Some terminologies Gene: A gene is the basic physical and functional of heredity. Genes are made up of DNA. Genome: The complete set of genes or genetic material present in a cell or organism. The genome includes both the genes and the noncoding DNA, as well as mitochondrial DNA and chloroplast DNA. Nuclear DNA: It is the DNA contained within each cel nucleus of a eukaryotic organism. \ Mitochondrial DNA : It is the small circular chromosom found inside mitochondria.aR OUT Cuno La RRR Ferman eae outcome toe eo ST Sencha Ue Urs e Coen oe cclit Reet ace Ra ges am lcs Gene expression, the process by which DNA Cael) alee alle aoe Central transcription and translation Dogma of life fecal) ert ol lolol er eal) eee Uae) Meee Reems nae information from gene sequence to protein product Derm Cum nme CLS aye mel Meee co a Rrra Matar Geet eee ccReplicationAn Analogy > When you get to the library, you search through the' until you find a book that has a good set of instructi making a table. > The library doesn't have a photocopier, but you came prepared and you whip out your pen and notebook and down (or ‘transcribe') the instructions. > Satisfied, you take your notes and head back home. > At home, you have all the wood and tools to make the ¥ > You follow the instructions and make the table, effectiv ‘translating’ the written words into a table which you your room.An Analogy Lv cg i Cake or Library = Nucleus Cree na ce UR ure ery Oe eae ounce Ry en at in) Seen eee ee Cgc COO ance orca Ry cle a oes ccu) Table = One protein product Wood to make the table = amino acids for building PeeBasic Principles of Transcription and Translation > RNA is the bridge between genes and the proteins' which they code > Transcription is the synthesis of RNA using informat' DNA > Transcription produces messenger RNA (mRNA) > Translation is the synthesis of a polypeptide, using information in the mRNA > Ribosomes are the sites of translation(b) Eukaryotic cell(b) Eukaryotic cell(b) Eukaryotic cellTranscription >» DNA sequence information is converted to mRNA in a process ¢ transcription Steps: 1. The double-stranded DNA molecule is partially unzipped 2. An enzyme called RNA polymerase copies the gene's nucleotides into a MRNA molecule. Like DNA, mRNA is made of a particular sequence of nucleotides Unlike DNA, mRNA has only a single strand, and the base Thyming) replaced by Uracil in RNA Very importantly, mRNA is small and can easily exit the nucleus and the cytoplasm, where proteins are made. RNA Polymena. DA —> — ProteinTranslation > Steps: 1. . As the strand of mRNA slides through the ribosome, tl The sequence encoded in the mRNA molecule is d and converted to an amino acid sequence in a proc called translation. After a mature MRNA leaves the nucleus of a cell, it heads for a ribosome in the cell’s cytoplasm where tl code it contains can be translated to produce a prot code is read three nucleotides at a time (called a cod Each codon specifies one amino acid in the polypepti chain of a protein which are linked together to fo, protein.DNA ron 3 DNA Sra IY [el ane Waaueen molecule, TESEGETETETEGECE CH TECHA| owe 8 ited! py Gene 2 wove Auch 3 ¢ | a Oe Amino acidAmin acids mRNA AUGACGGAUCAGCCGCAAGCGGAAUUGGCGUUUACGUACGAUGCGCCG Tal el I Stop Codon! — Codon CeedonCodon » Acodon is a trinucleotide sequence of DNA or RNA that. corresponds to a specific amino acid. The genetic code describes the relationship between the sequence of, DNA bases (A, C, G, and T) in a gene and the corresponding protein sequence that it encodes. PN ot -1g—Ne Mat 00 ne Ol NL sn A ReL0 MOAN GAG bases. There are 64 different codons: 61 specify amino while the remaining three are used as stop signals.Comparison between translation a transcription Bic lrcea) CMM CLaC To make RNA_ To synthesize proteins which are used Purpose Definition Products Location copies of individual genes Transcription is the synthesis of RNA from a DNA template. mRNA Nucleus for cellular functions Translation is the synthesis of a protein from an mRNA template. i.e., translating the DNA genetic information carried by mRNA to synthesize proteins. This is the second step of gene expression. Proteins Cytoplasmae