Cellular Immunology 271 (2011) 147–156

Contents lists available at ScienceDirect

Cellular Immunology
journal homepage: www.elsevier.com/locate/ycimm

Ligation of TLR2 and TLR4 on murine bone marrow-derived mesenchymal stem

cells triggers differential effects on their immunosuppressive activity
Junxia Lei a,b, Zhen Wang a, Dayang Hui b, Weihua Yu a, Dunhua Zhou c, Wenjie Xia d, Chun Chen c,
Qunzhou Zhang e, Zhichong Wang f, Qi Zhang g,⇑, Andy Peng Xiang a,f,g,⇑
a
Center for Stem Cell Biology and Tissue Engineering, Key Laboratory for Stem Cells and Tissue Engineering, Ministry of Education, Sun Yat-Sen University, Guangzhou 510080,
PR China
b
Department of Pathophysiology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou 510080, PR China
c
Department of Pediatrics, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510120, China
d
Guangzhou Blood Center, Luyuan Road 31#, Guangzhou 510095, PR China
e
Center for Craniofacial Molecular Biology, School of Dentistry, University of Southern California, Los Angeles, CA, USA
f
State Key Laboratory of Ophthalmology, Sun Yat-Sen University, Guangzhou 510060, PR China
g
Cell-Gene Therapy Translational Medicine Research Center, The Third Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510630, PR China

a r t i c l e i n f o a b s t r a c t

Article history: Mesenchymal stem cells (MSCs) have potent regulatory effects on immune and inflammatory responses.
Received 17 April 2011 Recently the findings of functional TLR expression on MSC implicates these receptors in the function
Accepted 14 June 2011 established for MSCs. Here we specially investigated the effects of TLR2, 4 ligation in mice MSC on
Available online 23 June 2011
migration, modulation of allogeneic mixed lymphocytes reaction (allo-MLR) and inducing Treg cells.
We demonstrated that ligation of TLR2, but not TLR4, could significantly inhibit migration of MSC,
Keywords: impair MSC-mediated immunosuppression on allo-MLR, and reduce MSC-mediated expansion of
Mesenchymal stem cells
CD4+CD25+Foxp3+ regulatory T cells. Compared with TLR4 activated MSCs and non-TLR activated
TLR2
TLR4
MSC, TLR2 activation induced a relatively lower level of CXCL-10 mRNA and protein expressions which
Allogeneic mixed lymphocytes reaction has been elucidated to act in concert with other soluble factor in MSC-mediated immunomodulation.
These data indicate that TLR2 and TLR4 ligation had different effects on immunomodulatory capability
of murine BMSCs, which should be considered in their use for treating inflammatory diseases.
Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Recently the findings of functional toll-like receptors (TLRs)

Mesenchymal stem cells (MSCs) have been isolated from vari-
ous adult tissues and are defined as adherent, fibroblast-like cells
that can differentiate into a variety of tissue types, including bone,
cartilage, tendon, fat, and muscle [1–3]. In addition to multilineage
differentiation capacities, MSCs also exert potent regulatory effects
on immune and inflammatory responses [1,3], thus providing
therapeutic potentials for treating a variety of autoimmune and
inflammatory diseases, such as Crohn’s disease, rheumatoid arthri-
tis (RA), autoimmune encephalomyelitis, and systemic lupus ery-
thematosus (SLE) [4,5] and especially, graft-versus-host disease
GvHD after allogeneic bone marrow transplantation [6–9]. How-
ever, to date, the exact molecular mechanisms underlying the
immunomodulatory effect of MSCs still remain largely unknown.
⇑ Corresponding author at: Center for Stem Cell Biology and Tissue Engineering,
Key Laboratory for Stem Cells and Tissue Engineering, Ministry of Education, Sun
Yat-Sen University, Guangzhou 510080, PR China. Fax: +86 20 87335858 (A.P.
Xiang), fax: +86 20 85253305 (Q. Zhang).
E-mail addresses: kee_kee@126.com (Q. Zhang), xiangp@mail.sysu.edu.cn (A.P.
Xiang).
expression on MSC implicates these receptors in the function
established for MSCs [10–18]. Due to the fact that in vivo trans-
planted MSCs will invariably encounter various ‘‘danger signals’’
coming from pathological tissues such as damages or injuries,
infection and inflammation, it would be critical to further clarify
the engagement of TLRs in immunomodulatory functions of MSCs.
Exogenous and endogenous TLRs in immune cells play a major
role in innate immune responses and the enhancement of adaptive
immunity against invaders [19,20]. To date, thirteen mammalian
TLR analogs have been identified (10 in humans and 13 in mice).
TLRs recognize a wide variety of pathogen-associated molecular
patterns in bacteria, viruses, and fungi, as well as certain host-
derived molecules [21]. For example, TLR2 recognizes bacterial
lipoproteins, peptidoglycans, and lipoteichoic acids from gram-po-
sitive bacteria. TLR3 recognizes virus derived double-stranded RNA
and its DNA analogue poly (I:C). TLR4 recognizes lipopolysaccha-
rides (LPS) from gram-negative bacteria and endogenous mole-
cules, including heat shock proteins and extracellular matrix
molecules [21]. Ligation of TLRs with their specific ligands or
agonists leads to MyD88 (a TLR adapter protein)-dependent
or MyD88-independent activation of downstream signaling

