Universitas Airlangga
collected will provide relevant data for studying the
ecology and genetic structure of the population of Conflict of Interest: The author reports no conflict of
Trichomonas gallinae and for disease prevention interest of this work.
and control.15 The degree of change and virulence of Source of Funding: This study is done with individual
pathological strains was low to high heterogeneity funding
of T. gallinae causes trichomoniasis. 16 Infiltration
of the trachea and lungs is associated with a severe
REFERENCE
inflammatory response to the surrounding tissue.17
1. Hamid A. Pola Tingkah Laku Makan Burung
Cytopathological analysis revealed many pyriform Merpati (Columba livia) Jantan Yang Dipelihara
protozoa, compatible with Trichomonas gallinae. Secara Intensif. Universitas Negeri Gorontalo; 2015.
Protozoa are not proven histopathologically in lesions
after staining the sample with Hematoxylin and Eosin 2. Dove, A., O.Z. Rojs, A.V. Rataj, Hibrovsek
staining or Gomori Methenamine Silver (GMS). 18 VUK and MD. Health Status of Freeliving
Histopathological changes in the esophagus of pigeons Pigeons (Columba livia domestica) in the City of
undergoing erosion and necrosis occur in the mucosal Ljubljana. Acta Vet Hung. 2004;52(2):219–26.
esophagus layer of pigeons. Erosion is the erosion or 3.
Bunbury, N., C.G. Jones, A.G. Greenwood
partial release of the mucosal epithelium. This occurs and DJB. Epydemology and Conservation of
because of a traumatic reaction to Trichomonas gallinae Trichomas gallinae infection in the endangerd
infection. 19 Changing histopathological of crop that Mauritian Pink Pigeon. Biol Conserv.
undergoes cell necrosis in the mucosal layer. Changes 2008;141:153–61.
in infiltration of inflammatory cells in the sub mucosal
4. Priosoeryanto, B.P., Ratih, D., Harlina, F., Tiuria,
layer of the crop. The severity of lesions that occur as
R., Estuningsih, S. W, W., dan Huminto H.
a result of Trichomonas gallinae infection in the upper
Patologi Trichomoniasis pada Burung Merpati
digestive tract varies from mild mucosal inflammation to
(Columba livia) diPeternakan Cianjur Jawa Barat.
sub-mucosal inflammation.20
JMed Vet Indones. 2005;9(1):1–5.
However, the virulence of Tricomonas gallinae 5. Begum N, Mamun M, Rahman S, Bari A.
depends on other factors such as exposure to previous Epidemiology and pathology of Trichomonas
pathogens (protective immunity) and individual gallinae in the common pigeon (Columba livia).
immunocompetence. Factors such as age, concurrent J Bangladesh Agric Univ. 2010;6(2):301–6.
disease, genetic heterogeneity, geographical variation,
habitat differences, abundance of means of transmission 6. Swinnerton KJ dkk. The ecology and concervation
and availability of food.16,21 In addition, livestock should of the Pink Pigeon Columba mayeri in Mauritius.
pay attention to the management of sanitary cages University of Kent, Canterbury,UK, 194 pp.; 2005.
and feed to break the chain of distribution. Further 7. Bunbury N, Jones CG, Greenwood AG, Bell DJ.
studies regarding the degree of infection in esophageal Trichomonas Gallinae in Mauritian Columbids:
histopathological changes and caches infected with Implications for an Endangered Endemic. J
Trichomonas gallinae need to be done as a step towards Wildl Dis [Internet]. 2007;43(3):399–407.
better diagnosis. Available from: http://www.jwildlifedis.org/
doi/10.7589/0090-3558-43.3.399
Conclusion
8. Taylor, M.A., R.L. Coop and RLW. Veterinary
There were histopathological changes in the Parasitology. Third Edit. Australia: Blackwell
esophagus and crop of pigeons with infection of Publishing; 2007. 44, 46, 460-461, 508-509, 655-
Trichomonas gallinae. 656, 673, 535-555., p.
9. Maritz JM, Land KM, Carlton JM, Hirt RP. What pigeons in Guangzhou, China. Korean J Parasitol.
is the importance of zoonotic trichomonads for 2017;55(3):333–6.
human? Trends Parasitol. 2014;30(7):333–41.
16. Borji H, Razmi GH, Movassaghi AH, Moghadas
10. Leibler JH1, Otte J, Roland-Holst D, Pfeiffer E, Azad M. Prevalence and pathological lesion
DU, Soares Magalhaes R, Rushton J, Graham of trichomonas gallinae in pigeons of Iran. J Vet
JP SE. Industrial food animal production and Parasitol. 2011;25(2):103–6.
global health risks: exploring the ecosystems
17. Stoute AST, Charlton BR, Bickford AA, Bland
and economics of avian influenza. Ecohealth.
MC, Stoute ST, Charlton ABR, et al. Respiratory
2009;6(1):58–70.
Tract Trichomoniasis in Breeder Squab Candidates
11. Fiebig L1, Smieszek T, Saurina J, Hattendorf J in Northern California Published by : American
ZJ. Contacts between poultry farms, their spatial Association of Avian Pathologists Linked
dimension and their relevance for avian influenza references are available on JSTOR for this article
preparedness. Geospat Heal. 2009;4(1):79–95. : Case Report ? Respiratory Tract Trichomoniasis
in Bre. Avian Dis. 2019;53(1):139–42.
12. Jake Astill, Rozita A. Dara, Evan D. G. Fraser, and
Shayan Sharif. Detecting and Predicting Emerging 18. Arenales A, Almeida ACO, Prado LF, Garcia S,
Disease in Poultry With the Implementation of Rui Luvizotto MC. Cytopathology in the diagnosis
New Technologies and Big Data: A Focus on of oral trichomoniasis in a rock pigeon (Columba
Avian Influenza Virus. Front Vet Sci. 2018;5:263. livia). Brazilian J Vet Pathol. 2014;7(2):98–9.
13.
Fenzi. Tingkat infeksi Trichomoniasis pada 19.
Al-Sadi HI, Hamodi AZ. Prevalence and
burung merpati (Columba livia) di Pasar Satwa pathology of trichomoniasis in free - living urban
dan Tanaman Hias Dongkelan. Universitas Gajah pigeons in the city of Mosul, Iraq. Vet World.
Mada; 2013. 2011;4(1):12–4.
14. Oryan A, Rakhshandehroo E, Kamali SA, Taebi 20. Amin, Azizah., Bilic, Ivana., Liebhart, Dieter., and
pour MJ. Histopathological changes in the upper Hess M. Trichomonad of Pigeon-Review. Clinic
digestive tract of pigeons infected with Hadjelia for Poultry and Fish Medicine, Departtment for
truncata. J Parasit Dis [Internet]. 2016;40(3):881– Farm Animals and Veterinary Public Health. 2013.
4. Available from: http://dx.doi.org/10.1007/
21. Nematollahi A, Ebrahimi M, Ahmadi A, Himan
s12639-014-0597-1
M. Prevalence of Haemoproteus columbae and
15. Qiu S Ben, Lv MN, He X, Weng YB, Zou SS, Wang Trichomonas gallinae in pigeons (Columba
XQ, et al. PCR identification and phylogenetic domestica) in Isfahan, Iran. J Parasit Dis.
analysis of trichomonas gallinae from domestic 2012;36(1):141–2.
The Effectiveness of Back Exercise for the Reduction of Low

Back Pain Prevalence on the Emergency Room Nurses
Dinda Nur Fajri Hidayati Bunga1, Harmayetty1, Candra Panji Asmoro1

1
Faculty of Nursing, Universitas Airlangga, Mulyorejo Street, Surabaya, East Java, Indonesia
ABSTRACT
Background: Low back pain is a major problem in the musculoskeletal system which affects nearly 84%
of adults. Those working for more than 42 hours in a week, including nurses, are at the highest risk of
developing low back pain. This research aimed to figure out the effectiveness of back exercise intervention
for low back pain on the emergency room nurses.
Method: This research is quasi-experimental research with a control-group pretest-posttest design. This
research was conducted on 12 nurses. The respondents were divided into two groups, treatment group and
control group, with 6 respondents each. The intervention was measured using McKenzie’s back exercise
SOP, general data questionnaires, and the Ovako Work Posture Analysis System (OWAS). The results of the
measurements were analyzed using the Wilcoxon Signed Rank Test, while the results of the post-test were
analyzed using the Mann-Whitney Test.
Results: The difference in the nurses’ work postures was significant according to the Wilcoxon Signed Rank
Test but insignificant according to the Mann-Whitney Test. In the pain measurement, pain frequency was
the only factor that yielded a significant value (p < 0.05) in both tests. The risk factors pain scale and pain
duration were significant in the Wilcoxon Signed Rank Test but insignificant in the Mann-Whitney Test.
Conclusion: Back exercise intervention for low back pain in nurses is effective in lowering low back pain
prevalence by reducing the risk factor pain frequency, especially prior to patient mobilization.
Keyword: low back pain, back exercise, nurse, pain
Introduction To compare the effectiveness of motor control exercises

and McKenzie exercises in reducing pain and disability
Low back pain is an important health problem from a in work related low back pain. Method: The study
socioeconomic perspective and is related to high cost and included 40 subjects with work related low back pain due
work disability 1sitting has now become the most common to prolonged sitting. They were randomly allocated into
posture in today’s workplace. Idea of using motor two groups (Group A and Group B. Some 12% of low
control learning approach provides the optimal control back pain prevalence occurs in adults, while 40% does
and coordination of the spine. The McKenzie evaluation in the elderly until the end of their lives 2. Every year, the
was received using repeated movements and sustained world’s LBP prevalence rate stands between 40%–50%.
positions. Therefore high quality randomized clinical Ninein 10 adults experience back pain at some point in
trial was required to compare the effectiveness of these their lives, and 5 in 10 do annually3.
treatments for work related low back pain. Objectives:
The highest risk of low back pain may be faced by
those who work for more than 42 hours a week 4. Nurses
Correspondence Author: work 7- through 8-hours shifts, and the number of hours
Harmayetty may increase during night shifts5. Of 250 nurses 61%
Faculty of Nursing, Universitas Airlangga, complained low back pain at medium- to high-scale of
Mulyorejo Street, Surabaya, East Java, Indonesia 60115 pain6. The prevalence rate of back pain in Hong Kong
Email: harmayetty123@gmail.com
nurses stood at 40.6%7. A higher prevalence rate of Procedure: All procedures in this research were
LBP in nurses was reported in a Turkey-based study to approved by the Health Research Ethics Committee of
stand between 62% and 88%8. In Indonesia, as many as the Faculty of Nursing, Universitas Airlangga, Surabaya,
45.5% of the nurses of a type A hospital in Surabaya Indonesia with an ethical clearance No. 220-KEPK.
complained back pain9. In the preparation, letters of permission were sent to a
number of institutions, including the type B hospital
From a preliminary observation at the emergency
RSU Haji Surabaya, Indonesia.
department of a type B hospital in Surabaya, Indonesia,
low back pain was found in 12 of 27 nurses (44.4%). All respondent candidates were informed about
This, according to the Public Satisfaction Survey the benefits, aim, and procedure of the research as well
(SKM), has caused the hospital’s service quality to fall as their rights based on the ethics before the research
from excellent (A) to good (B). The complaint was was conducted. The respondent candidates willing to
experienced by the nurses for two years, yet no mutation take part in the research were asked to sign an informed
took place due to the restriction in the number of nurses. consent. In the first session prior to the research, the
respondents were asked to complete low back pain
McKenzie exercises were first introduced by doctor
complaint questionnaires then subjected to a matching
Robin McKenzie in 1981. The technique of these
process aimed to distribute the respondents into two
exercises is altering the distorted shape of posterior discs.
groups equally based on the pre-test results. Together
McKenzie exercises are performed by extension that
with the emergency department party the researchers
creates pressure at a certain point in vertebrae, reducing the
made a schedule according to the nurses’ shift hour.
distance between vertebrae and pressing the disc nucleus
or pushing it to its initial position, causing the nucleus The treatment group performed back exercises
to move more easily because the disc shifts forward and twice a week for two weeks for a duration of 30 minutes
eventually removing protrusion in the posterior area and per session. In every back exercise session, the treatment
reducing back pain10. This research aimed to figure out the group was guided by a physiotherapist. Follow-up was
effectiveness of back exercise for low back pain in nurses undertaken every week to monitor the outcome of the
of a hospital in Surabaya, Indonesia. intervention. In the last session, the respondents filled
the low back pain complaint questionnaires after given
Method the back exercise procedure. On the same day, the
researchers also distributed the questionnaires to the
Design, Sampling, Variables: This research is quasy- control group who received no intervention in a separate
experiment research with a control-group pretest- place to prevent data bias between both groups.
posttest design. The research sample was selected
randomly by a non-probability sampling technique Data Analysis: The data were analyzed using the
named purposive sampling11. The sample consisted of Wilcoxon Signed Rank Test (administered to both
12 emergency nurses of RSU Haji Hospital Surabaya, treatment and control groups) at a significance level
Indonesia. The respondents were randomly divided into (α) of ≤ 0.05. Hypothesis testing for figuring out the
two groups: 1) a group of respondents receiving no back post-test results of the treatment and control groups
exercise intervention and 2) a group receiving a therapy were undertaken using the Mann-Whitney Test at a
according to the hospital’s program. significance level (α) of ≤ 0.05.
In this research, an observation of 4 dependent

Results
variables—work posture, pain frequency, pain duration,
and pain scale—was conducted. Measurements were Based on the interview with the head of the
carried out based on McKenzie’s back exercise SOP, emergency department of RSU Haji Surabaya, it was
general data questionnaires, and Ovako Work Posture found that in a 24-hour period, there were approximately
Analysis System (OWAS) observation sheet. 100 visits to the emergency department daily.
Table 1: Demographic characteristics of the respondents
No. Characteristic of the Respondents f (number) treatment % f (number) control %

1. Gender
Male 1 16.7 4 66.7
Female 5 83.3 2 33.3
Total 6 100 6 100
2. Age (years)
25 - ≤ 35 3 16.7 1 16.7
> 35 - ≤ 45 2 33.3 5 83.3
> 45 - ≤ 60 1 50 - -
Total 6 100 6 100
3. Time working at the hospital
<5 years 1 16.7 1 16.7
5–10 years 2 33.3 2 33.3
> 10 years 3 50 3 50
Total 6 100 6 100
After identifying the characteristics of the treatment and control group respondents, the researchers assessed the
work posture and pain of the treatment and control groups as outlined below.
Table 2: Results of the work posture assessment of the treatment and control groups before and after back
exercise intervention
Treatment Group Control Group

Resp.
OWAS Category Change OWAS Category Change
No.
Pre-Test Post-Test (∆) Pre-Test Post-Test (∆)
1. 1 1 0 1 1 0
2. 2 1 -1 2 2 0
3. 3 1 -2 1 1 0
4. 1 1 0 2 1 -1
5. 3 2 -1 3 2 -1
6. 1 1 0 1 1 0
Wilcoxon Signed Rank Test p = 0.046 Wilcoxon Signed Rank Test p = 0.157
Description: Wilcoxon Signed Rank Test significant at p < 0.05
The questionnaire responses show that in the working posture pre-test, two of six respondents in the treatment
group fell into category 3, namely dangerous and in need of immediate correction. Meanwhile, most respondents in
the control group (three people) had no problem with their posture.
In the Wilcoxon Signed Rank Test, the treatment group yielded a p value of 0.046, suggesting that there was
a significant difference in the nurses’ work posture between pre-test and post-test. Meanwhile, the control group
yielded a p value of 0.157 in the Wilcoxon Signed Rank Test, which suggests that there was a significant difference
in the nurses’ work posture between pre-test and post-test. As for the Mann-Whitney analysis results, a p value of
1.000 shows that back exercise was ineffective for the nurses’ work posture correction.
Table 3: Results of Pain Observation before and after Back Exercise Intervention in the Treatment Group
Resp. Pain Frequency Pain Period Pain Scale

