Published March 20, 2015
Research
Loss of Genetic Diversity of Jatropha curcas L.
through Domestication: Implications
for Its Genetic Improvement
Haby Sanou,* Miguel Angel Angulo-Escalante, Jorge Martínez-Herrera, Souleymane Koné, Albert Nikiema,
Antoine Kalinganire, Jon Kehlet Hansen, Erik Dahl Kjær, Lars Graudal, and Lene Rostgaard Nielsen
ABSTRACT
Jatropha curcas L. has been promoted as a
“miracle” tree in many parts of the world, but
recent studies have indicated very low levels
of genetic diversity in various landraces. In this
study, the genetic diversity of landrace col-
lections of J. curcas was compared with the
genetic diversity of the species from its native
range, and the mating system was analyzed on
the basis of microsatellite markers. The genetic
diversity parameters were estimated, and analy-
sis of molecular variance, principal coordinate
analysis, and unrooted neighbor-joining tree
were used to describe the relationship among
populations. Results confirmed very low genetic
diversity in African and Asian landraces. Mexi-
can populations from the regions of Veracruz,
Puebla, and Morelos were also found to have
low levels of diversity (mostly monomorphic),
while populations from Chiapas were polymor-
phic with an expected heterozygosity between
0.34 and 0.54. Bayesian analysis showed dif-
ferentiation according to geographic locations,
which was confirmed by principal coordinate
analysis and neighbor-joining tree. Estimations
of outcrossing rate of individual families from
Chiapas showed that some mother trees were
mainly outcrossing. Mating system could not
be estimated in the landraces from Mali and
populations from Veracruz, Puebla, and More-
los (Mexico), as these were highly monomor-
phic. The observed low level of genetic diver-
sity in some of the populations and landraces
suggests that breeding programs should test
for genetic variation and heritability in relevant
quantitative traits and estimate if sufficient gain
can be expected from traditional testing and
selection. Diversification of the local gene pools
may be considered for breeding and selection.
crop science, vol. 55, march– april 2015  www.crops.org 749
H. Sanou, and S. Koné, Institut d´Economie Rurale (IER) Forestry
Research Program, Sotuba BP 258, Bamako Mali; M.A. Angulo-
Escalante, Centro de Investigación en Alimentación y Desarrollo
A.C., Unidad Culiacán. Carretera a Eldorado. Km. 5.5. Culiacán,
Sinaloa, México. CP 80110; J. Martinéz-Herrera, JatroBioEnergy
and Oilseeds SPR de RL. Street Sureno Carranza 233-4. Col. E.
Zapata, Cuautla, Morelos. Mexico. ZIP 62744; A. Nikiema, For-
est Assessment, Management and Conservation Division, For-
estry Dep.,  FAO, Viale delle Terme di Caracalla 00153 Rome, Italy;
A. Kalinganire, ICRAF-WCA/Sahel BP E5118, Bamako, Mali;
H. Sanou, J.K. Hansen, E.D. Kjær, L. Graudal, and L.R. Nielsen, Dep. of
Geosciences and Natural Resource Management, Univ. of Copenhagen,
Rolighedsvej 23, 1958 Frederiksberg C, Denmark. Received 28 Feb.
2014. *Corresponding author: (hsan@ign.ku.dk, habysanou@yahoo.fr).
Abbreviations: FPT, genetic differentiation among populations;
AMOVA, analysis of molecular variance; GIS, Genetic Identification Ser-
vices; Ho, observed heterozygosity; He, expected heterozygosity; ICRI-
SAT, International Crops Research Institute for the Semi-Arid-Tropics;
IND1, 2, 3, …11, Indian seed lots; K, number of clusters; MCMC, Mar-
kov Chain Monte Carlo; MJJL 1, 2, 3, … MJJL 18, Mexican collections
from 2009; N, number of individuals (sample size); Na, average number
of observed alleles per locus; Ne, average effective number of alleles per
locus; PCO, principal coordinate analysis; PCR, polymerase chain reac-
tion; tm, multilocus outcrossing rate; ts, single locus outcrossing rate.
G enetic variation within and among populations of tree
species is in general considered of crucial importance for
the species’ ability to respond to environmental changes, includ-
ing occurrence of new pests and pathogens, and therefore essential
for long-term evolutionary potential and survival of the species
Published in Crop Sci. 55:749–759 (2015).
doi: 10.2135/cropsci2014.02.0165
© Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA
All rights reserved. No part of this periodical may be reproduced or transmitted in any
form or by any means, electronic or mechanical, including photocopying, recording,
or any information storage and retrieval system, without permission in writing from
the publisher. Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.
(Aguilar et al., 2008; Aitken et al., 2008; Jump et al., 2009).
Furthermore, presence of genetic diversity in traits of com-
mercial and adaptive significance is essential for progress in
breeding and domestication (Walsh, 2008). Studies based on
molecular markers have shown that temperate and tropical
trees in general maintain high diversity within populations
(Hamrick and Godt, 1996; Abayneh et al., 2011). This char-
acteristic of trees is often attributed to life history traits,
including outcrossing and efficient gene dispersal, because
outcrossing plant species with effective pollen dispersal in
general have higher genetic diversity than selfing species
(Hamrick et al., 1992; O’Connell et al., 2006).
Anthropogenic activities can lead to reduced genetic
diversity in multiple ways. Logging or destruction of trees
that reduce populations to critical sizes can cause genetic
erosion, which combined with reduced gene flow may
lead to elevated inbreeding, increased divergence between
populations, and genetic bottlenecks (Aldrich et al., 1998;
Fuchs et al., 2003; Cascante et al., 2002). Low levels of
genetic diversity in the introduced populations can be due
to single introductions based on genetically narrow mate-
rial (Lee, 2002; Novak and Mack, 2004). Multiple intro-
ductions of diverse populations and large founder numbers
can prevent loss of genetic diversity and even increase the
genetic diversity (Kjær and Siegismund, 1995; Dlugosch
and Parker, 2008; Uller and Leimu, 2011).
The effect of decreased diversity on average fitness dif-
fers between species and environments. Highly outcross-
ing species may suffer from inbreeding depression when
exposed to high levels of autozygosity, probably because
of recessive, mildly deleterious alleles in wild populations
that tend to be accumulated under outcrossing (Charles-
worth and Charlesworth, 1987; Husband and Schemske,
1996). Anthropogenic activities can significantly influ-
ence the outcrossing rate of populations (Eckert et al.,
2010), and the dynamics of mating systems are therefore
of specific interest when studying the impact of utiliza-
tion and conservation of commercially interesting species.
Understanding of the mating system functioning is also
important in order to design optimal breeding programs,
because effective crossing, selection, and deployment
regimes are highly dependent on the breeding system
(Sleper and Poehlman, 2006).