0008-8749/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved.
doi:10.1016/j.cellimm.2011.06.014
148 J. Lei et al. / Cellular Immunology 271 (2011) 147–156
pathways, including nuclear factor jB, AKT, and MAPKs. Conse-
quently, the activation of these pathways triggers the induction
and secretion of various cytokines, chemokines and other inflam-
matory mediators [22].
Accumulating evidence has demonstrated that MSCs derived
from bone marrow [10,13–15], adipose tissue [11,17] and umbil-
ical cord [16] express different functional TLRs, and ligation of
TLRs differently affect MSC functions, including their multipotent
differentiation, proliferation, apoptosis, migration as well as their
production of inflammatory cytokines and chemokines (e.g., IL-6,
IL-8, CXCL-10) [12]. Of note, TLR-mediated responses are both
pattern-specific and species-specific. For instance, it is recognized
that mice bone marrow-derived MSCs dominantly express func-
tional TLR2 and TLR4, which mediate NFjB activation and signif-
icant IL-6 production [14], while human bone marrow-derived
MSCs express dominantly functional TLR3 and TLR4 and the
ligation of TLR3 resulted in the greatest activation of the NF-jB
pathway [10,13,15]. Regarding the engagement of TLRs in immu-
nomodulatory functions of MSCs, controversial results have been
reported [10,13,14]. Liotta et al. [10] reported that ligation of
TLR3 and TLR4 on human BM-derived MSCs inhibits their capac-
ity to suppress the proliferation of CD4+ T cells, whereas studies
by Opitz et al. [13] indicated that TLR3, 4 ligation on human
BM-derived MSCs enhance their suppression on allogeneic mixed
lymphocytes reaction (allo-MLR) and Waterman et al. [18] re-
ported that TLR3-primed MSCs lead to suppressed allogeneic
T-lymphocyte activation and TLR4-primed MSCs lead to permis-
sive T-lymphocyte activation. However, another study reported
[14] that ligation of TLR2 and TLR4 did not impair the immuno-
suppressive ability of mice BM-derived MSCs on specific T cell
clone proliferation. Since the role of TLR on immunomodulation
of MSC was limited and even contradictory, so we want to
further identify effects of TLR ligation on MSC-mediated
immunosuppression.
Considering the significant expression of TLR2 and TLR4 in mur-
ine MSC and potential use of MSC in the treatment for GVHD, we
specially investigated the effects of TLR2, 4 ligation in mice MSC
on migration, modulation of allo-MLR and inducing CD4+CD25+
Foxp3+ regulatory T (Treg) cells. In addition, chemokine CXCL-10
has been elucidated to act in concert with other soluble factor in
MSC-mediated immunomodulation, so the expression of CXCL-10
was also analyzed under our experimental condition.
2. Materials and methods
All experimental procedures involving animals were approved
by the Animal Ethics Committee of Sun Yat-Sen University
(200810011).
2.1. Reagents and antibodies
The medium used for spleen cell culture was RPMI 1640
(GibcoBRL, Grand Island, NY, USA) supplemented with 2 mM L-
glutamine, 1% nonessential amino acids, 1% pyruvate, 2  105 M
2-mercaptoethanol (Gibco, Grand Island, NY, USA). FITC-conju-
gated anti mouse CD44, CD45, MHC-I (H-2Db) and CD11b, PE-con-
jugated anti mouse MHC-II, CD117 and CD80, FITC-conjugated rat
IgG2b isotype control, PE-conjugated rat IgG2b isotype control, and
PE-conjugated Ar ham IgG2 isotype control antibodies were pur-
chased from BD Biosciences (San Diego, CA). PE-cy5-conjugated
anti mouse Sca-1 and rat IgG2a isotype control antibodies were
purchased from eBioscience. Escherichia coli O55:B5 LPS and
Pam3Cys were from Sigma–Aldrich (St. Louis) and Merck
(Calbiochem, La Jolla, CA), respectively.
2.2. Isolation, expansion and characterization of mouse MSCs
MSCs were isolated from femora bone marrow of C57BL/6 mice
[23]. The medullary canal was washed using Dulbecco’s modified
Eagle’s medium (Gibco, Grand Island, NY, USA) containing 10% fetal
calf serum (Hyclone, Logan, UT), and filtered using a 200 steel mesh
filter to collect bone marrow cells. After red blood cells were lysed,
bone marrow cells were suspended, counted and diluted to
approximately 500 viable cells per well of 24-well plate using
DMEM containing 10% fetal calf serum. Plates were kept in 5%
CO2 at 37 °C. After several clones of fibroblastic cells emerged,
these cells were trypsinized (0.05% trypsin at 37 °C for 5 min,
and pooled together before they were distributed in 6-well plates.
These multiclonal cultures were kept in an incubator for 7 days un-
til 70–80% confluence was attained. At this point, the next passages
were initiated, and the cells were pooled and cultured in 75 cm2
plastic flasks (Falcon; Gibco) as passage-2 cells. Ninety nine per-
centages of cells that were expanded for about 8 weeks displayed
a homogeneous immunophenotypic pattern and were used for
the experiments.
The differentiation potential of MSCs was assessed by testing
their ability to differentiate into adipocytes and osteoblasts as pre-
viously described [23]. The passage-6 cells were incubated in
DMEM supplemented with 10% FCS for 1 or 2 days until confluence
was achieved. The proliferation medium was replaced with an
osteogenic medium, which contained DMEM composed of 50 lg/
mL ascorbic acid 2-phosphate (Sigma), 10 nM dexamethasone (Sig-
ma) and 10 mM b-glycerol phosphate (Sigma). The cultures were
then placed in an incubator at 37 °C and 5% CO2 for 21 days, with
media changes three times per week. At the end of the cultivation
period, the cells were fixed with 10% formalin for 10 min and
stained with alizarin red (Sigma) for 15 min at room temperature
so that the mineralized matrix of the bone could be examined.
For adipogenesis, the medium of the frozen-thawed confluent cul-
ture of passage-6 cells was replaced with a differentiation medium
consisting of DMEM, supplemented with 50 lg/mL indomethacine
(Sigma) and 100 nM dexamethasone (Sigma). The culture was
incubated at 37 °C and 5% CO2 for 3 weeks. At the end of this per-
iod, the cells were stained with 0.5% oil red O (Sigma) in methanol
for 15 min for adipocyte detection.
2.3. Transwell migration assay
Migration assays were performed in transwell inserts with 8-
lm pore membrane filters (BD Biosciences, San Jose, CA). Mouse
MSCs were grown to subconfluence (70%) prior to harvesting by
trypsinization, then MSC (2  105 cells per well in 300 ll) were
loaded onto the upper chamber, and 500 ll of MSC growth med-
ium with TLR ligands, as indicated, was loaded onto the bottom
chamber. After overnight incubation, the upper sides of the filters
were carefully washed with cold PBS, and nonmigrating cells
remaining were removed with a cotton-tipped applicator. Then
migrating cells were fixed with 10% formalin and labeled with
Hoechst33342. Finally images of the migrating cells were observed
and counted using a Olympus IX71 inverted fluorescence micro-
scope (Olympus USA). The experiments in duplicates were re-
peated three times.
2.4. Mixed leukocyte reaction
MSCs (2  104 cells) were plated in flat-bottom 96-well plates
(Corning Glass) in a total volume of 0.2 ml of DMEM and main-