No. Pre Post Pre Post Pre Post
1. 3 2 2 2 2 2
2. 2 1 1 1 2 1
3. 2 1 1 1 2 1
4. 3 2 1 1 1 1
5. 2 1 2 2 2 2
6. 2 1 3 1 2 1
p = 0.025 p = 0.317 p = 0.083
Description: Wilcoxon Signed Rank Test significant at p < 0.05
From the Wilcoxon Signed Rank Test on the Discussion
treatment group, a p value of 0.025 was obtained in
the pain frequency category, meaning that there was a Low back pain occurs as a result of muscular strain
significant difference in the pain frequency between pre- or spasm, strain of ligaments, degenerative discs, or
test and post-test. No change in the pain frequency value herniation of nucleus pulposus from the middle section
was found in all control group respondents who received of intervertebalis discs. Ninety-five percent of disc
no intervention at all (p = 0.157). The p value of 0.014 herniation occurs somewhere between the fourth and fifth
obtained from the Mann-Whitney analysis shows that lumbar regions (L4–5), while the remaining 5% occurs in
back exercise was effective in reducing the frequency of cervical and thoracic regions. Continuous muscular strain
pain felt by the nurses. or spasm will induce the breaking down of glycogens
into lactic acids. The accumulated lactic acids can irritate
The Wilcoxon Signed Rank Test results for the muscular nerve fibers and trigger low back pain12.
treatment group in the pain period category show a p
value of 0.317, meaning that there was no significant Pain scale may be effectively controlled by exercise
difference in the pain period between pre-test and therapy (either land- or water-based). A high level of
post-test. Two control group respondents experienced habit may reduce the scale of pain13. Back exercises that
a change in category. As for the control group, the p are performed properly and correctly within a relatively
value obtained from the Wilcoxon Signed Rank Test long period will actively increase the muscular strength,
was 0.317, which means that there was no significant hence the name active stabilization. The increased
difference in the pain period between pre-test and post- muscular strength will in turn improve the body’s
test. Meanwhile, from the Mann-Whitney analysis, a p endurance against changes in motion and static and
value of 0.523 was obtained, meaning that back pain dynamic loading14.
intervention was ineffective in reducing the period of Back exercise intervention was also performed in the
pain felt by the nurses. treatment group with low back pain due to spondylosis
From the Wilcoxon Signed Rank Test on the lumbalis, which resulted in an increased range of
treatment group, a p value of 0.083 was yielded in motion14. The increase in the range of motion would
the pain scale category, meaning that there was no affect the postures displayed by the nurses during work.
significant difference in the pain scale between pre-test Back exercise is highly effective for musculoskeletal
and post-test. As for the control group, the p value from strengthening, thereby reducing pain in patients with
the Wilcoxon Signed Rank Test was 0.317, meaning chronic back and neck pain. Low back pain management
that there was no significant difference in the pain scale principally aims at eliminating pain, returning activity
between pre-test and post-test as well. A p value of 0.269 and movement to their normal condition, and preventing
from the Mann-Whitney analysis suggests that back relapse15.
exercise intervention was ineffective in reducing the Back exercise is highly recommended for health
scale of pain felt by the nurses. lifestyle, longevity, mental health, and management
of some chronic diseases such as low back pain16,17. the risk of neck–shoulder and low back pain in
After receiving back exercise, nurses will have higher adolescents. The European Journal of Public
flexibility and endurance in lifting, pushing, or pulling Health. 2006;16(5):536–41.
patients when working. The more the nurses improve 5. Caruso CC. Negative impacts of shiftwork and
their muscular strength and grow used to perform the long work hours. Rehabilitation nursing : the
movements appropriate for spinal mechanics, the better official journal of the Association of Rehabilitation
they will endure the pain. Nurses [Internet]. 2013/06/18. 2014;39(1):16–25.
Conclusion pubmed/23780784
The dominant factor that influences low back pain 6. Al Dajah S, Al Daghdi A. Prevalence and
is the posture of the nurses. Back exercise is effective risk factors of low back pain among nurses in
for reducing low back pain prevalence by reducing pain Sudayr region. European Scientific Journal, ESJ.
frequency, as is the case in the pain frequency reduction 2013;9(33).
in nurses who work at hospitals. After receiving back 7. Cunningham C, Flynn T, Blake C. Low back pain
exercise intervention, nurses will have higher flexibility
and occupation among Irish health service workers.
and endurance in lifting, pushing, or pulling patients
Occupational Medicine. 2006;56(7):447–54.
when working.
8. Karahan A, Kav S, Abbasoglu A, Dogan N. Low
Ethical Clearance: This study has obtained the back pain: prevalence and associated risk factors
feasibility of ethical review in the Health Research among hospital staff. Journal of advanced nursing.
Ethics Commission of the Faculty of Nursing, Airlangga 2009;65(3):516–24.
9. Widajati N, Hidayat S, Nawawinwtu ED. Factors
Conflict of Interest: The author reports no conflict of Related to Low Back Pain Among Nurses at Dr.
interest of this work. Soetomo District Hospital-Surabaya. Indonesian
Journal of Public Health. 2006;3(1).
funding. 10. McKenzie R, Kubey C. 7 Steps to a Pain-Free
Life: How to Rapidly Relieve Back, Neck, and
REFERENCES Shoulder Pain. Penguin; 2014.
1. Tanna T, Thiyagarajan S, Gounder PC. Comparing 11. Bernard HR. Qualitative data analysis I: text
the Effectiveness of Motor Control Exercises analysis. Research methods of anthropology.
Versus Mckenzie Exercises for Work Related Back 2002;440–8.
Pain. Open Journal of Therapy and Rehabilitation 12. Smeltzer SC, Bare BG. Keperawatan medikal
[Internet]. 2016;4(3):178–85. Available from: bedah brunner & suddarth. Jakarta: Penerbit Buku
http://www.scirp.org/journal/PaperInformation. Kedokteran EGC. 2001;
aspx?paperID=70148$##$http://www.scirp.org/
journal/PaperDownload.aspx?DOI=10.4236/ 13. Beumer L, Wong J, Warden SJ, Kemp JL, Foster
ojtr.2016.43017 P, Crossley KM. Effects of exercise and manual
therapy on pain associated with hip osteoarthritis:
2. Hoy D, Bain C, Williams G, March L, Brooks
a systematic review and meta-analysis. British
P, Blyth F, et al. A systematic review of the
Journal of Sports Medicine [Internet]. 2016 Apr
global prevalence of low back pain. Arthritis &
1;50(8):458 LP – 463. Available from: http://
Rheumatism. 2012;64(6):2028–37.
bjsm.bmj.com/content/50/8/458.abstract
3. Patel AT, Ogle AA. Diagnosis and management of
14. Dachlan LM. PENGARUH BACK EXERCISE
acute low back pain. American family physician.
PADA NYERI PUNGGUNG BAWAH (Studi
2000;61(6):1779–86.
experimen perbandingan dua model latihan
4. Hakala PT, Rimpelä AH, Saarni LA, Salminen punggung bawah di Rumah sakit Dr. Moewardi
JJ. Frequent computer-related activities increase Surakarta). Universitas Sebelas Maret; 2009.
15. Tarwaka SHA, Bakri LS. Ergonomi Industri 17. Hurley B, Reuter I. Aging, physical activity,
Dasar-dasar Pengetahuan Ergonomi dan Aplikasi and disease prevention. Journal of aging
di Tempat Kerja. Surakarta: Harapan Press; 2010. research [Internet]. 2011 Jun 19;2011:782546.
16. Hurley BF, Hanson ED, Sheaff AK. Strength training
pubmed/21748011
as a countermeasure to aging muscle and chronic
disease. Sports medicine. 2011;41(4):289–306.
The Effect of Breeding Management on the Prevalence and

Trematode Infection Degree in Calves
Haris Setiawan1, Kusnoto1, Mas’ud Hariadi1

1
Surabaya, East Java
Abstract
Background: Poor management in farms can have a negative effect on livestock. The low hygiene of animal
feed is one-factor causing various kinds of parasitic agents which can infect livestock.
Objective: Examining the effect of breeding management on the prevalence and degree of Trematode worm
infection in calves.
Method: The samples of this study were 49 calves aged less than 205 days which were randomly selected; 5-7
grams of fresh fecal samples were taken directly from the rectum rectally and put in a plastic pot containing
10% formalin. Sample examination was carried out by sedimentation method and buoyancy method.
Results: It was found that 12 samples contained Trematode worms. There are several types of worm eggs,
including Fasciola spp., and Paramphistomum spp. Calculation of Worm Eggs per Gram of Stool in 12
positive samples showed a single infection of Fasciola spp. on an average of 0-460 worm eggs per gram
of stool, a single infection of Paramphistomum spp. on an average of 0-100 worm eggs per gram of stool,
and mixed Fasciola spp. and Paramphistomum spp. infection on an average of 0-700 worm eggs per gram
of stool. The livestock breeding system which is widely applied is caging. The prevalence of Trematodes
in calves was 24.4%, and the average degree of infection was mild, between 1-499 eggs per gram of stool.
Conclusion: The prevalence and degree of infection of Trematode worms are influenced by breeding
management applied by farmers.
Keywords: Breeding management, Trematode, Calves, Prevalence, Infection degree
Introduction of parasites which often infects calves is Trematode

worms. Trematodes in the digestive tract is a problem for
Parasites affect not only the health of livestock livestock managers, especially in dairy cattle. Trematode
but also the productive and reproductive performance worms commonly infect livestock with low health and
1
. Livestock infected with Trematode worms will immunity 4. Infection in livestock with a shepherd
experience physical changes; the body becomes very breeding system occurs passively because the livestock
thin, resulting in low market value in the market 2. Calves drinks water or eat feed which has been infected by
aged 3 to 12 months are more susceptible to infection Trematode Metacercariae.
with various types of worms such as Nematodes,
Trematodes and Cestoda compared to cows 3. One type Diagnosis of the possibility of worm infection can
be done by looking at the clinical symptoms identified
Corresponding Author: in livestock, such as anorexia, anemia, diarrhea, dirty
Kusnoto and gloomy hair, decreased body weight and stunted
Department of Veterinary Education, livestock growth 5. When a worm infection is found in
Faculty of Veterinary, livestock, the most common drug given to animals is
Universitas Airlangga, Jl. Mulyorejo, Anthelmintics. Anthelmintics are a group of drugs used
Surabaya, East Java, 60113 to expel worm parasites in the digestive tract and in other
Email: veterinariankusnoto@gmail.com body tissues such as the liver, lungs, skin, and blood
circulation 6. Poor breeding management of livestock can Examination of the samples using the floating
cause various types of parasitic agents to easily infect the method is similar to the sedimentation method, except
livestock in various ways, including contamination of that the buoyant method results in clear deposits of the
feed and drink 7. Good control of breeding management supernatant being replaced with float substances. In this
will minimize Trematodosis cases. Feed quality and the study, the float substance used was sucrose solution. The
tool for taking the feed are determinants of infection floating agent was added to 1 cm from the upper part
because they can be infected by parasites 8. of the tube. The results of the mixture were stirred and
then centrifuged for 3-5 minutes at a speed of 1500 rpm.
Livestock management is a factor that influences the The floating agent was gradually added to the solution
prevalence of worm infections 9. The breeding system is with Pasteur pipette until the surface looked convex. The
also one of the causes of parasitic infections 10. Based glass cover was taken and placed on an object glass. It
on the above explanation, the purpose of this study was was then examined in a microscope with a magnification
to determine the effect of breeding management on the of 100 times.
prevalence and degree of Trematode worm infection in The stools positively infected by Trematode worms
calves. The hypothesis of this study is that good livestock were then calculated by the Worm Per Gram Stool Egg
management results in the low prevalence and degree of using the Lucient Brumpt method to determine the
Trematode worm infection in calves. degree of infection. The stools were weighed ± 1 gram
and mixed with water. Dilution suspension was made
Method 10 times and filtered. One drop of suspension was taken
from the result. It was placed on an object glass and
This research was conducted at a dairy farm located examined using a microscope with a magnification of
in Malang Regency, East Java Province. The samples in 100 times. The examination result then analyzed using
this study were 49 calves Holstein breeders who were less the prevalence formula to determine the prevalence
than 205 days old 11. The first phase of the research is taken percentage of Trematode. Data obtained from the
the stools from the samples. The stool is freshly released questionnaire analyzed using the Classification and
fresh feces or taken directly from the rectum rectally with Regression Tree. Data from the calculation of Worm Per
the amount 5-7 grams. The stools put in a plastic pot Gram Stool Eggs analyzed using Correspondence test.
containing 10% formalin solution as a preservative. Each
plastic pot was given a label indicating the number, origin, Results
owner, information about the calf, and data management
applied. The collected stools were examined at the The results of laboratory tests indicated that 12
samples contained worm eggs, including Fasciola
Helminthology Laboratory of the Faculty of Veterinary
spp., and Paramphistomum spp. The types of eggs
Medicine, Universitas Airlangga.
from Trematode class were Fasciola spp. and
Sample examination was carried out by two Paramphistomum spp. From a single infection in
methods, sedimentation method and buoyancy method. calves, 8 samples contained Fasciola spp. and 1 sample
In the sedimentation method, the stools were inserted contained Paramphistomum spp. eggs. For the mixed
into a centrifuge tube, added with distilled water with infection, 3 samples contained Fasciola spp. and
Paramphistomum spp. eggs. The identification of worm
a ratio of 1:10, then filtered and centrifuged for 2-5
eggs was conducted by observing the worm morphology.
minutes at a speed of 1500 rpm. After being centrifuged,
The measurement of the eggs was done using Optilab
the supernatant at the top was removed and few
Imageraster software. Sample examination using the
deposits were left. Distilled water was added to the sedimentation method revealed that Fasciola spp eggs
remaining sediment and centrifuged for 2-5 minutes had a shape of an ovoid with an operculum at one end of
until the supernatant looked clear. After it was clear, the egg. The egg size ranged from 162.76µm x 78.64µm.
the supernatant was removed and the remaining filtrate The number of Paramphistomum spp. eggs found in the
was left. The sediment then taken with a Pasteur pipette samples using the sedimentation method was 4, where
and dropped on an object glass and covered with a glass 1 sample was a single infection and 3 were a mixed
cover. It was then examined with a microscope with a infection. The wall was clear and the egg size ranged
magnification of 100 times. from 143.76µm x 75.02µm.
From the calculation of the Worm Eggs per Gram Stool of the 12 samples, detailed data of the degree of infection
based on worm species were obtained. Single infection of Fasciola spp. was on average 0-460 worm eggs per gram
of stool, a single infection of Paramphistomum spp. was on average 0-100 worm eggs per gram of stool and mixed
infection of Fasciola spp. and Paramphistomum spp. was on average 0-700 worm eggs per gram of stool.
Table 1: Degree of Trematode Infection in Calves
Sample Number Types of Worm Eggs TCPGT

2 Fasciola spp. dan Paramphistomum spp. 400
3 Fasciola spp. 90
8 Fasciola spp. 400
10 Paramphistomum spp. 100
17 Fasciola spp. 300
Table 2: Management Aspects of Holstein Friesian Breeding
Livestock Management Total Percentage

Self-grown grass 21 42.9
Wild grass 11 22.4
The feed given every day
Self-grown and wild grass 17 34.7
Total 49 100
Wetland 8 16.3
Dryland 32 65.3
Origin of feed
Wetland and dry land 9 18.4
Total 49 100
Caged 35 71.4
Pastured 0 0
Livestock breeding system
Caged and pastured 14 28.6
Total 49 100
Receiving medication against worms 38 77.6
Livestock treatment record Never receiving medication against worms 11 22.4
Total 49 100
Clean 16 32.7
Moderate 22 44.9
Livestock housing conditions
Dirty 11 22.4
Total 49 100
Table 3: Trematodes Prevalence Data based on Calf Breeding Management
Prevalence (%)
Fasciola Paramphistomum Fasciola spp. &
Livestock Management Total
spp. spp. Paramphistomum spp.
Feed given daily
Self-grown grass 0 0 0 0
Wild grass 6 1 3 20.30%
Self-grown and wild grass 2 0 0 4.10%
Prevalence 16.30% 2% 6.10% 24.40%
Origin of feed
Wetland 5 0 3 16.30%
Dryland 0 0 0 0
Wetland and dry land 3 1 0 8.10%
Prevalence 16.30% 2% 6.10% 24.40%
Livestock breeding system
Intensive 1 0 0 2%
Semi-intensive 7 1 3 22.40%
Prevalence 16.30% 2% 6.10% 24.40%
Recording of medication
Having received medication 1 0 0 2%
Never receiving medication 7 1 3 22.40%
Prevalence 16.30% 2% 6.10% 24.40%
Condition of housing
Clean 0 0 0 0
Moderate 1 0 0 2%
Dirty 7 1 3 22.40%
Prevalence 16.30% 2% 6.10% 24.40%
Based on the livestock breeding system, the never received anthelmintic medication was 63.6%;
prevalence of Trematodosis was 2% for livestock the prevalence of Paramphistomum spp. infection was
intensively bred and 22.4% for those semi-intensively 9.1%; and the prevalence of mixed infection of Fasciola
bred. In terms of medication against trematodes, calves spp. and Paramphistomum spp. was 27.3%. On the other
receiving helminthiasis medication were 2% and those hand, the prevalence of Fasciola spp. in calves which had
never receiving the medication were 22.4%. Based received anthelmintic medication was 2.6%. The types
on the condition of housing, clean housing was 0%, of Trematodes in calves which had received anthelmintic
housing in a moderately clean condition was 2%, and medication are affected by the breeding system. There
dirty housing was 22.4%. was no Trematode infection in calves bred intensively
or caged, while Fasciola spp.infection of 25% was
Based on the value (p<0.01), the data are significantly found in calves bred semi-intensively. The results of a
different. Samples infected by trematodes were 75.5%; correspondence test on the relationship between the type
infected by Fasciola spp. were 16.3%; those infected of worm and infection degree indicate light infection due
by Paramphistomum spp. were 2.0%; and samples to Fasciola spp. Paramphistomum spp. infection also
infected by both Fasciola spp. and Paramphistomum resulted in light infection degree, while mixed infection
spp. were 6.1%. The prevalence of Trematodes infection of Fasciola spp. and Paramphistomum spp. resulted in a
was affected by the medication given to the calves. The moderate infection degree.
prevalence of Fasciola spp. infection in calves which
Discussion Trematodes, but its effectiveness is influenced by the