Jatropha curcas L. is a multipurpose perennial shrub or
tree species belonging to the family Euphorbiaceae. The
species originated from Mexico and neighboring parts of
Central America but have been spread to tropical and sub-
tropical countries around the world for centuries (Heller,
1996; Kumar and Sharma, 2008). According to Ginwal et
al. (2005) and Ganesh et al. (2008), the species was intro-
duced to Africa from Mexico via Cape Verde in West
Africa. In India, it is believed to have been introduced
by Portuguese seafarers during the 16th century (Singh et
al., 2010). The species plays an important role in tropical
750 www.crops.org crop science, vol. 55, march– april 2015
farming systems as it has several attributes. It is used as
live fences to protect gardens and farm fields since it is
not browsed by livestock (King et al., 2009). The seeds
are rich in oil content (30–40%), which can be used as
biofuel in industries and in agriculture ( Jayasingh, 2004;
Dyer and Mullen, 2008; Fairless, 2007). The seed oil con-
tains in general a high level of antinutritional factors such
as phorbol esters (Makkar et al., 1998). However, seeds
from nontoxic specimens are known to be consumed in
Mexico (Martinez-Herrera et al., 2006).
The reproductive biology of the species is poorly
understood. The plant is monoecious, with unisexual
flowers visited by insects (Luo et al., 2007; Liu et al.,
2008). Controlled pollination experiments suggest that J.
curcas has the ability to self-pollinate (Bhattacharya et al.,
2005). Reproduction through apomixis has also been sug-
gested (Bhattacharya et al., 2005; Negussie et al., 2014).
Because of the high oil content in the seeds, and the abil-
ity of J. curcas to survive and grow in tropical semiarid
areas, it has been promoted as a “miracle” tree in many
parts of the world. Despite the low genetic diversity sug-
gested by many authors (Sun et al., 2008; Tatiana et al.,
2010; Singh et al., 2010), and uncertainties regarding the
breeding system and seed productivity, the species is being
planted extensively in the tropics with high expectations
for oil production (Achten et al., 2008).
The purpose of the present study is to analyze the
genetic diversity and structure of J. curcas populations
from areas where it was introduced (Africa and Asia) and
from areas where it is native (Mexico) by microsatellite
markers. The outcrossing rate of the species was also esti-
mated in order to improve our understanding of its mating
system. Three main questions were addressed: (i) What is
the extent of the genetic diversity and genetic differentia-
tion in J. curcas at the global level and in the putative center
of origin of the species? (ii) Is the species predominantly
selfing or outcrossing? (iii) Can the genetic structure of
the species be explained by the introduction history and/
or by the mating system of the species?
MATERIALS AND METHODS
Leaf Sampling
In Africa, seeds were collected in Kenya, Tanzania, and Uganda
in East Africa and Mali, Gambia, Guinea Bissau, and Burkina
Faso in West Africa. The seedlings were grown at Samanko, and
the leaf material was provided by ICRAF–WCA/Sahel (Mali).
Leaf material from 11 Indian seed sources (IND1 to IND11)
grown in a field trial at Sadoré, Niger, together with three West
African landraces (two from Mali and one from Guinea Bissau)
and two accessions expected to originate from direct introduc-
tions from Mexico (‘Laspillas’ and ‘Mexico’) were provided
by ICRISAT (International Crops Research Institute for the
Semi-Arid-Tropics, Niger). Leaf material from these 16 acces-
sions was collected in May 2009 and used for this study. The
remaining material from Africa was provided by individual
Table 1. Sampling locations of Jatropha curcas including included both materials known to be toxic and material from
region, location, label (as used in Fig. 1), sample size, and nontoxic varieties. At each collection site, the geographic coor-
seed toxicity. dinates were registered using a global positioning system (GPS)
Sample (data not shown), and one leaf was collected from each tree.
Country Region Location size Label Toxicity
Mexico North America Veracruz 10 MJJL1 No Offspring Arrays for Outcrossing
Mexico North America Veracruz 11 MJJL2 No Rate Estimation
Mexico North America Veracruz 11 MJJL4 No Seeds were collected from fruit-producing mother trees in
Mexico North America Chiapas 9 MJJL5 Yes Mexico and Africa (Mali) for comparison of mating system. In
Mexico North America Chiapas 22 MJJL6 Yes Mexico, only a few trees had fruit during the collection period,
Mexico North America Chiapas 11 MJJL7 Yes but seeds were sampled and analyzed from 22 mother trees in 8
Mexico North America Chiapas 5 MJJL9 Yes of the 15 visited populations in Mexico.
Mexico North America Chiapas 3 MJJL10 Yes In Mali (Africa), many trees were fruiting when sampling
Mexico North America Chiapas 6 MJJL11 Yes took place and seeds were collected from 60 mother trees from
Mexico North America Puebla 7 MJJL12 No two sites (Kita and Mopti). However, because of the monomor-
Mexico North America Puebla 3 MJJL13 No phism of African landraces, only 10 mother-offspring pairs were
Mexico North America Puebla 11 MJJL14 No analyzed. Fruits were oven-dried and seeds removed and stored
Mexico North America Veracruz 8 MJJL15 No in a refrigerator until sowing.
Mexico North America Morelos 6 MJJL17 Yes In May 2010, 30 seeds were sown from each mother tree.
Mexico North America Morelos 15 MJJL18 Yes If fewer than 30 seeds were available, all seeds were sown. The
Mexico North America Mexico 5 Mexico Yes seedlings were watered once a day with one liter of water per
Mexico North America Laspillas 4 Laspillas Not seedling. Two months after germination, the leaves were sampled
known
from 8 to 22 seedlings per mother tree. The leaves were dried in
Guatemala Central America Guatemala 10 Guatemala Yes
silica gel until DNA extraction.
India Asia India 12 IND1 Yes
India Asia India 12 IND2 Yes
India Asia India 12 IND3 Yes Genotyping
India Asia India 12 IND4 Yes DNA extraction from all leaf samples was performed by using
India Asia India 10 IND5 Yes DNeasy 96 Plant Kit (Qiagen), following the recommendations
India Asia India 12 IND6 Yes of the manufacturer instructions (2006) for dried material.
India Asia India 12 IND7 Yes For genetic diversity studies, previously published primer
India Asia India 12 IND8 Yes pairs were used, and additional ones were developed. Three
India Asia India 12 IND9 Yes primer mixes were used. Mix 1 included the primer pairs Jcds24,
India Asia India 12 IND10 Yes Jcps6, Jcps20, Jcps21, and Jcms30, all from Sudheer-Pamidimarri
India Asia India 12 IND11 Yes et al. (2009b) together with Jc11 (from Sun et al., 2008). Mix
Kenya East-Africa Mgummani 3 Mgummani Yes 2 included the primers Jc01, Jc07, Jc09, Jc10, Jc13, and Jc17 all
Kenya East-Africa Shimba hills 3 Shimba Yes from Sun et al. (2008). Additional microsatellite primer pairs
hills were developed for J. curcas from two di-nucleotide microsatellite
Tanzania East-Africa Singida 3 Singida Yes enriched genomic libraries produced by Genetic Identification
Tanzania East-Africa Arhusha 11 Arhusha Yes Services (GIS; www.genetic-id-services.com, accessed 2 Dec.
