Hypertrophy-stimulated myogenic regulatory factor mRNA
increases are attenuated in fast muscle of aged quails
DAWN A. LOWE,1 TROY LUND,2 AND STEPHEN E. ALWAY1,3
Departments of 1Anatomy and 2Medical Microbiology and Immunology, College of Medicine, and
3Institute on Aging, University of South Florida, Tampa, Florida 33612
Lowe, Dawn A., Troy Lund, and Stephen E. Alway.
Hypertrophy-stimulated myogenic regulatory factor mRNA
increases are attenuated in fast muscle of aged quails. Am. J.
Physiol. 275 (Cell Physiol. 44): C155–C162, 1998.—Myogenic
regulatory factors (MRFs) are a family of skeletal muscle-
specific transcription factors that regulate the expression of
several muscle genes. This study was designed to determine
whether MRF transcripts were increased in hypertrophy-
stimulated muscle of adult quails and whether equivalent
increases occurred in muscles of older quails. Slow-tonic
anterior latissimus dorsi and fast-twitch patagialis muscles
of adult, middle-aged, aged, and senescent quails were stretch
overloaded for 6, 24, or 72 h, with contralateral muscles
serving as controls. RNase protection assays showed that
MRF4 and MyoD transcript levels were increased and myo-
genin and Myf5 transcripts were induced in stretch-over-
loaded muscles. However, MRF4 and MyoD increases were
significantly attenuated in patagialis muscles of older quails.
RT-PCR analyses of three MRF-regulated genes showed that
increases in the transcription of these genes occurred with
stretch overload, but the increases were less in muscles of
older quails. In summary, attenuated MRF responses in
muscles from aged animals may partially explain why muscles
from older animals do not hypertrophy to the same extent as
muscles from younger animals.
aging; stretch overload; skeletal muscle hypertrophy; MyoD;
MRF4
HYPERTROPHY OF SKELETAL MUSCLE involves an increased
rate of synthesis and accumulation of proteins, and
therefore increased transcription of muscle genes is
necessary. The mechanisms by which nuclei increase
transcription of specific skeletal muscle mRNA in re-
sponse to a hypertrophy stimulus are not known. We
suspect that a family of skeletal muscle-specific tran-
scription factors called myogenic regulatory factors
(MRFs) is involved. This family is composed of four
members that were identified on the basis of their
ability to convert nonmuscle cells to myoblasts: MRF4/
Myf6/herculin (33), MyoD (7), myogenin (39), and Myf5
(4). These factors belong to a larger basic helix-loop-
helix (bHLH) class of transcription factors. The basic
region binds DNA, whereas the HLH region is involved
in homo- or heterodimerization with other HLH pro-
teins. Heterodimerization with a ubiquitous E protein
is most common, and this dimerization increases the
efficiency of binding to target E boxes that are present
in the promoter region of several skeletal muscle genes
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
0363-6143/98 $5.00 Copyright r 1998 the American Physiological Society
(30). E box-containing genes, which MRFs have been
shown to bind and regulate, include a-actin (28), des-
min (20), nicotinic ACh receptor (AChR) (31), muscle
creatine kinase (17), troponin I (21), and myosin light
chain (36). Because increases in structural and contrac-
tile proteins (e.g., desmin and troponin I), as well as
muscle-specific enzymes (e.g., muscle creatine kinase),
are necessary for muscle to hypertrophy and remain
functional, we hypothesize that MRFs are upregulated
in response to a hypertrophy stimulus. Additionally,
hyperplasia often accompanies hypertrophy (1, 2, 5,
19), and this would require increases in AChR proteins
to enable neural connections to the new fibers.
MRFs play pivotal roles in establishing the myogenic
lineage and in controlling terminal differentiation (23),
and thus most studies of the MRFs have been con-
ducted from a developmental perspective. In general,
Myf5 and MyoD are required for the determination of
myoblasts, myogenin is critical for differentiation, and
the function of MRF4 appears to be in fully differenti-
ated fibers. The roles of MRFs in regenerating muscle
and in maintaining muscle phenotype have also been
investigated. Muscle regeneration involves activation
of satellite cells, the only myogenic cells in adult
skeletal muscle. Proliferation and differentiation of
these cells are similar to events that occur during
embryogenesis, including increased expression of MRFs
(34). MyoD and myogenin have also been implicated in
regulating muscle fiber type, as myogenin accumulates
in slow-twitch fibers and MyoD accumulates in fast-
twitch fibers (13, 35). Few studies have investigated
MRFs in fully differentiated, hypertrophic muscle (14,
22). The first objective of this study was to determine
whether skeletal muscle stimulated to hypertrophy by
stretch overload had an increased expression of MRFs
and whether increases in the transcription of genes
regulated by MRFs occurred.
Protein synthesis and accumulation are attenuated
in skeletal muscle of older individuals (24). Conse-
quently, muscles of aged animals have a reduced ability
to hypertrophy. For example, 30 days of overload re-
sulted in a 44% increase of muscle mass in adult quails
but only a 26% increase in aged quails (19). It is not
known which step(s) in the chain of processes that lead
to an increase in muscle protein content is responsible
for the attenuation. It is possible that specific genes are
not activated in hypertrophy-stimulated muscle in
aged animals. This would occur if transcription factors,
such as the MRFs, are lower or have reduced activity in
these muscles. Two studies have shown MRF expres-
sion in muscle from aged animals (27, 29). In those
studies it was reported that basal levels of MRF
transcripts were higher in hindlimb muscles from aged
C155
C156 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE
mice (29) and rats (27) than in muscles from younger
mice and rats, respectively. However, it remains to be
determined whether MRF expression in muscle from
older animals can be elevated further with a hypertro-
phy stimulus. Thus our second objective of this study
was to determine whether hypertrophy-stimulated
muscle in aged and senescent animals showed in-
creases in MRF expression and transcription of genes
regulated by MRFs similar to that in younger animals.