accuracy of the dose, the Anthelmintic spectrum, and the
The results of the laboratory tests show that two method of administration 15. Calves that are bred semi-
species of Trematode class were identified: Fasciola intensively and those grazed have Fasciola spp worm
spp. and Paramphistomum spp. Most of the farmers infection of 25%. This is different from calves that are
had their own farming for growing grass. Some farmers bred intensively. There was no Trematode infection
obtained feed from dry land. If the grasses taken are still found. Calves that received Anthelmintic medication but
wet, the farmers will wither the grasses. This treatment is are bred extensively or semi-intensively could be infected
applied to avoid bloating or tympanic cases in livestock by Trematodes. From the results of the correspondence
and also reduce the chance of livestock being infected analysis, the relationship between the types of worms and
by metacercaria. the degree of infection were obtained. A mild infection
The feed from wetlands or rice fields might result in is often caused by Fasciola spp., followed by infection
higher Trematode infection due to the influence of the due to Paramphistomum spp., which also results in mild
hosts which are likely to appear in runny areas because infection. Meanwhile, mixed infections of Fasciola spp.
the hosts need water. The prevalence of Trematode in and Paramphistomum spp. cause moderate infection.
calves which never receive anthelmintic medicine was Infection of the Fasciola spp. is closer to mild infection
22.4%. Meanwhile, the prevalence of Trematode in calves compared to that of the Paramphistomum spp. because
which have received medicine against helminthiasis the host of Fasciola spp., the Lymnea rubiginosa species,
was 2%. The cleanliness of housing has an effect on the can easily be found in the field.
prevalence of Trematode. The highest prevalence was
found in dirty housings, which was 22.4%. In moderately Conclusions
clean housings, the prevalence was 2%. There was a
The prevalence and infection degree of Trematode
mixed infection in the positive samples. The mixed
infecting calves are influenced by the breeding
infection from the whole samples was 6.1%. Based
management implemented by farmers, especially the
on the data, the prevalence of Trematode worms was
administration of Anthelmintic medication and breeding
24.4%. The prevalence of Trematode varies in different
system. No Trematode infections were found in calves
areas. This is due to geographical conditions affecting
receiving Anthelmintic medication and bred with the
the presence of snails as the host in the environment.
intensive breeding system.
As farming is at an altitude of ± 1,100 meters above the
sea level, the rainfall in the area is relatively high. The Ethical Clearance: This research is in accordance with
geographical condition is not suitable for the host of ethical clearance, has not been published before and is
Trematodes, which is the freshwater gastropods 12. Most not being considered for publication elsewhere.
freshwater gastropods live in shallow waters with the
slow current so that the risk of Trematode infection will Conflict of Interest: There is no conflict of interest in
be lower in environments which do not support the life this study.
of gastropods 13.
This is related to the habitat of the host which tend to team and funded independently.
be runny areas as the host needs water for living 14. Calves
that have never received Anthelmintic medication have References
Fasciola spp.prevalence of 63.6%; Paramphistomum
1. Bhutto B, Phullan MS, Rind R, Soomro AH.
spp. of 9.1%; and mixed infection of Fasciola spp. and
Prevalence of gastrointestinal helminths in buffalo
Paramphistomum spp. of 27.3%. These numbers are
calves. J Biol Sci. 2002;2(1):43–5.
greater compared to the figures obtained from calves that
have received anthelmintic medicine. The Fasciola spp 2. Khan MK, Sajid MS, Khan MN, Iqbal Z, Iqbal
infection was 2.6%; the number for Paramphistomum MU. Bovine fasciolosis: Prevalence, effects of
spp. infection, and mixed infection of Fasciola spp. treatment on productivity and cost benefit analysis
and Paramphistomum was 0%. The administration of in five districts of Punjab, Pakistan. Res Vet Sci.
Anthelmintic is considered effective for eliminating 2009 Aug;87(1):70–5.
3. Waruiru RM, Kyvsgaard NC, Thamsborg SM, 10. Martin R, Lazakis I, Barbouchi S, Johanning
Nansen P, Bøgh HO, Munyua WK, et al. The L. Sensitivity analysis of offshore wind farm
prevalence and intensity of helminth and coccidial operation and maintenance cost and availability.
infections in dairy cattle in central Kenya. Vet Res Renew Energy. 2016;85:1226–36.
Commun. 2000;24(1):39–53.
11. Levecke B, Rinaldi L, Charlier J, Maurelli MP,
4. Melaku S, Addis M. Prevalence and Intensity of Bosco A, Vercruysse J, et al. The bias, accuracy
Paramphistomum in Ruminants Slaughtered at and precision of faecal egg count reduction
Debre Zeit Industrial Abattoir, Ethiopia. Vol. 8, test results in cattle using McMaster, Cornell-
Global Veterinaria. 2012. 315–319 p. Wisconsin and FLOTAC egg counting methods.
Vet Parasitol. 2012;188(1–2):194–9.
5. Soulsby EJL. Helminths, arthropods and protozoa
of domesticated animals. Helminths, arthropods 12. Mage C, Bourgne H, Toullieu J-M, Rondelaud D,
protozoa Domest Anim. 1968; Dreyfus G. Fasciola hepatica and Paramphistomum
daubneyi: changes in prevalences of natural
6. Meles DK, S. SA, Juniastuti I, Sahrial, Kurnijasanti
infections in cattle and in Lymnaea truncatula
R. Buku Ajar Farmakoterapi dan Toksikologi.
from central France over the past 12 years. Vet
Global Persada Press. Surabaya: Global Persada
Res. 2002;33(5):439–47.
Press; 2001.
13. Jutting WSSVB. Systematic Studies On The
7. Wapenaar W, Archer SC, Remnant JG, Murphy
Non-Marine Mollusca Of The Indo-Australian
A. Control of infectious diseases in dairy cattle.
Archipelago. A J Zool Indo-Australian Archipel.
2017;
1956;23(2).
8. Shurson GC, Kerr BJ, Hanson AR. Evaluating the
14. Sugama IN, Suyasa IN. Keragaan infeksi parasit
quality of feed fats and oils and their effects on
gastrointestinal pada Sapi Bali model kandang
pig growth performance. J Anim Sci Biotechnol.
simantri. Balai Pengkaj Teknol Pertan Bali. 2011;
2015;6(1):10.
15. Pfukenyi DM, Mukaratirwa S, Willingham AL,
9. Fountas S, Carli G, Sørensen CG, Tsiropoulos
Monrad J. Epidemiological studies of Fasciola
Z, Cavalaris C, Vatsanidou A, et al. Farm
gigantica infections in cattle in the highveld and
management information systems: Current
lowveld communal grazing areas of Zimbabwe.
situation and future perspectives. Comput
Onderstepoort J Vet Res. 2006;73(1):37–51.
Electron Agric. 2015;115:40–50.
The Effectiveness of Cynodon dactylon Leaf Extract as

Hepatoprotector in Liver Damage of Hyperglycemic Mus
musculus
Ade Mahendra Putra1, Retno Sri Wahjuni1, Rahaju Ernawati1

1
Faculty of Veterinary Medicine, Universitas Airlangga, Surabaya, Indonesia
ABSTRACT
Background: The number of people with diabetes rises every day. Its treatment commonly causes significant
side effects that can even cause damage to body organs, including liver. Herbal medicine development
is currently carried out widely as in the Cynodon dactylon plant. C. dactylon plant contains antioxidant
compounds and hepatoprotective effects.
Purpose: The study aims to investigate hepatoprotective effect of C. dactylon leaf extract on liver
histopathological changes of hyperglycemic Mus musculus and to investigate how much the dose of C.
dactylon extract is most effective in protecting the liver.
Method: Experimental animals, M. musculus, were set up in hyperglycemic condition by administrating 10%
glucose with a dose of 2,000 mg/kg of body weight (bw), and administrating extract of C. dactylon leaves
with the doses of 250 mg/kg bw; 500 mg/kg bw; 750 mg/kg bw; and 1,000 mg/kg bw. Then, observation on
the results of M. musculus liver histopathology was conducted by a scoring method. Afterward, a statistical
test was performed.
Result: The most optimal hepatoprotective effect of C. dactylon extract was at the lowest administration
dose of 250 mg/kg bw. This finding was evident from lowest scores for degeneration damage at 6.50 ± 0.00;
necrosis damage at 6.00 ± 0.57; and inflammation rate at 7.13 ± 0.50.
Conclusion: Extract of C. dactylon leaves has a hepatoprotective effect on the liver histopathological
changes of hyperglycemic M. musculus.
Keywords: hepatoprotective effect, C. dactylon leaf extract, liver, hyperglycemia
Introduction insulin resistance. The cost spent on diabetes treatment

is very expensive. The total health budget spent to deal
In 2015, 415 million adults had diabetes. This figure with diabetes was US$ 147 billion for 25.8 million
was a 4-fold increase from 108 million people suffered people affected by diabetes 2.
from diabetes in 1980. In 2013, one of the biggest
burdens of the global health expenditure was diabetes, Hyperglycemia can deteriorate all organs, including
reaching approximately 612 billion dollars 1. Sixty liver. Liver can bind chemicals that enter the body. Liver
percent of diabetics are type 2 diabetics in which insulin cells are the main tissue that becomes target of increasing
is incapable of carrying out its task of reducing blood concentration of free radicals. It occurs because liver is
glucose. This condition is commonly referred to as organ where xenobiotic metabolism induces death of
liver cells 5. Liver also has a central role in metabolism of
toxic substances in the body 6. Up to the present, people
Corresponding Author: with diabetes require lifelong therapy with various
Retno Sri Wahjuni side effects. The application of herbal medicine as an
Faculty of Veterinary Medicine, Universitas Airlangga, alternative is currently being encouraged as it has natural
Surabaya-60115, Indonesia compounds with fewer side effects as a good alternative7.
Email retnowahjuni@yahoo.com C. dactylon contains 12.4% essential oils of triticin,
glycoside, saponin, tannin, flavonoid, and carbohydrate. However, on 13th to 22nd day, the glucose infusion
The contained saponin, tannin, and flavonoid in other was carried out 60 minutes after the present of metformin
herbal plants, so far, are believed to be able to overcome therapy or C. dactylon leaf extract with different doses.
diabetes cases affordably and naturally8. The treatment group 1 (P1) used metformin therapy
amounting to 65 mg/kg bw. P2 used C. dactylon extract
Based on these facts, this study was conducted to therapy at a dose of 250 mg/kg bw. P3 used C. dactylon
investigate the hepatoprotective effect of C. dactylon extract therapy at a dose of 500 mg/kg bw. P4 used C.
leaf extract on liver histopathological changes of dactylon extract therapy at a dose of 750 mg/kg bw. Last,
hyperglycemic M. musculus. This study is also expected P5 used C. dactylon extract therapy at a dose of 1,000
to be able to determine the optimal dose of C. dactylon mg/kg bw.
leaf extract to reduce the impacts of liver tissue damage
of hyperglycemic M. Musculus. Preparation of C. dactylon leaf extract employed
a solid-liquid extraction method with decocta water
solvent. The extract obtained was then diffracted to
separate non-polysaccharide fraction by adding ethanol
This research was conducted in October 2015 at until the precipitation stopped and then filtered to
the Laboratory of the Faculty of Veterinary Medicine, separate the polysaccharide and non-polysaccharide
Universitas Airlangga. components. Filtrate that was extracted from the
results of filtration was a non-polysaccharide fraction
Instruments and Materials: The instruments in this evaporated with a Rotary evaporator to vaporize ethanol
study included 6-7 wire-covered plastic tubs, rat feed, and and aquades solvents until a thick extract was obtained.
drink, microtome, cage, paraffin block casts, tweezers, Thick extract was dried through a freeze-drying method
light microscope, 20 G needles, hot plate, digital scales, so that it became powder extract.
rat feeding tubes, Easy Touch® digital glucometer,
tuberculin syringes, Soxhlet extractor, syringe, freeze Measurements of M. musculus sugar levels
drying extract dryer, surgical scissors, tweezers, blade, utilized the Easy Touch® digital glucometer after the
and scalpel. animals were put to fasting conditions for 6-8 hours.
Measurements were carried out on 7th, 10th, 12th, 19th,
The materials in this study were 2-3 months old and 22nd days. Preparation of hepatic histopathology
BALB-C strain mice (Mus musculus), weighing 20- of M. musculus was carried out through euthanasia of
30 grams, mice feed, mice drinking water, Bermuda cervical dislocation. M. musculus livers were placed in
grass (Cynodon dactylon), 10% glucose, 70% alcohol, a pot containing 10% formalin buffer fixation solution.
96% ethanol, Hematoxylin-eosin (HE) stainer, generic Histopathology was made by Hematoxylin-Eosin (HE)
metformin from Kimia Farma®, tween 80, aquades, staining. Histopathological examination was carried out
label paper, object glass, glass cover, and formalin buffer. by using a microscope at 400x and 1,000x magnifications.
Work Procedures: This study used twenty four M. Scoring of liver histopathology changes that
Musculus animals to be treated for 22 days. They were occurred in each visual field was carried out by using
classified into 6 groups, i.e., hyperglycemic control the scoring method. The degree of damage of each
group without therapy; hyperglycemic control group sample was determined by summing up all determined
with metformin therapy; treatment groups with Cynodon histopathological lesions 9. In scoring method
dactylon extract therapy with the doses of 250 mg/kg assessment, there were three forms of observed lesions,
bw, 500 mg/kg bw, 750 mg/kg bw, and 1,000 mg/kg bw. i.e., degeneration and focal necrosis, periportal and
Environmental adaptation process took the first seven bridging necrosis, and last inflammatory cell infiltration
days. Then, from 8th until 22nd day, the treatment process (inflammation).
was conducted. Research animals were administered
with 10% glucose on the 8th day to the 22nd day at a dose Data Analysis: The data obtained from scoring results
of 2,000 mg/kg to obtain hyperglycemic conditions. P1 of hepatic histopathology were analyzed with Kruskal-
to P5 treatment groups were administered with 10% Wallis test and if there were significant differences
glucose treatment with a dose of 2,000 mg/kg bw from among treatment groups (p <0.05), Mann-Whitney test
8th day to 22nd day. would be applied 10.
Result
Hepatic cell histopathology changes of hyperglycemic M. musculus occurred in the form of degeneration,
necrosis, and inflammation. Scoring results of hepatic histopathology were analyzed with the Kruskal-Wallis test and
then analyzed with the Mann-Whitney test. The results of analysis can be observed in Table 1.
Table 1: The mean and standard deviation scores of degeneration, necrosis, and liver inflammation of M.
musculus for each treatment.
Treatment Mean ± SD
Degeneration Necrosis Inflammation
P0 17.50b ± 0.00 20.50b ± 0.00 21.88ᶜ ± 0.50
P1 10.75ᵃᵇ ± 1.41 20.50b ± 0.00 9.00ᵃ ± 0.00
P2 6.50ᵃ ± 0.00 6.00a ± 0.57 7.13ᵃ ± 0.50
P3 10.75ᵃᵇ ± 1.41 8.00a ± 0.50 7.13ᵃ ± 0.50
P4 12.00ᵃᵇ ± 0.57 10.00a ± 0.00 13.75ᵃᵇ ± 1.15
P5 17.50ᵇ ± 0.00 20.50b ± 0.00 16.13ᵇ ± 1.00
Note: P0 = control, P1 = metformin at a dose of 65 mg/kg bw, P2 = C. dactylon extract at a dose of 250 mg/kg bw, P3
= C. dactylon extract at a dose of 500 mg/kg bw, P4 = C. dactylon extract at a dose of 750 mg/kg bw, P5 = C. dactylon
extract at a dose of 1,000 mg/kg bw. Letter notations stated significant differences (p <0.05) among each treatment.
Same-letter notation means that the difference was not significantly different. Different letter notations mean that the
results were significantly different.
Based on Table 1, test results were significantly different (p <0.05) in all treatments. The lowest score of
degeneration damage was in P2, reaching 6.50 ± 0.00. Highest score result was in P0 and P5 amounting to 17.50 ±
0.00 and 17.50 ± 0.00 respectively. Lowest score of necrosis damage was in P2, reaching 6.00 ± 0.5.
Highest scores of inflammation damage were in P0 and P5, reaching 20.50 ± 0.00 and 20.50 ± 0.00 respectively.
Lowest score was in P2, reaching 7.13 ± 0.50. Highest score was found in P0 with 21.88 ± 0.50. Thus, administering
C. dactylon extract at the dose of 250 mg/kg bw resulted in best hepatoprotective effect. Qualitative hepatoprotective
effects of C. dactylon leave extract can be observed in liver histopathology of M. musculus in every treatment.