Uganda East-Africa Mukono 3 Mukono Yes 2014). In one library (CA) 41 of 58 clones included a micro-
Burkina West-Africa Gueguere, 10 Burkina Yes satellite, and in the other library (GA), 48 of 60 clones had a
Faso Tiakora, microsatellite. Genetic Identification Services designed prim-
Kienako,
Bobo ers using Designer PCR version 1.03 (Research Genetics) and
Gambia West-Africa Gambia 10 Gambia Yes tested 24 of the loci, of which four were polymorphic. Locus
Guinea West-Africa Guinea 4 Guinea Yes name and sequences of the four polymorphic primers are as fol-
Bissau Bissau lows: Jac113, Forward-GAGGAGAAGGGACATCTCTCAG /
Mali West-Africa Mopti 10 Mopti Yes Revers-AGCATGGTGATTACTTGTCAGC; Jac118, Forward-
Mali West-Africa Kita 10 Kita Yes CCAGAGAAATCGCAAAGTTG/Revers-GCATCCAGGTA-
Mali West-Africa Mali 6 I-Mali Yes ACTGTTTATCC; Jac103, Forward-GGTTCATACGCGAC-
Mali West-Africa Mali 5 Falou Yes TTGA / Revers-TAGTGGCGAATGACTGTTG; and Jac109,
Forward-GAGGAGGAAGGCCACAAG/Revers-TGACCGAT-
scientists. In addition, samples with expected origin from Gua- TTCGTCGATC.
temala were provided by Mali Folke Center. From each tree, The primers for these loci were combined in a third mix.
one leaf was sampled and put in a plastic bag containing silica gel The same multiplex polymerase chain reaction (PCR) protocol
to dry the leaves. Sample information is given in Table 1. was used for this mix as for the two others. All primers were
In Mexico, material was collected in November 2009 from purchased from Applied Biosystems, and forward primers were
trees grown in villages, in the fields, and in natural populations fluorescently labeled.
(referred to as the MJJL collections, Table 1). The sampling

crop science, vol. 55, march– april 2015  www.crops.org 751

 The final volume of each PCR reaction was 10 µL, which
included 3.2 µL H 2O, 1 µL 10X primer mix, 5 µL 2X Qiagen
master mix, 0.8 µL DNA (~25 ng). Polymerase chain reactions
were finalized on Applied Biosystems Thermal Cyclers (models
2700 and 9700). The temperature profile consisted of an initial
denaturation step of 15 min at 95°C, followed by 30 cycles.
Each cycle consisted of denaturation at 94°C for 30 sec, primer
annealing at 57°C for 90 sec, and extension at 72°C for 1 min,
with a final extension at 60°C for 30 min.
The amplified products were diluted 50-fold or more and
separated in an automated capillary sequencer system ABI 3130xl
(Applied Biosystems). The microsatellite patterns were visualized
and scored using the software GeneMapper (Applied Biosystems).
Eleven microsatellite loci were chosen for population genetic
analyses (Jac113, Jac118, Jac103, Jac109, Jcds24, Jcps21, Jcps30,
Jcps6, Jc11, Jcps20, Jc13) of which two were monomorphic. In
total, 365 individuals were genotyped and analyzed.
For outcrossing rate estimation, eight primer pairs were used:
Mix 1 included three of the new primer pairs (Jac103, Jac109,
Jac113) and Jc01 from Sun et al. (2008), and Mix 2 included the
new primer pair Jac118, Jcps21 from Sudheer-Pamidimarri et al.
(2009b), and Jc09 and Jc11 from Sun et al. (2008). Polymerase
chain reaction was performed and visualized as above.
In total, 32 maternal plants and 407 offspring derived from
those mother trees were genotyped with an average of 10 to 15
offspring per mother plant.
Data Analysis
To characterize the level of genetic diversity in landraces and
native populations from the worldwide collections (Africa,
India, and Central America), the average number of alleles
per locus (Na), the effective number of alleles per locus (Ne),
the observed heterozygosity (Ho), and expected heterozygos-
ity (He  = gene diversity) were calculated using the software
GenAlex version 6.41 (Peakall and Smouse, 2006).
Relationships among populations were described with an
unrooted neighbor-joining tree based on Nei’s genetic distance,
which assumed that differences arose by genetic drift and muta-
tions. The neighbor-joining method of Saitou and Nei (Saitou
and Nei, 1987) was applied with the software MEGA version 5
(Tamura et al., 2011). Analysis of molecular variance, AMOVA,
was applied as implemented in GenAlex6.41 to estimate the
partitioning of microsatellite variation within and among pop-
ulations and regions of J. curcas global population on the basis of
the global dataset. The analysis was performed on the basis of
distance matrix derived from the genotypic data, and tests were
based on permutation procedures (Excoffier et al., 1992).
Four regions were considered: East and West Africa, Asia
(India), and America (Mexico and Guatemala).
For the Mexican populations, deviations from Hardy-Wein-
berg proportions for the polymorphic loci in the polymorphic
populations from Chiapas (MJJL 5, 6, 7, 9, 10, 11) were tested
with the software Genepop vers. 4.2.1 (Raymond and Rous-
set, 1995). A Markov-chain algorithm (10,000 dememorization
steps, 20 batches, and 50,000 iterations per batch) was used to
obtain unbiased estimates of the exact P values. The Bonferroni
procedure was applied to calculate table-wide levels of signifi-
cance, where the test with smallest significance level is judged
significant, if P1 < a/n, where n is the number of tests (here
752 www.crops.org crop science, vol. 55, march– april 2015
the number of loci and populations) (Holm, 1979). The second
smallest P value was declared significant if P2 < a/(n - 1) and
so forth.
Analysis of molecular variance was also applied on the basis
of the data from Mexican populations only with GenAlex 6.41,
where FPT = estimated variance among populations/(estimated
variance within populations + estimated variance among pop-
ulations) following Peakall and Smouse (2006).
Principal coordinate analysis (PCO) was used to analyze and
visualize patterns of variation in the multivariate dataset. The
analysis was based on Euclidean genetic distance matrix and con-
ducted in GenAlex version 6.41 (Peakall and Smouse, 2006).
The genetic structure of Mexican populations was also inferred
using the software STRUCTURE version 2.3.4 (Pritchard et al.,
2000; Falush et al., 2003). This method assigned each individual to
a number of homogeneous clusters (populations) using a Bayesian
approach. The loci were coded as diploid codominant markers.
Admixture and correlated allele frequencies were assumed in the
model as recommended by Pritchard et al. (2000). Information
on sampling localities was not applied a priori. Several lengths
of burn-in periods and Markov Chain Monte Carlo replicates
(MCMC) were tested for consistent results over runs; 100,000 was
chosen for burn-in period and 1,000,000 for MCMC for the final
run. The program was also run with increasing numbers of clusters
(K) (burn-in = 10,000, MCMC = 100,000) to estimate the likely
number of clusters according to the approach described by Evanno
et al. (2005). Twenty independent runs were performed for each K
from 1 to 15 to estimate the test statistic ΔK.
