Research Article

For reprint orders, please contact: reprints@futuremedicine.com

Molecular diagnosis of bovine

tuberculosis in bovine and human
samples: implications for zoonosis

Md Masudur Rahman*,1,2, Monira Noor1, Kazi Mehetazul Islam1, Md Bashir Uddin1,3,

Ferdaus Mohd Altaf Hossain1,4, Mohammad Ali Zinnah5, Mohammad Al Mamun1,
Mohammad Rafiqul Islam6, Seong Kug Eo4 & Hossam M Ashour**,7,8

Abstract Aim: To develop emerging diagnostic technique for bovine tuberculosis and
to identify its potential risk factors. Materials & methods: Bacterial genomic DNA was isolated
from bovine milk and human sputum samples and subjected to PCR using specific primer
pairs. PCR results were validated using bacteriological cultures. Results: PCR amplification
of the targeted DNA fragment of Mycobacterium bovis was successful in 12.33% (37/300) of
the bovine samples. Interestingly, 500-bp DNA fragment was also amplified in 6.67% (6/90)
of the sputum indicating the possibility of zoonotic transmission. Rearing of livestock in
household, unpasteurized milk consumption and smoking were identified as potential risk
factors. Conclusion: Results of the study may add value to bovine tuberculosis eradication
campaigns to achieve the One Health initiative.

Bovine tuberculosis (bTB) is caused primarily by Mycobacterium bovis, a Gram-positive acid-fast Keywords 
bacterium that affects domestic and wild mammalians as well as humans [1–3] . According to WHO, • bovine tuberculosis
bTB is a neglected, endemic zoonosis in many countries. In Bangladesh, there is little information on • molecular diagnosis
the prevalence of bTB in livestock animals. Moreover, all the prevalence studies were made relying • zoonotic transmission
on dermal tuberculin test which may not represent exact prevalence rate of the disease. According
to available reports, prevalence rate of bTB in cattle, buffalos, sheep and goats in Bangladesh were
33.73, 6.12, 9.15 and 1.29%, respectively [4,5] . This zoonotic disease constitutes a significant eco-
nomic burden to the agricultural industries in many countries including Bangladesh. Infection
most commonly occurs through the consumption of contaminated, unpasteurized dairy products.
Infection can also occur from direct contact with a wound during slaughter, or by inhaling the
bacteria in air exhaled by animals infected with M. bovis [6,7] . Transmission to humans makes it a
public health problem. This is particularly important given that zoonotic TB, caused by transmis-
sion of M. bovis to humans, is clinically identical to infections caused by Mycobacterium tuberculosis
(typical TB). Most of the world’s population live in countries in which there is limited control
of bovine tuberculosis [8] . Thus, there is consensus regarding risks to human health on a global
scale. The control of bTB relies on test and slaughter policies and abattoir surveillance. In spite of

1
Faculty of Veterinary & Animal Science, Sylhet Agricultural University, Sylhet 3100, Bangladesh
2
Veterinary Research Institute, Hudcova 70, Brno 621 00, Czech Republic
3
College of Veterinary Medicine, Chungnam National University, Daejeon, Republic of Korea
4
College of Veterinary Medicine & Bio-Safety Research Institute, Chonbuk National University, Jeonju 561–756, Republic of Korea
5
Faculty of Veterinary Medicine & Animal Science, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh
6
Animal Health Research Division, Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh
7
Department of Pharmacy Practice, Eugene Applebaum College of Pharmacy & Health Sciences, Wayne State University, Detroit,
MI 48202, USA
8
Department of Microbiology & Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt
*Author for correspondence: rahmanmm.dpp@sau.ac.bd
**Author for correspondence: hossamking@mailcity.com part of

