9

Science
Quarter 1 – Module 6
DNA, GENES AND CHROMOSOMES

Source: https://www.pngkit.com/bigpic/u2t4o0e6w7i1q8w7/
Science– Grade 9
Quarter 1 – Module 6: DNA, GENES AND CHROMOSOMES

Republic Act 8293, section 176 states that: No copyright shall subsist in any
work of the Government of the Philippines. However, prior approval of the government
agency or office wherein the work is created shall be necessary for exploitation of such
work for profit. Such agency or office may, among other things, impose as a condition
the payment of royalties.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this book are owned by their respective copyright holders.
Every effort has been exerted to locate and seek permission to use these materials
from their respective copyright owners. The publisher and authors do not represent
nor claim ownership over them.

Regional Director: Gilbert T. Sadsad

Assistant Regional Director: Jessie L. Amin

Development Team of the Module

Writer: Gracea M. Manjares

Editor: Benjie L. Cadag

Reviewer: Emily Esmabe

Illustrator

Layout Artist:
Explain the different patterns of
Non-Mendelian inheritance.
 Supplementary Learning Module for Junior High School Learners

LESSON 6

DNA, GENES AND CHROMOSOMES

In your Grade 8 Biology, you learned how some traits are passed on from
parents to offspring following the Mendelian principles. However, not all traits are
inherited the same way. In this module, the discussion will focus on the structure of
the genetic materials and the different non-Mendelian patterns of inheritance.

All living things are composed of cells. These cells are governed by the central
processing unit we call the nucleus. Inside the nucleus are threadlike structures called
chromosomes containing the genetic materials called DNA. Inheritance of traits
depends on their behavior during sexual reproduction.

Just like any structure, chromosomes are

made up of units organized together. Do you want
to have a mental picture of these structures? Read
on and perform the activities prepared for you in this
module.
At the end of the module, you should be able to:

 describe the structure of the DNA molecule;

 infer that a particular gene has specific location in the chromosomes;
 appreciate the role of genes in storing genetic information.
A. Directions: Identify what is asked or described in each item then write the letter
of the correct answer.

1. Which is correctly sequenced from smallest to the biggest unit?

a. Chromosomes, nucleosomes, DNA molecules and chromatin
b. DNA molecules, nucleosomes, chromatin and chromosomes
c. Nucleosomes, DNA molecules, chromatin and chromosomes
d. Genes, DNA molecules, chromatin and chromosomes

2. Which of the following statements is correct?

a. Genes are made up of chromosomes.
b. DNA are made up of genes.
c. Genes are made up of DNA molecules.
d. Genes are found in DNA molecules.

3. In humans, there are about 30,000 genes found in the 23 pairs of

chromosomes. What do you think would happen if a part of the chromosome
is lost with 2 or more genes in it?
a. The trait controlled by these genes will not be expressed.
b. This may result to abnormalities in an individual.
c. There will be no effect in an individual.
d. Both statements a and b are correct
B. Match column A and B.

Name of Part Illustration

1. genes

a.
Adapted from Grade 8 Learners Manual page 322

2. DNA double helix

b.
Source: https://courses.lumenlearning.com/suny-wmopen-
biology1/chapter/eukaryotic-gene-regulation/

3. chromatin

c.
Source: https://www.genome.gov/genetics-glossary/Double-
Helix

4. nucleosome

d.

5. chromosome

e.
Source: https://www.shmoop.com/study-
guides/biology/dna/dna-packaging
 Hi! How did you find the test?
I’m sure you encountered some of these terms and
structures in your Grade 8 Biology. So just check your
answers using the answer key section. But don’t worry
if you got a low score. This just means that there are
more things that you can learn from this module. So,
hop on!

Let’s find out if you have any idea of the relationship between DNA, genes and
chromosomes by doing this simple task.

Directions: Read each statement and check the appropriate box at the right.

NOT
STATEMENT CORRECT NOT SURE
CORRECT
1. DNA is found in genes.

2. Genes are found in DNA.

3. Chromosomes are found in DNA.

4. DNA is found in chromosomes.

5. Genes are made up of DNA.

6. DNA is made up of genes.

7. Chromosomes are made up of
DNA.
8. DNA is made up of
chromosomes.
9. Chromosomes are made up of
genes.
10. Genes are found in
chromosomes.