Because of the lack of polymorphism at all localities but
Chiapas, outcrossing rate estimations were only performed
on families from Chiapas. Estimations were done using the
maximum likelihood computation under the mixed mating
model with the software MLTR 2.2 (Ritland, 2002) using the
Newton-Raphson method. The mixed mating model assumed
that each mating represented a random event of outcrossing or
self-fertilization (with probabilities t and [1 - t], respectively),
assuming no mutation, no selection following fertilization, and
random mating (Ritland and Jain, 1981). The following param-
eters were estimated for families and population: the multilocus
outcrossing rate (tm), the average single-locus outcrossing rate
(ts), and the difference between these (at population level only)
(tm - ts). If tm was larger than ts, it was an indication of biparental
inbreeding. The standard errors were estimated by numerical
resampling based on 1,000 bootstrap iterations.
RESULTS
Global Population Structure
African and Asian samples revealed very low levels of
genetic diversity. The mean number of alleles per locus
and population was 1 or close to 1. These populations were
fixed or almost fixed at all screened loci. The expected
and observed heterozygosity (He and Ho) were therefore 0
or close to 0 (data not shown). However, populations from
Mexico varied in the level of heterozygosity from 0 (MJJL
13, MJJL 18) to above 0.5 (MJJL 6, MJJL 9) (Table 2).
The total molecular variance attributable to the
regional divergence was 53%, with the remaining part
Table 2: Mean values and standard errors (in parentheses) Table 3. Analysis of molecular variance of Jatropha curcas
of genetic parameters in Mexican populations based on 9 global population. Groups are Eastern Africa, Western Africa,
polymorphic loci. India, and America.
Populations N† N a† Ne† Ho † He † Source of Sum of Estimated Percentage
variation df squares variance of variation
MJJL 1 10 1.11 1.09 0.01 0.05
(0) (0.11) (0.09) (0.01) (0.05) Among groups 3 1009.204 3.936 53%
Among populations 37 728.859 2.071 28%
MJJL 2 10.56 1.11 1.08 0.00 0.05
within groups
(0.18) (0.11) (0.08) (0.00) (0.05)
Within populations 324 456.394 1.409 19%
MJJL 4 10.89 1.44 1.19 0.02 0.11
Total 364 2194.458 7.415 100%
(0.11) (0.24) (0.12) (0.02) (0.06)
MJJL 5 8.89 2.56 1.88 0.31 0.34
(0.11) (0.5) (0.31) (0.1) (0.1) of MJJL 1, 2, 4, 12, 13, 14, 15, 17, and 18. These essen-
MJJL 6 21.11 4.11 2.69 0.49 0.53 tially monomorphic collections belong to the regions of
(0.35) (0.59) (0.43) (0.08) (0.08) Veracruz, Puebla, and Morelos. For the populations of
MJJL 7 10.78 4.0 2.69 0.45 0.48 Chiapas (represented by MJJL 5, 6, 7, 9, 10, and 11), the
(0.15) (0.80) (0.56) (0.1) (0.1)
average effective number of alleles per locus was higher
MJJL 9 6 3.67 2.77 0.56 0.54
than those from other collections from Mexico and varied
(0) (0.47) (0.43) (0.12) (0.09)
between 1.88 and 2.77. The expected heterozygosity
MJJL 10 3 2.56 2.12 0.37 0.44
(0) (0.34) (0.28) (0.09) (0.09) ranged between 0.34 and 0.54 (Table 2).
MJJL 11 5.89 2.78 2.06 0.47 0.41
Before Bonferroni corrections, 7 out of 44 tests (poly-
(0.11) (0.52) (0.3) (0.14) (0.09) morphic loci and populations) were significant at the 0.05
MJJL 12 7 1.11 1.04 0 0.03 level of significance. However, none of these tests were
(0) (0.11) (0.04) (0) (0.03) significant after Bonferroni correction, suggesting that the
MJJL 13 3 1 1 0 0 genotypic distributions in the populations were relatively
(0) (0) (0) (0) (0) close to Hardy-Weinberg proportions in the analyzed loci.
MJJL 14 11 1.11 1.1 0 0.05 Analysis of molecular variance showed a high among-
(0) (0.11) (0.1) (0) (0.05)
population variance also within Mexico (Table 4), reflect-
MJJL 15 8 1.22 1.13 0 0.08
(0) (0.15) (0.1) (0) (0.06)
ing strong differentiation among populations (FPT = 0.57).
When subjected to a PCO (Fig. 2), the first two coor-
MJJL 17 6 1.11 1.04 0 0.03
(0) (0.11) (0.04) (0) (0.03) dinates explained 64.63% of the total variation (35.40%
MJJL 18 15 1 1 0 0 for the first axis and 29.33% for the second). The popula-
(0) (0) (0) (0) (0) tions from Chiapas grouped together. The remaining col-
†
N, number of individuals; Na, average number of observed alleles per locus; Ne, lections had a tendency to group in two: MJJL 1, 2, 4,
average effective number of alleles per locus; Ho and He, observed and expected 12, 13, 14, and 15 formed one group, and MJJL 17 and 18
heterozygosities (per polymorphic locus).
constituted a third group. These groups corresponded to
almost equally partitioned among populations within Veracruz-Puebla and Morelos, respectively. In addition,
regions (28%) and among individuals within populations the PCO revealed structure among the Chiapas popula-
(19%) (AMOVA, Table 3). The neighbor-joining tree based tions, though with overlap between populations.
on Nei’s genetic distance showed a tendency of four groups The bar diagrams in Fig. 3 show admixture coef-
(Fig. 1). The first included all collections from Africa and ficients for all individuals when K = 3. Analysis with
India and the seed lot from Guatemala (24 collections). STRUCTURE revealed three clear Mexican groups
These populations were monomorphic or nearly mono- (with K = 3) similar to the Mexican groups found in the
morphic. The second group included the six collections neighbor-joining tree. MJJL 1, 2, 4, 12, 13, 14, and 15
from the Chiapas area of Mexico (MJJL 5, 6, 7, 9, 10, and from Veracruz and Puebla (Northeastern Mexico) repre-
11). The third group included individuals from the vicinity sented the first of the three groups. The trees from this
of Mexico City (MJJL 17 and 18 from Morelos), and the group were all considered nontoxic. The polymorphic
fourth group contained populations from the eastern part of populations from Chiapas (considered toxic) were found
Mexico (Veracruz and Puebla). The two ICRISAT collec- in a second group. The last group included MJJL 17 and
tions with origin from Mexico (“Laspillas” and “Mexico”) 18 from Morelos (also considered toxic). The approach of
were found among members of the fourth group. Evanno et al. (2005) suggested an extra group (K = 4),
with Chiapas divided into two clusters.
Genetic Structure in Mexico
For the polymorphic loci (9) the average effective number Outcrossing Rates
of alleles per locus (Ne) was close to 1, and the expected The offspring from monomorphic populations were
heterozygosity (He) was therefore close to 0 for collections likewise monomorphic and did not exhibit any foreign

crop science, vol. 55, march– april 2015  www.crops.org 753

Figure 1. Neighbor-joining tree for worldwide collections of Jatropha curcas collected in 2009 and 2010. See Table 1 for corresponding
locations. ______ Scale of the genetic distance

alleles. As seen in Table 5, the estimated outcrossing rates Table 4. Analysis of molecular variance of Mexican Jatropha
were high in families from Chiapas, apart from MJJL 6 curcas populations collected in 2009.
tree 1. The highest tm and ts were estimated for MJJL Sum of Variance Percentage
5 tree 2 (tm=1.003 ±0.001, and t s=1.016 ±0.035). At the Source df squares components of variation
population level, in Chiapas the average level of bipa- Among populations 14 555.023 4.025 57%
rental inbreeding (tm - ts) was 0.104 (0.023) and thus Within populations 124 374.136 3.017 43%
Total 138 929.158 7.042 100%

754 www.crops.org crop science, vol. 55, march– april 2015

Figure 2. Principal coordinates analysis in Mexican populations of Jatropha curcas (2009). Circles: Chiapas region; diamonds: Veracruz
and Puebla regions; squares: Morelos region.

