Sadie Lanigan

16451494

Practical 1: A) PCR amplification of human DNA and detection of polymorphisms

Introduction: PCR is a technique that exploits DNA replication in order to yield many copies of a
particular region of DNA, generating a large amount of copies from a small initial sample [1]. It
involves the use of a heat stable DNA polymerase, usually Taq polymerase, which has the ability to
withstand extreme temperature changes. It involves denaturing the double stranded DNA, supplying
specific primers to anneal to the area desired for replication on both of the single strands and the
action of the polymerase proceeding to extend the primers and copy the template strand. This is
repeated for usually 20 or 30 cycles until sufficient amplification of the desired region has occurred.
The aim of this practical is to detect polymorphisms between individuals present in two different
hypervariable regions within the D loop, namely HSV2 and HSV2, from mitochondrial DNA isolated
from human cheek cells. PCR will be used to amplify this mitochondrial DNA template.

Methodology: 10 ml of 4% sucrose was agitated in the subject’s mouth for 30 s and the resulting
suspension of buccal cells was collected in a test tube. The sucrose solution was centrifuged for 10
min at 3.5K in order to collect the cells. The supernatant was discarded and the remaining contents of
the tube, including the pellet, were transferred to a microfuge tube using a pipette. The contents of the
microfuge tube were centrifuged for 2 min at 10K and the supernatant was discarded. The cell pellets
were re-suspended in 500 µl of 10 mM NaCl/ 10 mM EDTA and transferred to a microfuge tube. The
tube was then centrifuged for 20 s in a microfuge and the supernatant was carefully removed with a
pipette. The pellet was re-suspended in 500 µl of 50 mM NaOH using a pipette. The tube was
immersed in boiling water for 20 min using a boiling rack. Once removed from the boiling water, the
cells were neutralised by adding 100 µl of 1M Tris pH 7.5 and vortexed for 5 s. The sample was spun
in a microfuge for 2 min to remove cell debris and the supernatant was transferred to a fresh
microfuge tube using a pipette. The PCR reaction was then set up and the materials were added
according to the calculations outlined below. 1 µl of Taq polymerase was added by the demonstrators
and the PCR was set up and ran.

Calculations:
500 ng DNA required (approximately 5 µl of DNA prepared)
5 µl of DNA required

Need 0.2 mM of dNTPs which is provided as 2 mM stock

0.2:2 = 1:10 therefore a 1/10 dilution
Total volume is 50 µl
V1 C1 = V2 C2
(X) (2) = (50) (0.2)
Solving for X,
X = 5 µl therefore 5 µl of dNTPs is required for the reaction
 Sadie Lanigan
16451494

Need 20 pm of oligo DL1 and DL2 which are provided as 10 µM stocks

20 pm = 20 x 10-12 moles
10 µM = 10 x 10-6 M
20 x 10-12 / 10 x 10-6 = 2 x 10-6 = 2 µl DL1 required
(Same calculation for DL2 thus 2 µl of DL2 also required)

1X Taq buffer (provided as 10X stock)

1/10 = 0.1
Total volume = 50 µl
(1.1) (50 µl) = 5 µl Taq buffer required

5 units of Taq polymerase (provided as 5U/ µl)

Therefore need 1 µl of Taq polymerase

Sterile water to 50 µl
Complete volume of all other components = 20 µl
Therefore, 50 µl – 20 µl = 30 µl of water required

From the calculations the quantities needed for the PCR are as follows:

5 µl DNA
5 µl dNTP
2 µl oligo 1
2 µl oligo 2
5 µl Taq buffer
30 µl H2O
1 µl of Taq polymerase

Sequence of the primers designed using the criteria outlined in the lab manual:
Both primers selected fit the criteria outlined in the lab manual
 Sadie Lanigan
16451494

HSV1 primer sequence:

AAGCAGATTTGGGTACCACCCAAG
Relevant region from the sequence alignment is indicated by the highlighted yellow area

HSV2 Primer sequence:

GGGTTTGGCAGAGATGTGTTTAAAG
Relevant region from the sequence alignment is indicated by the highlighted yellow area

B) Karyotyping:
Introduction: Karyotyping is “the process of pairing and ordering all the chromosomes of an
organism, thus providing a genome-wide snapshot of an individual’s chromosomes”. This
 Sadie Lanigan
16451494

standardized arrangement of the cell includes chromosome number, form and size. Normal human
karyotypes contain 22 pairs of autosomal chromosomes and one pair of sex chromosomes.