tained 1 day before the T cell proliferation assays. Splenocytes
were isolated from C57BL/6 and BALB/c spleens after mechanical
dissociation into 1 PBS/3% FCS. Erythrocytes were removed using
1-min Tris–NH4Cl incubation, followed by two washes in RPMI
 J. Lei et al. / Cellular Immunology 271 (2011) 147–156
1640 supplemented with 10% FCS, 100 U/ml penicillin, 100 lg/ml
streptomycin, L-glutamine (2 mM), HEPES (N-2-hydroxyethylpip-
erazine-N0 -2-ethanesulfonic acid, 25 mmol/L), and 5  105 M
2-ME. Responding splenocytes (2  105) and an equal number of
irradiated (30 Gy) allogeneic stimulating splenocytes were added
to the MSC culture. T cell proliferation assays were performed in
a total volume of 0.2 ml of complete RPMI 1640. Triplicate cultures
were incubated at 37 °C for 4 days, then 20 ll of the CellTiter 96Ò
AQueous One Solution reagent (Promega) was added to each well.
After 3 h, the absorbance at 492 nM was measured by means of a
counter (PerkinElmer).
Where specified, cell proliferation was also measured by 5, 6
carboxyfluorescein diacetate succinimidyl ester (CFSE) staining
method. C57BL/6 splenocytes were resuspended at a concentration
of 1  107 cells/ml in PBS. CFSE (Invitrogen) was added to a final
concentration of 5 lM and incubated 10 min at 37 °C. Labeling
was stopped by washing with RPMI plus 10% fetal calf serum
(FCS). Labeled cells were then stimulated with irradiated (30 Gy)
allogeneic splenocytes in the presence or absence of MSCs for
4 days, and analyzed by flow cytometry.
2.5. Flow cytometric analysis
MSC immunophenotypic analysis was performed as detailed
elsewhere. Briefly, MSCs were detached using trypsin–EDTA buf-
fer, washed, and resuspended at 106 cells per milliliter. One hun-
dred microliters of cell suspension was incubated at 4 °C for
10 min with 15% fetal calf serum (FCS), followed by incubation
with the specific mAb at 4 °C for 30 min. Cells were then washed
with phosphate-buffered saline (PBS) plus 0.5% bovine serum
albumin (BSA) and analyzed by flow cytometry (BDLSR II; BD
Biosciences).
For proliferation assay, spleen mononuclear cells were recov-
ered and stained with CD4-PE antibodies (eBioscience) for 30 min
on ice, washed with FACS buffer, and analyzed with a BD LSR
cytometer. The data were analyzed using Cell Quest and Modfit
software. T-cell proliferation was assessed by measuring CFSE
intensity within total lymphocytes and CD4+ T cell subpopulation.
T-cell proliferation was showed by equally spaced peaks on a log-
arithmic scale and proliferation fraction (PF) and proliferation in-
dex were indicated. In addition, T-cell proliferation was also
expressed by dot plots in which the dividing cells with gradually
deceased fluorescent intensity and their subgroups distribution
were clearly showed.
For Treg cell assay, 2  106 spleen cells per well were stimu-
lated with an equal number of irradiated (30 Gy) allogeneic stimu-
lating splenocytes in the presence or absence of MSC (2  105 cells)
in a 12-well plate for 5 days. On day 6, spleen mononuclear cells
were recovered by agitation and analyzed by flow cytometry for
Treg cells (Mouse Regulatory T cell Staining Kit (w/PE Foxp3 FJK-
16s, FITC CD4, APC CD25, eBioscience) according to manufactures’
instructions.
2.6. CXCL-10 ELISA
MSCs at 2  105 per well were seeded in MSC medium in 12-
well plates. Twenty-four hours later, MSC medium was removed
and 2  106 spleen cells per well stimulated with an equal number
of irradiated (30 Gy) allogeneic stimulating splenocytes were
added and incubated for 4 days. CXCL-10 concentration in culture
media was determined by enzyme-linked immunosorbent assay
(ELISA) for CXCL-10 (mouse CXCL-10 conventional ELISA; Bender
Medsystems, Austria) according to the manufacturer’s instructions.
Standard curves were established using mouse recombinant CXCL-
10. The assay detection limit was 16–32 pg/mL.
149
2.7. Real-time PCR
Total RNA was isolated from MSC at different intervals, as pre-
viously described. A total of 2 lg of RNA was reverse-transcribed
into cDNA using SuperScriptTM III First-Strand Synthesis System
(Invitrogen Life Technologies). Real-time PCR was performed on
an ABI Prism 7500 sequence detection system (Applied Biosys-
tems) using SYBR Green PCR Master Mix. In a final reaction volume
of 15 ll, the following were added: 2 SuperMix (SYBR Green mas-
ter mix; TOYOBO), cDNA, and 0.3 mM of each primer. Amplification
conditions were: 95 °C (1 min) followed by 35 cycles of 95 °C
(15 s), 60 °C (10 s), 72 °C(35 s).The following primer pairs were
used: for GADPH, CACGGCCGGTACAGTGAAAC (forward) and CCC
GTCGGCATGTATTAGCT (reverse); for CXCL-10, GCCGTCATTTTCT
GCCTCA (forward) and CGTCCTTGCGAGAGGGATC (reverse); for
inducible nitric oxide synthases (iNOS), TGGCCACCTTGTTCAGC-
TACG (forward) and GCCAAGGCCAAACACAGCATA (reverse). A
melting curve analysis was performed to assess primer specificity
and product quality. The levels of PCR product were compared to
GADPH mRNA, defined as 1 arbitrary unit.
2.8. Statistical analysis
Statistical differences between means in each experiment were
performed using an analysis of variance test (ANOVA) with subse-
quent post hoc analysis using Bonferroni correction. Differences
were considered statistically significant with a P value less than
0.05.
3. Results
3.1. MSCs, free of hematopoietic cells, express Sca-1 and differentiate
into osteocytes and adipocytes
We isolated and propagated plastic adherent, hematopoietic
cell-depleted stromal cells from mouse BM. The isolated stromal
cell population was negative for expression of CD45, CD11b,
CD117 and MHC-II, but was mild positive for MHC-I, CD44, and
strong positive for stem cell antigen-1 (Sca-1) expression
(Fig. 1a). These results ruled out the possibility of hematopoietic
cell contamination in the stromal cell cultures. To confirm the iso-
lated stromal cells (Fig. 1b) were unique MSCs, multiple differenti-
ation analysis was performed. Under osteogenic induction
condition, the cultured cells differentiated into osteocytes as deter-
mined by Alizarin red staining (Fig. 1c). On the other hand, the adi-
pogenic differentiation was confirmed by Oil red O staining of cells
after cultured in adipogenic induction medium for 21 days
(Fig. 1d). Taken together, these results suggest that the isolated
stromal cells possess typical characteristics of multipotent mesen-
chymal stem cells (MSCs).
3.2. TLR2 stimulation of MSCs inhibits their chemotaxis in a dose-
dependent manner
It has been demonstrated that MSCs possess the capability
homing to injured or inflammatory sites. However, the detailed
mechanisms that drive their migration and recruitment remain
largely unclear [1–3]. Then we explored whether TLRs are engaged
in the migration of MSCs. To this end, a transwell migration assay
was performed, whereby TLR2 and TLR4 ligands (Pam3Cys and LPS,
respectively) were added into the bottom chamber as chemoat-
tractants while single-cell suspensions of MSCs were loaded onto
the top inserts. Our results showed that the presence of Pam3Cys
inhibited the chemotaxis of MSCs in a dose-dependent manner,
150 J. Lei et al. / Cellular Immunology 271 (2011) 147–156