Figure 3. Genetic structure in Jatropha curcas for Mexican populations (2009): Assignment of individuals to K = 3 clusters; each cluster
is represented by a different color. Blue: MJJL 1, 2, 4, 12, 13, 14, 15, Veracruz and Puebla (low diversity and nontoxic seeds); red: MJJL
5, 6, 7, 9, 10, 11, Chiapas (high diversity, toxic seeds); and green: MJJL 17 and 18, Morelos (low diversity, toxic seeds).

Table 5. Multilocus outcrossing rates (tm), single locus out-

significantly different from 0, suggesting some mating
crossing rate (ts), and their standard errors in brackets for five
families of Jatropha curcas from Chiapas (Mexico, collected between relatives in the population.
in 2009) and the population average. n = sample size.
Family ts SE (ts) tm SE (tm)
DISCUSSION
MJJL 6 Tree 1 (n = 17) 0.007 0.156 -0.618 1.268 Genetic Differentiation of Native and
MJJL 6 Tree 10 (n = 8) 0.856 0.096 1.000 0.001 Nonnative Jatropha curcas
MJJL 6 Tree 22 (n = 16) 0.645 0.072 0.947 0.020
MJJL 5 Tree 2 (n = 13) 1.016 0.035 1.003 0.001 In the present study, strong differentiation of the global
MJJL 5 Tree 4 (n = 21) 0.383 0.086 0.580 0.125 J. curcas populations (landraces and native populations)
Population 0.412 (0.033) 0.517 (0.040) was found at the regional level. The within-population
variance was low, which mirrors the high level of mono-
morphism found in many of the surveyed populations. As

crop science, vol. 55, march– april 2015  www.crops.org 755

indicated by the neighbor-joining tree (Fig. 1), the Afri-
can and Indian landraces were clearly separated from the
Mexican material. The Mexican samples seemed to divide
in three groups: one group including six collections from
Chiapas, another including the collections from Veracruz
and Puebla, and a third one with the collections from
Morelos.
The native populations from Mexico showed a similar
division of molecular variance with low within-population
variation. Strong genetic differentiation of Mexican popu-
lations was also illustrated by the structure analysis, clearly
separating the populations into three or four distinctive
gene pools. From our study, the populations from Chiapas
region, with high genetic diversity, represent areas known
to have toxic Jatropha. Veracruz and Puebla are known to
have nontoxic origins, while Morelos included toxic acces-
sions. The results suggest limited gene flow between the
regions with toxic and nontoxic Jatropha, but strong effects
of genetic bottleneck related to domestication may also
have contributed to the clear genetic differentiation.
Our study supports previous works showing high dif-
ferentiation among populations in J. curcas (Mingfu et al.,
2010; Basha and Sujatha, 2007; Sun et al., 2008; Singh et
al., 2010). However, in a study on J. curcas diversity from
nine different countries (Brazil, Argentina, Mexico, Mali,
Togo, Tanzania, India, Jordan, and Sri Lanka), Ambrosi
et al. (2010) found most of the variation (80%) within
populations and only 20% among populations; Mexican
landraces clustered apart with a mean genetic similarity of
77%. Basha et al. (2009) also found that Mexican popula-
tions cluster separately from accessions from Asia, Africa,
and Central and South America on the basis of random
amplified polymorphic DNA, inter-simple sequence
repeat, simple sequence repeat, and sequenced character-
ized amplified regions markers.
The Issue of Unproceeded Low Levels
of Diversity in Landraces
Microsatellite markers showed very limited genetic diver-
sity in Jatropha curcas and very low diversity in African and
Asian landraces. However, this is not an inherent feature
of the species, because some of the native Mexican pop-
ulations from the Chiapas region had substantially more
variation, with He > 0.5. Interestingly, Mexican popula-
tions from Veracruz, Puebla, and Morelos were also basi-
cally without diversity in the investigated markers. These
results may be due to strong genetic bottlenecks during
early domestication of the species in Mexico. The popu-
lations from Chiapas, with high genetic diversity, most
likely represent areas with low human influence. In these
areas, the seeds are known to be toxic, a common feature
in many Euphorbiaceae species (Hohmann et al., 2000;
Amorim et al., 2005; Alonso and Santos, 2013). How-
ever, in Veracruz and Puebla, where the nontoxic seeds
756 www.crops.org crop science, vol. 55, march– april 2015
are consumed as ingredients for cooking, people may have
influenced the diversity by selecting and cultivating the
consumable varieties. The 61 nontoxic accessions in our
study included only eight different genotypes. This low
number of genotypes may thus be a result of selection by
the native Indians. In Morelos close to Mexico City, the
populations of J. curcas may have been disturbed by people
involved in construction of roads and houses, but selection
for other uses than food, like medicines and firewood,
may also have been involved.
Our finding of a low level of genetic diversity in landra-
ces compared with native origins is consistent with the find-
ings by other authors (Sudheer-Pamidimarri et al., 2009a;
Tatiana et al., 2010; Singh et al., 2010; Zhengyin et al., 2011).
High morphological variation in populations from
Chiapas (broad sense heritability about 70% for oil content
and 90% for fatty acid) and high genetic diversity were
found, respectively, by Ovando-Medina et al. (2011) and
Pecina-Quintero et al. (2010).
Genetic Diversity in Relation with the
Mating System
Our results from the mating system analysis revealed
that offspring from homozygous populations were just as
homozygous as the parent population. None of the sur-
veyed offspring revealed alleles not present in any gen-
otyped plant from the population of origin. This could
suggest that the species is highly selfing as suggested by
Bhattacharya et al. (2005). However, highly outcrossing
individuals were found in Chiapas, whereas others were
also selfing. The population-based outcrossing rate was
0.517 ±0.40, suggesting a mixed mating system, as also
suggested by Negussie et al. (2014) on the basis of cross-
ing experiments. The results showed that J. curcas was an
outcrossing species, at least under natural conditions, but
highly capable of producing fruits through selfing. In gen-
eral, selfing will lead to increased levels of homozygosity
and limit gene flow (Eriksson et al., 2009). The world-
wide low levels of genetic variation of J. curcas found in
domesticated landraces can thus be the result of genetic
bottlenecks generated in the early domestication process
combined with the ability of the species to self-pollinate.
In addition, the species is easily propagated by cutting and
grafting. Farmers’ distribution of seeds, cuttings, or grafts
might also have contributed to spreading the same few
genotypes across landscapes through the countries.