CONFUSED???
That’s ok. You will go back
to these questions after you are
done with the activities in this
module.

Directions: Study the illustration below.

 Source: https://qph.fs.quoracdn.net/main-qimg-155a58a13ca50d661a1b293c23b0d0d4

Levels of Organization of the Chromosomes

A. Supply the needed term or information in the following statements: (Refer to the
choices below)

genes chromosomes DNA nucleotides

chromatin nucleosomes

1. The structure that is so compact and becomes visible during cell division is:
______________________________________________________________
2. The structure that is composed of coiled strands of nucleosomes is called:
______________________________________________________________
3. Segments of chromatin that code for a trait are called ___________________

4. In order to shorten during cell division, the DNA double helix coil around
histone proteins and form _________________________________________

5. The basic units of the DNA molecule that form the double helix are the
______________________________________________________________
6. Arrange these structures from the largest to the smallest (chromatin, DNA
nucleotides, genes
The genetic materials in the nucleus of our cells like any other structures are so
organized and also made up of building units. The largest structures visible under the
microscope during cells division are called the chromosomes. These chromosomes
are composed of super packed coiled threadlike structures called the chromatin
which in turn are composed of nucleosomes grouped together. These nucleosomes
are the DNA strands that wound themselves around a histone protein.
What do you think is the purpose of packing the DNA strands into a super-
packed chromosome?

Source: https://sites.google.com/a/gshare.blackgold.ca/nielsen/home/biology-30/cells-chromosomes-dna
The Hierarchical Structure of DNA through to the Chromosome
 A long segment of chromatin in the
chromosome that code for a certain trait is called the
gene. Genes are the ones that are actually shuffled
in different combinations, as they are passed on
from parents to offspring during sexual reproduction.
They carry the hereditary traits that are inherited by
children from their parents.

The illustration at the right shows the parts

of the chromosome. Several genes may be found in
this chromosome.

QUESTION:
*What is the role of the genes in storing genetic
information

Now that you had a brief review of the structure and organization of the chromosomes,
let’s take a look at the basic unit of the DNA molecule, the nucleotide.

A. At the right is the structure of the nucleotide.

Source: https://quizlet.com/113828289/dna-structurefunctionreplication-flash-cards/
Parts of a Nucleotide
Q1. What are the 3 parts of a nucleotide?
________________________________________________________________
Q2. How are they attached to one another?
________________________________________________________________

B. The illustrations below are the 4 types of nucleotides.

Source: https://knowgenetics.org/nucleotides-and-bases/

The Four Types of Nucleotides

Q3. What parts similar to the 4 types of nucleotides?

__________________________________________________________________
_______

Q4. What part is different from among them?

Q5. Nucleotides are named according to the nitrogenous base they contain.

What are these 4 nucleotides?

__________________________________________________________________
_______

Two of these nitrogenous bases have one ring only whereas the other two have
two rings. Nucleotides with one ring are called Pyrimidines. Those with 2 rings are
called Purines.

Q6. What are the two Pyrimidines? ______________________________________

Q7. What are the 2 Purines? ___________________________________________

 Look closely at how the nucleotides are
attached to one another to form a strand. A strand
is a chain of nucleotides.

Q8. In the illustration at the right, how many

strands are there? ____________________

Q9. What parts of the nucleotides are connected

to form a strand?
___________________________

Take note that the nitrogenous bases form

Hydrogen bonds with another nitrogenous base
from another strand so that they form a structure
that looks like the rung of a ladder.

Q10. To which nucleotide does a Thymine

nucleotide pair up? ___________. What is the
pair of Guanine nucleotide? _____________ Source:
https://journals.sagepub.com/doi/abs/10.1177/10
99800416678321?journalCode=brna

Q11. How many hydrogen bonds are formed between Thymine and Adenine?
_____
What about between Guanine and Cytosine? ___________
What are the base pairings?
___________________________________

Q12. In a long strand of DNA molecule, will there be an equal

number of guanine and cytosine nucleotides in it?
________________________

Q13. In a long strand of DNA molecule, will there be an equal

number of thymine and adenine nucleotides in it? The DNA double helix
_____________________________________________________
Source:
https://www.genome.gov/genetics-
Q14. Describe the double helix structure of the DNA molecule. glossary/Double-Helix

__________________________________________________________________
_____________________________________________________________
 Adapted from Grade 9 Learners Manual pp. 21.