Fig. 1. MSCs, free of hematopoietic cells, express Sca-1 and differentiate into osteocytes and adipocytes. (A) MSCs were stained with antibodies against surface markers or
control antibodies and subjected to flow cytometry analysis. (B) Morphology of passage 6 mMSCs, original magnifications: 40. (C) Differentiation into osteocytes after
induction culture was detected by Alizarin red staining, original magnifications: 40. (D) Adipogenesis after induction culture was detected by Oil red O staining. Original
magnifications: 100.

but no obvious effects were observed in MSCs in response to LPS
exposure (Fig. 2A–F).
3.3. TLR2 and TLR4 ligation on MSCs exhibit differential effects on allo-
MLR and induction of CD4+CD25+Foxp3+ regulatory T cells
One-way allo-MLR is a well-accepted cell model for the study of
GvHD. Previous studies have shown that bone marrow derived
MSCs can suppress allo-MLR [1,3]. Herein we further examined
whether LPS and Pam3Cys ligation could affect the immunosup-
pressive effect of MSCs on allo-MLR. To this end, MSCs alone were
pre-incubated with LPS (1 lg/ml) or Pam3Cys (2 lg/ml) for 2 days
and then collected, washed, and cocultured with allostimulated
lymphocytes at a ratio of 1:10 (MSC: responder spleen cell). As ex-
pected, the addition of non-pretreated MSCs significantly inhibited
the MLR by MTS proliferation assay and CFSE staining (Fig. 3).
However, the addition of MSCs pretreated by Pam3Cys, but not
by LPS, almost completely restored the lymphocyte proliferation
(Fig. 3). Proliferation kinetic analysis by CFSE staining method
further showed that the addition of MSCs pretreated by Pam3Cys
even stimulated lymphocytes proliferation and formed more
significant division peaks compared with MLR system in the ab-
sence of MSC (Fig. 3B). Secondly, the continuously proliferating
subgroups of lymphocytes were mainly located in CD4-T cells
(Fig. 3B). These results suggest that ligation of TLR2, but not
TLR4, could not only impair the ability of mice bone
 J. Lei et al. / Cellular Immunology 271 (2011) 147–156 151

Fig. 2. TLR2 stimulation inhibits the migration of the exposed mMSCs, while TLR4 stimulation does not. MSC migration toward TLR-specific ligands was examined by
transwell migration assay. After 12 h incubation, migration toward the various TLR ligands was visualized and recorded by fluorescence microscopy. (A) Medium alone, (B)
Pam3Cys treatment at concentration of 2 lg/ml(b), (C) Pam3Cys treatment at concentration of 20 lg/ml, (D) LPS treatment at 1 lg/ml, (E) LPS treatment at 10 lg/ml, (F) the
number of migrated cells per high-power field. A representative result from three experiments. (A–E, original magnifications: 40).