The final objective was to define whether MRFs were
regulated differently in fast- and slow-twitch muscles
during hypertrophy.
METHODS
Animals and experimental protocol. Japanese quails
(Couturnix couturnix Japonica) of four different ages were
studied. Quails were obtained from a breeder (Willow Games
Farms) at 16–18 mo of age and used as the oldest animals in
this study when they reached 28 mo of age (senescent). Eggs
produced by the quails were incubated and hatched in an
incubator (Humidaire Incubator, New Madison, WI). Chicks
were housed in a chicken brooder for 2 wk and then housed
five to seven quails per cage, along with the older quails, at
20–23°C with a 12:12-h light-dark cycle. Chicks were studied
when they reached 4 (adult), 8 (middle aged), and 18 mo
(aged). The life span of Japanese quails is ,2.5 yr, with a
mortality rate of ,60% by 28 mo (38). Quails in our colony
have lived as long as 32 mo. Japanese quails are physically
and sexually mature at 6 wk and show no maturational
changes in carcass composition or body weight beyond 2 mo
after hatching (25, 26, 38). Body weight did not differ among
adult, middle-aged, aged, and senescent quails in this study:
173 6 28, 176 6 22, 170 6 23, and 174 6 20 (SD) g,
respectively (P 5 0.92, n 5 9 for middle-aged group and 21 for
adult, aged, and senescent groups). It was important that the
quails were at a stable body weight during these experiments
so that hypertrophy-stimulated growth was not confounded
by normal growth of the animals. Male and female quails
were used in these studies, because hypertrophic responses
are not different between the sexes in these animals (S. E.
Alway, unpublished observations).
Muscle hypertrophy was induced by stretch overload of the
right wing, as described previously (2). The left wing served
as a contralateral control. After 6, 24, or 72 h of stretch
overload (n 5 7 per age group per time, except for the middle-
aged group, where n 5 3 per time), quails were anesthetized
with pentobarbital sodium (35 mg/kg ip). The anterior latissi-
mus dorsi (ALD) and patagialis (Pat) muscles from both
wings were excised and immediately frozen in liquid nitrogen
to preserve RNA quality and then stored at 280°C.
Riboprobes. Quail cDNA clones for MyoD (qmf1-cc509) (6),
myogenin (qmf2-cc527) (32), and Myf5 (qmf3-cc528) (32),
provided by Dr. Charles Emerson (Fox Chase Cancer Center,
Philadelphia, PA), were subcloned to make riboprobes that
could be used simultaneously in RNase protection assays
(RPAs). MyoD riboprobes were made from a Dde I-EcoR I
267-bp fragment of qmf1, myogenin probes from a Hind
III-BamH I 203-bp fragment of qmf2, and Myf5 probes from a
Sac II-EcoR I 408-bp fragment of qmf3. Restriction fragments
were cloned into pBluescript KS vectors (Stratagene, La
Jolla, CA). For the quail MRF4 riboprobe, total RNA from
quail muscle was reverse transcribed (Superscript II RNase
H2 RT, Life Technologies) using oligo(dT) primers (Promega,
Madison, WI) and then amplified by PCR. Oligonucleotides
used for PCR were derived from the chicken MRF4 mRNA
sequence (9) and produced a 330-bp PCR product (58-
GGCTGGATCAGCAGGACAAA and 38-AGGGCCGTTCGCC-
GGGGGGA; annealing temperature 62°C). The resulting
cDNA was cloned using the pCR-Script Amp SK(1) Cloning
Kit (Stratagene), and the insert was verified by DNA sequenc-
ing; the quail 330-bp cDNA was 98% homologous to chicken
MRF4 mRNA. A 150-bp segment of quail glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) was also amplified by
RT-PCR. The lower primer was synthesized, including a T3
phage promoter element (Table 1). The resulting PCR product
was then transcribed directly. Riboprobes were transcribed
using biotin-14-CTP and T7 or T3 RNA polymerase (Bright-
Star BIOTINscript Kit, Ambion) and then gel purified. In the
MyoD, myogenin, and Myf5 riboprobes, 100% of the CTP was
biotinylated; only 50 and 10% of the CTP was biotinylated in
the MRF4 and GAPDH riboprobes, respectively. Each probe
was verified for specificity by Northern blot analyses using 25
µg of total RNA from a control Pat muscle; each probe
detected a single band at ,1.2 kb.