10.2217/FMB.14.139 © 2015 Future Medicine Ltd Future Microbiol. (2015) 10(4), 527–535 ISSN 1746-0913 527
Research Article  Rahman, Noor, Islam et al.
extensive eradication efforts in many countries,
bTB continues to be a global problem [9] .
Currently available methods for bTB diag-
nosis include tuberculin skin tests, bacteriologic
culturing, histopathology, serological tests and
molecular PCR-based techniques [10] . However,
no single method is sufficient for detecting all
bTB-infected cattle [8] . The tuberculin skin test
using a purified protein derivative of M. bovis
origin (bovPPD) is the OIE prescribed test for
international trade [11] . However, confirmation of
the diagnosis is achieved by culture and biochem-
ical assays as cattle infected with Mycobacterium
avium, M, tuberculosis, M. avium paratubercu-
losis, Nocardia farcinius or other mycobacteria
can also be reactive to bovPPD, leading to false-
positive results. The microbiological culture is
highly specific. However, a positive result is time
consuming and is typically achieved after the
sacrifice of the animal. Thus, it is necessary to
develop new diagnostic methods that identify
M. bovis directly in milk or blood, without the
need for microbiological culture. This is expected
to also improve the predictive value of the tuber-
culin test by confirming the tuberculin-positive
cases. A PCR-based method targeting the highly
conserved sequence of the microorganism can be
applied successfully for the diagnosis of tuber-
culosis [12,13] . A rational approach for preventing
bTB and human infection by M. bovis and reduc-
ing its negative economic impact involves iden-
tification of risk factors for human transmission
and implementation of eradication programs.
Little or no data are available on this. Therefore,
the present study was designed to evaluate a
PCR-based diagnostic test specific for M. bovis
for testing bovine and human biological samples
for bTB and to identify potential risk factors for
its human transmission.
Table 1. Biological samples from cows and human patients.
Sampling location
Government Dairy Farm, Sylhet
Kabir Dairy Farm, Major Tila, Sylhet
Home Fresh Dairy Farm, Boro Bari Baluchar, Sylhet
Dream Dairy Farm, Al-Isla, Sylhet
Provati Dairy Farm, West Sibgonj, Sylhet
BLRI Dairy Farm, Savar, Dhaka
Individual farmers from Zonaki Area, Sylhet
 