The Introduction History of Jatropha curcas
The extremely low level of genetic diversity found in land-
races worldwide suggests a history with one or several strong
genetic bottleneck(s) leading to the increase of genetic drift,
the loss of genetic diversity, and the increase of genetic dif-
ferentiation among populations. The introduction history
of J. curcas has been discussed during the last decade, and the
story is still not clear (Sun et al., 2008; Basha et al., 2009;
Jubera et al., 2009; Machua et al., 2011). According to our
analysis, the landraces from Africa and India resemble the
Mexican material from the Chiapas area, but it is not a close
relationship. If landraces originated from the southern part
of Mexico (Chiapas), the landrace formation would have
involved substantial genetic drift during the introduction
to Asia and Africa, leading to the extremely low genetic
diversity. However, the landraces might also have origi-
nated in other parts of the natural distribution areas not
included in the present study. A thorough collection of J.
curcas throughout its natural distribution areas will therefore
be necessary to get closer to the introduction story of the
species to other parts of the world.
Implications for Genetic Improvement
Efforts were undertaken for breeding and propagation of
superior trees in several countries because of the potential
importance of J. curcas seed oil in energy supply in tropical
countries. The present study supports several other molecu-
lar studies that indicate a very low genetic diversity in the
deployed genetic resources of the species. However, the find-
ings from the molecular studies are only partly in line with
experience from breeding activities, where presence of at least
some levels of genetic variation have been reported in com-
mercial traits, allowing progress from traditional breeding
(Tatiana et al., 2010). Although ancient bottlenecks must have
reduced genetic diversity in quantitative trait loci as well as
in selectively neutral loci (as microsatellite markers), it is pos-
sible that quantitative traits that are under polygenetic control
have restored faster relative to diversity in neutral molecular
markers (Lynch, 1988). The observations of extremely low
diversity in molecular markers of the deployed germplasm
of J. curcas, however, suggest that diversification by mixing
of populations can be an interesting option to consider in
domestication. Of special interest will be comparison of fit-
ness and productivity of J. curcas plants derived from control
outcrossing and selfing, because heterosis (hybrid vigor) can
be expected to occur if presently deployed germplasm suf-
fers from inbreeding depression. Careful testing of resulting
provenance hybrids is advised, because growing conditions
(soil and climate) in major J. curcas planting areas in Africa,
Asia, and Central and South America can differ substantially
between sites and from conditions in the native areas with
J. curcas. It is important to study the degree of genotype by
environment interaction along with other basic quantitative
genetic parameters to assess the plasticity of such new plant
material and thereby the ability to produce an acceptable
crop under conditions where the species is presently planted
for bioenergy (Achten et al., 2010). Presence of genotype by
environment interaction has been reported from a study in
East Africa (Ngugi et al., 2012), suggesting that testing of
seed sources at a local scale is important. It will be important
to estimate genetic variance components and inheritance
crop science, vol. 55, march– april 2015  www.crops.org 757
of quantitative traits in traits of commercial interest at the
initial stage of any new domestication program of J. curcas.
Deployment of molecular breeding is presently complicated
owing to lack of polymorphisms in DNA marker loci, but
more comprehensive genomic resources may become avail-
able on the basis of second-generation sequence techniques
in the future. Studies of variations in candidate genes may
prove valuable in the future for guiding effective domesti-
cation and germplasm management strategies by revealing
links between genetic variation in neutral genetic markers
and quantitative traits of commercial interest.
Acknowledgments
We would like to thank the Danish International Development
Agency (DANIDA), which has supported the project (DFC
Project no. 40-08-LIFE), and also all persons who have partici-
pated at any time to this work (elaboration of the project and
activities in the fields and laboratory).
References
Abayneh, D., O. Gailing, and R. Finkeldey. 2011. Maintenance of
genetic diversity in Cordia africana Lam., a declining forest tree
species in Ethiopia. Tree Genet. Genomes 7:1–9. doi:10.1007/
s11295-010-0310-1
Achten, W.M.J., L. Verchot, Y.J. Franken, E. Mathijs, V.P. Singh,
R. Aerts, and B. Muys. 2008. Jatropha bio-diesel production
and use. Biomass Bioenergy 32:1063–1084. doi:10.1016/j.biom-
bioe.2008.03.003
Achten, W.M.J., L.R. Nielsen, R. Aerts, A.G. Lengkeek, E.D. Kjær,
A. Trabucco, J.K. Hansen, W.H. Maes, L. Graudal, F.K. Akin-
nifesi, and B. Muys. 2010. Towards domestication of Jatropha
curcas. Biofuels 1:91–107. doi:10.4155/bfs.09.4
Aguilar, R., M. Quesada, L. Ashworth, Y. Herrerias-Diego, and J.
Lobo. 2008. Genetic consequences of habitat fragmentation in
plant populations: Susceptible signals in plant traits and meth-
odological approaches. Mol. Ecol. 17:5177–5188. doi:10.1111/
j.1365-294X.2008.03971.x
Aitken, S.N., S. Yeaman, J.A. Holliday, T. Wang, and S. Curtis-
McLane. 2008. Adaptation, migration or extirpation: Climate
change outcomes for tree populations. Evol. Appl. 1:95–111.
doi:10.1111/j.1752-4571.2007.00013.x
Aldrich, P.R., J.L. Hamrick, P. Chavarriaga, and G. Kochert. 1998.
Microsatellite analysis of demographic genetic structure in frag-
mented populations of the tropical tree Symphonia globulifera.
Mol. Ecol. 7:933–944. doi:10.1046/j.1365-294x.1998.00396.x
Alonso, E.C., and D.Y.A.C. Santos. 2013. Ricinus communis and Jat-
ropha curcas (Euphorbiaceae) seed oil toxicity against Atta sex-
dens rubropilosa (Hymenoptera: Formicidae). J. Econ. Entomol.
106:742–746. doi:10.1603/EC12035
Ambrosi, D.G., G. Galla, M. Purelli, T. Barbi, A. Fabbri, S. Lucretti,
T.F. Sharbel, and G. Barcaccia. 2010. DNA markers and FCSS
analyses shed light on the genetic diversity and reproductive
strategy of Jatropha curcas L. Diversity. 2:810–836. doi:10.3390/
d2050810
Amorim, S.L., R.M.T Medeiros, and F. Riet-Correa. 2005. Intoxi-
cação experimental por Manihot glaziovii (Euphorbiaceae) em
caprinos. (In Portuguese with English abstract). Pesquisa V., et
Brasil. 25:179–187.
Basha, S.D., and E.M. Sujatha. 2007. Inter and intra-population vari-
ability of Jatropha curcas (L). characterized by RAPDs and ISSR
markers and development of population specific SCAR mark-
ers. Euphytica 156:375–386. doi:10.1007/s10681-007-9387-5
Basha, S.D., F. Georges, H.P.S. Makkar, K. Becker, and M. Sujatha.
2009. A comparative study of biochemical traits and molecular
markers for assessment on genetic relationships between Jat-
ropha curcas L. germplasm from different countries. Plant Sci.