RNA analyses. Total RNA was isolated from ALD and Pat
muscles with use of TriReagent (Molecular Research Center,
Cincinnati, OH), which is based on the guanidine thiocyanate
method. Frozen muscles were mechanically homogenized in 1
ml of TriReagent. Extracted RNA was solubilized in RNase-
free H2O and quantitated in duplicate by absorbance at 260
nm. Twenty-five micrograms of RNA from an ALD muscle or
40 µg of RNA from a Pat muscle were used for each RPA. Any
remaining RNA was stored at 280°C. RPAs were done
according to the directions from the manufacturer (HybSpeed
RPA, Ambion). Positive and negative control samples con-
tained all five riboprobes and either yeast mRNA or mouse
liver mRNA. Protected fragments were not observed when
control samples were digested with RNase (negative con-
trols), and full-length riboprobes ($10% larger than protected
fragments) were observed when RNase digestion was omitted
(positive controls). Century Marker Template (Ambion) was
transcribed using biotin-14-CTP and used as size standards
in the RPAs. Protected fragments, controls, and standards
were electrophoresed on 5% acrylamide-8 M urea gels, electro-
blotted onto positive-charged nylon membranes, and immobi-
lized by ultraviolet cross-linking. Chemiluminescence detec-
tion was used (BrightStar BioDetect Nonisotopic Detection
Kit, Ambion), and exposure to film was 2–4 h. Signals were
quantitated on a densitometer (model 620, Bio-Rad, Her-
cules, CA), and each MRF signal was normalized by the
GAPDH signal in that lane. This normalization accounted for
variability in initial amounts of RNA used in the assays,
losses during the assays, or blotting inefficiencies. Prelimi-
nary experiments were done to ensure that 1) riboprobes
Table 1. Primers for PCR given in 58-38 direction
Length, TA,
Product Sequence Position bp °C
GAPDH 58-GGAGTCAACGGATTTGGC 41
38-TCTACACACGGACACTTC 190 150 56
Desmin 58-CTGAAGGATGAGATGGCC 7
38-GGTCGCCTCGCTCACCAC 273 267 56
Muscle cre-
atine kinase 58-CTCCCTGCCCCCACACTG 482
38-CACCGCCGCCGTATCCAC 1,052 571 61
AChR 58-CCTTCTACTTCCCTGGTG 856
38-GCATCTCTCATTTCTGGT 1,304 449 50
Sequences were obtained from the following GenBank accession
numbers: quail glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
Z19086, chicken desmin K02445, chicken muscle creatine kinase
M10012, and chicken ACh receptor (AChR) M37336. TA , annealing
temperature.
 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE C157

were used in excess of the message they were to detect and 2)

the resulting signals were within the linear range of the
detection system and the film (i.e., each probe was biotinyl-
ated such that all 5 resulting signals could be analyzed
simultaneously).
RT-PCR was performed using 1 µg of total RNA, 250 ng of
oligo(dT) primer, and 100 units of RT (Superscript II RNase
H2 RT) in a total volume of 10 µl. Control RT reactions that
contained no RT were done. Thirty cycles of PCR were carried
out using 1 µl of cDNA generated from the RT, 100 ng of each
primer (specific primers are listed in Table 1), and 2.5 units of
Taq DNA polymerase (Sigma Chemical, St. Louis, MO) in a
total volume of 50 µl. GAPDH was amplified in the same
PCRs and used as an internal control to verify that equal
amounts of cDNA were used in PCRs and that equal amounts
of PCR products were loaded onto agarose gels. Annealing
temperatures given in Table 1 for desmin, muscle creatine
kinase, and AChR were used in the PCRs. The resulting
signals were visualized after separation on 1.5% agarose gels
with use of SYBR Green I nucleic acid gel stain (Molecular
Probes, Eugene, OR), scanned using an optical scanner
(model 840, Molecular Dynamics, Sunnyvale, CA), and then
quantitated using ImageQuant software. Preliminary experi-
ments were conducted to ensure that PCR was performed
within the linear range. Control RT reactions were PCR
amplified to confirm that DNA did not contaminate the RNA;
no bands were detected when these reactions were visualized
on agarose gels with SYBR Green I staining. In addition, no
extraneous bands were detected in any of the PCRs.
DNA analyses. DNA was extracted from the same Pat and
ALD muscle homogenates from which the RNA was isolated.
The extraction was done according to the directions provided
with the TriReagent. After precipitation, DNA was solubilized
in 40 mM NaOH and quantitated in duplicate by absorbance
at 260 nm.
Statistical analyses. MRF data are expressed as percent Fig. 1. Changes in RNA (top) and DNA (bottom) content of anterior
differences of MRF-to-GAPDH ratios between contralateral latissimus dorsi (ALD) muscles from adult and senescent quails after
control and stretch-overloaded muscles. Values are means 6 6, 24, and 72 h of stretch overload relative to contralateral control
SE. One-way ANOVA (age) and Tukey post hoc tests were values. Values are means 6 SE. RNA and DNA content changes were
used to determine whether differences between basal MRF affected by age (P # 0.002): * significantly different from adult at
same respective time point.
and GAPDH mRNA levels occurred. Two-way ANOVA (age 3
time) and Tukey post hoc tests were used to determine
whether differences between the means for percent changes DNA content of control ALD muscles was not different
in nucleic acid contents and MRF mRNA levels occurred. An between adult and senescent quails: 21 6 2 and 23 6 2
a-level of 0.05 was used for all tests. µg/muscle, respectively (P 5 0.52).