TB Hospital, Sylhet
†
Cows from government/private dairy farms were apparently healthy whereas cows from individual farms were clinically sick.
‡
Sputum samples were collected from tuberculosis-positive human patients.
528 Future Microbiol. (2015) 10(4)
Materials & methods
●●Sample collection
Three hundred bovine milk samples were asep-
tically collected from apparently healthy cows
at government farms (50 samples) and pri-
vate dairy farms (150 samples) and from cows
showing clinical sign of debilitated condition,
cough, decreasing milk production and labored
respiration at individual farms (100 samples).
Government and private dairy farms are defined
as farms in which more than 100 cows are reared
in an organized way. Individual farms are defined
as those farms in which farmers rear one to ten
cows in a nonorganized way at their house prem-
ises. Approximately 10–20 ml milk samples were
collected from each cow and immediately trans-
ferred to the laboratory for further processing. In
addition to bovine samples, 90 sputum samples
were collected from tuberculosis-positive human
patients admitted at the TB Hospital, Sylhet
3100, Bangladesh for treatment. Tuberculosis
was diagnosed by chest radiograph and direct
smear positivity for acid-fast bacilli (AFB) of
sputum samples as reported by the respective
physician of the hospital. Patients were requested
to submit early morning sputum sample in a 50
ml screw-cap centrifuge tube (BD Falcon™,
Becton Dickinson, NJ, USA) before they started
antibiotic treatment for TB. A summary of sam-
ple collection is depicted in Table 1.
●●Extraction of bacterial genomic DNA from
collected bovine & human samples
Bacterial genomic DNA was isolated from
bovine milk samples using Milk Bacterial
DNA Isolation Kit (Norgen Biotek Corp.
ON, Canada) according to the manufacturer’s
instruction. Viscous human sputum samples
were liquefied and homogenized by adding
Sample type Samples (n)
Bovine milk† 50
Bovine milk 25
Bovine milk 25
Bovine milk 25
Bovine milk 25
Bovine milk 50
Bovine milk 100
Total bovine milk 300
samples
Human sputum‡ 90
future science group
 Molecular diagnosis of bovine tuberculosis in bovine & human samples  Research Article
dithiothreitol (DTT) to the sample at a final
concentration of 50 μg/ml and heating at 37°C
for 20 min prior to DNA isolation. Bacterial
genomic DNA was isolated from completely
homogenized sputum samples using Sputum
DNA Isolation Kit (Norgen Biotek Corp.) fol-
lowing the manufacturer’s instruction. Bacterial
genomic DNA was extracted from M. bovis
pure culture kindly provided by Laboratory of
Animal Health, Bangladesh Livestock Research
Institute, Savar, Dhaka and used as template
for positive control to validate our PCR results.
After elution, DNA concentration and purity
were determined using NanoDrop TM 2000c
(Thermo Scientific, DE, USA). DNA sam-
ples were kept at -20°C until use for PCR
amplification.
●●PCR amplification
For PCR, a set of for ward ( JB21:
TCGTCCGCTGATGCAAGTGC) and reverse
( JB22: CGTCCGCTGACCTCAAGAAAG)
primers specific for M. bovis were designed as
described previously [12,13] and primer anneal-
ing was checked using NCBI nucleotide BLAST
software. The extracted bacterial DNA was
subjected to the PCR amplification of the tar-
get sequence (500-bp) using specific primer
pairs ( JB21 and JB22, Bioneer, Daedeok-gu,
Daejeon, Republic of Korea) following previ-
ously described methods [13] with slight modi-
fication. The PCR reactions were performed in
a final volume of 20 μl containing 1× reaction
buffer (Promega, WI, USA), 2.5 U of Taq poly-
merase (Promega), 0.2 mM each deoxynucleo-
side triphosphate (dNTP), 1.5 mM magnesium
chloride and 20 pmol of each primer. Target
DNA was denatured by incubation for 10 min
at 95°C before amplification for 30 cycles of
94°C for 1 min, annealing at 65°C for 1 min
and extension at 72°C for 1 min followed by
72°C for 10 min (final extension) and holding
at 4ºC until collection. All reactions were carried
out in an automated thermal cycler (BioRad,
CA, USA). Amplicons were subjected to 1.5%
agarose gel electrophoresis and visualized with
ethidium bromide by ultraviolet light using an
image documentation system.
●●Isolation and identification of
M. bovis from bTB-positive samples by
bacteriological culture & biochemical tests
To validate PCR assay, the samples (bovine
milk and human sputum) that were positive
future science group
for bTB at PCR assay were further processed
for M. bovis isolation and identification as pre-
viously described [14] . Briefly, a volume of 5 ml
of bovine milk or homogenized human sputum
sample was decontaminated with 4% sodium
hydroxide and then neutralized using concen-
trated hydrochloric acid. Suspensions were
then centrifuged at 3000 ×g for 30 min and
the sediment was inoculated onto Lowenstein-
Jensen and Coletsos media and incubated at
37°C for 8 weeks. M. bovis characterization
was performed using the Ziehl-Neelsen stain-
ing, culture characteristics (growth rate, colony
morphology) and standard biochemical tests
(niacin production, nitrate reduction, catalase,
aryl sulfatase activity, etc.) as recommended by
the CDC, Atlanta, GA, USA, with appropriate
control [15] .
●●Risk factor analysis for bTB in human
& cattle
A questionnaire was developed including previ-
ously identified risk factors [16,17] . Interviewing
data were collected from farm owners, indi-
vidual farmers and tuberculosis-positive human
patients while collecting biological samples.
●●Statistical analysis
Epidemiological data analysis was performed
with the software package STATA 10.1 to iden-
tify the risk factors for bovine tuberculosis in
human and cattle.
Results
●●Identification of M. bovis from bovine milk
& human sputum samples
Milk samples collected from cows at differ-
ent farming conditions were used for molecu-
lar diagnosis of bTB. Bacterial genomic DNA
was extracted from the bovine milk samples
followed by PCR amplification of target frag-
ment (500 bp) using JB21 and JB22 prim-
ers specific for M. bovis. A DNA fragment of
500 bp was amplified from 37 milk samples
out of 300 (12.33%) indicating bTB positivity
(Figure 1 & Table 2) . To determine the possibility
of zoonotic transmission of bTB to human, spu-
tum samples from tuberculosis-positive human
patients were evaluated by PCR using the same
primer pair ( JB21 and JB22) specific for M.
bovis. Interestingly, 500-bp DNA fragment was
amplified (Figure 1 & Table 2) from six samples
out of 90 (6.67%) indicating possible zoonotic
transmission of bTB to humans. PCR data were
www.futuremedicine.com 529
Research Article  Rahman, Noor, Islam et al.

M S1 S2 P N M

500 bp

Figure 1. Ethidium bromide-stained 1.5% (w/v) agarose gel showing target amplicon of
Mycobacterium bovis DNA amplified by PCR assay. Bacterial genomic DNA extracted from
biological samples (suspected bovine milk and sputum of tuberculosis-positive human patients)
were employed to amplify specific fragment of M. bovis DNA using specific primer pair. The arrow in
agarose gel image indicates amplified specific DNA fragment (500 bp).
Lanes M: size marker (100-bp ladder); S1: bovine milk sample; S2: human sputum from tuberculosis-
positive patient; P: positive control (bacterial DNA extracted from pure culture of M. bovis as
template); N: Negative control (DNA-free water).

