PRACTICE – DNA, RNA and Gene Expression (solutions)

Biology I, Pre-Health Sciences - Durham College, Fall 2020

DNA

1. What characteristics of DNA make it an excellent molecule for inheritance?

Replicates, stores information, mutates

2. Multiple choice: What is considered to be the building block (monomer) of DNA?

a. Pentose sugar
b. Nucleotide
c. Adenine
d. Phosphate
e. Double helix

3. Draw a simplified diagram of a DNA nucleotide. Be sure to include labels for its 3 main parts.

phosphate Base
(A,C,T,
G)

deoxyribose
sugar

4. Describe how the structure of DNA is similar to a twisted ladder. What components of the
nucleotide are considered to be the “poles/backbone” and “rungs” of the ladder?

Poles/backbone: Sugar-phosphate Rungs: nitrogenous bases

5. If a strand of the DNA has the following sequence, what is the sequence of its complementary
strand?
AATTGCGAGCGAGCAGCGCGCGGAG
TTAACGCTCG CTCGTC GCGCGCCTC

PHS – Pre-Health Sciences

6. Describe how hydrogen bonding keeps the 2 strands of DNA together. Be sure to include
information about how hydrogen bonding changes depending on the types of bases present.

DNA is made of 2 strands that come together to resemble a twisted ladder. Each strand contains a
sugar-phosphate backbone (poles of ladder) and nitrogenous bases (rungs of the ladder). The DNA
strands are held together at the “rungs” due to complementary base pairing between the nitrogenous
bases where “A” forms 2 hydrogen bonds with “T” and “C” forms 3 hydrogen bonds with “G.” These
hydrogen bonds keep the 2 strands together and prevent the molecule from falling apart. The only time
that they are broken is when the DNA needs to unzip to undergo DNA replication or transcription.

7. Draw a labeled diagram of a DNA molecule with the sequence AGTGGT. Be sure to explain (in
your own words) how your diagram embodies the 5 characteristics of DNA.

See notes.

RNA

8. Which of the following is NOT a type of RNA?

a. mRNA
b. transfer RNA
c. ribosomal RNA
d. dRNA
e. tRNA

9. Draw a simplified diagram of a RNA nucleotide. Be sure to include labels for its 3 main parts.
How is this nucleotide different than a DNA nucleotide?

phosphate Base
(A,C,U,
G)

ribose sugar

The RNA nucleotide is similar to the DNA nucleotide in the sense that they are both composed of
a sugar, phosphate and base. However, uracil base is present in RNA and thymine base is present
in DNA. In addition, ribose sugar is present in RNA whereas deoxyribose sugar is present in
DNA.

PHS – Pre-Health Sciences

10. Fill in the blanks:

Words to choose from: Transcription, translation, nucleotides (2X), protein, ribosome, codon,
amino acid, genes, mRNA, tRNA

 Genes are short segments of DNA in the nucleus that provide the instructions for building
proteins. Each gene has a specific sequence of nucleotides that codes for one protein.

 To create a protein from a gene, the section of DNA coding for that protein “unzips” and one
side acts as a template. A molecule of mRNA is produced that provides a copy of the DNA
template, using complimentary base pairing. This step (the copying of a message onto mRNA)
is called transcription.

 After the mRNA is made, the DNA in the nucleus “zips” back up and the code is preserved
until the next time it is needed. The mRNA is processed and moves from the nucleus into the
cytoplasm. Here it docks with an organelle known as the ribosome.

 The ribosome “reads” the information spelled out by the base sequence in the mRNA and
directs the making of a protein. The mRNA is read 3 bases at a time – this triplet is called a
codon and specifies one particular amino acid.

 tRNA contains the anti-codon that is complementary to each codon of the mRNA. It picks up
the correct amino acid molecule in the cytoplasm and brings it to the correct spot along the
mRNA. Soon, many amino acids are joined together to form a protein. This step (the
assembling of a protein following the instructions in the mRNA) is called translation.

 Once translation is completed, the ribosome disassembles, the protein is released and the
mRNA breaks back up into its monomers, the nucleotides, to be recycled.

PHS – Pre-Health Sciences

11. Summarize the process of gene expression (transcription and translation) in your own words. Try
to include an analogy of your own, similar the one in the course notes re: making the best salsa
recipe.

See notes.

PHS – Pre-Health Sciences