Nucleic acid content of Pat muscles. After 6 h of
RESULTS stretch overload, RNA content was increased in Pat
muscles from adult animals (P 5 0.01; Fig. 2), and after
Nucleic acid content of ALD muscles. RNA content of 24 h of stretch overload, RNA content was increased in
ALD muscles from adult quails was increased after 6, muscles from adult, middle-aged, and aged animals
24, and 72 h of stretch overload compared with contra- (P # 0.04). RNA content of Pat muscles from quails of
lateral muscles (P # 0.013; Fig. 1) and was increased in all ages was increased after 72 h of stretch overload
muscles from senescent quails after 24 and 72 h of compared with contralateral muscles (P # 0.01). In-
stretch overload (P # 0.04). RNA content increases in creases in RNA content after 24 and 72 h of stretch
72-h stretch-overloaded ALD muscles were affected by overload were less in Pat muscles from senescent quails
age (P 5 0.001; Fig. 1). RNA content of control ALD than in those from younger quails (P 5 0.04; Fig. 2).
muscles was not different between adult and senescent RNA content of control Pat muscles was not different
quails: 32 6 2 and 34 6 2 µg/muscle, respectively (P 5 among adult, middle-aged, aged, and senescent quails:
0.58). 122 6 9, 127 6 5, 132 6 6, and 118 6 4 µg/muscle,
DNA content of ALD muscles was not affected by 6 or respectively (P 5 0.35).
24 h of stretch overload (P # 0.17; Fig. 1). DNA content DNA content of Pat muscles was not affected by 6 or
was greater in 72-h stretch-overloaded ALD muscles 24 h of stretch overload regardless of age (P $ 0.19; Fig.
than in contralateral control muscles (P # 0.003), and 2). DNA contents were increased after 72 h of stretch
the increase was affected by age (P 5 0.002; Fig. 1). overload in muscles from quails of all ages (P # 0.04),
C158 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE

aged animals than in Pat muscles from aged and

senescent animals (P 5 0.02). Because GAPDH was
used as an internal control in the RPAs and the MRF
data (relative to GAPDH) were expressed as within-
animal differences, the change in GAPDH mRNA with
age was not a confounding factor.
Basal MRF levels. Control muscle MRF mRNA levels
(basal levels) were not different among age groups in
ALD muscles (P $ 0.48), but a difference was detected
in Pat muscles (P # 0.02). MRF4 and MyoD mRNA
levels in Pat muscles from senescent quails were 48 and
50% greater, respectively, than levels from adult quails.
In Pat muscles from middle-aged and aged quails,
MRF4 and MyoD mRNA basal levels were intermediate
to those from adult and senescent quails but not
significantly different from any group.
Stretch overload-induced MRF changes in ALD
muscles. Initially, only ALD muscles from adult and
senescent quails were investigated. The time of stretch
overload did not affect increases in MRF4, MyoD, or
Myf5 mRNA levels (P $ 0.13). When collapsed across
time, MRF4, MyoD, and Myf5 mRNA levels were
significantly elevated in response to stretch overload in
ALD muscles from adult and senescent animals (P #
0.03; Fig. 4). However, no differences in MRF4, MyoD,
or Myf5 mRNA increases between ALD muscles from
adult and senescent quails were found (P $ 0.38);
therefore, ALD muscles from middle-aged and aged
quails were not studied.

Fig. 2. Changes in RNA (top) and DNA (bottom) content of patagialis

(Pat) muscles from adult, middle-aged, aged, and senescent quails
after 6, 24, and 72 h of stretch overload relative to contralateral
control values. Values are means 6 SE. RNA and DNA content
changes were affected by age (P # 0.04): * significantly different from
adult at same respective time point; ** significantly different from
middle-aged at same respective time point.

and the increases were affected by age (P 5 0.01; Fig.

2). DNA content of control Pat muscles was not differ-
ent among adult, middle-aged, aged, and senescent
quails: 79 6 8, 84 6 11, 90 6 13, and 83 6 11 µg/muscle,
respectively (P 5 0.65).
RPAs. All five riboprobes were used and detected
simultaneously in each RPA (Fig. 3). Protected frag-
ments of MRF4, MyoD, and GAPDH were detected in
all muscle samples. Myf 5 was detected in ,60% of the
ALD muscles, and myogenin was detected only in 72-h
stretch-overloaded ALD muscles. Fewer than 20% of
the Pat muscles expressed detectable levels of myo-
genin or Myf5 mRNA, but when they were detected it
was always in stretch-overloaded muscle (Fig. 3).
GAPDH mRNA was a valid internal control, because
levels were not different between stretch-overloaded
and contralateral control muscles within each age
group (P $ 0.16 for ALD muscles and P $ 0.25 for Pat
muscles). No difference in GAPDH levels was detected Fig. 3. Representative results of RNase protection assays. Simulta-
neous detection of Myf5, MRF4, MyoD, myogenin, and glyceraldehyde-
between ALD muscles from adult and senescent quails 3-phosphate dehydrogenase (GAPDH) mRNAs are shown in 72-h
(P 5 0.53). However, levels of GAPDH mRNA were stretch-overloaded (Stretch) and contralateral control (Control) Pat
,25% greater in Pat muscles from adult and middle- muscles of adult quails. In each assay, 40 µg of total RNA were used.