176:812–823. doi:10.1016/j.plantsci.2009.03.008
Bhattacharya, A., K. Datta, and S.K. Datta. 2005. Floral biology
resource constraints and pollination limitations in Jatropha curcas
L. Pak. J. Biol. Sci. 8:456–460. doi:10.3923/pjbs.2005.456.460
Cascante, A., M. Quesada, J.J. Lobo, and E.A. Fuchs. 2002. Effects
of dry tropical forest fragmentation on the reproductive success
and genetic structure of the tree Samanea saman. Conserv. Biol.
16:137–147. doi:10.1046/j.1523-1739.2002.00317.x
Charlesworth, D., and B. Charlesworth. 1987. Inbreeding depres-
sion and its evolutionary consequences. Annu. Rev. Ecol. Syst.
18:237–268. doi:10.1146/annurev.es.18.110187.001321
Dlugosch, K.M., and I.M. Parker. 2008. Founding events in species
invasions: genetic variation, adaptive evolution, and the role
of multiple introductions. Mol. Ecol. 17:431–449. doi:10.1111/
j.1365-294X.2007.03538.x
Dyer, J.M., and R.T. Mullen. 2008. Engineering plant oils as high-
value industrial feedstocks for biorefining: The need for under-
pinning cell biology research. Physiol. Plant. 132:11–22.
Eckert, C.G., S. Kalisz, M.A. Geber, R. Sargent, E. Elle, P.O.
Cheptou, et al. 2010. Plant mating systems in a changing world.
Trends Ecol. Evol. 25:35–43. doi:10.1016/j.tree.2009.06.013
Eriksson, A., B. Mahjani, and B. Mehlig. 2009. Sequential Mar-
kov coalescent algorithms for population models with demo-
graphic structure. Theor. Popul. Biol. 76:84–91. doi:10.1016/j.
tpb.2009.05.002
Evanno, G., S. Regnaut, and J. Goudet. 2005. Detecting the number
of clusters of individuals using the software STRUCTURE: A
simulation study. Mol. Ecol. 14:2611–2620. doi:10.1111/j.1365-
294X.2005.02553.x
Excoffier, L., P.E. Smouse, and J.M. Quattro. 1992. Analysis of
molecular variance inferred from metric distances among
DNA haplotypes—application to human mitochondrial-DNA
restriction data. Genetics 131:479–491.
Fairless, D. 2007. The little shrub that could—maybe. Nature
449:652–655. doi:10.1038/449652a
Falush, D., M. Stephens, and J.K. Pritchard. 2003. Inference of pop-
ulation structure using multilocus genotype data: Linked loci
and correlated allele frequencies. Genetics 164:1567–1587.
Fuchs, E.J., J.A. Lobo, and M. Quesada. 2003. Effects of forest
fragmentation and flowering phenology on the reproduc-
tive success and mating patterns of the tropical dry forest tree
Pachira quinata. Conserv. Biol. 17:149–157. doi:10.1046/j.1523-
1739.2003.01140.x
Ganesh, R.S., K.T. Parthiban, R.K. Senthil, V. Thiruvengadam,
and M. Paramathma. 2008. Genetic diversity among Jatropha
species as revealed by RAPD markers. Genet. Resour. Crop
Evol. 55:803–809. doi:10.1007/s10722-007-9285-7
Ginwal, H.S., S.S. Phartyal, P.S. Rawat, and R.L. Srivastava. 2005.
Seed source variation in morphology, germination and seedling
growth of Jatropha curcas Linn. in Central India. Silvae Genet.
54:76–80.
Hamrick, J.L., M.J.W. Godt, and S.L. Sherman-Broyles. 1992. Fac-
tors influencing levels of genetic diversity in woody plant spe-
cies. New For. 6:95–124. doi:10.1007/BF00120641
758 www.crops.org crop science, vol. 55, march– april 2015
Hamrick, J.L., and M.J.W. Godt. 1996. Effects of life history traits
on genetic diversity in plant species. Philos. Trans. R. Soc.
London. Ser. B. 351:1291–1298.
Heller, J. 1996. Physic nut. Jatropha curcas L. Promoting the conserva-
tion and use of underutilized and neglected crops. Ph.D. diss.,
Institute of Plant Genetic and Crop Plant Research, Gatersle-
ben, Germany, and International Plant Genetic Resource Insti-
tute, Rome, Italy.
Hohmann, J., F. Evanics, L. Berta, and T. Bartók. 2000. Diter-
penoids from Euphorbia peplus. Planta Med. 66:291–294.
doi:10.1055/s-2000-8568
Holm, S. 1979. A simple sequentially rejective multiple test proce-
dure. Scand. J. Stat. 6:65–70.
Husband, B.C., and D.W. Schemske. 1996. Evolution of the magni-
tude and timing of inbreeding depression in plants. Evolution
50:54–70. doi:10.2307/2410780
Jayasingh, J.M. 2004. The use of biodiesel by the Indian railways.
p. 31–33. In: D.M., Hedge, J.N. Daniel, and S. Dhar, editors,
Jatropha and other perennial oilseed crop. BAIF Development
Research Foundation, Pune, India.
Jubera, M.A., B.S. Janagoudar, D.P. Biradar, R.L. Ravikumar, R.V.
Koti, and S.J. Patil. 2009. Genetic diversity analysis of elite Jat-
ropha curcas genotypes using randomly amplified polymorphic
DNA markers. Karnataka J. Agric. Sci. 22(2):293–295.
Jump, A.S., R. Marchant, and J. Peñuelas. 2009. Environmental
change and the option value of genetic diversity. Trends Plant
Sci. 14:51–58. doi:10.1016/j.tplants.2008.10.002
King, A.J., W. He, J.A. Cuevas, M. Freudenberger, D. Ramiarama-
nana, and I.A. Graham. 2009. Potential of Jatropha curcas as a
source of renewable oil and animal feed. J. Exp. Bot. 60:2897–
2905. doi:10.1093/jxb/erp025
Kjær, E.D., and H.R. Siegismund. 1995. Allozyme diversity of two
Tanzanian and two Nicaraguan landraces of Teak (Tectona gran-
dis L.). For. Genet. 3:45–52.
Kumar, A., and S. Sharma. 2008. An evaluation of multipurpose oil
seed crop for industrial uses ( Jatropha curcas L.): A review. Ind.
Crops Prod. 28:1–10. doi:10.1016/j.indcrop.2008.01.001
Lee, C.E. 2002. Evolutionary genetics of invasive species. Trends
Ecol. Evol. 17:386–391. doi:10.1016/S0169-5347(02)02554-5
Liu, H.-F., Y.-F. Deng, and J.-P. Liao. 2008. Floral organogenesis
of three species of Jatropha (Euphorbiaceae). (In Chinese with
English abstract). J. System. Evol. 46:53–61.
Lynch, M. 1988. The rate of polygenic mutation. Genet. Res.
51:137–148. doi:10.1017/S0016672300024150
Luo, C.-W., K. Li, Y. Chen, and Y.-Y. Sun. 2007. Floral display and
breeding system of Jatropha curcas L. For. Stud. China 9:114–119.
doi:10.1007/s11632-007-0017-z
Machua, J., G. Muturi, S.F. Omondi, and J. Gicheru. 2011. Genetic
diversity of Jatropha curcas L. populations in Kenya using RAPD
molecular markers: Implication to plantation establishment.