validated using bacteriologic culturing and bio-
chemical tests. As shown in Table 2, M. bovis was
isolated and identified from all samples (bovine
milk and human sputum) that were positive for
bTB by PCR assay.
●●Descriptive epidemiology of the risk
factors
A total of 300 bovine milk samples were col-
lected, of which 200 samples were collected from
apparently healthy cows of six different dairy
farms (government and private) and 100 samples
from cows of individual farmers showing clinical
signs similar to bTB. bTB was not detected in
cows of any government or private dairy farms.
Conversely, bTB was detected in 37 cows of
individual farmers (out of 100 cows). As bTB
is a management-related disease, we studied
different management factors. Good manage-
ment practices were followed at all dairy farms
in the study. However, at the farmers’ level, most
farmers did not maintain good management
practices, such as bio-security, balanced nutri-
tion and proper ventilation (Table 3) . This is due
to their lack of knowledge and due to poverty
conditions. We identified poor biosecurity and
ill health due to poor nutrition as management-
related risk factors for the outbreak of bTB at the
farmers’ level (Table 3) .
To determine bTB at the bovine–human
interface and zoonotic transmission, we col-
lected 90 sputum samples from tuberculosis-
positive human patients. These were subjected to
molecular diagnosis of bTB by PCR using JB21
and JB22 primer pairs specific for the 500-bp
fragment of M. bovis genome. Out of 90 tuber-
culosis-positive samples, six samples were positive
for bTB. To determine the risk factors for the
outbreak of tuberculosis and bTB in humans,
we collected information from all 90 individual
human patients admitted to the TB Hospital,
Sylhet. This is summarized in Table 4. As shown
in Table 4, people above 35 years old were more
susceptible to tuberculosis and females were more
frequently affected than males. Educational lev-
els, rearing of livestock animals in household,
consumption of unpasteurized milk, smoking
and contact with TB patients were identified
as major risk factors for tuberculosis in humans
whereas rearing of livestock in household,