 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE C159

Fig. 4. Densitometric quantitation of MRF4, MyoD, and Myf5 mRNA

increases in ALD muscles from adult and senescent animals. All
myogenic regulatory factor values were normalized by GAPDH
values in same lane and are expressed as percent increases above Fig. 5. Densitometric quantitation of MRF4 and MyoD mRNA in-
contralateral control values. Values are means 6 SE. Myogenic creases in Pat muscles from adult, middle-aged, aged, and senescent
regulatory factor values were not different between muscles stretch quails. MRF4 and MyoD values were normalized by GAPDH values
overloaded for 6, 24, or 72 h; therefore, these data within adult and in same lane and are expressed as percent increases above contralat-
senescent groups were pooled (n 5 21 per age group for MRF4 and eral control values. Values are means 6 SE. MRF4 and MyoD values
MyoD and n 5 11–15 per age group for Myf5). MRF4, MyoD, and were not different between muscles overloaded for 6, 24, or 72 h;
Myf5 mRNAs were increased (i.e., significantly different from zero) in therefore, these data within each age group were pooled (n 5 21 per
stretch-overloaded muscles in both age groups. MRF4, MyoD, and age group, except for middle-aged group, where n 5 9). MRF4 and
Myf5 mRNA increases were not affected by age (P $ 0.38). MyoD mRNAs were increased (i.e., significantly different from zero)
in stretch-overloaded muscles in all age groups. MRF4 and MyoD
mRNA increases were affected by age (P # 0.02): * significantly
different from adult; ** significantly different from adult and middle-
Stretch overload-induced MRF changes in Pat aged.
muscles. MRF4 and MyoD mRNA increases were not
different between Pat muscles stretch overloaded for 6,
24, and 72 h within any age group (P $ 0.34), and no (Fig. 8). A second set of 72-h stretch-overloaded and
interaction between time of stretch overload and age control Pat and ALD muscles from adult and senescent
was detected (P $ 0.25). Therefore, data from the three quails was analyzed to confirm the RT-PCR results
stretch-overload times were pooled for further analy- shown in Figs. 6–8. The amplification results were
ses. MRF4 mRNA levels in stretch-overloaded Pat analogous to those shown.
muscles (collapsed across time) were significantly ele- DISCUSSION
vated above contralateral control levels at each age
(P # 0.005). However, MRF4 increases in muscles from General. We have emphasized our findings in the Pat
older animals were less than those in muscles from muscle over those in the ALD muscle because of their
younger animals (P 5 0.02; Fig. 5). MyoD mRNA was
also increased at each age after stretch overload (P #
0.04), and the increase was significantly affected by age
(P 5 0.02; Fig. 5).
RT-PCR of transcripts whose genes are regulated by
MRFs. Analyses of desmin, muscle creatine kinase, and
AChR mRNA were done to determine whether changes
in transcription of some genes regulated by MRFs
occurred with stretch overload. Because quantities of
RNA were limited, the sensitive method of RT-PCR was
performed using the primers listed in Table 1 and RNA
isolated from 72-h stretch-overloaded and control Pat
and ALD muscles from adult and senescent animals.
Stretch-overloaded muscles from adult and senescent
quails had greater desmin signals than the contralat-
eral control muscles (Fig. 6). The desmin signal in-
crease in Pat muscle from the younger quails was
greater than that from the older quails. No differences Fig. 6. Desmin RT-PCR results of 72-h stretch-overloaded (S) and
in stretch-induced desmin signal increases were ob- contralateral control (C) Pat and ALD muscles from adult and
senescent quails. Desmin and GAPDH were amplified in the same
served between adult and senescent ALD muscles (Fig. PCR, and 2 µl of PCR product were loaded per lane. Gels were stained
6). These same patterns of increases were observed with SYBR Green I nucleic acid gel stain, and the image was
with muscle creatine kinase (Fig. 7) and AChR signals captured using a PhosphoImager.
C160 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE
Fig. 7. Muscle creatine kinase RT-PCR results of 72-h
stretch-overloaded (S) and contralateral control (C) Pat
and ALD muscles from adult and senescent quails.
Muscle creatine kinase and GAPDH were amplified in
the same PCR, and 1.5 µl of PCR product were loaded
per lane. Gels were stained with SYBR Green I nucleic
acid gel stain, and the image was captured using a
PhosphoImager.
different fiber type compositions. The ALD muscle is
composed of tonic fibers (2, 5), and thus its relevance to
mammalian muscle is unclear. The Pat muscle, how-
ever, is a twitch muscle that is composed primarily of
fibers similar to type II mammalian fibers (19), and so it
is probable that findings in this muscle can be extrapo-
lated more readily to mammalian muscle.
It is not surprising that MyoD transcripts were
detected in all Pat muscles, because MyoD is prevalent
in fast-twitch fibers (13, 35). Likewise, very few of these
muscles showed transcripts of myogenin, the MRF that
is prevalent in slow-twitch fibers (13, 35). We did not
consistently detect myogenin mRNA in the slow-tonic
ALD muscle, except after 72 h of stretch overload. This
makes sense in light of the facts that 1) ALD muscle is a
slow-tonic muscle and myogenin is more prevalent in
slow-twitch muscle and 2) myogenin is primarily in-
volved in differentiation and thus is normally ex-
pressed at time points later than Myf 5 and MyoD (23).
MRF4 is predominantly expressed in fully differenti-
ated muscle fibers (12). Correspondingly, all muscles in
our study had relatively high levels of MRF4 tran-
scripts.
Muscle hypertrophy. RNA content in adult ALD and
Pat muscles was increased as early as 6 h after stretch
Fig. 8. AChR RT-PCR results of 72-h stretch-over-
loaded (S) and contralateral control (C) Pat and ALD
muscles from adult and senescent quails. AChR and
GAPDH were amplified in the same PCR, and 5 µl of
PCR product were loaded per lane. Gels were stained
with SYBR Green I nucleic acid gel stain, and the image
was captured using a PhosphoImager.
overload, and DNA content was increased after 72 h.