marrow-derived MSC to suppress the proliferation of lymphocytes,
but also alter proliferation kinetics of lymphocytes.
CD4+CD25+Foxp3+ Treg cells, a well-characterized cell popula-
tion with immunosuppressive activity, have been demonstrated to
protect host from GvHD-caused lethality in bone marrow trans-
plantation models. Several lines of evidence have shown that
MSC may implement their immunosuppressive effect by inducing
the generation of regulatory T cells [24]. Therefore, we endeavored
to investigate whether TLR2 and TLR4 activation could affect MSC-
induced generation of Treg cells. To this purpose, allostimulated
splenocytes were cocultured with MSCs pretreated or non-
pretreated by LPS (1 lg/ml) or Pam3Cys (2 lg/ml). After 5 days of
coculture, allostimulated spleen cells were collected and analyzed
for CD4, CD25 and Foxp3 expression. In agreement with previous
reports, coculture with MSCs without pretreatment with TLR
ligands significantly promoted the generation of Treg cells
(Fig. 4A–D). However, coculture with MSCs pretreated with TLR2
ligand (Pam3Cys) resulted in a dramatic reduction in the percent-
age of CD4+CD25+ T cell (3.01% ± 0.44 vs 7.19% ± 1.33; p < 0.05)
and CD4+CD25+Foxp3+ T cells (8.83% ± 1.02 vs 15.12% ± 1.02;
p < 0.05) as compared with non-pretreated MSCs (Fig. 4A–D). On
the contrary, MSCs pretreated with TLR4 ligand (LPS) still main-
tained their ability to promote Treg generation to a similar degree
as compared to non-pretreated MSCs (Fig. 4A–D). Again, these re-
sults suggest that ligation of TLR2, but not TLR4, could impair the
ability of mice bone marrow-derived MSCs to induce the genera-
tion or expansion of Treg cells.
3.4. Different effects of TLR2 and TLR4 activation on expression of
CXCL10 and iNOS produced by MSC
It was reported that TLR4 activation induced IFN-b-mediated
STAT1 phosphorylation which permitted induction of CXCL-10
and iNOS gene in mouse macrophage and MSC, whereas TLR2
did not induce IFN-b-dependent CXCL10 production [17,25,26].
In addition, it is shown that the concerted action of some chemo-
kines (e.g.,CXCL-9, CXCL-10) and immune-inhibitory nitric
oxide(NO) plays key role in MSC-mediated immunosuppression
[27,28], since NO which mainly catalyzed by the iNOS is highly
unstable and only acts locally. So we wonder whether differential
induction of CXCL-10 and iNOS are responsible for different effects
of TLR2 and TLR4 activation on MSC-mediated immnosuppres-
sion? To this purpose, CXCL-10 production in the supernatants
from cocultures of MSCs and allostimulated splenocytes was
determined by using ELISA. Our results showed that the concen-
tration of CXCL-10 from Pam3Cys pretreated MSC group was sig-
nificantly lower than that from untreated MSC group (p < 0.05),
whereas no obvious changes in CXCL-10 production were ob-
served in supernatants from LPS pretreated MSC group as com-
pared with non-pretreated MSC group (p > 0.05) (Fig. 5A). To
further clarify the cellular origin of CXCL-10 and its dynamic
expression in the cocultures, CXCL-10 mRNA expression in MSC
cocultured with allostimulated lymphocytes for various intervals
was assayed by real-time PCR and compared to GADPH mRNA
(Fig. 5B). Our results showed that, 1 day after co-cultured with all-
ostimulated lymphocytes, CXCL-10 mRNA expression by MSCs un-
der different conditions started to increase, but with a little lower
expression in Pam3Cys pretreated MSCs. At day 2 post coculture,
the increase of CXCL-10 mRNA became more significant in both
non-pretreated and LPS-pretreated MSCs, but reduced in the
Pam3Cys pretreated MSCs (Fig. 5B). Afterwards, CXCL-10 mRNA
expression continued to increase in MSCs under different condi-
tions till day 4 after coculture, but LPS-pretreated MSCs expressed
a lower level of CXCL-10 mRNA than non-pretreated MSCs,
whereas the expression of CXCL-10 mRNA in Pam3Cys-pretreated
MSCs was always maintained at the lowest level as compared
with non-pretreated and LPS-pretreated partners (Fig. 5B). Mean-
while, the dynamic expression of iNOS mRNA by MSCs cocultured
with allostimulated splenocytes was also determined by real-time
PCR. As shown in Fig. 5C, a relatively very low level of iNOS mRNA
expression was detected in both non-pretreated and LPS-pre-
treated MSCs after cocultured for different time intervals, but a
significant increase in iNOS mRNA expression was detected in
Pam3Cys-pretreated MSCs. Taken together, these results showed
152 J. Lei et al. / Cellular Immunology 271 (2011) 147–156

Fig. 3. Pam3Cys preincubation, but not LPS, impairs the inhibitory activity of MSCs on allo-MLR. (A) C57 splenocytes were stimulated by irradiated allogeneic (BALB/c) spleen
mononuclear cells in the absence or presence of different treated MSCs (MSC/responding cell ratios of 1/10). After 4 days of culture, MTS was added to the culture medium for
additional 3 h, and then OD value was measured. Columns represent mean values ± SD (n = 7). ⁄p < 0.05. (B) C57 splenocytes were stained with CFSE and were stimulated by
irradiated BALB/c spleen mononuclear cells in the absence or presence of different treated MSCs. After 4 days of culture, splenocytes were harvested and lymphocytes
proliferation was assessed by measuring CFSE intensity within total lymphocytes and CD4+ T cell subpopulation. T-cell proliferation was showed by equally spaced peaks on a
logarithmic scale (left panel) or expressed by dot plots (right panel). FACS plot is a representative of three experiments of identical design. NC, negative control, C57
splenocytes alone; PC, positive control, C57 splenocytes were stimulated by irradiated allogeneic (BALB/c) spleen mononuclear cells in the absence of MSC.
 J. Lei et al. / Cellular Immunology 271 (2011) 147–156 153

Fig. 4. Pam3Cys preincubation, but not LPS, reduce the percentage of CD4+CD25+Foxp3+ T cells within allostimulated lymphocytes population. (A–D) C57 splenocytes were
stimulated by irradiated allogeneic spleen mononuclear cells in the absence or presence of different treated MSCs (MSC/responding cell ratios of 1/10). On day 6 of MLR
containing C57 splenocytes, irradiated allogeneic splenocytes and untreated MSCs or TLR ligands preincubated MSC, non-adherent cells were harvested and stained with anti-
CD4, anti-CD25 and anti-Foxp3Abs, then analyzed by flow cytometry. (A) Percentages ± SD of CD4+CD25+among lymphocytes from four experiments and (B) dot plots from a
representative experiment were shown. (C) Percentages ± SD of CD25+Foxp3+ cells among CD4+ lymphocytes from four experiments and (D) dot plots from a representative
experiment were shown. ⁄p < 0.05.