Figure 1: Hepatic histopathological description of M. musculus for each treatment. Description: P0 = control,
P1 = metformin at a dose of 65 mg/kg bw, P2 = C. dactylon extract at a dose of 250 mg/kg bw, P3 = C. dactylon
extract at a dose of 500 mg/kg bw, P4 = C. dactylon extract at a dose of 750 mg/kg bw, P5 = C. dactylon extract
at a dose of 1,000 mg/kg bw. a = degeneration damage, b = necrosis damage, c = inflammation.
Based on Figure 1, the liver cells seemed to experience degeneration, necrosis, and inflammatory lesions in P0,
which was the most severe inflammatory lesion among the other treatment groups. The histopathological descriptions
in the P1 shows liver cells experienced degeneration, necrosis, and inflammation but not as severe as in P0 group.
The P2 treatment group with C. dactylon extract therapy was the treatment with the lowest score in the
quantitative test. However, there was still degeneration, necrosis, and inflammation damages in a lower intensity. The
P3 treatment group suggested that the damages in the livers of M. musculus were similar to the P1 treatment group.
The P4 suggested increased damage compared to P1. The liver histopathology of P5 treatment group suggested
severe damage comparable to the liver hyperglycemic of P0 group.
The blood sugar examination levels also suggested an influence on each treatment administered by C. dactylon
extract. The sugar content can be observed in Table 2.
Table 2: The mean and standard deviation of blood sugar levels (mg/dl) for each treatment
Mean + SD
Treatment
7th day 10th day 12th day 19th day 22nd day
P0 60.00 + 12.19 108.25 + 16.33 144.25 + 20.69 139.50 + 32.74 185.00 + 32.74
P1 91.50 + 6.55 133.25 + 30.80 102.50 + 10.75 120.00 + 34.72 113.25 + 25.68
P2 70.75 + 14.99 136.75 + 22.80 119.50 + 26.21 75.50 + 19.97 93.75 + 12.68
P3 76.00 + 20.11 145.00 + 26.91 114.50 + 11.81 128.75 + 34.63 110.00 + 36.79
P4 75.75 + 3.50 134.25 + 6.75 123.75 + 33.64 133.75 + 33.43 120.50 + 23.10
P5 81.25 + 7.67 124.50 + 22.39 140.00 + 17.10 130.25 + 11.84 140.00 + 9.05
Note: P0 = control variable, P1 = metformin at a dose of 65 mg/kg bw, P2 = C. dactylon leaf extract at a dose of 250
mg/kg bw, P3 = C. dactylon extract at a dose of 500 mg/kg bw, P4 = C. Dactylon leaf extract at a dose of 750 mg/kg
bw, P5 = C. dactylon extract at a dose of 1000 mg/kg bw.
Based on Table 2, it was suggested that the general M. musculus’s normal blood sugar content on the 7th day was
normal at less than 100 mg/dL. On the 10th day after 10%, glucose was administered for three days, all M. musculus’s
sugar levels increased at more than 100 mg/dL, meaning that M. musculus had reached hyperglycemia conditions. On
the 19th day, after the treatment with metformin therapy or C. dactylon leaf extract was administered, the P2 treatment
group suggested a drastically decreasing sugar level. On the last treatment day, the 22nd day, only in P2 treatment did
the sugar level decreased to less than 100 mg/dL.
Discussion from the P1 group as the standard drug treatment method

for metformin. Phenolic compounds, such as flavonoids,
The lowest liver histopathological degeneration have free radical scavenger antioxidant activity 17. In this
score was in P2, which was significantly different from
study, the highest inflammatory score was experienced
the control group (P0) and P5 treatment group with C.
in P0 group. This situation caused oxidative stress and
dactylon leaf extract administration at the high dose
increased the levels of Reactive Oxygen Species (ROS),
of 1,000 mg/kg bw. Many liver cells that experienced
which lead to insulin resistance. The hyperglycemia
degeneration could not maintain its balance so that
pathogenic effects were mediated to a significant degree
the damaged cells were irreversible. The prolonged
by increasing the production of ROS. Oxidative damage
disturbances could result in the initial reversible injury
could lead to lipid destruction or even hardening, which
at first. Then, it reached the point of no return phase, and
is the composer of all cell membranes. The destructing
it became irreversible where the cells could not recover
or hardening cells occurs due to lipid peroxidation. It
and experienced death, known as necrosis. The dead cell
causes cell death or the cells inability to get nutrients or
nucleus looks smaller and the chromatin, and reticular
fibers multiply, the nucleus becomes denser, and then the the inability to communicate with other cells properly 18.
cells become eosinophilic (karyolysis) 12. Low dosage of C. dactylon leaf extract at a dose of
The P2 treatment group reached the lowest 250 mg/kg bw was capable of obtaining a hepatoprotective
histopathological necrosis score, and its value was effect and was capable of reducing blood sugar levels to
insignificantly different from P3 and P4 because the its normal values. The blood glucose levels in the mice are
antioxidant composition in C. dactylon was capable classified as hyperglycemic if the mice’s blood glucose
of protecting liver cells. One of the hepatoprotectors levels exceed 125 mg/dL after setting up in fasting
that improves liver function is the antioxidant activity conditions for 6-8 hours. In fasting condition, the mice’s
13
. P5 and P0 groups were significantly different from normal blood glucose levels range from 50-125 mg/dL 19.
the other treatments because both of them regulated the
level of severe damage. P5 group had the highest dose
Conclusion
of C. dactylon leaf extract. It could be analogized with
the optimal dose of drug consumption. The dosage curve C. dactylon leaf extract has the potential to be a
and effect had the sigmoid-shaped, so if the administered hepatoprotector against hyperglycemic mice’s liver. The
dose were more than the maximum limit, it would
effective dosage of C. dactylon as a hepatoprotector is at
decrease the drug function 14. This fact was similar to C.
a dose of 250 mg/kg bw.
dactylon dosage, where if the dosage were more than it
should be, it would reduce the hepatoprotective effect. Further research is required to investigate the effect
According to the histopathology score, the lowest of administering C. dactylon leaf extract towards the
degeneration score and necrosis score were experienced levels of ROS (Reactive Oxygen Species) and other
by the P2 group. The hepatoprotective plant compounds, organs in the hyperglycemic M. musculus.
including flavonoids, can protect the liver cells and
Ethical Clearance: The research process was using
repair the damaged liver tissue 15. Quercetin contained in
experimental method that was accordant with the ethical
flavonoid extract of C. dactylon leaves is predicted to be
capable of preventing liver damage through its activity research principle based on the regulation of research
in suppressing TNF-α production as a hepatotoxic ethic committee. The present study was carried out in
mediator and increasing the production of IL-10 as a accordance with the research principles. This study
hepatoprotective mediator. Thus, TNF-α activity can implemented the basic principle ethics of respect,
reduce the spurring of inflammation or damage to the beneficence, non-maleficence, and justice for animal.
liver tissue. The increasing production of IL-10 by
quercetin can prevent the liver from being damaged due Conflict of Interest: The author reports no conflict of
to glucose induction 16. interest of this work.
The lowest liver histopathological inflammatory Source of Funding: This study is done with individual
scores in P2 and P3 groups were not significantly different funding.
References 11. Rippey JJ. Illustrated Lecture Notes: General

Pathology. Witwatersrand University Press; 1994.
1. WHO. Diabetes-Facts-and-Numbers-
Indonesian.; 2016. 12. Kasno PA. Patologi hati dan saluran empedu
ekstra hepatik. Semarang Badan Penerbit Univ
2.
Association AD. Standards of medical
Diponegoro. 2008;9.
care in diabetes—2011. Diabetes Care.
2011;34(Supplement 1):S11-S61. 13. Dandagi PM, Patil MB, Mastiholimath VS, Gadad
AP, Dhumansure RH. Development and evaluation
3. McGavin MD, Zachary JF. Pathological Basis of
of hepatoprotective polyherbal formulation
Veterinary Disease. Mosby Elsevier; 2007.
containing some indigenous medicinal plants.
4. Lorenz MD, Cornelius LM, Ferguson DC. Small Indian J Pharm Sci. 2008;70(2):265.
Animal Medical Therapeutics. JB Lippincott Co.;
14. Mycek MJ. Obat-obat Antiinflamasi dan Autakoid.
1992.
Dalam: Harvey RA, Champe PC. Farmakol Ulas
5. Prayitno J. Efek Pemberian Tablet Effervescent Bergambar. 1997.
Kombinasi Ekstrak Etanol Daun Dewanbaru
15. Dalimartha S. Ramuan Tradisional Untuk
(Eugenia uniflora L) dan Sambiloto (Andrographis
Pengobatan Hepatitis. Penebar Swadaya; 1997.
paniculata [Burm. f.] Ness) Terhadap Fungsi Hati
Pada Tikus yang Dibebani Glukosa. 2009. 16. Khofiyah SN, Azmijah A, Iman ERS. Efek
Pemberian Ekstrak Ethanol Daun Kenikir (Cosmos
6. Fawcett DW. Buku ajar histologi. Jakarta EGC.
caudatus) Terhadap Gambaran Histopatologis
2002;202:583-597.
Hepar pada Mencit (Mus musculus) Balb/C
7.
WHO. Traditional medicine Report by the Jantan yang Diinduksi Parasetamol The Effect
Secretariat GLOBAL SITUATION. Fifty-sixth of Cosmos Caudatus Leaf Ethanol Extract on
World Heal Assem. 2003;(March):14-17. Paracetamol Induced in Histopath. Veterinaria.
8. Avvarai SK, Kattamanchi G, Doni K, Anugu MR, 2014;7(2).
Raju C. Antidiabetic activity of ethanolic extract 17. Gülçin I, UĞUZ MT, Oktay M, Beydemir
of Cynodon dactylon root stalks in streptozotocin Ş, KÜFREVİOĞLU Öİ. Evaluation of the
induced diabetic rats. Int J Adv Pharm Res. antioxidant and antimicrobial activities of clary
2011;2(8):418-422. sage (Salvia sclarea L.). Turkish J Agric For.
9. Knodell RG, Ishak KG, Black WC, et al. 2004;28(1):25-33.
Formulation and application of a numerical 18. Sen S, Chakraborty R, Sridhar C, Reddy YSR,
scoring system for assessing histological activity De B. Free radicals, antioxidants, diseases
in asymptomatic chronic active hepatitis. and phytomedicines: current status and future
Hepatology. 1981;1(5):431-435. prospect. Int J Pharm Sci Rev Res. 2010;3(1):91-
10. Daniel WW. Statistika nonparametrik terapan. 100.
Jakarta PT Gramedia. 1989:25-31. 19. Kohn DF, Clifford CB. Biology and diseases of
rats. Lab Anim Med. 2002;2:121-167.
The Relationship between the Forms of Social Interactions and

the Life Quality of the Elderly
Muthmainnah1, Elida Ulfiana1, Setho Hadisuyatmana1

1
Faculty of Nursing, Universitas Airlangga, Surabaya, Jawa Timur
Abstract
Background: The decreasing social interactions in the elderly can make them feel isolated. Some of them
feel lonely and experience social isolation and stress, which can affect the quality of life of the elderly.
Purpose: This research aims to analyze the relationship between social interactions, the quality of life of the
elderly, and the forms of the social interactions.
Method: This research is a cross sectional study with the population of elders living in Nursing Home. Fifteen
respondents were recruited using total sampling technique. Social interaction is used as an independent
variable and quality of life is the dependent variable. Research data were obtained using a questionnaire and
analyzed using Spearman Rho with a significance level of p <0.05.
Results: The results indicate that there is no significant relationship between social interaction and quality
of life in the elderly (p = 0.760).
Conclusion: Social interactions in nursing homes do not have a correlation with the quality of life in the
elderly who live in the nursing homes. Other variables that influence social interactions in nursing homes
need to be examined. Nurses must maintain social interactions by improving some activities for better
quality of life.
Keywords: Social Interaction, Quality of Life, Elderly
Introduction of elderly people in Indonesia is estimated to be around

34.22 million(4). The increasing number reflects the
In Indonesia, the elderly population grows more success of the Government in improving the welfare and
rapidly compared to other age groups. The rapid growth life expectancy of the community. The Central Bureau
has occurred since 2013 at 8.9% and 13.4% in the world of Statistics (BPS) stated that life expectancy within the
(1)
. Three provinces have the highest percentage of the period of 1995-2000 was 66.0 years; within the period
elderly population compared to the other provinces, of 2000-2005 was 67.8 years; within the period of 2005-
which are DI Yogyakarta (13.81%), Central Java 2010 was 69.1 years; and within the period of 2010
(12.59), and East Java (12.25%) (2). It is estimated that -2015 was 70.1 years.
the elderly population in Indonesia will continue to grow
by around 450,000 people per year. In 2017, there were This increasing number of the elderly poses quality
around 23.4 million elders in Indonesia, or 8.97% of the of life problem. At the moment, there are many families
total population. Most of the elderly were women with that decide to leave the elderly in nursing homes. Thus,
a percentage of 52% (3). Therefore, in 2025, the number in the future, the nursing homes play an important
role in maintaining and improving the quality of life
of the elderly. This is not necessarily acceptable to the
Corresponding Author: elderly and can make them feel abandoned, ignored and
Elida Ulfiana lonely(5). World Health Organization defines quality of
Faculty of Nursing, Universitas Airlangga, 60115, life as an individual’s perception of life in the society in
Surabaya, Jawa Timur the context of existing culture and value systems related
Email: Elidaulfiana@yahoo.com to goals, expectations, standards and concerns (6). Some
previous studies have shown how social interactions Research Variables: The independent variable in
affect the quality of life of the elderly. this study is the forms of social interactions while the
dependent variable is the quality of life of the elderly.
The first study indicated that 10% of the elderly
in the community had poor interactions, 76% had Research Instrument: This research employed
moderate interactions and 15% had good interactions three types of questionnaires. The first type was the
(7)
. The second study showed that the percentage of the demographic questionnaire containing such data as
elderly with less social interaction who experienced number of respondents, gender, age, religion, ethnicity,
severe depression was 71.4%, while the percentage recent education, period of living in nursing homes,
of the elderly with moderate social interaction who daily activities to spare time. The second questionnaire
experienced severe depression was 31.4%, and the focused on the form of social interactions which was
percentage of the elderly with good social interactions adopted from the social interaction questionnaire (12)
who experienced major depression was 12.5% (8). This with a total of 20 questions and 5 questions in each
shows that the better the elderly in social interactions, form of social interaction. The last was World Health
the less likely they experience major depression. Social Organization-Quality of Life-BREF (WHOQOL-BREF)
interaction can also affect the psychological condition quality of life questionnaire (13).
of the elderly (9)(10). The better the social interaction, the
better the psychological condition of the elderly is, and Data Analysis: The data analyzed using the spearman
this affects the quality of life of the elderly. rho test and All statistical tests used a significance level
of α = 0.05 (SPSS 20 windows program).
This study aims to provide insights into how social
interactions affect the quality of life of the elderly living Results
in nursing homes. It focuses on examining the forms of
social interactions that can affect the quality of life of the Demographic Characteristics of the Respondents:
elderly in Indonesia. The samples of this research were 15 respondents. The
demographic characteristics of the respondents were
Method female aged 60-69 years old (33.3%), 70-79 years old
(33.3%) and above 80 years old (33.3%). All respondents
Design: This study employed the Cross Sectional were Christians and most of them were Javanese (80%).
approach which emphasizes the moment of measurement In terms of education background, almost half of the
or observation of independent and dependent variables respondents did not have any education background
at one time. In this research, the independent and (46.6%). Based on the period of living in the nursing
dependent variables were assessed simultaneously at home, 13 elders (86.6%) have lived in the nursing home
one time; so, there was no follow-up data measurement for 0-5 years and all of the elderly did not work.
(11)
. This research was conducted at Anugerah Nursing
Home, Surabaya from May to June 2016. Forms of Social Interactions: Social interactions
have several forms in social situations. The forms are
Sample and Sampling: The samples of this study were cooperation, competition, conflict and accommodation
15 elders who met the criteria. The sampling technique (14)
. Data on the forms of social interactions are presented
used was total sampling. in the following table.
Table 1: The Forms of Social Interaction in Anugerah Nursing Home from May to June 2016
Respondent Code Cooperation Competition Conflict Accomodation Dominant Value

1 20 14 11 19 Kode 1
2 20 11 11 16 Kode 1
3 14 12 13 18 Kode 4
4 22 13 10 20 Kode 1
5 20 9 9 21 Kode 4
6 15 9 10 16 Kode 4
7 18 9 8 19 Kode 4
8 17 9 10 16 Kode 1
9 21 14 14 16 Kode 1
10 13 9 9 17 Kode 4
11 17 13 8 20 Kode 4
12 17 20 12 15 Kode 2
13 14 8 5 19 Kode 4
14 14 15 8 20 Kode 4
15 17 12 9 16 Kode 1
Table 2: Respondent Distribution based on Research Variables, May-June 2016
Variable Category Total Percentage