The increases indicate that the stretch overload did
apply a hypertrophy stimulus to these muscles, and the
data are comparable to other reports of nucleic acid
content changes in chicken and rat muscles after
stretch (10, 18). Earlier studies conducted in our labora-
tory have characterized muscle mass and fiber number
increases that occur in ALD (1, 2, 5) and Pat (19)
muscles from adult and aged quails after stretch over-
load.
The roles of MRFs in mature skeletal muscle have
not been delineated, despite the finding that each has a
unique role during embryonic skeletal muscle develop-
ment (23). In our study, MyoD and MRF4 mRNA levels
were elevated and myogenin and Myf5 mRNAs were
induced after stretch overload, indicating that they all
take part in the response to a hypertrophy stimulus.
MyoD and MRF4 mRNAs were elevated by 100–500%
after 6–72 h of stretch overload in adult ALD and Pat
muscles. Although we observed no increase of any MRF
mRNA in quail Pat muscle after 0.5 h of stretch in situ
(unpublished observations), the MRF mRNA responses
after 6–72 h of stretch overload are similar in magni-
tude to those observed in stretched ALD muscle of adult
chickens (8) and adult rat hindlimb muscles after the
 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE
muscles were casted for 48 h in a stretched position
(22). We did not determine MRF levels between 0.5 and
6 h, because our goal was to determine a time at which
MRFs were elevated in stretch-overloaded muscle of
adult animals and then to find whether the same
increases occurred in muscles of older animals. We
extended our experiments to time points beyond 6 h to
ensure that the attenuated response we found in Pat
muscle from aged and senescent quails was not simply
a lag in the response time of the older muscle.
Studies conducted on regenerating muscle suggest
that MRF mRNA increases occur in satellite cell nuclei,
because the time of MRF increases coincides with the
initiation of satellite cell proliferation (11, 15). Our data
obtained from 72-h stretch-overloaded muscles agree
with this suggestion. These muscles had elevated levels
of DNA, indicating that satellite cells were proliferat-
ing, and MRF mRNA levels were also increased at this
time point. However, Jacobs-El et al. (14) suggested
that myonuclei express elevated levels of MRF mRNA
1) on the basis of observations that MRF increases were
detected as early as 2 h after stimulation and 2)
because Myf5 and MRF4 in situ hybridization signals
in stimulated rat muscles spread into the cytoplasm of
some mature fibers. Our data also support the sugges-
tion of an elevation of MRF mRNA in the myonuclei,
because these levels were increased after just 6 h of
stretch overload, and it has been shown that satellite
cells in quail ALD muscle are not activated until after
24 h of stretch overload (37). In addition, a previous
study in our laboratory showed that 3–14 days of
stretch overload did not result in satellite cell prolifera-
tion in quail Pat muscle (19). Therefore, the increases
in MRF mRNA we observed in quail Pat muscle were
likely derived from myofiber nuclei. Additional studies
are necessary to localize MRF transcript increases, i.e.,
myofiber nuclei vs. satellite cell nuclei, especially after
periods of stretch overload that induce satellite cell
proliferation.
Aging. Only two previous studies have reported MRF
expression in muscles from aged animals (27, 29).
Musaro et al. (29) showed that basal mRNA levels of
MyoD, myogenin, and Myf5, but not MRF4, were
higher in hindlimb muscles of aged than adult mice. In
agreement with this, we found higher basal levels of
MyoD mRNA in Pat muscles from senescent than adult
quails. Additionally, we found that basal MRF4 mRNA
levels were elevated in Pat muscles from older quails.
Marsh et al. (27) also reported elevated levels of MyoD,
myogenin, and MRF4 mRNA with aging. In the present
study, basal levels of MyoD and MRF4 in muscles from
middle-aged and aged animals were intermediate to
those from adult and senescent animals, indicating
that the increases occur gradually during aging. It is
puzzling why MRF mRNA basal levels are higher in
muscles of older animals, because basal rates of protein
synthesis are lower in muscles of aged animals than
younger animals (24). One possible explanation for the
higher basal MRF mRNA levels in muscle of older
animals may be the loss of a-motor neurons that occurs
with aging (3). It has been demonstrated that MyoD
C161
and myogenin transcripts are elevated in denervated
muscle (16, 35) and that the extent of the elevation
depends on the severity of the denervation (16). Muscle
of aged animals may be considered mildly denervated,
and this could influence basal expression of the MRFs.
In this study and in the studies by Musaro et al. (29)
and Marsh et al. (27), only mRNA levels of MRFs were
investigated in muscles of older animals and not the
levels of active MRF proteins. Although Musaro et al.
showed accumulation of myogenin in the nuclei of
muscle from aged mice by immunohistochemistry, it is
not known whether the protein was active. Thus it
remains unknown whether MRF proteins in muscle
from aged animals bind DNA and are functional in
regulating specific skeletal muscle genes. If, indeed,
hypertrophy-stimulated increases in MRF mRNA lev-
els that we have shown correspond to increases in
active MRF proteins, then several skeletal muscle-
specific genes are likely to be upregulated. The upregu-
lation of these genes would result in an increase in the
production of muscle-specific proteins that would sup-
port hypertrophy of the muscle. Although it was non-
quantitative, we used RT-PCR to detect increases in
desmin, muscle creatine kinase, and AChR mRNA
expression, three products whose genes are regulated
by MRFs, in stretch-overloaded muscles from adult and
senescent quails. In support of the suggestion that
MRFs may be involved in the diminished hypertrophic
response of older fast-twitch muscle, we showed that
hypertrophy-stimulated increases in MRF-regulated
genes are lower in Pat muscle from senescent animals
than in Pat muscle from younger, adult animals. In
contrast, the ALD muscle, which showed no age-related
differences in hypertrophy-stimulated MRF increases,
also showed no age-related differences in hypertrophy-
stimulated desmin, muscle creatine kinase, or AChR
transcript increases.