that the change trend of CXCL-10 produced by TLR2 and TLR4 acti- was not observed under our experimental condition. Anyway,
vated MSCs was just in accord with their different immunosup- the synergistic action of CXCL10 with soluble factors should be
pressive ability, however the concomitant expression of iNOS further clarified.
154 J. Lei et al. / Cellular Immunology 271 (2011) 147–156
Fig. 5. Different effects of TLR2 and TLR4 activation on expression of CXCL10 and
iNOS produced by MSC. (A) On day 5 of allo-MLR containing C57 splenocytes,
irradiated allogeneic stimulating splenocytes and untreated MSCs or TLR ligands
preincubated MSC, Supernatants from cell cultures were harvested for the
determination of CXCL-10 production by ELISA method. Mean values ± SD of four
different experiments were shown. ⁄p < 0.05. (B) CXCL-10 mRNA in different co-
cultures containing untreated MSCs or TLR ligands preincubated MSC and allosti-
mulated lymphocytes for various intervals was assayed by real-time PCR and
compared to GADPH mRNA. (C) iNOS mRNA in different cocultures was assayed by
real-time PCR and compared to GADPH mRNA. mRNA data is a representative of
three experiments.
4. Discussion
TLRs, a conserved family of receptors, are type I transmembrane
glycoproteins which contain an extracellular domain composed of
numerous leucine-rich repeats and an intracellular region contain-
ing a terminal inverted repeats (TIR) homology domain [29] differ-
ently expressed on immune and nonimmune cells. TLRs recognize
a wide variety of pathogen-associated molecular patterns, and
their activation contributes to the regulation of both innate and
adaptive immune responses [19]. Recently, several lines of evi-
dence have demonstrated the expression of functional TLRs on
murine and human mesenchymal stem cells of different tissue ori-
gins, including cord blood MSCs [16], bone marrow-derived MSCs
[10,13–15] and adipose-derived MSCs [11,17]. Functionally, com-
plicated findings have been reported on the engagement of TLRs
in the regulation of differentiation of MSC originated from different
tissues [11,14,16,30]. In addition, previous studies have indicated
that TLR agonists drive the migration of human bone marrow MSCs
[15]. However, in murine bone marrow MSCs, TLR2 activation re-
duced the basal motility but increased the proliferation of MSCs
[14]. In agreement with this study, our results showed that TLR2
ligation by Pam3Cys treatment significantly inhibited the migra-
tion response of murine BMSCs but TLR4 ligation by LPS showed
no obvious effects.
Considering the use of MSC in the treatment for immunodisor-
ders, our study focused on the engagement of TLR activation in
immunomodulatory function of MSCs. Recently some conflict re-
sults have been reported. Under certain conditions, TLR3,4 engage-
ment enhances the immunosuppressive properties of human
BMSCs [13], but TLR2,3,4 activation does not impair the immuno-
suppressive properties of hADSCs on allo-MLR [11] and TLR2 ligand
does not affect immunosuppression of murine BMSCs on T-cell line
proliferation [14]. However, Liotta et al. reported that ligation of
TLR3 and TLR4 on human BMSCs inhibited their ability to suppress
the proliferation of T cells [10]. In the present study, our results
showed that activation of TLR2 by Pam3Cys impaired the murine
BMSC-mediated immunosuppressive activity on allo-MLR, while
TLR4 ligation by LPS had no effects. It is well recognized that the
function of TLR activation varies among different types and differ-
ent species. Here, we particularly noticed that effects of even the
same TLR from the same species also varied on specific experimen-
tal model [10,13,14]. Our results showed that activation of TLR2 on
MSC more clearly improve CD4-T cells proliferation which was in
accord with the suggestion by Opitz et al. [13] that CD4-T cells
are important in mediating immunosuppression induced by TLR-
stimulated MSC. So such discrepancies in the TLR engagement in
the regulation of immunosuppressive ability of MSCs might, at
least in part, due to different types of responder lymphocyte cells,
e.g. T-cell line specific to MOG p35–55 peptide [14], PBMC [13],
CD4+ T cells [10] or splenocytes that were used in allo-MLR.
Several lines of evidence have also shown that MSCs exert their
immunosuppressive effect by promoting the generation/expansion
of CD4+CD25+Foxp3+ Treg cells via direct cell-cell contact or/and
soluble factors [24]. It was shown that activation of TLR2, but not
TLR4, could directly control the expansion of highly purified Treg
cells and temporarily abrogate the suppressive phenotype of Treg
cells, thereby enhancing immune responses [31]. In the current
study, our findings indicated that TLR2 ligation by Pam3Cys, but
not TLR4 ligation by LPS, on murine BMSCs significantly inhibited
the generation/expansion of Treg cells in the cocultures of MSCs
and allostimulated lymphocytes, which was in accord with effects
of engagement of TLR2, 4 in MSC-mediated modulation of allo-
MLR.
It was reported that TLR4 activation induced IFN-b-mediated
STAT1 phosphorylation which permitted induction of CXCL-10
 J. Lei et al. / Cellular Immunology 271 (2011) 147–156
and iNOS gene in mouse macrophage and MSC, whereas TLR2 did
not induce IFN-b-dependent CXCL10 production [17,25,26]. In
addition, it is shown that some chemokines (e.g., CXCL-9, CXCL-
10) act in concert with immune-inhibitory NO which mainly cata-
lyzed by the iNOS to mediate immunomodulation of MSC [27,28].
So we wonder whether differential induction of CXCL10 and iNOS
are responsible for different effects of TLR2 and TLR4 activation on
MSC-mediated immnosuppression? In the present study, our re-
sults showed that TLR4 activation led to a higher expression of
CXCL-10 but a lower expression of iNOS as compared with TLR2
activation, indicating that asynchronous expression of CXCL-10
and iNOS by MSC under our experimental condition. However,
since NO can be also produced by macrophages, the synergistic
inhibition action of CXCL-10 and NO can not be ruled out in co-
cultures of TLR4-activated MSC and allo-MLR. It was reported that
only when MSC and macrophages were both derived from iNOS/
mice, the effect of TLR4-activated MSC on IL-10 induction could be
eliminated [32]. On the other hand, higher iNOS and lower CXCL-
10 expression induced by TLR2 activation on MSC still led to
impairment of the MSC-mediated immunosuppression. These data
suggest that differential induction of CXCL10 may be play key role
in different effects of TLR2 and TLR4 activation on MSC-mediated
immnosuppression. Anyway, the synergistic action of CXCL10 with
other soluble factors should be further clarified.
In conclusion, our findings have provided further evidence that
the differential expression of TLRs on MSCs might contribute to the
discrete changes in the function of MSCs, especially their migration
and immunomodulatory abilities. In the last decade, one of the
hallmarks in MSC research is the discovery that MSCs possess po-
tent immunosuppressive and anti-inflammatory capacities as
demonstrated in various in vitro and in vivo studies. The immuno-
modulatory properties of MSCs implicate their potential applica-
tion in the treatment of autoimmune and inflammation-related
diseases, especially in cell-based therapy of GvHD [3,6–9]. Further