Let’s have a short activity to determine how well you

understand the structure and base pairing of the
nucleotides by doing this simple task.

Use the base pairing rule to determine the sequence of the complementary
strand or pair strand of the given strand. Write your answer on the space provided
for.
1.
DNA strand AATCCGTACGTACGTACGTAC
Complementary strand

2.
DNA strand CATGACCTGAACTTGGGCAAA
Complementary strand

3. Create your own strand and its complimentary strand.

DNA strand
Complementary strand
 1. What could happen if a nucleotide is removed from the chain?
____________________________________________________________
____________________________________________________________
2. How will a change in the nucleotide sequence affect the genes and
chromosomes?
____________________________________________________________
____________________________________________________________
3. What are some of the ways by which the nucleotide sequence can be
changed? -
____________________________________________________________
____________________________________________________________

Well, it’s nice if you try to answer these questions but they will be
answered when you go to the next Grade level. For now, the focus of the
discussion is on the relationship between DNA, genes and chromosomes and
the structure of the DNA molecule.

I have learned that…

______________________________________________________________
______________________________________________________________
______________________________________________________________

I wish to ask my teacher about…

______________________________________________________________
______________________________________________________________
______________________________________________________________
 A. For a more comprehensive discussion of the
topic and if you have access to the
internet, you can access the following
links:

1. Structure of the nucleic acid

http://www.sivabio.50webs.com/nucleicacidstructure.htm
2. DNA: The Book of You
3. https://betterlesson.com/lesson/633524/dna-the-molecule-of-life?from=search
4. The hierarchical structure of DNA through to the chromosomes
https://sites.google.com/a/gshare.blackgold.ca/nielsen/home/biology-30/cells-
chromosomes-dna
5. The nucleotide molecule
https://biochemuwi1362.files.wordpress.com/2014/04/a9069290.gif
6. The DNA double helix https://geneed.nlm.nih.gov/topic_subtopic.php?tid=15&sid=16
7. Mechanisms of mutation : http://www.biochem.uthscsa.edu/med/06-8. Mechanisms-of-
Mutation/PrereqMechanismsofMutation_print.html

B. You can also perform Activity 6: DNA modeling on page 20 of the Learners
manual.

The words used in this module are defined as follows:

1. Chromosomes – supercoiled compact chromatin visible under the microscope

during cell division.
2. Genes – portions in the chromosomes that code for a particular trait.
3. DNA – deoxyribonucleic acid
4. Chromatin – threadlike structure of the chromosome composed of nucleosomes
5. Nucleosome – structure formed when DNA coiled around a protein molecule.
 6. Nucleotide – the building blocks of the DNA molecule made up of the phosphate
group, deoxyribose sugar and the nitrogen-containing base (either adenine,
thymine, cytosine or guanine).

1. What are the components of the nucleotides?

______________________________________________________________

2. If you get DNA from you and your classmate’s skin, would it have the same or
different nucleotide? Explain your answer
_______________________________________________________________
_______________________________________________________________

3. If you examine your DNA sequences in all of your chromosomes would it be the
same or different? Explain your answer.
_______________________________________________________________
_______________________________________________________________
4. If you compare your DNA sequence with that of your classmate’s, would it be the
same or different? Explain your answer.
_______________________________________________________________
_______________________________________________________________

Congratulations, you have finished the first part

of this module!
Please check your answers by referring to the
answer key. If you feel you need more information or
explanations, you can ask your teacher or surf the
internet using the given links.
Try this
1. b
2. c
3. d

Match the following:

1. d
2. c
3. e
4. b
5. a

YES, NO, I DON’T KNOW

NOT
STATEMENT CORRECT NOT SURE
CORRECT
1. DNA is found in genes. /

2. Genes are found in DNA. /

3. Chromosomes are found in DNA. /

4. DNA is found in chromosomes. /

5. Genes are made up of DNA. /

6. DNA is made up of genes. /

7. Chromosomes are made up of
/
DNA.
8. DNA is made up of
/
chromosomes.
9. Chromosomes are made up of
/
genes.
10. Genes are found in
/
chromosomes.