Cooperation 6 40%
Competition 1 6.7%
Form of Social Interaction Conflict 0 0%
Accomodation 8 5.3%
Total 15 100%
Table 2 indicates that the highest value is code 4, nursing home. Most of the activities in the nursing home
which is accommodation with a total of 8 respondents are spiritual activities such as praying in the morning
or 53.3%. and evening. Spiritual activities are considered sufficient
to meet the needs of the elderly because the higher the
Quality of Life of the Elderly: The quality of life religiosity level of a person, the person will be happier,
of the elderly is measured from several aspects: and might have better mental and physical conditions (15).
health, psychological condition, social relation, and
the environment. The life quality of the elderly in the Forms of Social Interactions: The most dominant form
nursing home is generally moderate (13 respondents or of social interactions is accommodation. Most of the
80%) while the rest of the elderly have good quality of elderly living in the nursing home are Javanese. Based
life. The analysis on the correlation between the forms on the anthropology of Javanese, the Javanese culture
of social interactions and the quality of life of the elderly is seen as elastic. The elasticity of the culture refers to
conducted based on the Spearman’s rho test generated flexibility in overcoming problems or inputs from the
a correlation value of 0.760 and a p-value of 0.86. This social environment. This suggests that Javanese people
indicates that there is no significant relationship between and Javanese culture have the ability to continuously
the forms of social interactions and the quality of life of adapt to challenges and changes (16).
the elderly living in Anugerah nursing home. The ability of the elderly to continuously establish
social interactions is the key to maintaining their social
Discussion status based on their ability to interact (17). Good social
interactions allow the elderly to get a feeling of having
The results of this study are different from those of a group in which they can share stories, interests, and
previous studies focusing on the relationship between concerns. They also have opportunities to do various
social interactions and the quality of life of the elderly. activities together (12). The nursing home will become
This study reveals that at the nursing home, social a place for the development of social interactions,
interaction does not have a significant relationship with because they will live together with fellow elderly
the quality of life of the elderly. This is related to the people. Besides that, at the nursing home, they will
low number of activities which can facilitate social receive trainings aimed at empowering them to remain
interactions between elders living in the nursing home. productive. Physical and health development of the
This might be due to the lack of health workers in the elderly will be effectively monitored (18).
In this study, social interactions refer to spiritual socially active are more likely to adjust to aging well
needs which provides comfort and peace. Based on the . Social interaction is the key to carrying out social
(22)
social theory, nurses should be able to facilitate social activities. If the elderly are active in social activities,
interactions among the elderly by holding discussions, they will have high enthusiasm and life satisfaction as
exchange of ideas, and telling stories related to well as more positive mental health compared to those
spirituality. Nurses must be able to provide inner peace who are less active. Theory of activity states that in order
in the religion which the elderly follow, especially if for the elderly to succeed, they must remain socially
the elderly are sick or dying. Providing opportunities active. The older a person is, the more active he or she
for the elderly to gather with fellow elderly people should maintain social relations, both physically and
means creating interactions for the elderly. In the emotionally (23). The life satisfaction of the elderly is
implementation, nurses can create social relations among very dependent on the continuity of their involvement in
the elderly, as well as between the elderly and the nurses various activities (Latrancois 1984). This theory supports
themselves. The nurses should provide opportunities for the elderly who are still active in various activities. The
the elderly to interact. elderly will get satisfaction if they are still involved in
various social activities (24).
Quality of Life of the Elderly: The quality of life of the
elderly in Anugerah Nursing Home is at moderate level. This study shows that the elderly in Anugerah
Quality of life is a measure of happiness; it comprises five Nursing Home have moderate and good quality of life
aspects, which are feeling happy with daily activities, because they can accept their conditions. They pray do
considering life meaningful and accepting life, feeling some activities with their abilities. They also feel happy
successful in achieving goals, having a positive self- and enjoy their time. In line with the role of nurses in
image, and having an optimistic attitude and a good providing excellent service through Teach and Support
mood (19). Quality of life refers to individuals’ emotional, caregivers, nurses can facilitate social interactions
social and physical well-being as well as their ability to among the elderly by holding discussions, exchanging
function in daily life (20). The quality of life of the elderly ideas, and telling stories related to spirituality so that
is influenced by several factors, which are the ability interactions between the elderly occur. This is one of the
to adapt and accept all changes and setbacks, and the efforts in carrying out social approach. Nurses must be
appreciation and reasonable treatment from the elderly’s able to provide inner peace in their relationship with God
social environment (21). or in the religion they follow, especially if the elderly
are sick or dying. Providing opportunities to gather with
The decreasing quality of life is related to fellow elders means creating interactions for the elderly
physiological diseases among the elderly, such as stroke so that they can improve their quality of life and enjoy
and diabetes mellitus. Nursing is a holistic science which the atmosphere of the nursing home.
studies individuals from various aspects of life, including
physiological, psychological, social, and spiritual Other studies in line with this study also conclude
aspects. Understanding the effect of social environment that there is no meaningful relationship between social
on health is important to help implement appropriate interactions and the quality of life of the elderly at
nursing care. Data on the quality of life of the elderly Abiyoso Paken Nursing Home (25). The researchers
in various social settings can be used as an evaluation believe that each individual will have different social
material for determining empowerment programs for the interactions that can affect the quality of life of the
elderly, so that the program can effectively improve the elderly. The results of this study are limited only to
quality of life of the elderly. female respondents and the number of samples. Because
the research subjects were all women, the results could
The Relationship between the Forms of Social not be generalized to all of the elderly population.
Interactions and the Quality of Life of the Elderly
in Anugerah Nursing Home: The forms of social
Conclusion
interactions and the quality of life of the elderly at
Anugerah Nursing Home are not significant in this In conclusion, the social interactions that occur in the
study. The results of this study are in contrast with nursing home do not always have a significant influence
Lemon’s (2009) theory which states that elders who are on the quality of life of the elderly. However, there are
several aspects which can affect the quality of life of the bps.go.id/publication/download.html ?nrbvfeve
elderly, such as the psychological aspect of the elderly = YmVjYjNjM GZhMm RiZWM0YWY3
accepting their current situation. This does not have a YTI0NDMw & xzmn = aHR0 cHM6 Ly93d3
significant effect on the quality of life of the elderly in cuYnBzLmdvLmlkL3 B1YmxpY2 F0aW9
nursing homes. In addition, nursing homes can improve uLzIwMTMv MDMvMDUvYm VjYjNjMGZh
social activities based on the needs of the elderly living MmRiZWM0 YWY3 YTI0NDMwL3 BlbmR1
in the nursing homes. ZHVrLWluZG9 uZXNpYS1oYXNpbC1zcC0
yMDEwLmh0bWw%3D & twoadfnoarfea
Ethical Clearance: The current study was carried
out in correspondence with the research principles. It 5. Yang Y-Y, Lee F-P. [Concept analysis of feelings
is implemented the basic principle ethics of respect, of loss among elderly nursing home residents].
beneficence, non-maleficence, and justice. The research Hu Li Za Zhi [Internet]. 2012 Aug [cited 2019 Feb
process entangles participants in the survey using a 20];59(4):99–104. Available from: http://www.
compatible questionnaire that was in accordance with ncbi.nlm.nih.gov/pubmed/22851400
the ethical research principle based on the research 6. Pucci G, Reis RS, Rech CR, Hallal PC. Quality
ethics committee’s regulation. of life and physical activity among adults:
population-based study in Brazilian adults. Qual
Conflict of Interest: The author reports no conflict of
Life Res. 2012;21(9):1537–43.
7. Kusumowardani A, Puspitosari A. Hubungan
Source of Funding: This study is completed with Antara Tingkat Depresi Lansia Dengan Interaksi
individual funding. Sosial Lansia Di Desa Sobokerto Kecamatan
Ngemplak Boyolali. Interes J Ilmu Kesehat.
References 2014;3(2).
1.
Kementerian Kesehatan Republik Indonesia, 8.
Sehanto. Hubungan Interaksi Sosial Dengan
RI KK. Riset Kesehatan Dasar (RISKESDAS). Tingkat Depresi Pada Lanjut Usia Di Desa
Jakarta: Badan Penelitian dan Pengembangan Leyangan. STIKES Ngudi Waluyo Ungaran;
Kesehatan, Departemen Kesehatan. Republik 2013.
Indonesia. 2013.
9. Rantepadang A. Interaksi sosial dan kualitas
2. Kementrian Kesehatan RI. Analisis lansia di hidup lansia di Kelurahan Lansot Kecamatan
Indonesia. Jakarta Pus Data dan Inf Kementeri Tomohon Selatan. J Interak Sos Dan Kualitas
Kesehat RI. 2017; Hidup. 2012;1(1):63–80.
3. Badan Pusat Statistik. Statistik Penduduk Lanjut 10. Widodo G, Aniroh U. Hubungan Interaksi Sosial
Usia 2017 [Internet]. Jakarta: Badan Pusat Statistik; Dengan Tingkat Depresi Pada Lanjut Usia di
2017 [cited 2019 Apr 24]. xxvii + 258. Available Desa Leyangan Kecamatan Ungaran Timur
from: https://www.bps.go.id/publication/ Kabupaten Semarang. STIKES Ngudi Waluyo
download.html?nrbvfeve = N 2ExMzBhMjJhYTI Ung Semarang. 2011;
5Y2M 4MjE 5YzVkMTUz & xzmn = aHR0cHM
11.
Nursalam S. Metodologi Penelitian Ilmu
6Ly93d3 cuYnBzLmdvLmlkL3 B1YmxpY2F
Keperawatan Pendekatan Praktis. Jakarta Salemba
0aW9 uLzIwMTgv MDQvMTMvN2
Med. 2013;
ExMzBhMjJhYTI5 Y2M4MjE5 YzVkMTUzL3
N0YXRpc3 Rpay1 wZW5 kdWR1 ay1sYW5 12. Sanjaya A, Rusdi I. Hubungan Interaksi Sosial
qdXQtdXNpYS0 yMDE 3Lmh0bWw% 3D & dengan Kesepian pada Lansia. Medan Fak
twoadfnoa Keperawatan Univ Sumatera Utara. 2012;
4. Badan Pusat Statistik. Penduduk Indonesia: Hasil 13. Organization WH. The world health organization
Sensus Penduduk 2010 [Internet]. 2012 [cited quality of life (WHOQOL)-BREF. World Health
2019 Feb 19]. Available from: https://www. Organization; 2004.
14. Santoso S. Teori-teori psikologi sosial. Bandung: 20. Donald A. What is quality of life? Hayward
Refika Aditama. 2010; Medical Communications; 1998.
15.
Abdel-Khalek AM. Happiness, health, and 21. Kuntjoro ZS. Dukungan sosial pada lansia.
religiosity: Significant relations. Ment Health Diperoleh dari http//www e-psikologi com/epsi/
Relig Cult. 2006;9(1):85–97. artikel. 2002;
16. Darmina. Interaksi Sosial Masyarakat Jawa dan 22. Potter PA, Perry AG. Buku ajar fundamental
Masyarakat Tolaki di Desa Langgea. Universitas keperawatan: konsep, proses, dan praktik. Jakarta
Gadjah Mada; 2002. Egc. 2005;1.
17. Noorkasiani ST. Kesehatan usia lanjut dengan 23. Neugarten BL. Personality change in late life: A
pendekatan asuhan keperawatan. Salemba Med developmental perspective. 1973;
Jakarta. 2009;
24. Suardiman SP. Psikologi: usia lanjut. Gadjah
18.
Putri ST, Fitriana LA, Ningrum A. Studi Mada University Press; 2011.
Komparatif: Kualitas hidup lansia yang
25. Oktavia AR. Hubungan Antara Bentuk Interaksi
tinggal bersama keluarga dan panti. J Pendidik
Sosial Dengan Kualitas Hidup Lansia Di PSTW
Keperawatan Indones. 2015;1(1):1–6.
Abiyoso Pakem Yogyakarta. UGM, Yogyakarta
19. Fauziah. Quality Of Life Of Acute Coronary Skripsi, tidak dipublikasikan. 2009;
Syndrome. J South Arricultural Educ Res.
2010;(51).
Educational Game Methods of Attaching Images to Slide

Calendar towards School-Age Children’s Knowledge and
Attitudes on Choosing Healthy Snacks
Adzan Fachrurrozi1, Tiyas Kusumaningrum1, Praba Diyan Rachmawati1

Faculty of Nursing, Universitas Airlangga, Mulyorejo Street, Surabaya, East Java, Indonesia
1
ABSTRACT
Introduction: There are several problems of fulfilling nutrition that disrupts health, growth, and development
in children. There is no knowledge in children that resulting they consume unhealthy snacks. The purpose
of this study was to determine the effect of educational game methods of attaching images to slide calendar
towards school-age children’s knowledge and attitudes on choosing healthy snacks.
Method: This study was a quantitative study design with quasi experiment approach. There were 47
respondents selected in the treatment group and the control group, by using the method of educational
game tools towards their knowledge and attitudes. The instruments used in this study were educational tools
of attaching images to slide calendar and a modified questionnaire about attitudes and knowledge. Data
analysis used the Mann Whitney test and the Wilcoxon signed rank test.
Results: The results showed there was a significant difference (p≤ 0.05) in the level of knowledge between
the treatment and control groups after treatment. Whereas the attitude between the treatment and control
groups after treatment resulted no significant difference (p≥ 0.05).
Conclusion: The educational tools methods of attaching images to slide calendar had an influence on
increasing the knowledge of choosing healthy snacks in school-age children. Children did not experience
changes in attitude of choosing healthy snacks, but children would increase their knowledge with the method
of attaching images to slide calendar.
Keywords: paste the slide image calendar, knowledge, attitude, healthy snacks
Introduction Prevalence of children aged 6 to 11 years who

experience a problem of nutrients exceeds in the United
Children often do not have much knowledge, States as much as 7% then increased to 13% in the
especially related to healthy foods selection1. Children’s following year2. In addition to nutrients exceeds, another
eating patterns give a strong influence on their health, problem that found is food poisoning. According to the
especially in their growth and intellectual development2. Indonesian food and drug supervisory agency, known as
There are many cases that children experience allergies Badan Pengawas Obat dan Makanan (BPOM) data in
to foods, so that it is necessary to choose the right food 2014, showed that schools are ranked second (28.9%)
for children3. The mistake in food selection can cause a after residence (59.25%) in the most common places
variety of health problems such as anemia, obesity, and where the food poisoning cases found in Indonesia.
other nutritional disorders2. Surveillance data on food poisoning in East Java,
Indonesia, is still very high from year to year. In 2013,
the number of outbreaks reached 60 incidences of food
Correspondence Author: poisoning with 1,106 cases and the number of case
Tiyas Kusumaningrum fatality rates (CFR) of 0.27%4.
Faculty of Nursing, Universitas Airlangga,
Mulyorejo Street, Surabaya, East Java, Indonesia 60115 The results of preliminary data collection on
Email: tiyaskusuma41@gmail.com students’ knowledge and attitudes about a healthy
snacks selection in two elementary schools, namely slide calendar on changes in knowledge and attitudes
Sumbersekar I and SDN Mulyoagung II, found that the about the healthy snacks selection in school-age
knowledge and attitudes of fourth grade students were children. Some of the research instruments used in this
still poor. Schools only overcome the problems by using study were the attaching images to slide calendar and
posters about healthy snacks and providing a canteen modified questionnaire about knowledge and attitudes.
with a healthy environment but still unable to increase Attaching images to slide calendar game was made
the student’s awareness. There are still many students from modified images and used calendars. Images
who often experience nutritional disorders such as are presented by relating to the healthy snacks, which
vomiting, stomach ache, or diarrhea. consists of the definition of snacks, types of snacks,
characteristics of snacks, the positive or negative effects
Children tend to like to consume random and of snacks, sanitation and safety of snacks, and also
unhealthy snacks, and not often occur dental caries5. the foodborne illnesses. When implementing health
Children can recognize a variety of snacks that sold education by attaching an image to slide calendar,
in schools by buying snacks. Snacks can contribute to the researcher used the event program unit. The data
36% energy intake for school children, 29% protein, and obtained were processed and analyzed using the SPSS
52% iron. Therefore, snacks have an important role in for Windows 21 software. Statistical analysis used in this
the growth and learning achievement of school children. study were the Mann Whitney test analysis to compare
According to Food and Agriculture Organization (FAO) between the control group and the treatment group. then
in 2008, food or drinks sold by the street vendors are sold it was continued with the Wilcoxon signed rank test
without proper preparation and processing7. Snacks for analysis to determine the difference between before and
children who are less nutritious will disrupt the child’s after treatment.
learning process.
Results
Environment and society will shape children’s
The results of this research related to the educational
behavior and activities8. One of places that can be used game method of attaching images to slide calendar
as a media for promoting health nutrition for children is towards the knowledge and attitudes about the healthy
school2,8. Almost half a day spent by children at school, snacks selection in school-age children were explained
they also spend their breakfast and lunch time at school2. through demographic characteristics. General data
Schools are the right medium for developing children describes the demographic characteristics of respondents
to improve the children’s knowledge and attitudes. This including (1) age and sex, (2) number of siblings, (3)
study aimed to determine the effectiveness of educational father’s education, (4) mother’s education, (5) father’s
game methods of attaching images to slide calendar work, (6) mother’s work, (7) parents’s income, (8)
towards knowledge and attitudes about the selection of breakfast, (9) information about healthy snacks, and
healthy snacks for school-age children. (10) sources of information, for more details here is a
following table of demographic respondents:
Method
Table 1: Demographics of Respondents in the
This study used a quasy experimental design, treatment and control groups
which try to reveal a causal relationship by involving
a control group in addition to the experimental group. Treatment Control
Paramater
The selection of these two groups did not use random n % n %
techniques9,10. Age
9 years 16 67 15 65
Population in this study were all elementary
10 years 7 29 7 30
schools in the Dau Malang region which were reachable
populations, namely all students in SDN Sumbersekar I 11 years 1 4 1 4
and SDN Mulyoagung II. The inclusion and exclusion Total 24 10 23 100
criteria were determined, so that 47 respondents were Gender
obtained for the treatment and control groups9. Man 11 46 6 26
This study aimed to determine the effect of a Woman 13 54 17 74
educational game tools methods of attaching images to Total 24 10 23 100
Conted… Conted…
Number of siblings Parents’s income