530 Future Microbiol. (2015) 10(4) future science group

 Molecular diagnosis of bovine tuberculosis in bovine & human samples  Research Article
consumption of unpasteurized milk and smoking
were found to be risk factors for bTB in humans.
Discussion
Cases of human tuberculosis of bovine origin
have long been reported causing severe nega-
tive impacts on public health and global econ-
omy  [18–20] . In the present study, we diagnosed
bTB directly in biological samples of bovine milk
and human sputum using a PCR-based diagnos-
tic assay targeting a unique 500-bp fragment of
genomic DNA of the microorganism using JB21
and JB22 primers. We also identified risk fac-
tors of bTB that influence its possible zoonotic
transmission in humans and cattle.
●●PCR-based diagnosis of bTB from
biological samples
We used a PCR-based diagnostic assay, in
which we amplified a highly conserved 500-bp
fragment  [12,13] using JB21 and JB22 primers
(Figure 1) . This is important for discrimination
of M. bovis from M. avium, M. paratuberculo-
sis or other related strains [21] . It is noteworthy
that this sequence is also present in isolates
from other mammals, such as sea lions and
wild deer [22–24] . It is noteworthy that diagnosis
was established with different methods and thus
cannot be directly compared.
●●Prevalence of bovine tuberculosis in cattle
& humans
The prevalence of bTB in cattle (12.33%) was
three- to fourfold higher than that reported by
Boukary et al. in a study in Niger (3.6%) [17]
but nearly threefold lower than that reported by
Uddin et al. in Bangladesh [25] . The prevalence
in cattle is influenced by the geographical situ-
ation of a country, temperature, precipitation,
hygienic status of humans and animals and
enforced regularity laws in Public Health and
Veterinary Public Health sectors. False-positive
reactions can sometimes influence the results of
bovine tuberculin tests. We recorded a preva-
lence rate of 6.67% bTB in humans. This is
consistent with previous findings [7] .
Table 2. Validation of PCR assay by bacteriological culture and biochemical tests.
Species Sample type
Bovine Milk
Human Sputum
†
Bacteriology was performed only with the samples positive for bovine tuberculosis by PCR.
future science group
●●Risk factors for bTB transmission in human
& cattle
We identified poor biosecurity and ill health
due to poor nutrition as critical management-
related risk factors of bTB infection in cattle at
the farmers’ level. Previous research in Africa
identified several environmental risk factors for
transmission of bTB among animals, such as
sharing water points, grazing or high promis-
cuity [26,27] . Several authors found a significant
association between herd size and bTB infection
among cattle and stated that as the herd size
increased, there was a corresponding increase
in the prevalence of bTB [17,28] . In this study, we
detected bTB at individual farmers’ levels but
not at organized dairy farms comprising herd
size of 100–300 cattle. Strict biosecurity and
proper quarantine practices were maintained at
all the farms.
Cleaveland  et al. reported that cattle older
than 10 years of age are at a higher risk of infec-
tion  [29] . This might be due to the increased
duration of exposure in older cattle [27,30] .
We observed the same trend in our study.
Moreover, we found that people above 35 years
old were more susceptible to tuberculosis and
females were more frequently affected than
males. Educational levels, rearing of livestock
animals in household, consumption of unpas-
teurized milk, smoking and contact with TB
patient are major risk factors for tuberculosis
in humans. On the other hand, rearing of live-
stock in household, consumption of unpasteur-
ized milk and smoking are risk factors for bTB
in humans.
Raw milk consumption generally leads to
more cases of human TB of animal origin [26] .
Consumption of unpasteurized dairy products
was a common practice among farmers in our
study. Boukary et al.  [17] reported that hygiene
in households and consumption of raw milk
are main determinants of M. bovis infection in
humans. Others have drawn positive correla-
tions between animal-to-human transmission of
M. bovis and food habits or hygienic conditions
in a population [28,29] .
Samples (n) Bovine tuberculosis-positive samples Isolation of Mycobacterium bovis
by PCR, n (% positive) by bacteriology†
300 37 (12.33) 37
90 6 (6.67) 6
www.futuremedicine.com 531
Research Article  Rahman, Noor, Islam et al.
We analyzed possible risk factors for M. bovis
infection in cattle and its transmission in
humans using univariable analysis as the sam-
ple size and number of bTB-positive cases were
less. Therefore, we could not precisely address
how each of the individual risk factor interacts.
A more comprehensive study including large
cohorts of samples and multivariable analysis
of the risk factors could gain an understanding
on how each of the individual risk factor inter-
acts, for example, how does sex and education
interact with household livestock and contact
with TB patients. Positive correlations between
animal-to-human transmission of bTB could
also be made.
Conclusion
In this study, a PCR-based diagnostic assay for
bTB was evaluated and validated using bovine
milk and human sputum samples which may be
used as rapid and specific diagnosis of bTB in
cattle and humans. Early detection of M. bovis by
PCR could be useful either as an epidemiological
tool for field trials in cattle or in human clini-
cal follow-up programs, in order to establish the
real magnitude of bovine tuberculosis. Positive
molecular diagnosis of bovine tuberculosis in
bovine and human samples in Bangladesh is
alarming and calls for stricter measures to mini-
mize risk factors for human transmission. Risk
factors identified in this study can be useful in
preventing zoonotic transmission of bTB at the
cattle–human interface and can be implicated
Table 3. Risk factor analysis of bovine tuberculosis at the level of individual farms.
Risk factors Categories
Farmer’s educational level No education
  Primary school
  Secondary school
Knowledge on biosecurity Moderate
  Poor
  No
Herd size 1–5 animals
  6–10 animals
Age class 3–6 years
  7–10 years
  11–19 years
Balanced nutrition Yes
  No
Biosecurity Poor
  Moderate
Proper ventilation Yes
  No
532 Future Microbiol. (2015) 10(4)
in implementation of control and eradication
programs against bTB.
Future perspective
Animal and human health is inextricably inter-
woven and food animals, especially cattle serve
as a reservoir of diseases of public health impor-
tance. WHO considered bovine tuberculosis
as one of the seven neglected zoonotic diseases
having great potential to infect humans. There
is increasing evidence that bovine tuberculosis
caused by M. bovis infections may be much more
significant than generally considered. Though
the incidence of bovine tuberculosis in developed
countries is greatly reduced following implemen-
tation of eradication programs involving test and
slaughter policy and milk pasteurization, the cur-
rent increasing incidence of tuberculosis in the
human population has given rise to a renewed
interest in the zoonotic importance of M. bovis,
especially in developing countries, as humans
and animals are sharing the same microenviron-
ment and dwelling premises, especially in rural
areas. The direct correlation between M. bovis
infection in cattle and the disease incidence in
humans has been well documented in developed
countries, whereas scanty information on this
issue is available from developing countries. On
the international scene, several fora and institu-
tions like the Food and Agricultural Organization
(FAO), World Organization for Animal Health
(OIE) and WHO have stressed on the need to
prevent and control tuberculosis in both humans
Bovine tuberculosis positive cases, n (% positive)
17 (17)
11 (11)
9 (9)
5 (5)
9 (9)
23(23)
21 (21)
16 (16)
6 (6)
9 (9)
22 (22)
8 (8)
29 (29)
30 (30)
7 (7)
17 (17)
20 (20)
future science group
 Molecular diagnosis of bovine tuberculosis in bovine & human samples  Research Article

Table 4. Risk factor analysis in tuberculosis-positive human patients.