Online karyotyping exercise: Identifying the abnormalities in the karyotype of the patients
shown
1A) 47 XX +21
1B) Down’s syndrome
2A) 47 XXY
2B) Klinefelter’s syndrome
3A) 47 XY +13
3B) Trisomy 13 syndrome

Down’s syndrome is a genetic disorder that occurs when an individual has 3 copies of chromosome
21 i.e. trisomy 21. It can occur when homologous chromosomes fail to separate during cell division
also known as non-disjunction. This disorder is a life-long condition that affects the normal physical
development of the affected individual and results in mild to moderate learning difficulties. Some
physical characteristics associated with this syndrome are decreased muscle tone, large tongue relative
to mouth, eyes that slant upwards, irregular shaped eyes and flat face among many other things.
Children who are born with the disorder are more likely to develop other conditions such as
congenital heart disease along with sight and hearing problems. The incidence of down’s syndrome is
between 1 in every 1000 and 1 in every 1500 live births in the general population and about 1 in every
550 live births in Ireland. The prevalence of downs syndrome increases with maternal age [6].
Klinefelter’s syndrome is a sex chromosomal condition that affects boys and men in which the
individual possesses an extra X chromosome [4]. There are varying signs and symptoms among
individuals as some experience a very mild from of the disorder and are not diagnosed until puberty
and adulthood compared to others whose symptoms are evident from a much younger age [4]. These
males usually have smaller testes that produce a lower amount of the hormone testosterone and this
lack of testosterone can lead to delayed or incomplete puberty, reduction of hair on the face and body
and gynecomastia if no treatment is given [2]. Due to the reduced size of the testes coupled with the
low testosterone levels, affected males are infertile and often have a lower sex drive and require
assisted reproductive technologies to produce offspring [4]. It affects 1 in every 500-1,000 new-born
boys and is one of the most common sex chromosome disorders [4].
Trisomy 13 syndrome, also known as Patau syndrome, is a chromosomal condition that is caused by
the presence of three copies of chromosome 13 [5]. This extra genetic material disrupts normal
development thus causing severe intellectual disability and physical abnormalities in the body and
only 5-10% of children with the condition will live past their first year [3]. Some of the defects caused
by the syndrome are cleft palate, cleft lip, microphthalmia, extra fingers and toes and heart defects
among many others [5]. Most cases of Patau syndrome are not inherited and just occur by chance
often due to an error in during conception [3]. The incidence of the syndrome is about 1 in every
16,000 new-borns and prevalence increases with the age of the mother [5].

Hardy-Weinberg equilibrium calculation:

 Sadie Lanigan
16451494

P = frequency of the presence of a “disease” allele

Q = frequency of the presence of a normal allele
p+q=1
p2 = 1/2500 = 0.0004
√0.0004 = 0.02 therefore p = 0.02
0.02 + q = 1 → q = 1 – 0.02 → q = 0.98
P2 + 2pq + q2 = 1 where 2pq is the number of heterozygous carriers → 2(0.02) (0.98) = 0.0392
Answers: Frequency of the “disease” allele = 0.02
Frequency of heterozygous carriers = 0.0392

References

1. Ncbi.nlm.nih.gov. (2019). Polymerase Chain Reaction (PCR). [online] Available at:

https://www.ncbi.nlm.nih.gov/probe/docs/techpcr/ [Accessed 8 Feb. 2019].
2. nhs.uk. (2019). Klinefelter syndrome. [online] Available at:
https://www.nhs.uk/conditions/klinefelters-syndrome/ [Accessed 8 Feb. 2019].
3. nhs.uk. (2019). Patau's syndrome. [online] Available at:
https://www.nhs.uk/conditions/pataus-syndrome/ [Accessed 8 Feb. 2019].
 Sadie Lanigan
16451494

4. Reference, G. (2019). Klinefelter syndrome. [online] Genetics Home Reference. Available at:
https://ghr.nlm.nih.gov/condition/klinefelter-syndrome#statistics [Accessed 8 Feb. 2019].
5. Reference, G. (2019). Trisomy 13. [online] Genetics Home Reference. Available at:
https://ghr.nlm.nih.gov/condition/trisomy-13#inheritance [Accessed 8 Feb. 2019].
6. Who.int. (2019). WHO | Genes and human disease. [online] Available at:
https://www.who.int/genomics/public/geneticdiseases/en/index1.html [Accessed 8 Feb.
2019].