No sibling 4 17 1 4 < The Regional
15 63 16 70
1 sibling 12 50 7 30 Minimum Wage
> The Regional
2 siblings 8 33 7 30 9 38 7 30
Minimum Wage
>2 siblings 0 0 8 35
Total 24 10 23 100
Total 24 10 23 100 Breakfast
Father’s education Yes 19 79 20 87
Elementary school 8 33 4 17 No 5 21 3 13
Junior high school 6 25 6 26 Total 24 10 23 100
Senior high school 10 42 10 43 Information of healthy snacks
Undergraduate 0 0 3 13 Yes 13 54 22 96
Total 24 10 23 100 Never 11 46 1 4
Mother’s education Total 24 10 23 100
Source of information about healthy snacks
Elementary school 3 13 5 22
Never get the
Junior high school 5 21 6 26 11 46 0 0
information
Senior high school 12 50 9 39 Parents 3 33 8 35
Undergraduate 3 13 3 13 Teacher 0 0 14 61
Others (Postgraduate) 1 4 0 0 Electronic media 5 21 0 0
Total 24 10 23 100 Friend 0 0 1 4
Father’s occupation Total 24 10 23 100
Employee 2 8 3 13
The results shown in the treatment group and
Entrepreneur 5 21 5 22 the control group were mostly 9 years old. Most of
Others 17 71 15 65 respondents in both treatment group and control group
Total 24 10 23 100 had a breakfast habits. Most of respondents in the
Mother’s occupation treatment group had received information related to
Employee 1 4 4 17 healthy snacks with sources of information from their
parents. While the entire respondents in the control
Entrepreneur 7 29 3 13
group had received information about healthy snacks
Others 16 67 16 70 and the information sources mostly obtained from the
Total 24 10 23 100 school teachers.
Table 2: Distribution of respondents based on knowledge about the healthy snacks selection in the treatment
and control groups
Treatment group Control group

Pre Post Pre Post
Variable Category f % f % f % f %
Good 3 12 12 50 2 9 1 5
Knowledge levels Fair 9 38 12 50 10 43 12 52
Poor 12 50 0 0 11 48 10 43
Total 24 100 24 100 23 100 23 100
Wilcoxon Test p = 0.000 p = 1.000
Mann-Whitney Test Pretest p = 1.000
Mann-Whitney Test Posttest p = 0.000
The results of the Wilcoxon test analysis in the treatment group showed a p value = 0.000 so that p ≤ 0.05, which
means there was a significant difference in the level of knowledge in pre test and post test. While the results of the
Mann Whitney test analysis at post test showed a p value = 0.000, so that p ≤ α ≤ 0.05, which means that there was
a significant difference in the level of knowledge between the treatment and control groups after the intervention.
This proved that health education with educational game tools of attaching images to slide calendar had a significant
influence on the level of children’s knowledge in the healthy snacks selection.
Table 3: Distribution of respondents based on attitudes about choosing healthy snacks in the treatment and
control groups
Treatment group Control group

Post Pre Post Pre
Variable Category f % f % f % f %
Positive 6 25 10 42 5 22 5 22
Attitudes
Negative 18 75 14 58 18 78 18 78
Total 24 100 24 100 23 100 23 100
Wilcoxon Test p = 0,102 p = 0,655
Mann-Whitney Test Pretest p = 0,933
Mann-Whitney Test Posttest p = 0,147
The results of the Wilcoxon test and the Mann as many as 16 respondents. The average income of the
Whitney test in the treatment group and the control respondents’ parents is below the regional minimum
group obtained p values p ≥ α ≥ 0.05, which means there wage standard of Malang city. Respondents’ parents who
were no significant differences in attitude levels during have a low economy often have a difficulty in reaching
pre-test and post-test. This proved that health education the healthy food. Many children who have a high BMI
with educational game tools of attaching images to slide due to parent’s inability to provide proper food14.
calendar did not have a significant effect on the level of
children’s attitudes in the healthy snacks selection. Educational game methods of attaching images
to slide calendar was effective enough to improve
the children’s knowledge level. Previous studies on
Discussion
an educational program attracted the attention of the
Before being given a health education with the children so that children easily apply with the things
educational game tools of attaching images to a slide they learned15. Children tend to be interested in a creative
calendar, most of the respondents in the treatment learning system that contains elements of education. An
group had a poor knowledge about healthy snacks. activity in the form of a game that contains education
After intervention in a period of one day to one week, will be easy for children to absorb. The creative health
then post test was performed11. Age affects person’s education program is also able to control the eating
perception and mindset. An increase in age will also habits of the overweight children16.
develop the ability to capture the information and
mindset, so that the knowledge gained is getting better12. Educational game tools used in the learning activity
Based on this theory, changes in knowledge can occur provide an optimal function in children’s development,
because the respondents in this study were 4th graders where children can develop physical abilities, language,
who aged 9 to 11 years. Children aged 9-11 years was in cognitive abilities, and social adaptation through this
the developmental stage that have entered an operational game18,19. One educational game tool is attaching images
concrete stage where children are able to think logically, to slide calendar. This game has 3 stages process that
make sense, and increasingly socialized13. This resulted can increase children’s knowledge, the first stage is
in an increase in the post test in the treatment group. the learning process (entering information obtained
The economic status of the respondents’ parents in into memory), the second stage is the retention process
the treatment group was mostly in a low condition, which (storing information obtained), and the third stage is
the recall process (recall information obtained). So 2. Wechsler H, Brener ND, Kuester S, Miller C.
that someone is expected to be able to improve his/her Food service and foods and beverages available
understanding of information and remember information at school: results from the School Health Policies
obtained. Health education with educational game tools and Programs Study 2000. Journal of School
of attaching images to slide calendar is used as a method Health. 2001;71(7):313–24.
of health promotion to increase a knowledge level about
3. Roesler TA, Barry PC, Bock SA. Factitious food
the healthy snacks selection.
allergy and failure to thrive. Archives of pediatrics
This study showed there was no improvement & adolescent medicine. 1994;148(11):1150–5.
attitudes because respondents did not meet the level 4. Jatim D. Profil Kesehatan Provinsi Jawa Timur
of attitudes which included receiving, responding, Tahun 2012. Surabaya: Dinkes Jatim. 2012;
respecting, and being responsible which took time in
the process. This can caused by when the intevention of 5. Holm A, Blomquist HK son, Crossner C, Grahnén
health education with educational game tools was given, H, Samuelson G. A comparative study of oral
there were some male students who are not paying health as related to general health, food habits
attention when the researcher gave an explanation, so and socioeconomic conditions of 4‐year‐old
that disturbed other students to concentrate on receiving Swedish children. Community dentistry and oral
the information. According to Gurian (2010) most boys epidemiology. 1975;3(1):34–9.
are very active and unable to calm down while studying 6. Pei-Lin H. Factors influencing students’ decisions
so they have more difficulty in concentrating than girls20. to choose healthy or unhealthy snacks at the
University of Newcastle, Australia. The journal of
Conclusion nursing research: JNR. 2004;12(2):83–91.
The method of educational tools of attaching 7.

FOODS MHIN. Food and Agriculture
images to slide calendar had an effect on increasing the organization of the United Nations. A framework
knowledge level in school-age children regarding the for land evaluation Soils Bulletin. 2008;32.
healthy snacks selection. Respondents’ attitudes about 8. Wechsler H, Devereaux RS, Davis M, Collins
choosing healthy snacks did not change, but almost all J. Using the School Environment to Promote
respondents got an increased scores after being given Physical Activity and Healthy Eating. Preventive
the intevention of educational game tools of attaching Medicine [Internet]. 2000;31(2):S121–37.
images to slide calendar. The method of educational Available from: http://www.sciencedirect.com/
game tools of attaching images to slide calendar can science/article/pii/S0091743500906492
be used as one of the health promotion intervention
methods for children in school. 9.
Nursalam. Metodologi Penelitian Ilmu
Keperawatan : Pendekatan Praktis Edisi 3.
Ethical Clearance: This study has obtained the Jakarta: Salemba Medika; 2013.
feasibility of ethical review in the Health Research
10. Efendi F, Kurniati A, Savage E, Nursalam N, Yusuf
Ethics Commission of the Faculty of Nursing, Airlangga
A, Kusnanto K. Return migration of nurses: A
concept analysis. Indian Journal of Public Health
Conflict of Interest: The author reports no conflict of Research and Development. 2018;9(9):199–203.
interest of this work. 11. Cepeda NJ, Pashler H, Vul E, Wixted JT, Rohrer
D. Distributed practice in verbal recall tasks: A
review and quantitative synthesis. Psychological
funding.
bulletin. 2006;132(3):354.
REFERENCE 12. Fisher R. Teaching children to think. Nelson

Thornes; 2005.
1. Mayall B. Conversations with children: Working
with generational issues. In: Research with 13. Papalia DE, Olds SW, Feldman RD. Human
children. Routledge; 2008. p. 125–40. development. McGraw-Hill; 2007.
14. Sturm R, Datar A. Body mass index in elementary Elementary School. Pediatrics [Internet]. 2007 Oct
school children, metropolitan area food prices 1;120(4):e1059 LP-e1068. Available from: http://
and food outlet density. Public Health [Internet]. pediatrics.aappublications.org/content/120/4/
2005;119(12):1059–68. Available from: http:// e1059.abstract
www.sciencedirect.com/science/article/pii/
17. Notoatmodjo S. Promosi kesehatan dan ilmu
S0033350605001526
perilaku. Jakarta: Rineka Cipta. 2007;20.
15. Kelder S, Hoelscher DM, Barroso CS, Walker
18. Saracho O, Spodek B. Contemporary perspectives
JL, Cribb P, Hu S. The CATCH Kids Club: a
on play in early childhood education. IAP; 2003.
pilot after-school study for improving elementary
students’ nutrition and physical activity. Public 19.
Johnson JE, Christie JF, Wardle F. Play,
health nutrition. 2005;8(2):133–40. development, and early education. Pearson/Allyn
and Bacon; 2005.
16. Stock S, Miranda C, Evans S, Plessis S, Ridley
J, Yeh S, et al. Healthy Buddies: A Novel, Peer- 20. Gurian M. Boys and girls learn differently! A
Led Health Promotion Program for the Prevention guide for teachers and parents: Revised 10th
of Obesity and Eating Disorders in Children in anniversary edition. John Wiley & Sons; 2010.
The Correlation between Dementia Severity and Caregiver

Burden Level in Community
Eryin Sulistyani1, Joni Haryanto2, Makhfudli2

1
Faculty of Nursing, Universitas Airlangga; 2Department of Psychiatric Nursing and Community,
Universitas Airlangga, Jl. Mulyorejo Kampus C Universitas Airlangga, Surabaya, Indonesia
Abstract
Objective: This research aim is to investigate the correlation between dementia severity and caregiver
burden level.
Methodology: This research is a cross-sectional research involving 23 respondents who took care of the
elderly with dementia. The questionnaire employed in the data collection was MMSE (Mini-Mental Status
Examination) questionnaire to assess the dementia severity level, while the data on the caregiver burden
level was collected through the Cregiver Burden questionnaire by Zarit.
Result: Among 23 elderly taken care, 61% of them suffered from severe dementia. Meanwhile, the caregiver
burden level of the respondents was measured in mild-moderate level. There were no respondents with
severe caregiver burden level. The caregiver burden level suggested a different result in each dementia
severity level. Furthermore, the correlation between dementia severity and caregiver burden level indicated
p value of 0.001 and r value of 0.694 (significance α < 0.05).
Conclusion: There was a significant relationship between dementia severity level and caregiver burden
level. Positive coping played a highly critical role in minimizing the caregiver burden level experienced by
elderly caregivers.
Keywords: caregiver burden level, dementia severity, elderly patients
Introduction in the community. It is estimated that 47 million people

worldwide in 2017 suffered from dementia and most
Along with the increase in life expectancy, currently, of them lived together and were taken care of by their
there are 35.6 million people suffering from dementia. families in the community 3. Dementia is the factor of
This number will double in every two decades where major disability in the world that causes 11.9% of years
the figure is estimated to reach 65.7 million by 2030. lived with disability (YLDS). Moreover, dementia leads
Furthermore, it is estimated that 11.4 million elderly to the dependence of the elderly life, in either high,
will suffer from dementia in 2050 1. Dementia is a medium, or low-income countries. In 2010, the cost to
primary chronic disease that contributes to disability take care of dementia patients was estimated to reach
and care needs in the elderly 2. The increase in dementia US$ 604 billion globally 4. It is generally known that
incidence is one of the health crisis currently observed taking care of dementia in elderly patients extremely
burdens the caregivers 5.
Corresponding Author: From the previous research, it is discovered that

Joni Haryanto taking care of the elderly with dementia might lead to
Department of Psychiatric Nursing and Community, caregiver burden 1,2,5–8. The caregiver burden includes
Universitas Airlangga emotional, social and financial hardship, as well
Jl. Mulyorejo Kampus C Universitas Airlangga, as routine activity constraints that can threaten the
Surabaya, Indonesia 60115 caregivers in helping the elderly patients to fulfill their
Email: joniharyanto375@yahoo.com daily life 6,9. Moreover, several studies also state that
taking care of the elderly with dementia can be stressful dementia severity level and caregiver burden of the
for the caregivers due to the behavior issue, time spent family taking care of the elderly with dementia in the
to take care and psychological well-being provision 10. community.
In addition, the family taking care of the elderly with
dementia incurs financial burden. As a matter of fact, Methodology
95% of the elderly live with their family and depend
on their family to provide health care and other aids This research applied cross-sectional approach
1
. Family members who are in charge of being the with quantitative method. The research was carried
caregivers include the spouse, the adult children, and out in Ponorogo, Indonesia. The sample amount was
other close relatives (11, 12). 23 caregivers for the elderly and was selected based
on purposive sampling technique with the following
The assistance provided by a caregiver is not only
inclusion criteria: i) the elderly taken care aged more
limited to housework. Instead, it is divided into four
than 65 years; ii) family member’s age who took care
categories: 1) physical care, including feeding, putting
for dementia patients was more than 21 years; iii) the
on clothes, cutting nails, cleaning rooms, etc.; 2) social
care, including visiting entertainment venues, acting as family member took care for the elderly for more than
an informant from all over the world outside of the home 6 months.
care; 3) emotional care, including showing concern, love, The independent variable in this research was
and affection for the elderly, not only with words but also the dementia severity level of patients treated by
through the tasks done; and last 4) quality care, covering their family members. The variable was measured by
monitoring the level of care, standard of treatment, and MMSE questionnaire covering orientation parameter,
attention to problems that arise due to illness. Another motorist registration, attention, and calculation, as
assistance provided by the caregiver include spiritual well as re-introduction of language 17. On the other
assistance 13.
hand, the dependent variable in this research was the
Caregiving to the elderly with dementia requires a caregiver burden level of the family members treating
lot of time and physical assistance. A survey in 2003 in the elderly. The variable was assessed by caregiver
the United States described that a quarter of caregivers burden questionnaire of Zarit covering physical load,
spent 40 hours per week to take care of elderly dementia psychology, social and economy parameter 17.
patients 11.
The data was analyzed using the correlation test of
Taking care of elderly patients might put on burden Spearmen Rank Correlation with significance level α <
or strain to caregivers which affect the family life 0.05. Furthermore, the data was tested using SPSS for
quality. Caregiver burden is a multi-dimension response Windows software.
toward physical, psychological, social, and financial
stressors associated with the caregivers’ experience in Results
treating their clients 1,14. The burden in taking care of the
Demography Data: Based on the research result,
elderly are, among others, related to physical problems,
such as fatigue, sleep disorder, and chronic condition. the data obtained from 23 respondents indicated that
Meanwhile, the psychological problems consist of the approximately 20 respondents (87%) were female.
feelings of anxiety, worry, pessimism, shame, guilt, Meanwhile, nine respondents (39%) were aged around
self-esteem disorders, and depression. The social issues 36-45 years old. A total of 11 respondents (50%) were
include limitations in building relationships with other the biological children of the elderly with dementia.
people, conducting social activities, and having free Meanwhile, a total of 8 respondents (35%) had treated
time. in addition, financial problems may arise, namely the elderly with dementia for approximately 4 to 5
cost and financial limitation since the caregivers cannot months. in addition, 11 respondents (48%) graduated
work as they take care of their sick family member 15,16. from elementary schools. Last, 13 respondents (57%)
This research aims to identify the correlation between worked as farmers.
Table 1: Demographic data of respondents Conted…
Total Percentage High School 3 13

Gender DIII 1 4
Female 20 87 S1 (Undergraduate Degree) 1 4
Male 3 13 Occupation
Age Farmer 13 57
26-35 5 22 Merchant 3 13
36-45 9 39 Housewife 5 22
46-55 5 22 Teacher 1 4
56-55 3 13 Nurse 1 4
>65 1 4 Dementia severity of elderly patients
Caregiver relationship with the elderly Light 3 13
Biological children 11 50 Medium 6 26
Children in law 6 23 Severe 14 61
Grandchildren 5 18 Caregiver Burden Level
Wife 2 9 None-little 3 13
Taking care period Light-Medium 12 52
0-1 year 3 13 Medium-Severe 8 35
1-2 year 4 17 Highly Severe 0 0
2-3 year 1 4
Dementia severity of elderly patients: Among 23
3-4 year 2 9
elderly patients with dementia, 14 patients (61%)
4-5 year 8 35
suffered from severe dementia.
5-6 year 5 22
Last Education Caregiver Burden Level: Meanwhile, from a total
Elementary School 11 48 of 23 caregiver respondents, 12 respondents (52%)
Junior High School 7 31 experienced mild-moderate caregiver burden level.
Table 2: Caregiver Burden Scale
Caregiver burden scale