In conclusion, we have shown that a hypertrophy
stimulus causes elevations in MRF expression in muscle
from adult, middle-aged, aged, and senescent quails.
However, the elevation is attenuated in fast-twitch
muscles from older quails. This attenuation may be
part of the reason that muscles from aged animals do
not hypertrophy as much as muscles from younger
animals.
We thank Dr. Charles Emerson for providing the qmf1, qmf 2, and
qmf3 cDNA, Dr. Duane Hinton for assistance with the subcloning,
and Paul Llobet for assistance with the DNA analyses.
This research was supported by National Institute on Aging Grant
AG-10871.
Address for reprint requests: S. E. Alway, Dept. of Anatomy, MDC
#6, 12901 Bruce B. Downs Bl., University of South Florida, Tampa,
FL 33612.
Received 4 February 1998; accepted in final form 31 March 1998.
REFERENCES
1. Alway, S. E. Overload-induced c-myc oncoprotein is reduced in
aged skeletal muscle. J. Gerontol. A Biol. Sci. Med. Sci. 52:
B203–B211, 1997.
2. Alway, S. E., P. K. Winchester, M. E. Davis, and W. J.
Gonyea. Regionalized adaptations and muscle fiber prolifera-
C162 MRF EXPRESSION IN ADULT AND AGED HYPERTROPHIC MUSCLE
tion in stretch-induced enlargement. J. Appl. Physiol. 66: 771–
781, 1989.
3. Ansved, T., and L. Larsson. Quantitative and qualitative
morphological properties of the soleus and motor nerve and the
L5 ventral root in young and old rats. Relation to the number of
soleus fibers. J. Neurol. Sci. 96: 269–282, 1990.
4. Braun, T., E. Baber, G. Buschhausen-Denker, S. Kotz, K. H.
Grzeschik, and H. H. Arnold. Differential expression of myo-
genic determination genes in muscle cells: possible autoactiva-
tion by the Myf gene products. EMBO J. 8: 3617–3625, 1989.
5. Carson, J. A., M. Yamaguchi, and S. E. Alway. Hypertrophy
and proliferation of skeletal muscle fibers from aged quail. J.
Appl. Physiol. 78: 293–299, 1995.
6. Charles de la Brousse, F., and C. P. Emerson. Localized
expression of a myogenic regulatory gene, qmf1, in the somite
dermatome of avian embryos. Genes Dev. 4: 567–581, 1990.
7. Davis, R. L., H. Weintraub, and A. B. Lassar. Expression of a
single transfected cDNA converts fibroblasts to myoblasts. Cell
51: 987–1000, 1987.
8. Eppley, Z. A., J. Kim, and B. Russell. A myogenic regulatory
gene, qmf1, is expressed by adult myonuclei after injury. Am. J.
Physiol. 265 (Cell Physiol. 34): C397–C405, 1993.
9. Fujisawa-Sehara, A., Y. Nabeshima, T. Komiya, T. Uetsuki,
A. Asakura, and Y. Nabeshima. Differential trans-activation of
muscle-specific regulatory elements including the myosin light
chain box by chicken MyoD, myogenin, and MRF4. J. Biol. Chem.
267: 10031–10038, 1992.
10. Goldspink, D. F., V. M. Cox, S. K. Smith, L. A. Eaves, N. J.
Osbaldeston, D. M. Lee, and D. M. Mantle. Muscle growth in
response to mechanical stimuli. Am. J. Physiol. 268 (Endocrinol.
Metab. 31): E288–E297, 1995.
11. Grounds, M. D., K. L. Garrett, M. C. Lai, W. E. Wright, and
M. W. Beilharz. Identification of skeletal muscle precursor cells
in vivo by use of MyoD1 and myogenin probes. Cell Tissue Res.
267: 99–104, 1992.
12. Hinterberger, T. J., D. A. Sassoon, S. J. Rhodes, and S. F.
Konieczny. Expression of the muscle regulatory factor MRF4
during somite and skeletal myofiber development. Dev. Biol. 147:
144–156, 1991.
13. Hughes, S. M., J. M. Taylor, S. J. Tapscott, C. M. Gurley,
W. J. Carter, and C. A. Peterson. Selective accumulation of
MyoD and myogenin mRNAs in fast and slow adult skeletal
muscle is controlled by innervation and hormones. Development
118: 1137–1147, 1993.
14. Jacobs-El, J., M.-Y. Zhou, and B. Russell. MRF4, Myf-5, and
myogenin mRNAs in the adaptive responses of mature rat
muscle. Am. J. Physiol. 268 (Cell Physiol. 37): C1045–C1052,
1995.
15. Kami, K., K. Noguchi, and E. Senba. Localization of myo-
genin, c-fos, c-jun, and muscle-specific gene mRNAs in regenerat-
ing rat skeletal muscle. Cell Tissue Res. 280: 11–19, 1995.