Risk factors Categories Tuberculosis-positive Bovine tuberculosis-positive
cases, n (% positive) cases (n)
Sex Female 57 (63.33) 3
  Male 33 (36.67) 3
Age class <15 years 12 (13.33) 0
  15–35 years 33 (36.67) 2
  >35 years 45 (50) 4
Unpasteurized milk Yes 51 (56.67) 6
consumption  No 39 (43.33) 0
Livestock in household Yes 57 (66.33) 6
  No 33 (36.67) 0
Educational levels No education 63 (70) 4
  Primary school 27 (30) 2
Smoking No 45(50) 6
  Yes 45 (50) 0
Contact with No 60 (66.67) 3
tuberculosis patients  Yes 30 (33.33) 3

and animals both in developed and develop-
ing countries. According to their recommenda-
tions, strong disease surveillance programs using
improved diagnostic tools in cattle and humans
should be considered a priority, especially in devel-
oping countries where risk factors are present. In
this study, a PCR-based diagnostic assay is intro-
duced for rapid and specific diagnosis of bTB from
biological samples in cattle and humans. Some
locally operative risk factors for zoonotic TB in
Bangladesh have also been identified in this study
which may help to determine persons at risk and
to develop appropriate control measures against
tuberculosis in developing countries. Stronger
intersectoral collaboration between the medical
and veterinary professionals is of spark importance
to combat against zoonotic bTB. International
cooperation in all aspects of zoonotic bTB is essen-
tial to fight against the disease.
Acknowledgements
The authors thank the farmers and organization who par-
ticipated in the study for their cooperation and time. The
authors extend their grateful thanks to Ivan Rychlik,
Veterinary Research Institute, Brno, Czech Republic for his
critical comments on manuscript preparation. The authors
gratefully acknowledge the Director General of Bangladesh
Livestock Research Institute, Savar, Dhaka, Bangladesh for
his kind permission to execute the research work and to
provide laboratory facilities.
Disclosure
The handling of animals in the study was performed in
accordance with current Bangladesh legislation (Cruelty to
Animals Act 1920, Act No. 1 of 1920 of the Government
of the People’s Republic of Bangladesh). Experiments with
human samples were approved by the Ethics Committee of
the Bangladesh Livestock Research Institute, Savar, Dhaka,
Bangladesh. Animal experiments were approved by the
Sylhet Agricultural University Institutional Animal Care
and Use Committee, Sylhet, Bangladesh. Written permis-
sion was received from individual cow owner to collect and
use bovine milk samples in this study.
Financial & competing interests disclosure
This study was performed under the project “Molecular
diagnosis of tuberculosis from bovine samples and their
interface for zoonotic transmission” funded by the
University Grants Commission (UGC) of Bangladesh
(UGC Research Grant No, 5921) through Sylhet
Agricultural University Research System (SAURES),
Government of the People’s Republic of Bangladesh. The
authors have no other relevant affiliations or financial
involvement with any organization or entity with a finan-
cial interest in or financial conflict with the subject matter
or materials discussed in the manuscript apart from those
disclosed.
No writing assistance was utilized in the production of
this manuscript.
Ethical conduct of research
The authors state that they have obtained appropriate
institutional review board approval or have followed the
principles outlined in the Declaration of Helsinki for all
human or animal experimental investigations. In addi-
tion, for investigations involving human subjects,
informed consent has been obtained from the participants
involved.

future science group www.futuremedicine.com 533

Research Article  Rahman, Noor, Islam et al.

Executive summary
Aim
●● To develop a PCR-based diagnostic test specific for Mycobacterium bovis for testing bovine and human biological
samples for bovine tuberculosis (bTB).
●● To identify potential risk factors for transmission of bTB in humans.
Materials & methods
●● Bacterial genomic DNA was isolated from bovine milk samples and sputum samples collected from TB-positive
human patients.
●● PCR targeting to the highly conserved 500-bp fragment of M. bovis was performed using specific primer pairs.
●● PCR results were validated using bacteriological culture and biochemical tests.
●● Data collection and risk factor analysis for bTB in human and cattle were performed.
Results & conclusions
●● PCR amplification of the targeted 500-bp DNA fragment of M. bovis was successful in 12.33% (37/300) of the bovine
samples.
●● 500-bp DNA fragment of M. bovis was also amplified in 6.67% (6/90) of the human sputum samples tested.
●● M. bovis was isolated and identified from all PCR-positive samples in bacteriological culture and biochemical tests.
●● Poor biosecurity and ill health due to poor nutrition were identified as management-related risk factors for the
outbreak of bTB at the farmers’ level.
●● Rearing of livestock in household, consumption of unpasteurized milk and smoking were identified as risk factors for
bTB in humans.
●● PCR-based diagnostic assay for bTB evaluated in this study on biological samples may be used for rapid and specific
diagnosis of bTB in cattle and humans.
●● Identified risk factors can be implicated in preventing zoonotic transmission of bTB at the cattle–human interface.