None-Mild Mild-Moderate Moderate-Severe Highly Severe Total
MMSE ∑ % ∑ % ∑ % ∑ % ∑ %
Mild 2 9% 1 4% 0 0% 0 0% 3 13%
Moderate 1 4% 5 22% 0 0% 0 0% 6 26%
Severe 0 0% 6 26% 8 35% 0 0% 14 61%
TOTAL 3 13% 12 52% 8 35% 0 0% 23 100%
p = 0.000 *, r = 0.694
Note: * p < 0.005
Correlation test with Spearman Rank Correlation α < 0.05
Correlation between the severity of dementia and five respondents (22%) suffered from mild-moderate
the caregiver burden: Table 2 indicates that out of caregiver burden, Meanwhile, eight respondents (35%)
23 respondents, three respondents (13%) taking care out of 14 caregiver respondents who took care of the
of the elderly suffered from light caregiver burden; six elderly with severe dementia suffered from moderate-
respondents (26%) suffered moderate caregiver burden; severe caregiver burden.
Discussion Moreover, if the elderly met their relatives, they

would find it difficult to remember their names. Thus,
Some issues complained by the caregivers were the respondents should remind them. The elderly with
neuropsychiatric syndrome (NPS), functional disorders, moderate dementia encountered problems in completing
memory disorders, and cognitive impairments. Some a sequenced instruction. It implies that their language
caregivers even detected that NPS was a functional aspect was weak. Even, some elderly found it hard to
disorder that mostly lead to strain and depression 17,18. mention time and place.
In addition, coping toward behavioral problems of the
The respondents taking care of the elderly with
elderly with dementia was also a heavy burden for the
severe dementia were at the caregiver burden level of
caregivers 12.
mild-moderate and moderate-severe. It was because
Based on the research results, it was identified that the elderly with severe dementia suffered from a
there was a correlation between the severity of dementia decline in doing their activities independently. They
occasionally did not recognize their caregivers, often
and the caregiver burden level. The correlation occurred
talked digressively, and required maximum assistance in
since the behavioral change shown by the elderly
fulfilling ADL. The elderly with severe dementia were
dementia patients became the stressor for the family
in the worst decline condition. They could not maintain
members taking care of them. These changes comprised
their personal health (hygiene), had changed in thinking
of weakening physicality and inability to complete behaviorand could not remember new information. The
daily activities independently. Consequently, the elderly elderly with severe dementia were not supposed to be
needed more help from the caregivers to perform their left alone since they could harm themselves and other
daily activities. people. Consequently, the family memebrs of the elderly
with severe dementia should supervise them strictly.
The elderly who were at the level of mild dementia
were still capable of carrying out daily activities This study had several limitations, among others;
independently, and most of them could still be oriented the data collection in this study was based on self-
to time and place. Nevertheless, the elderly sometimes report with questionnaires so that the perception of
forgot small things with a low value in the language caregivers was highly personal. The assessment of
domain. This finding was congruent with previous caregiver burden was in a range. It was probable that
studies arguing that the elderly with mild dementia had the respondents encountered difficulty in selecting the
begun to neglect house chores and were hard to have available answers, i.e. “never, rarely, sometimes, often,
and always.” Furthermore, the accuracy in completing
two-way communication. However they could still
the questionnaire was highly affected by the respondents’
recognize people, home addresses and the streets around
honesty and understanding. This research detected a
them. Respondents taking care of the elderly with mild
significant correlation between dementia severity and
dementia experience a caregiver burden at the level of caregiver burden level. Nonetheless, further studies
none-mild and mild-moderate, which might result from should be taken into account by involving larger samples
the minimum assistance required by the elderly. In in order to obtain better research objectivity.
addition, the low score in the language domain based
on the MMSE evaluation might be caused by the lack
Conclusion
of knowledge, hence, the elderly sometimes found
difficulties in understanding the assessor’s instruction, This research discovered the significant relationship
between dementia severity and caregiver burden level.
Most of the respondents treating the elderly patients The elderly with mild and moderate dementia did not
with moderate dementia level were in mild-moderate require much help from their caregivers since they
caregiver burden level. This might result from the were still capable of performing their activities of daily
respondents’ occasional assistance in fulfilling basic living independently. In contrast, the elderly with severe
needs such as feeding and bathing. Usually, the elderly dementia relied more on the caregivers’ help in fulfilling
only required help in preparing their clothes because their activities in everyday life. Therefore, the caregivers
they often forgot where they put them. Respondents also should bear a heavier burden. It is expected that the
stated that they should remind the patients to eat, take a caregivers could improve positive coping to decrease
bath and pray for the elderly with moderate dementia. the burden they felt.
Ethical Clearance: The research was reviewed and and mental health in caregiving: A systematic
approved by the Health Research Ethics Commission review and meta-analysis. Vol. 242, Journal of
of Universitas Airlangga Number 06-KEPK. The Affective Disorders. 2019. p. 14–21.
research process involves participants in the survey
9. Gilhooly KJ, Gilhooly MLM, Sullivan MP,
using a questionnaire that was accordant with the ethical McIntyre A, Wilson L, Harding E, et al. A meta-
research principle based on the regulation of research review of stress, coping and interventions in
ethic committee. The present study was carried out in dementia and dementia caregiving. BMC Geriatr.
accordance with the research principles. This study 2016 Dec 18;16(1):106.
implemented the basic principle ethics of respect,
beneficence, non-maleficence, and justice. 10. Pot AM, Deeg DJH, Van Dyck R, Jonker C.
Psychological distress of caregivers: The mediator
Conflict of Interest: The author reports no conflict of effect of caregiving appraisal. Patient Educ Couns.
interest of this work. 1998;34(1):43–51.
Source of Funding: This study is done with individual 11.

Brodaty H, Donkin M. Family caregivers
funding. in dementia. Dialogues Clin Neurosci.
2009;11(2):217–28.
References 12. Van der Lee J, Bakker TJEM, Duivenvoorden

HJ, Dröes RM. Multivariate models of subjective
1. Chan SW-C. Family Caregiving in Dementia: The caregiver burden in dementia: A systematic
Asian Perspective of a Global Problem. Dement review. Vol. 15, Ageing Research Reviews.
Geriatr Cogn Disord. 2010;30(6):469–78. Elsevier; 2014. p. 76–93.
2. Wimo A, Jönsson L, Bond J, Prince M, Winblad 13. Milligan S. Perceptions of spiritual care among
B. The worldwide economic impact of dementia nurses undertaking postregistration education. Int
2010. Alzheimer’s Dement. 2013;9(1):1–11. J Palliat Nurs. 2004;10(4):162–71.
3.
Cheng ST. Dementia Caregiver Burden: a 14.
Losada A, Pérez-Peñaranda A, Rodriguez-
Research Update and Critical Analysis. Curr Sanchez E, Gomez-Marcos MA, Ballesteros-Rios
Psychiatry Rep. 2017;19(9). C, Ramos-Carrera IR, et al. Leisure and distress
in caregivers for elderly patients. Arch Gerontol
4. Wimo A, Prince M. World Alzheimer Report 2010
Geriatr. 2010;50(3):347–50.
– The Global Economic Impact of Dementia.
Alzheimer’s Disease International. London. 15. Sales E. Family burden and quality of life
2010;96. [Elektronische Version]. Qual Life Res. 2003;12
Suppl 1:33–41.
5. Haley WE, Pardo KM. Relationship of severity of
dementia to caregiving stressors. Psychol Aging. 16. Etters L, Goodall D, Harrison BE. Caregiver
1989;4(4):389–92. burden among dementia patient caregivers: A
review of the literature. J Am Acad Nurse Pract.
6. TAK Y, SONG J, WOO H, AN J. Realist Review: 2008;20(8):423–8.
Understanding Effectiveness of Intervention
Programs for Dementia Caregivers. Asian Nurs 17. Cheng ST, Lam LCW, Kwok T. Neuropsychiatric
Res (Korean Soc Nurs Sci). 2019 Jan 9; symptom clusters of alzheimer disease in
Hong Kong Chinese: Correlates with caregiver
7. Liu S, Liu J, Wang X-D, Shi Z, Zhou Y, Li J, et burden and depression. Am J Geriatr Psychiatry.
al. Caregiver burden, sleep quality, depression, 2013;21(10):1029–37.
and anxiety in dementia caregivers: a comparison
18. Gaugler JE, Wall MM, Kane RL, Menk JS,
of frontotemporal lobar degeneration, dementia
Sarsour K, Johnston JA, et al. The Effects of
with Lewy bodies, and Alzheimer’s disease. Int
Incident and Persistent Behavioral Problems on
Psychogeriatrics. 2018 Aug 10;30(08):1131–8.
Change in Caregiver Burden and Nursing Home
8. del-Pino-Casado R, Espinosa-Medina A, López- Admission of Persons With Dementia. Med Care.
Martínez C, Orgeta V. Sense of coherence, burden 2010 Oct;48(10):875–83.
An Exploratory Study in the Indonesian Archipelago: Are

There Influenza B Virus (B-Victoria Sub-Type) in the Bat’s
Respiratory Organs?
Muhammad Anas Wildanu Rahman1, Chairul Anwar Nidom1, Setya Budhi1

1
Faculty of Veterinary, Universitas Airlangga, Surabaya, Indonesia
Abstract
Bats act as hosts in carrying Influenza B disease and can act as a natural reservoir of various types of
viruses, including Nipah virus, Hendra virus, and Ebola virus in mammals. This research aimed to study
the presence of Influenza B virus (B-Victoria sub-type) in the respiration organs of bats (Chynoptera sp.)
in Indonesian Archipelago. A total of 99 bats from several regions representing the islands in Indonesia
were taken in Snowball sampling technique. Samples that had been isolated and passed the incubation
period were tested using the Hemagglutination (HA) test and Hemagglutination Inhibition (HI) test. The
data obtained were processed descriptively. The result showed that there were 13 samples positively in
the Hemagglutination (HA) test (13.13%), but after going through the Hemagglutination Inhibition Test
(HI) with B-Victoria antisera, no positive samples were found. We conclude that there was no virus type B
influenza virus (B-Victoria sub-type) in the bat respiration organ.
Keywords: Influenza B virus, Respiratory Organ, Bats, B-Victoria sub-type
Introduction Interestingly, bats infected with various viruses rarely

show clinical symptoms of the disease.The pathogenesis
Influenza viruses circulate and cause disease in and potential threat of most viruses transmitted by bats
humans every year. Influenza type B is considered a to public health is still unknown. Besides, this host-virus
mild disease and lack of attention compared to influenza interaction may result in a large diversity of zoonotic
A, even though it has caused 20 to 50% of the total viruses in bats.5
incidence of influenza in several regions of the world 1.
The genus of Influenza B virus is generally considered Bats are important to be noticed because they consist
a human virus. A chain of events that allows influenza of nearly 1,200 species in the world 6. The diversity of
viruses to be successfully transmitted in alternative host hosts raises questions about transmission of viruses
populations needs to be known 2. Animals can function between individuals of species that same and between
as an intermediary spread of disease. Cats, like pigs, can species. In the case of multispecific roots, bats show high
act for the emergence of a new virus that has the potential seroprevalence levels observed and related to ecology 7.
for a pandemic 3. In recent years, bats (Chiroptera order) Type B influenza is one of the important components
are known to act as important reservoirs of several of all major influenza diseases that attack humans, both
viral diseases which allow infection in humans and B-Yamagata and B-Victoria. Normally, this Influenza
other mammals 4. Bats play an important role in the B virus is only found in humans and pigs 8. However,
emergence of severe acute respiratory syndrome (SARS). the process of transmitting this virus needs to be known
since bats are an important medium in transmitting other
infectious viruses. Transmission of influenza viruses
Corresponding Author: may occur directly from the dynamic interactions
Chairul Anwar Nidom between animals, environmental factors and the human
Faculty of Veterinary, Universitas Airlangga, immune system even though barriers can occur between
Surabaya, Indonesia species and the virus itself 7. Short-term decisions on
Email: chairulanwar157@yahoo.com patient care, for example, in the case of vaccines and
early onset of epidemiological examination, including (thawing). Next, the storage was carried out in 15 ml
WHO’s decision on vaccine composition are important 9. conical tube with a solution of 1:10 Phosphate Buffer
Saline (PBS) at a speed of 3000 rpm for 10 minutes at
Infectious diseases are a major threat to the welfare 10oC.The samples were then placed in eppendorf, mashed,
of animals and humans globally through threats from centrifuged, candling then isolated in ECE (embryonated
old and new pathogens that continue to emerge.Along chicken eggs) which have SAN (Specific Antibody
with global climate change, agricultural practices Negative) characteristic. Isolation was carried out for
and demographic presentations make conditions very 9-11 days to multiply the virus. ECE was then stored in
favorable for the spread of diseases. Interaction between an incubator at 37oC for three days by checking it every
animals and humans can pose significant additional day. Embryos which were dead before the third day were
threats to human health, including influenza viruses10. removed and stored in the 4oC refrigerator for one night.
The spread of viruses/zoonotic infections can occur
through direct and indirect contact even though the After going through the inoculation and isolation
spread of current diseases depends on strong assumptions stages, the Hemagglutination Test (HA) of the
about the contribution of indirect contact to the spread of Microtechnics was carried out using a 24-unit 4HA
infection 11. antigen. The Retraction Test was also performed to
test the accuracy of the dilution of the antigen used.
If the Influenza B virus (B-Victoria sub-type) is found Positive samples on the Hemagglutination Test were
in the bat’s respiratory organs, it will easily be carried then examined using Microtechnic Hemagglutination
out further research for prevention of cross infection and Inhibition (HI) Test with B-Victoria subtype Influenza
treatment on veterinary medicine. Therefore this study type B antisera with HAU titers/0.025 mL. RBC used
aimed to identify the Influenza B virus (B-Victoria sub- in this test came from chickens with a concentration of
type) in the respiratory organs of bats in the regions 0.5%. Data obtained from the results of virus isolation,
representing all islands in Indonesia. Hemagglutination test and Hemagglutination inhibition
test (HI) are presented in descriptive form.
Method
This descriptive study was conducted at the BSL- Result

2 Avian Influenza Research Center (AIRC) Laboratory, A total of 99 bats with the type of Cynoptera sp.
Surabaya for 12 weeks in 2017. Sampling of 99 bats represented all bats in the Indonesian archipelago. In
was carried out through the Snowball sampling method. the several regions, the largest number of samples were
Samples in the form of Cynoptera sp. bats were captured taken from the Sumatra Island region, 32 of which
using bat trapped nets on trees and attics installed for 72 were Bintan, but the samples with the most positive
hours. Hemagglutination Test (HA) were found on the Borneo
The research was carried out through several stages. island, Pontianak. Therefore, 13 positive samples were
The respiration organs of the bat which included the obtained by forming hemagglutination at the bottom of
trachea and lung weretaken through the freezing process the “V” microplate hole and presented in Table 1.
Table 1: Hemagglutination (HA) Test Results
Results
Total Samples
No. Sample Origin Positive Negative
n % n % n %
1. Pontianak 8 8.1 12 12.1 20 20.2
2. Bawean 2 2 25 25.3 27 27.3
3. Bintan 3 3 29 29.3 32 32.3
4. Padang 0 0 20 20.2 20 20.2
Total 13 13.1 86 86.9 99 100
A total of 13 samples were known to get Hemagglutinous Test results with HA titers of more than 22, followed
by HI test using B-Victoria antisera. The results of the HI test were positive at the highest dilution which could still
inhibit complete clotting of erythrocytes. However, it was found that no sample received a positive Hemagglutination
Inhibition Test. So that it can be seen that from all samples, no hepatitis B virus (sub-type B-Victoria) was found in
bat respiration organs. The Hemagglutination Inhibition Test (HI) results are described in Table 2.
Table 2: Hemagglutination Inhibition (HI) Test Results
Results
Total Samples
No. Sample Origin Positive Negative
n % n % n %
1. Pontianak 0 0 8 61.5 8 61.5
2. Bawean 0 0 2 15.4 2 15.4
3. Bintan 0 0 3 23.1 3 23.1
Total 0 0 13 100 13 100
Discussion ferrets, or nonhuman primates, is considered the most

likely mode of infection in humans. Humans can also
This study found that in bat respiration organs there be infected with viruses through aerosols by enteringbat
was no Influenza B virus (B-Victoria Sub-type) found. caves or through direct contact with bats, such as
So far, there has been no risk of transmission of type catching bats or being bitten by bats.15
B (sub-type B-Victoria) through bat respiration organs.
The negative results in 86 of these samples may be B-Victoria’s subtype of Influenza B virus was
caused by a virus that cannot be detected in this way. previously found in street cats through 26 blood serum
The causes include virus titers that are still low while samples in the nasopharynx which contained Victoria
this study wasbeing conducted, the presence of viral B-type subtype Influenza B antibodies 16. In addition,
deaths caused by tissue autolysis, viral predilection the pathogenesis of type B influenza virus was found
is more common in other organs, and less diverse in ferrets. B/Brisbane/60/2008 virus and B/Yamagata
sampling locations 12. Reagents or diagnostic tests are strains cause the most severe clinical disease in the
indeed available for all viruses,but to detect previously middle to lower respiratory tract with a high viral load.
unknown viruses, new reagents and approaches must be This type forms the lower respiratory tract that becomes
developed through PCR exploration. Classic methods, persistent and begins the process of developing the virus
including test of hemagglutination inhibition, need to be in the airways. Although this infection does not induce
widely developed 4. the initial epithelium, the lesion causes severe damage to
Viruses originating from bats are the most famous the small airways resembling the pathology of Influenza
zoonoses that spread from wildlife to domestic animals A. The virus then spreads to the lower respiratory tract.
and human. Transmission of the virus from bat to The response of specific influenza antibodies is also
human requires a hierarchy of conditions that allow the measured by the haemagglutination inhibition (HI) test.1
relationship between the host reservoir, viral infection in In the hemagglutination inhibition (HI) test, a positive
the host, and exposure and susceptibility of the recipient result will show the presence of point erythrocytes
host.13 Human cells do not support the growth of bat flu deposited in the middle of the microplate well because
viruses in the test tube. This shows that bat flu viruses the antiserum is used homologously with antigens
may not grow or replicate in humans. However, bat so that the virus is able to agglutinate erythrocytes 17.
virus genome examination showed that the bat’s internal In addition to bats which are thought to be related to
genes were compatible with human flu viruses. Scientists influenza type B, certain pigs become agents of the
cannot rule out the possibility of this virus eventually B virus, i.e. guinea pig. As in the case of influenza A
becoming able to infect humans 14. Although bats are not viruses, transmission of influenza B virus is increased
in close contact with humans, the spread of viruses from at colder temperatures, providing an explanation for
bat to intermediate host animals, such as horses, pigs, seasonal influenza epidemics in temperate regions.18
Influenza B virus B-Victoria subtype is less Acknowledgement