16. Koishi, K., M. Zhang, I. McLennan, and J. Harris. MyoD
protein accumulates in satellite cells and is neurally regulated in
regenerating myotubes and skeletal muscle fibers. Dev. Dyn. 202:
244–254, 1995.
17. Lassar, A. B., J. N. Buskin, D. Lockshor, R. L. Davis, S.
Apone, S. D. Hauschka, and H. Weintraub. MyoD is a
sequence-specific DNA binding protein requiring a region of myc
homology to bind to muscle creatine kinase enhancer. Cell 58:
823–831, 1989.
18. Laurent, G. J., M. P. Sparrow, and D. J. Millward. Turnover
of muscle protein in the fowl: changes in rates of protein
synthesis and breakdown during hypertrophy of the anterior and
posterior latissimus dorsi muscles. Biochem. J. 176: 407–417,
1978.
19. Lee, J., and S. E. Alway. Adaptations of myonuclei to hypertro-
phy in patagialis muscle fibers from aged quail. Mech. Ageing
Dev. 88: 185–197, 1996.
20. Li, H., and Y. Capetanaki. Regulation of the mouse desmin
gene: transactivation by MyoD, myogenin, MRF4, and Myf5.
Nucleic Acids Res. 21: 335–343, 1993.
21. Lin, H., K. E. Yutzey, and S. F. Konieczny. Muscle-specific
expression of the troponin I gene requires interactions between
helix-loop-helix muscle regulatory factors and ubiquitous tran-
scription factors. Mol. Cell. Biol. 11: 267–280, 1991.
22. Loughna, P. T., and C. Brownson. Two myogenic regulatory
factor transcripts exhibit muscle-specific responses to disuse and
passive stretch in adult rats. FEBS Lett. 390: 304–306, 1996.
23. Ludolph, D. C., and S. F. Konieczny. Transcription factor
families: muscling in on the myogenic program. FASEB J. 9:
1595–1604, 1995.
24. Makrides, S. C. Protein synthesis and degradation during aging
and senescence. Biol. Rev. 58: 343–422, 1983.
25. Marks, H. L. Growth curve changes associated with long-term
selection for body weight in Japanese quail. Growth 42: 129–140,
1978.
26. Marks, H. L. Carcass composition, feed intake and feed effi-
ciency following long-term selection for four-week body weight in
Japanese quail. Poult. Sci. 72: 1005–1011, 1993.
27. Marsh, D. R., D. S. Criswell, J. A. Carson, and F. W. Booth.
Myogenic regulatory factors during regeneration of skeletal
muscle in young, adult, and old rats. J. Appl. Physiol. 83:
1270–1275, 1997.
28. Moss, J. B., E. N. Olson, and R. J. Schwartz. The myogenic
regulatory factor MRF4 represses the cardiac a-actin promoter
through a negative-acting N-terminal protein domain. J. Biol.
Chem. 271: 31688–31694, 1996.
29. Musaro, A., M. G. Cusella DeAngelis, A. Germani, C. Cic-
carelli, M. Molinaro, and B. M. Zani. Enhanced expression of
myogenic regulatory genes in aging skeletal muscle. Exp. Cell
Res. 221: 241–248, 1995.
30. Olson, E. N. Regulation of muscle transcription by the MyoD
family. Circ. Res. 72: 1–6, 1993.
31. Piette, J., J. L. Bessereau, M. Huchet, and J. P. Changeux.
Two adjacent MyoD1-binding sites regulate expression of the
acetylcholine receptor a-subunit gene. Nature 345: 353–355,
1990.
32. Pownall, M. E., and C. P. Emerson. Sequential activation of
three myogenic regulatory genes during somite morphogenesis
in quail embryos. Dev. Biol. 151: 67–79, 1992.
33. Rhodes, S. J., and S. F. Konieczny. Identification of MRF4: a
new member of the muscle regulatory factor gene family. Genes
Dev. 3: 2050–2061, 1989.
34. Smith, C. K., II, M. J. Janney, and R. E. Allen. Temporal
expression of myogenic regulatory genes during activation, prolif-
eration, and differentiation of rat skeletal muscle satellite cells.
J. Cell. Physiol. 159: 379–385, 1994.
35. Voytik, L. L., M. J. Przyborski, S. F. Badylak, and S. F.
Konieczny. Differential expression of muscle regulatory factor
genes in normal and denervated adult rat hindlimb muscles. Dev.
Dyn. 198: 214–224, 1993.
36. Wentworth, B. M., M. Donohue, J. C. Engert, E. B. Ber-
glund, and N. Rosenthal. Paired MyoD-binding sites regulate
myosin light chain gene expression. Proc. Natl. Acad. Sci. USA
88: 1242–1246, 1991.
37. Winchester, P. K., M. E. Davis, S. E. Alway, and W. J.
Gonyea. Satellite cell activation in the stretch-enlarged anterior
latissimus dorsi muscle of the adult quail. Am. J. Physiol. 260
(Cell Physiol. 29): C206–C212, 1991.
38. Woodard, A. E., and H. Abplanalp. Longevity and reproduc-
tion in Japanese quail maintained under stimulatory lighting.
Poult. Sci. 50: 688–692, 1971.
39. Wright, W. E., D. A. Sassoon, and V. K. Lin. Myogenin, a factor
regulating myogenesis, has a domain homologous to MyoD. Cell
56: 607–617, 1989.