References
Papers of special note have been highlighted as:
• of interest; •• of considerable interest
1 Smith NH, Gordon SV, De La Rua-
Domenech R, Clifton-Hadley RS, Hewinson
RG. Bottlenecks and broomsticks: the
molecular evolution of Mycobacterium bovis.
Nat. Rev. Microbiol. 4(9), 670–681 (2006).
2 Renwick AR, White PC, Bengis RG. Bovine
tuberculosis in southern African wildlife: a
multi-species host-pathogen system.
Epidemiol. Infect. 135(4), 529–540 (2007).
3 Oloya J, Opuda-Asibo J, Kazwala R et al.
Mycobacteria causing human cervical
lymphadenitis in pastoral communities in the
Karamoja region of Uganda. Epidemiol.
Infect. 136(5), 636–643 (2008).
4 Hossain Ml, Khan Mfr, Nazir Khmnh,
Rahman Mb. A cross sectional study on
prevalence of bovine tuberculosis of buffaloes in
Bangladesh. Microbes Health 1, 23–26 (2012).
5 Rahman MM, Rahman KMF, Nazira
NHKHM, Rahmana MB. Prevalence of
bovine and avian tuberculosis in sheep and
goat population of Bangladesh. Sci. J.
Microbiol. 2(1), 1–8 (2013).
6 Ayele WY, Neill SD, Zinsstag J, Weiss MG,
Pavlik I. Bovine tuberculosis: an old disease
but a new threat to Africa. Int. J. Tuberc. Lung
Dis. 8(8), 924–937 (2004).
7 Wilkins MJ, Meyerson J, Bartlett PC et al.
Human Mycobacterium bovis infection and
bovine tuberculosis outbreak, Michigan,
1994–2007. Emerg. Infect. Dis. 14(4),
657–660 (2008).
8 Vordermeier HM, Rhodes SG, Dean G et al.
Cellular immune responses induced in cattle
by heterologous prime-boost vaccination
using recombinant viruses and bacille
Calmette-Guerin. Immunology 112(3),
461–470 (2004).
9 Schiller I, Oesch B, Vordermeier HM et al.
Bovine tuberculosis: a review of current and
emerging diagnostic techniques in view of
their relevance for disease control and
eradication. Transbound. Emerg. Dis. 57(4),
205–220 (2010).
•• An overview of current and emerging bovine
tuberculosis (bTB) testing strategies/tools
and their incorporation into the current
control/eradication programs.
10 Medeiros Ldos S, Marassi CD, Figueiredo
EE, Lilenbaum W. Potential application of
new diagnostic methods for controlling
bovine tuberculosis in Brazil. Braz. J.
Microbiol. 41(3), 531–541 (2010).
11 Cousins DV, Florisson N. A review of tests
available for use in the diagnosis of
tuberculosis in non-bovine species. Rev. Sci.
Tech. 24(3), 1039–1059 (2005).
12 Rodriguez JG, Mejia GA, Del Portillo P,
Patarroyo ME, Murillo LA. Species-specific
identification of Mycobacterium bovis by PCR.
Microbiology 141(Pt 9), 2131–2138 (1995).
• A fragment of approximately 500 bp was
amplified from the genome of 15 different
Mycobacterium bovis strains using random
amplified polymorphic DNA.
13 Rodriguez JG, Fissanoti JC, Del Portillo P,
Patarroyo ME, Romano MI, Cataldi A.