Afr. J. Biotechnol. 10:3062–3069.
Makkar, H.P.S., A.O. Aderibigbe, and K. Becker. 1998. Compara-
tive evaluation of nontoxic and toxic varieties of Jatropha curcas
for chemical composition, digestibility, protein degradabil-
ity and toxic factors. Food Chem. 62:207–215. doi:10.1016/
S0308-8146(97)00183-0
Martinez-Herrera, J., P. Siddhuraju, G. Francis, G. Dávila-Ortíz,
and K. Becker. 2006. Chemical composition, toxic/antimeta-
bolic constituents, and effects of different treatments on their
levels, in four provenances of Jatropha curcas L. from Mexico.
Food Chem. 96:80–89. doi:10.1016/j.foodchem.2005.01.059
Mingfu, W., H. Wang, Z. Xia, M. Zou, C. Lu, and W. Wang. 2010.
Development of EST SSR and genomic-SSR markers to assess
genetic diversity in Jatropha curcas L. BMC Res. Notes 3:42.
doi:10.1186/1756-0500-3-42
Negussie, A.M., Achten, W.M.J., Verboven, H., Hermy, and M.,
Muys, B. 2014. Floral display and effects of natural and artificial
pollination on fruiting and seed yield of the tropical biofuel
crop Jatropha curcas L. GCB Bioenergy. 6:210–218.
Ngugi, K., A. Nabiswa, and J. Kinama. 2012. Adaptation of Jatropha
curcas L. in the agroecological environments of Kenya: Geno-
type × environment interactions analysis. Biofuels 3:535–543.
doi:10.4155/bfs.12.47
Novak, S.J., and R.N. Mack. 2004. Genetic bottlenecks in alien plant
species: Influence of mating systems and introduction dynam-
ics. p. 201–228. In: S.F., Sax, J.J. Stachowicz, and S.D. Gaines,
editors, Species invasions. Insights into ecology evolution and
biogeography. Sinauer Associates Inc., Sunderland, MA.
O’Connell, L.M., A. Mosseler, and O.P. Rajora. 2006. Impacts of
forest fragmentation on the mating system and genetic diversity
of white spruce (Picea glauca) at the landscape level. Heredity
97:418–426. doi:10.1038/sj.hdy.6800886
Ovando-Medina, I., F.J. Espinosa-García, J. Núñez-Farfán, and M.
Salvador-Figueroa. 2011. Genetic variation in Mexican Jatro-
pha curcas  L. estimated with seed oil fatty acids. J. Oleo Sci.
60(6):301–311. doi:10.5650/jos.60.301
Peakall, R., and P.E. Smouse. 2006. GENALEX 6: Genetic anal-
ysis in Excel. Population genetic software for teaching and
research. Mol. Ecol. Nat. 6:288–295. doi:10.1111/j.1471-
8286.2005.01155.x
Pecina-Quintero, V., J.L. Anaya-López, A. Zamarripa-Colmenero,
N. Montes García, C.A.N. Colín, J.L.S. Bonilla, M.R. Aguil-
lar-Rangel, H.R.G. Langarica, and D.J.M. Bustamante. 2010.
Molecular characterization of Jatropha curcas L. Genetic resources
from Chiapas, México, through AFLP markers. Biomass Bio-
energy 35:1897–1905. doi:10.1016/j.biombioe.2011.01.027
Pritchard, J.K., P. Stephens, and P. Donnelly. 2000. Inference of
population structure using multilocus genotype data. Genetics
155:945–959.
Raymond, M., and F. Rousset. 1995. Genepop version.1.2: Pop-
ulation genetics software for exact tests and ecumenicism. J.
Hered. 86:248–249.
Ritland, K., and S. Jain. 1981. A model for the estimation of out-
crossing rate and gene frequencies using n independent loci.
Heredity 47:35–52. doi:10.1038/hdy.1981.57
crop science, vol. 55, march– april 2015  www.crops.org 759
Ritland, K. 2002. Extensions of models for the estimation of mat-
ing systems using n independent loci. Heredity 88:221–228.
doi:10.1038/sj.hdy.6800029
Saitou, N., and M. Nei. 1987. The neighbor-joining method: A new
method for reconstructing phylogenetic trees. Mol. Biol. Evol.
4:406–425.
Singh, P., S. Singh, S.P. Mishra, and S.K. Bathia. 2010. Molecular
characterization of genetic diversity in Jatropha curcas L. Genes,
Genomes and Genomics 4 (Special Issue 1):1–8.
Sleper, D.A., and J.M. Poehlman. 2006. Breeding field crops, 5th
ed. Blackwell Publishing, Ames, IA.
Sudheer-Pamidimarri, D.V.N., S. Singh, S.G. Mastan, J. Patel, and
M.P. Reddy. 2009a. Molecular characterization and identifi-
cation of markers for toxic and non-toxic varieties of Jatropha
curcas L. using RAPD, AFLP and SSR markers. Mol. Biol. Rep.
36:1357–1364. doi:10.1007/s11033-008-9320-6
Sudheer-Pamidimarri, D.V.N., R. Sinha, P. Kothari, and M.P.
Reddy. 2009b. Isolation of novel microsatellites from Jatro-
pha curcas L. and their cross-species amplification. Mol. Ecol.
Resour. 9:431–433. doi:10.1111/j.1755-0998.2008.02471.x
Sun, Q.B., L.F. Li, Y. Li, G.J. Wu, and X.J. Ge. 2008. SSR and
AFLP markers reveal low genetic diversity in the biofuel plant
Jatropha curcas in China. Crop Sci. 48:1865–1871. doi:10.2135/
cropsci2008.02.0074
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S.
Kumar. 2011. MEGA5: Molecular evolutionary genetics anal-
ysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Mol. Biol. Evol. 28:2731–2739.
doi:10.1093/molbev/msr121
Tatiana, B.R., B.G. Laviola, D.A. Faria, M.R. Pappas, L.L. Bher-
ing, B. Quirino, and D. Grattapaglia. 2010. Molecular markers
reveal limited genetic diversity in a large germplasm collec-
tion of the biofuel crop Jatropha curcas L. in Brazil. Crop Sci.
50:2372–2382. doi:10.2135/cropsci2010.02.0112
Uller, T., and R. Leimu. 2011. Founder events predict changes
in genetic diversity during human-mediated range expan-
sions. Glob. Change Biol. 17:3478–3485. doi:10.1111/j.1365-
2486.2011.02509.x
Walsh, B. 2008. Evolutionary quantitative genetics. p. 533–586. In:
D.J. Balding, M. Bishop, and C. Cannings, editors, Handbook
of statistical genetics. John Wiley and Sons, London.
Zhengyin, Z., X. Guo, B. Liu, L. Tang, and F. Chen. 2011. Genetic
diversity and genetic relationship of Jatropha curcas between
China and Southeast Asian revealed by amplified fragment
length polymorphisms. Afr. J. Biotechnol. 10:2825–2832.