dominant compared to Influenza B subtype B-Yamagata.
We thank to the Staff of Research Center (AIRC)
Currently, viruses with B/Victoria/2/87 strains are
Laboratory and Universitas Airlangga for supporting
genically and antigenically more closely related to
this research.
strains B/Brisbane/60/2008. Virus was recommended to
be used as a vaccine in the seasonal Influenza region of Ethical Clearance: This research has gone through
the northern world in 2015 19. Research on B-Yamagata ethical tests and permits from the veterinary faculty of
Influenza B subtypes on bats showed similar results, Universitas Airlangga and through licensing in the area
i.e. no positive results were found in bats 20. Although where the samples were taken
bats are a strong reservoir of human bacterial pathogens
in some cases, a large number of pathogenic viruses Conflict of Interest: The author reports no conflict of
colonize bats, the bacterial flora of bats and its zoonotic
threats remain unclear.21 Influenza viruses can occur and Source of Funding: This study is done with individual
spread through commercial farms.22 funding
Bats are a natural reservoir of a number of high-
impact viral zoonoses. Bats host special zoonotic REFERENCES
viruses compared to mice, the role of other important 1. Stephen S. H. Huang, David Banner, Stephane G.
hosts. Bats do have more viral zoonoses per species than Paquette, Alberto J. Leon, Alyson A. Kelvin DJK.
mice but the total number of zoonotic viruses identified Pathogenic influenza B virus in the ferret model
in bats is lower than mice. As a result, there are about establishes lower respiratory tract infection. J Gen
twice of rat species number as bat species.23 Bats are Virol. 2014;95:2127–39.
also increasingly known as a host reservoir for viruses
2. Webby RJ, Webster RG RJ. Influenza viruses in
that can across species boundaries to infect humans and animal wildlife populations. Curr Top Microbiol
other wild and domestic mammals, although bats have Immunol. 2007;315:67–83.
the function of helping to control insects, replanting
logged forests, and pollinating plants that provide food 3. Horimoto T, Gen F, Murakami S, Iwatsuki-
for humans and other species, and their guano is used as Horimoto K, Kato K, Hisasue M, Sakaguchi
fertilizer and for making soap, gasohol, and antibiotics.4 M, Nidom CA KY. Cats as a potential source of
emerging influenza. Virol Sin. 2015;30(3):221–3.
Further research needs to be done to check the sample
4. Charles H. Calisher, James E. Childs, Hume E.
which may react positively to other viral antiserums Field, Kathryn V. Holmes and TS. Bats: Important
that have hemagglutinin proteins.The strategy used reservoir hosts of emerging viruses. Clin
by viruses targets innate and adaptive responses to the Microbiol Rev. 2006;19(3):531–45.
immune response phase.With regard to bats, there is
evidence that “healthy bats” can be asymptomatic as 5. Thomas J. O’Shea, Paul M. Cryan, Andrew A.
in the rabies virus. The infected bat which survive are Cunningham, Anthony R. Fooks, David T.S.
Hayman, Angela D. Luis, Alison J. Peel, Raina K.
known to have no virus in the brain or saliva.
Plowright JLNW. Bat Flight and Zoonotic Viruses.
Emerg Infect Dis CDC. 2014;20(5):741–5.
Conclusion
6. Tong S1, Li Y, Rivailler P, Conrardy C, Castillo
This study recommend that apart from bats as DA, Chen LM, Recuenco S, Ellison JA, Davis
other viral agents, there is no risk of exposure and CT, York IA, Turmelle AS, Moran D, Rogers
transmission of influenza B virus (B-Victoria sub-type) S, Shi M, Tao Y, Weil MR, Tang K, Rowe LA,
in bats. Further research needs to be done on the pattern Sammons S, Xu X, Frace M, Lindblade KA, Cox
of viral development on other virus dan other organs of NJ, Anderson LJ, Rupprecht CE DR. A distinct
bat. Vigilance must be increased because bats are still at lineage of influenza A virus from bats. Proc Natl
risk as an important part of the spread of other viruses. Acad Sci U S A [Internet]. 2012;109(11):4269–
74. Available from: http://www.pnas.org/cgi/ Liua X-JY. Bats as reservoirs of severe emerging
doi/10.1073/pnas.1116200109 infectious diseases. Virus Res. 2015;205:1–6.
7. Benoit de Thoisy, Hervé Bourhy, Marguerite 16. Susianti Rachman. Identification of Influenza B
Delaval, Dominique Pontier, Laurent Dacheux, (B-Victoria and B Yamagata) virus on stray cat
Edith Darcissac, Damien Donato, Amandine (Felis silvestris catus) in Indonesia. Perpustakaan
Guidez, Florence Larrous, Rachel Lavenir, Arielle Universitas Airlangga. 2017.
Salmier, Vincent Lacoste AL. Bioecological
17. Rovid Spickler A. Avian Influenza Fowl
Drivers of Rabies Virus Circulation in a
Plague, Grippe Aviaire. OIE [Internet].
Neotropical Bat Community. PLoS Negl Trop
2016;(September):1–24. Available from: http://
Dis. 2016;10(1):1–21.
www.cfsph.iastate.edu/
8. Harimoto T and Kawaoka. Pandemic Threat
18. Natalie Pica, Yi-Ying Chou, Nicole M. Bouvier
Posed by Avian Influenza Viruses. Clin Microbiol.
PP. Transmission of Influenza B Viruses in the
2001;Vol. 14(1):129–49.
Guinea Pig. 2012;4279–87.
9. Biere B, Bauer B, Schweiger B. Differentiation
19. WHO. Influenza B Victoria lineage candidate
of influenza b virus lineages yamagata and
vaccine viruses for development and production
victoria by real-time PCR. J Clin Microbiol.
of vaccines for use in the northern hemisphere
2010;48(4):1425–7.
2016-2017 influenza season. 2017;1–3.
10. Tomley FM, Shirley MW. Livestock infectious
20. Wahyu Hidayat. Identification ofInfluenza
diseases and zoonoses. Philos Trans R Soc B Biol
B-Yamagata Virus on Bats Respiratory Organs in
Sci. 2009;364(1530):2637–42.
Indonesia Archipelago. 2017.
11. Gianluigi Rossi, Rebecca L. Smith, Stefano
21. Ville Veikkolainen, Eero J. Vesterinen, Thomas
Pongolini LB. Modelling farm-to-farm disease
M. Lilley ATP. Bats as reservoir hosts of human
transmission through personnel movements
bacterial pathogen, Bartonella mayotimonensis.
: from visits to contacts, and back. Sci Rep.
Emerg Infect Dis. 2014;20(6):960–7.
2017;7(April):1–11.
22.
Wibawa, H., Karo-Karo, D., Pribadi, E.S.,
12.
Susanti R., Soejoedono R.D., Mahardika
Bouma, A., Bodewes, R., Vernooij, H., Diyantoro,
I.G.N.K. WIWT and SMT. Waterfowl Potential
Sugama, A., Muljono, D.H., Koch, G., Tjatur
as Reservoirs of High Pathogenic Avian Influenza
Rasa, F.S., Stegeman A. Exploring contacts
h5N1 viruses. JITV. 2007;12(2):160–6.
facilitating transmission of influenza A(H5N1)
13. Raina K. Plowright, Peggy Eby, Peter J. Hudson, virus between poultry farms in West Java,
Ina L. Smith, David Westcott, Wayne L. Bryden, Indonesia: A major role for backyard farms? Prev
Deborah Middleton, Peter A. Reid, Rosemary Vet Med. 2018;156:8–15.
A. McFarlane, Gerardo Martin, Gary M. Tabor,
23. Luis AD, Hayman DT, O’Shea TJ, Cryan PM,
Lee F. Skerratt, Dale L. Anderson, Gary Crameri,
Gilbert AT, Pulliam JR, Mills JN, Timonin
David Qua HM. Ecological dynamics of emerging
ME, Willis CK, Cunningham AA, Fooks AR,
bat virus spillover. Proc R Soc B Biol Sci.
Rupprecht CE, Wood JL WC. viruses: are bats
2014;282(1798).
special? A comparison of bats and rodents as
14. CDC. Bat Influenza (Flu) [Internet]. 2018. reservoirs of zoonotic A comparison of bats and
Available from: https://www.cdc.gov/flu/other/ rodents as reservoirs of zoonotic viruses: are bats
bat-flu.html%0A%0A special? Proc Biol Sci. 2013;
15.
Hui-Ju Hana, Hong-ling Wena, Chuan-Min
Zhou, Fang-Fang Chena, Li-Mei Luoa, Jian-wei
Call for Papers/Article Submission
The editor invites scholarly articles that contribute to the development and understanding of all aspects of Public
Health and all medical specialties. All manuscripts are double blind peer reviewed. If there is a requirement,
medical statistician review statistical content. Invitation to submit paper; A general invitation is extended to
authors to submit papers for publication in IJPHRD.
The following guidelines should be noted:

• The article must be submitted by e-mail only. Hard copy not needed. Send article an attachment in e-mail.
• The article should be accompanied by a declaration from all authors that it is an original work and has not
been sent to any other journal for publication.
• As a policy matter, journal encourages articles regarding new concepts and new information.
• Article should have a Title
• Names of authors
• Your affiliation (designations with college address)
• Abstract
• Keywords
• Introduction or background
• Material and Method
• Findings
• Discussion
• Conclusion
• Interest of conflict
• Source of Funding
• Ethical Clearance
• References in Vancouver style.
• Please quote references in text by superscripting
• Word limit 2500-3000 words, MSWORD Format, single file.
All articles should be sent to: editor.ijphrd@gmail.com
Our Contact Info:
Institute of Medico-Legal Publications

Logix Office Tower, Unit No. 1704, Logix City Centre Mall, Sector-32, Noida-201 301 (Uttar Pradesh)
Mob.: 09971888542, E-mail: editor,ijphrd@gmail.com
Website: www.ijphrd.com
Indian Journal of Public Health Research & Development
CALL FOR SUBSCRIPTIONS
About the Journal
Print-ISSN: 0976-0245 Electronic-ISSN: 0976-5506, Frequency: Monthly
Indian Journal of Public Heath Research & Development is a double blind peer reviewed
international Journal. The frequency is Monthly. It deals with all aspects of Public Health including
Community Medicine, Public Health, Epidemiology, Occupational Health, Environmental Hazards,
Clinical Research, Public Health Laws and covers all medical specialties concerned with research and
development for the masses. The Journal strongly encourages reports of research carried out within
Indian continent and South East Asia.
The journal has been assigned international standards (ISSN) serial number and is indexed with Index
Copernicus (Poland). It is also brought to notice that the journal is being covered by many international
databases.
Subscription Information
Journal Title Print Only
Indian Journal of Public Health Research &

` 9,000/=
Development
Note for Subscribers

zz Advance payment required by cheque/demand draft/bank Transfer in the name of “Institute of Medico-
Legal Publications” payable at New Delhi.
zz Cancellation not allowed except for duplicate payment.
zz Claim must be made within six months from issue date.
zz A free copy can be forwarded on request.
Bank Details
Send all payment to :
Name of Account: Institute of Medico-Legal Publications Pvt Ltd
Bank: HDFC Bank 501, Manisha Building, 75-76, Nehru Place, New Delhi-110019,
Branch: Sector-50, Noida-201 30109971888542, Fax No. +91 11 3044 6500
Mob:
E-mail: editor.ijphrd@gmail.com,
Account Number: 09307630000146 Website: www.ijphrd.com
Type of Account: Current Account
MICR Code: 110240113
RTGS/NEFT code: HDFC0000728
Our Contact Info:
Logix Office Tower, Unit No. 1704, Logix City Centre Mall, Sector- 32, Noida-201 301 (Uttar Pradesh)
Phone: +91 120 429 4015; Mobile: +91 997 188 8542
Email: editor.ijphrd@gmail.com | Website: www.ijphrd.com
Published, Printed and Owned: Dr. R. K. Sharma
Printed: Printpack Electrostat, G-2, Eros Apartment, 56-Nehru Place, New Delhi-110019
Published at: Institute of Medico-Legal Publications, Logix Office Tower, Unit No. 1704, Logix City Centre Mall Sector-32,
Noida-201 301 (Uttar Pradesh)
Editor: Dr. R. K. Sharma, Mobile: +91 997 188 8542

IJPHRDSeptember2019ason06 09 2019

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

IJPHRDSeptember2019ason06 09 2019

Uploaded by

Copyright:

Available Formats

Volume 8 Number 49 September 2019 2017

SCOPUS IJPHRD CITATION SCORE

Indian Journal of Public Health Research &

20. Detection of mecA Gene in Methicillin-Resistant Staphylococcus hemolyticus Isolated from

27. Effect of Thyroid Hormone Abnormalities on Hemoglobin A1c in Hemodialysis

39. Functional Gastrointestinal Disorders in Pediatrics .................................................................................. 207

41. Factors Related to Competence in Prehospital Care ................................................................................. 217

48. Implementation of Nutrition Education to Knowledge, Behaviour, and Performance of

50. Risk Factors Related to Diabetes Mellitus ................................................................................................ 269

57. Utilization of Lactobacillus Acidophilus FNCC-0051 Microencapsulation: Potential Benefit of

59. Carbon Emission Disclosure in Manufacturing Companies in Indonesia ................................................. 320

64. Attenuation of Eimeria tenella with Immersion Various Concentration of Formaldehyde in

69. Fasciolosis Prevalence on Several Cattle Breeds ...................................................................................... 376

70. BPJS Kesehatan Patients Satisfaction on Pharmaceutical Services in Community

76. The Correlation between Goat Maintenance Management to the Incidence of

Knowledge, Attitude, Practice and Barriers for Self-care

Aliya Jasmine1, Ramesh Harihara Iyer2

Keywords: attitude, barriers, Diabetes, knowledge, practice, self-care.

Introduction areas. The rising burden of diabetes-related health costs

Methodology Knowledge Assessment: The mean knowledge score of

Table 2: Attitude among DM patients attending a rural health centre (n = 77)

S. No. Attitude Positive n (%) Negative n (%)

S. No. Practice Good practice n(%) Poor practice n(%)

The details are given in Figure 1 and Figure 2.

Discussion similar to our study. In addition about 37.2% participants

Health Status of the Rabha Community: A Study in Goalpara

Keywords: Health Status, Rabhas, Goalpara.

Introduction The health status of Assam is not satisfactory. The

ST population of the state. Among the districts, Goalpara Objective

Table 1: Design of the Sampling

Sample Sample Total Number of Number of Sample

Survey Tools: The necessary data to fulfill the objective of D0

system, manpower, resources all has to be strengthen

Ethical Clearance: It is a review article.

Source of Funding: Self.

Conflict of Interest: Nil.

Acoustic Analysis of Infant Cry Using Multidimensional Voice

Deepa N Devadiga1, Remyasree T2, Aiswarya Liz Varghese3, Ananthakrishna T4

Introduction dysfunction or deficit of central or peripheral nervous

7. Lind J, Wasz-Höckert O, Vuorenkoski V, Valanne 14.

An Analysis of Access to Primary Health Care Services: A

Keywords: Accessibility, Availability, Acceptability, Primary Health Care.

Introduction care services. The concept of primary health care came

Total 10% of the total Availability of Primary Health Services: Adequate

Table 2: Distance to the nearest Primary Health Service

Bellow 1 Km 1-3Km 3-8Km Above 8Km

Table-3: Health Care Expenditure among Socio-economic Groups (in percentage)

Selected Below Above

Table 4: Choice of Providers among Socio-economic Groups (in percentage)

Selected Variable Description Public Private Total

Table 5: Distribution of Morbid Persons seeking Conclusion

Adaptive Signal Enhancement in Clinical Cardiac Care

Asiya Sulthana1, Md. Zia-Ur-Rahman2

Introduction studies are carried out in the field among noninvasive

techniques are preferable to update the filter weights in

In [11-12] conventional Least Mean Square (LMS)

w(n + 1) = w(n) + α(n).medL [Sign{d(n)}u(n), Sign

w(n + 1) = w(n) + α(n).medL [Sign{d(n)}

Filtering of Respiration Artifact (RA) using Adaptive

Noise Rec. no LMS MLMS SRMLMS SMLMS SSMLMS

Evaluation of the Baby Friendly Hospital Initiative

Figure 1: Baby Friendly Initative quality cycle.3 (p.5)

Table 1: Monitoring of the BFHI in Azadi Teaching Hospital