534 Future Microbiol. (2015) 10(4) future science group

 Molecular diagnosis of bovine tuberculosis in bovine & human samples  Research Article
Amplification of a 500-base-pair fragment
from cultured isolates of Mycobacterium bovis.
J. Clin. Microbiol. 37(7), 2330–2332 (1999).
• The presence of a 500-bp fragment that
amplifies a region from the genome of
M. bovis was evaluated by carrying out PCR
on 121 M. bovis isolates.
14 Mishra A, Singhal A, Chauhan DS et al.
Direct detection and identification of
Mycobacterium tuberculosis and Mycobacterium
bovis in bovine samples by a novel nested PCR
assay: correlation with conventional
techniques. J. Clin. Microbiol. 43(11),
5670–5678 (2005).
15 Vestal AL. Procedures of isolation and
identification of mycobacteria. U.S.
Department of Health, Education, and
Welfare publication no. (CDC) 77–8230.
Centers for Disease Control, GA, USA,
65–98 (1977).
16 Tschopp R, Bobosha K, Aseffa A et al. Bovine
tuberculosis at a cattle-small ruminant-
human interface in Meskan, Gurage region,
Central Ethiopia. BMC Infect. Dis. 11, 318
(2011).
• Assessment of bTB prevalence at an intensive
contact interface in cattle, small ruminants
and suspected TB-lymphadenitis human
patients.
17 Boukary AR, Thys E, Abatih E et al. Bovine
tuberculosis prevalence survey on cattle in the
rural livestock system of Torodi (Niger). PloS
ONE 6(9), e24629 (2011).
• Prevalence study of bTB infection in cattle
and identification of risk factors for infection
in human and cattle populations.
future science group
18 Brett JL, Humble MW. Incidence of human
tuberculosis caused by Mycobacterium bovis.
NZ Med. J. 104(904), 13–14 (1991).
19 De Kantor IN, Ritacco V. Bovine tuberculosis
in Latin America and the Caribbean: current
status, control and eradication programs. Vet.
Microbiol. 40(1–2), 5–14 (1994).
20 Fanning A, Edwards S. Mycobacterium bovis
infection in human beings in contact with elk
(Cervus elaphus) in Alberta, Canada.
Lancet 338(8777), 1253–1255 (1991).
21 Bauerfeind R, Benazzi S, Weiss R, Schliesser
T, Willems H, Baljer G. Molecular
characterization of Mycobacterium
paratuberculosis isolates from sheep, goats, and
cattle by hybridization with a DNA probe to
insertion element IS900. J. Clin.
Microbiol. 34(7), 1617–1621 (1996).
•• Mycobactin J-dependent mycobacterial
isolates from sheep, goat and cattle herds
with Johne’s disease were tested for the
repetitive insertion sequence IS900 of
Mycobacterium paratuberculosis by PCR.
22 Bernardelli A, Bastida R, Loureiro J et al.
Tuberculosis in sea lions and fur seals from
the south-western Atlantic coast. Rev. Sci.
Tech. 15(3), 985–1005 (1996).
23 Cousins DV, Francis BR, Gow BL et al.
Tuberculosis in captive seals: bacteriological
studies on an isolate belonging to the
Mycobacterium tuberculosis complex. Res. Vet.
Sci. 48(2), 196–200 (1990).
24 Romano MI, Alito A, Bigi F, Fisanotti JC,
Cataldi A. Genetic characterization of
Mycobacteria from South American wild seals.
Vet. Microbiol. 47(1–2), 89–98 (1995).
www.futuremedicine.com
25 Uddin Asmt AM, Khatun Mn, Mannan Ma,
Rahman Mm, Kabir Sml. Investigation of
bovine tuberculosis in rangpur division of
Bangladesh. J. Life Sci. Res. 1, 1–4 (2014).
26 Cosivi O, Grange JM, Daborn CJ et al.
Zoonotic tuberculosis due to Mycobacterium
bovis in developing countries. Emerg. Infect.
Dis. 4(1), 59–70 (1998).
•• Review on information on zoonotic TB in
developing countries, risk factor analysis and
recommendation to assess the magnitude of
the problem and control the disease in
humans and animals.
27 Humblet MF, Boschiroli ML, Saegerman C.
Classification of worldwide bovine
tuberculosis risk factors in cattle: a stratified
approach. Vet. Res. 40(5), 50 (2009).
•• Recommendations suggested to animal
health professionals and scientists directly
involved in the control and prevention of
bTB in cattle.
28 Ameni G, Erkihun A. Bovine tuberculosis on
small-scale dairy farms in Adama Town,
central Ethiopia, and farmer awareness of the
disease. Rev. Sci. Tech. 26(3), 711–719
(2007).
29 Cleaveland S, Shaw DJ, Mfinanga SG et al.
Mycobacterium bovis in rural Tanzania: risk
factors for infection in human and cattle
populations. Tuberculosis 87(1), 30–43
(2007).
30 Tschopp R, Schelling E, Hattendorf J, Aseffa
A, Zinsstag J. Risk factors of bovine
tuberculosis in cattle in rural livestock
production systems of Ethiopia. Prev. Vet.
Med. 89(3–4), 205–211 (2009).
535
Reproduced with permission of the copyright owner. Further reproduction prohibited without
permission.