B. Supply the needed term or information in the following statements:

1. The structure that is so compact and becomes visible during cell division is:
chromosome
2. The structure that is composed of coiled strands of nucleosomes is called:
 chromatine
3. Segments of chromatin that code for a trait are called genes
4. In order to shorten during cell division, the DNA double helix coil around histone
proteins and form nucleosomes
5. The basic units of the DNA molecule that form the double helix are the DNA
nucleotides.
6. Arrange these structures from the largest to the smallest (chromosome, DNA,
genes) chromosomes, genes, DNA

Explore:

Q1. What are the 3 parts of a nucleotide?

phosphate group, deoxyribose sugar and nitrogenous base

Q2. How are they attached to one another?

The phosphate group is attached to the 4th carbon of the deoxyribose sugar
whereas the N-base is attached to the 1st carbon

Q3. What are the parts similar to the 4 types of nucleotides?

The parts common to all are the phosphate groupn are the phosphate
group and the 5-carbon sugar.

Q4. What is the part that differs among them?

The Nitrogenous base

Q5. Nucleotides are named according to the nitrogenous base they contain. What are
these?
Adenine nucleotide, Thymine nucleotide, Cytosine nucleotide and Guanine
nucleotide

Q6. What are the Pyrimidines? Thymine and Cytosine

Q7. What are the 2 Purines? Adenine and Guanine

Q8. In the illustration at the right, how many strands are there? Two

Q9. What are the parts of the nucleotides are connected to form a strand?
Phosphate group and deoxyribose sugar

Q10. To which nucleotide does a Thymine nucleotide pair up? Adenine nucleotide
What is the pair of Guanine nucleotide? Cytosine nucleotide

Q11. How many hydrogen bonds are formed between Thymine and Adenine? Two
What about between Guanine and Cytosine? Three
What are the base pairings? Thymine – Adenine, Cytosine - Guanine

Q12. In a long strand of DNA molecule, will there be an equal number of guanine and
cytosine nucleotides in it? Yes

Q13. In a long strand of DNA molecule, will there be an equal number of thymine and
adenine nucleotides in it? Yes
Q14. Describe the double helix structure of the DNA molecule

The double helix of DNA is like a twisted ladder in which the base pairs at
the center form the rungs of the ladder. The sides of the ladder are composed
of the alternating sequence of sugar and phosphate group.

APPLY WHAT YOU HAVE LEARNED

DNA strand AATCCGTACGTACGTACGTAC

Complementary strand TTAGGCATGCATGCATGCATG

DNA strand CATGACCTGAACTTGGGCAAA

Complementary strand GTACTGGACTTGAACCCGTTT

ASSESS WHAT YOU HAVE LEARNED

1. What are the components of the nucleotides?

Phosphate group, deoxyribose sugar and nitrogen-containing base

2. If you get DNA from you and your classmate’s skin, would it have the same
or different nucleotide? Explain your answer
I would get the same type of nucleotides since all DNAs are made up of only
the 4 nucleotides.

3. If you examine your DNA sequences in all of your chromosomes would it be

the same or different? Explain your answer.
All of my chromosomes have the same sequence of DNA nucleotides since
they originated from a zygote that divided repeatedly.

4. If you compare your DNA sequence with that of your classmate’s, would it
be the same or different? Explain your answer.
The DNA sequence of my classmate will be different from my own because
we are two different individuals.
Grade 8 Learners Manual page 322
Grade 9 Learners Manual
https://courses.lumenlearning.com/suny-wmopen-biology1/chapter/eukaryotic-gene-
regulation/
https://www.genome.gov/genetics-glossary/Double-Helix

https://www.shmoop.com/study-guides/biology/dna/dna-packaging
https://quizlet.com/113828289/dna-structurefunctionreplication-flash-cards/
https://knowgenetics.org/nucleotides-and-bases/
https://www.genome.gov/genetics-glossary/Double-Helix

https://betterlesson.com/lesson/633524/dna-the-molecule-of-life?from=search