clarification of the molecular mechanisms underlying the immu-
nosuppressive ability of MSCs will provide novel approaches to im-
prove stem cell-based therapeutic strategies.
Conflict of Interest
This statement certifies that there are no conflicts of interest.
Acknowledgments
This work was supported by the Key Scientific and Technologi-
cal Projects of Guangdong Province (2007A032100003,
2008B030301305), the Key Scientific and Technological Projects
of Guangzhou City (2008A1-E4011-5, 2010U1-E00551), the Guang-
dong Medical Science Foundation (A2009157), the National Science
Foundation (30872786, 30772367), Program for New Century
Excellent Talents in University and the Fundamental Research
Funds for the Central Universities (09ykpy79, 10ykzd02).
References
[1] G. Chamberlain, J. Fox, B. Ashton, J. Middleton, Concise review: mesenchymal
stem cells: their phenotype, differentiation capacity, immunological features,
and potential for homing, Stem Cells 25 (2007) 2739–2749.
[2] N.K. Satija, V.K. Singh, Y.K. Verma, P. Gupta, S. Sharma, F. Afrin, M. Sharma, P.
Sharma, R.P. Tripathi, G.U. Gurudutta, Mesenchymal stem cell-based therapy: a
new paradigm in regenerative medicine, J. Cell Mol. Med. 13 (2009) 4385–
4402.
[3] A. Uccelli, L. Moretta, V. Pistoia, Mesenchymal stem cells in health and disease,
Nat. Rev. Immunol. 8 (2008) 726–736.
[4] G.W. Dryden, Overview of stem cell therapy for Crohn’s disease, Expert Opin.
Biol. Ther. 9 (2009) 841–847.
[5] R.E. Newman, D. Yoo, M.A. LeRoux, A. Danilkovitch-Miagkova, Treatment of
inflammatory diseases with mesenchymal stem cells, Inflammation Allergy
Drug Targets 8 (2009) 110–123.
155
[6] K. Le Blanc, F. Frassoni, L. Ball, F. Locatelli, H. Roelofs, I. Lewis, E. Lanino, B.
Sundberg, M.E. Bernardo, M. Remberger, G. Dini, R.M. Egeler, A. Bacigalupo, W.
Fibbe, O. Ringdén, Mesenchymal stem cells for treatment of steroid-resistant,
severe, acute graft-versus-host disease: a phase II study, Lancet 371 (2008)
1579–1586.
[7] K. Le Blanc, I. Rasmusson, B. Sundberg, C. Götherström, M. Hassan, M.
Uzunel, O. Ringdén, Treatment of severe acute graft-versus-host disease
with third party haploidentical mesenchymal stem cells, Lancet 363
(2004) 1439–1441.
[8] H. Ning, F. Yang, M. Jiang, L. Hu, K. Feng, J. Zhang, Z. Yu, B. Li, C. Xu, Y. Li, J.
Wang, J. Hu, X. Lou, H. Chen, The correlation between cotransplantation of
mesenchymal stem cells and higher recurrence rate in hematologic
malignancy patients: outcome of a pilot clinical study, Leukemia 22 (2008)
593–599.
[9] O. Ringden, M. Uzunel, I. Rasmusson, M. Remberger, B. Sundberg, H. Lönnies,
H.U. Marschall, A. Dlugosz, A. Szakos, Z. Hassan, B. Omazic, J. Aschan, L.
Barkholt, K. Le Blanc, Mesenchymal stem cells for treatment of therapy-
resistant graft-versus-host disease, Transplantation 81 (2006) 1390–1397.
[10] F. Liotta, R. Angeli, L. Cosmi, L. Filì, C. Manuelli, F. Frosali, B. Mazzinghi, L.
Maggi, A. Pasini, V. Lisi, V. Santarlasci, L. Consoloni, M.L. Angelotti, P.
Romagnani, P. Parronchi, M. Krampera, E. Maggi, S. Romagnani, F.
Annunziato, Toll-like receptors 3 and 4 are expressed by human bone
marrow-derived mesenchymal stem cells and can inhibit their T-cell
modulatory activity by impairing Notch signaling, Stem Cells 26 (2008) 279–
289.
[11] E. Lombardo, O. DelaRosa, P. Mancheño-Corvo, R. Menta, C. Ramírez, D.
Büscher, Toll-like receptor-mediated signaling in human adipose-derived stem
cells: implications for immunogenicity and immunosuppressive potential,
Tissue Eng. Part A 15 (2009) 1579–1589.
[12] K. Nemeth, B. Mayer, E. Mezey, Modulation of bone marrow stromal cell
functions in infectious diseases by toll-like receptor ligands, J. Mol. Med. 88
(2010) 5–10.
[13] C.A. Opitz, U.M. Litzenburger, C. Lutz, T.V. Lanz, .I. Tritschler, A. Köppel, E.
Tolosa, M. Hoberg, J. Anderl, W.K. Aicher, M. Weller, W. Wick, M. Platten, Toll-
like receptor engagement enhances the immunosuppressive properties of
human bone marrow-derived mesenchymal stem cells by inducing
indoleamine-2, 3-dioxygenase-1 via interferon-beta and protein kinase R,
Stem Cells 27 (2009) 909–919.
[14] M. Pevsner-Fischer, V. Morad, M. Cohen-Sfady, L. Rousso-Noori, A. Zanin-
Zhorov, S. Cohen, I.R. Cohen, D. Zipori, Toll-like receptors and their
ligands control mesenchymal stem cell functions, Blood 109 (2007)
1422–1432.
[15] S.L. Tomchuck, K.J. Zwezdaryk, S.B. Coffelt, R.S. Waterman, E.S. Danka, A.B.
Scandurro, Toll-like receptors on human mesenchymal stem cells drive
their migration and immunomodulating responses, Stem Cells 26 (2008)
99–107.
[16] L.C. van den Berk, B.J. Jansen, K.G. Siebers-Vermeulen, M.G. Netea, T. Latuhihin,
S. Bergevoet, R.A. Raymakers, G. Kögler, C.C. Figdor, G.J. Adema, R. Torensma,
Toll-like receptor triggering in cord blood mesenchymal stem cells, J. Cell Mol.
Med. 13 (2009) 3415–3426.
[17] S. Yu, H.H. Cho, H.J. Joo, Y.C. Bae, J.S. Jung, Role of MyD88 in TLR agonist-
induced functional alterations of human adipose tissue-derived mesenchymal
stem cells, Mol. Cell. Biochem. 317 (2008) 143–150.
[18] R.S. Waterman, S.L. Tomchuck, S.L. Henkle, A.M. Betancourt, A new
mesenchymal stem cell (MSC) paradigm: polarization into a pro-
inflammatory MSC1 or an Immunosuppressive MSC2 phenotype, PLoS ONE 5
(2010) e10088.
[19] S. Akira, K. Takeda, T. Kaisho, Toll-like receptors: critical proteins linking
innate and acquired immunity, Nat. Immunol. 2 (2001) 675–680.
[20] V. Hornung, S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdörfer, T. Giese, S.
Endres, G. Hartmann, Quantitative expression of Toll-like receptor 1-10 mRNA
in cellular subsets of human peripheral blood mononuclear cells and
sensitivity to CpG oligodeoxynucleotides, J. Immunol. 168 (2002) 4531–4537.
[21] B. Beutler, Inferences questions and possibilities in Toll-like receptor signaling,
Nature 430 (2004) 257–263.
[22] S. Akira, K. Takeda, Toll-like receptor signaling, Nat. Rev. Immunol. 4 (2004)
499–511.
[23] M.B. Eslaminejad, A. Nikmahzar, L. Taghiyar, S. Nadri, M. Massumi, Murine
mesenchymal stem cells isolated by low density primary culture system, Dev.
Growth Differ. 48 (2006) 361–370.
[24] Z. Selmani, A. Naji, I. Zidi, B. Favier, E. Gaiffe, L. Obert, C. Borg, P. Saas, P.
Tiberghien, N. Rouas-Freiss, E.D. Carosella, F. Deschaseaux, Human leukocyte
antigen-G5 secretion by human mesenchymal stem cells is required to
suppress T lymphocyte and natural killer function and to induce
CD4+CD25highFoxp3+ regulatory T cells, Stem Cells 26 (2008) 212–222.
[25] S.H. Rhee, B.W. Jones, V. Toshchakov, S.N. Vogel, M.J. Fenton, Toll-like receptors
2 and 4 activate STAT1 serine phosphorylation by distinct mechanisms in
macrophages, J. Biol. Chem. 278 (2003) 22506–22512.
[26] V. Toshchakov, B.W. Jones, A. Lentschat, A. Silva, P.Y. Perera, K. Thomas, M.J.
Cody, S. Zhang, B.R. Williams, J. Major, T.A. Hamilton, M.J. Fenton, S.N. Vogel,
TLR2 and TLR4 agonists stimulate unique repertoires of host resistance genes
in murine macrophages: interferon-beta-dependent signaling in TLR4-
mediated responses, J. Endotoxin Res. 9 (2003) 169–175.
[27] G.W. Ren, L.Y. Zhang, X. Zhao, G. Xu, Y. Zhang, A.I. Roberts, R.C. Zhao, Y. Shi,
Mesenchymal stem cell-mediated immunosuppression occurs via concerted
action of chemokines and nitric oxide, Cell Stem Cell 2 (2008) 141–150.
156 J. Lei et al. / Cellular Immunology 271 (2011) 147–156

[28] Y. Shi, G. Hu, J. Su, W. Li, Q. Chen, P. Shou, C. Xu, X. Chen, Y. Huang, Z. Zhu, X.
Huang, X. Han, N. Xie, G. Ren, Mesenchymal stem cells: a new strategy for
immunosuppression and tissue repair, Cell Res. 20 (2010) 510–518.
[29] J.K. Bell, G.E. Mullen, C.A. Leifer, A. Mazzoni, D.R. Davies, D.M. Segal, Leucine-
rich repeats and pathogen recognition in Toll-like receptors, Trends Immunol.
24 (2003) 528–533.
[30] H. Hwa Cho, Y.C. Bae, J.S. Jung, Role of toll-like receptors on human adipose-
derived stromal cells, Stem Cells 24 (2006) 2744–2752.
[31] H. Liu, M Komai-Koma, D. Xu, F.Y. Liew, Toll-like receptor 2 signaling
modulates the functions of CD4+CD25+ regulatory T cells, Proc. Natl Acad.
Sci. USA 103 (2006) 7048–7053.
[32] K. Németh, A. Leelahavanichkul, P.S. Yuen, B. Mayer, A. Parmelee, K. Doi, P.G.
Robey, K. Leelahavanichkul, B.H. Koller, J.M. Brown, X. Hu, I. Jelinek, R.A. Star, E.
Mezey, Bone marrow stromal cells attenuate sepsis via prostaglandin E(2)-
dependent reprogramming of host macrophages to increase their interleukin-
10 production, Nat. Med. 15 (2009) 42–49.