Food Control 115 (2020) 107292

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Rapid and sensitive detection of VBNC Escherichia coli O157: H7 in beef by T

PMAxx and real-time LAMP
Xinrui Lva, Li Wanga,∗∗, Jingfeng Zhanga, Haiyan Zenga, Xun Chenb, Lei Shib, Hualing Cuia,
Xiaoxin Hea, Lichao Zhaoa,∗
a
Guangdong Provincial Key Laboratory of Nutraceuticals and Functional Foods, College of Food Science, South China Agricultural University, Guangzhou, 510642, China
b
Institute of Food Safety and Nutrition, Jinan University, Guangzhou, 510632, China

A R T I C LE I N FO A B S T R A C T

Keywords: Accurate and rapid identification of the live fraction of pathogenic bacteria in beef food samples has emerged as
Escherichia coli O157 a pressing issue due to the serious threat posed by pathogens to human health. Escherichia coli O157: H7, one of
H7 the most common pathogens in beef, causes hemorrhagic colitis or hemolytic uremic syndrome and subsequently
Viable but nonculturable (VBNC) a viable but nonculturable (VBNC) state under low temperatures in which the bacteria do not grow in culture
Improved propidium monoazide (PMAxx)
medium but remain potentially virulent. The objective of this study was to establish and evaluate a method that
Real-time loop-mediated isothermal
combines improved propidium monoazide (PMAxx) treatment with real-time loop-mediated isothermal ampli-
amplification (qLAMP)
Flow cytometry (FCM) analysis fication (qLAMP) for the detection and quantification of VBNC E. coli O157: H7 in beef. In this study, E. coli
O157: H7 was induced to enter the VBNC state by simulating food storage conditions at −20 °C. The respiratory
activity of VBNC E. coli O157: H7 was measured by flow cytometry. The optimal PMAxx final concentration was
10 μM with exposure to light for 10 min for photoactivation, which was found to completely inhibit amplifi-
cation of DNA derived from dead cells. When there were low levels of VBNC microorganisms in beef samples,
PMAxx was significantly more accurate and effective at distinguishing between viable and dead E. coli O157: H7
cells. The developed PMAxx-qLAMP assay remarkably exhibited both high sensitivity in pure culture and beef
(30 colony-forming units/mL and 300 CFU/g, respectively) and rapidity (60 min). Especially for frozen beef
samples, positive ratio was 4.71% (four out of eighty-five were positive) by PMAxx-qLAMP method and the
mean measured value of positive samples was 2.04 ± 0.08 Log10 CFU/g. Therefore, PMAxx-qLAMP is an
effective means for improving the detection and quantification accuracy of VBNC E. coli O157: H7 in beef.

1. Introduction
Escherichia coli O157: H7 (E. coli O157: H7) is a ubiquitous Gram-
negative bacterium and one of the most common pathogens that cause
gastrointestinal illness in humans, where it is mainly spread through
contaminated meat products, especially beef products (Kakagianni &
Koutsoumanis, 2019; Smith, Fazil, & Lammerding, 2019). This pa-
thogen can colonize the intestinal tract of cattle and contaminate beef
products during slaughter and subsequent processing (Ouf, Yuan,
Singh, & Mustapha, 2017). Moreover, it can reproduce rapidly at am-
bient temperatures and has a very low infectious dose, leading to pos-
sible large-scale outbreaks of food-borne diseases (Albright, Kendall,
Avens, & Sofos, 2003). To ensure the freshness of beef and prevent the
growth and propagation of E. coli O157: H7, refrigeration has become
one of the most important aspects of meat transportation. Although low
temperature can prevent reproduction of E. coli O157: H7, it can also
cause E. coli O157: H7 to enter a viable but nonculturable (VBNC) state
(Wei & Zhao, 2018). These VBNC bacteria can easily remain undetected
and become a possible source of contamination. The VBNC state is a
unique survival strategy employed by microorganisms that protects
against adverse environmental conditions (Ramamurthy, Ghosh,
Pazhani, & Shinoda, 2014). In this state, the bacteria cannot grow into
visible colonies and, thus, are not detectable by routine methods
(Ayrapetyan & Oliver, 2016). In addition, VBNC cells are potentially
pathogenic and can facilitate cell survival until the environmental
conditions become favorable for cell growth and division (Li, Mendis,
Trigui, Oliver, & Faucher, 2014; Wang, Zhong, & Li, 2012; Zhao et al.,
2020), thus posing a threat to human health. VBNC E. coli O157: H7 still
maintains virulence, as illustrated by an abundance of reports (Dinu &
Bach, 2011; Liu, Wang, Tyrrell, & Li, 2010; Liu et al., 2017). Therefore,

∗
Corresponding author.
∗∗
Corresponding author.
E-mail addresses: wangli_scau@scau.edu.cn (L. Wang), zlc@scau.edu.cn (L. Zhao).

https://doi.org/10.1016/j.foodcont.2020.107292
Received 3 December 2019; Received in revised form 28 March 2020; Accepted 31 March 2020
Available online 04 April 2020
0956-7135/ © 2020 Elsevier Ltd. All rights reserved.
X. Lv, et al. Food Control 115 (2020) 107292

developing an accurate and efficient method to detect VBNC E. coli Table 1

O157: H7 in beef products is necessary and has become the focus of Verification of PMAxx-qLAMP specificity.
current food microbial research. No. Bacterial species Strains PMAxx-qLAMP results
There are various methods of monitoring viable microbial popula-
tions involving traditional culture-based methods. However, these 1 Escherichia coli O157: H7 NCTC 12900 +
2 Escherichia coli O157: H7 ATCC43889 +
methods fail to estimate the number of VBNC bacteria because VBNC
3 Escherichia coli O157: H7 SCAUFHSM 1101 +
cells are unable to grow on plates (Ayrapetyan, Williams, & Oliver, 4 Escherichia coli O157: H7 SCAUFHSM 1102 +
2015). Also, there are many molecular detection methods used for de- 5 Escherichia coli O157: H7 SCAUFHSM 1103 +
tection of foodborne pathogenic bacteria, such as real-time polymerase 6 Escherichia coli O157: H7 SCAUFHSM 1104 +
chain reaction (qPCR) and loop-mediated isothermal DNA amplification 7 Escherichia coli O157: H7 SCAUFHSM 1105 +
8 Escherichia coli O157: H7 SCAUFHSM 1106 +
(qLAMP). Compared with qPCR, qLAMP is faster, does not require ex-
9 Escherichia coli O157: H7 SCAUFHSM 1107 +
pensive instruments or sophisticated techniques, and has a comparable 10 Escherichia coli O157: H7 SCAUFHSM 1108 +
detection sensitivity (Cao et al., 2019; Telli & Dogruer, 2019; Zhao 11 Escherichia coli O157: H7 SCAUFHSM 1109 +
et al., 2010). However, DNA does not degrade immediately following 12 Escherichia coli O157: H7 SCAUFHSM 1110 +
13 Escherichia coli O26: H11 CMCC(B) 44103 –
cell death (Rudi, Moen, Dromtorp, & Holck, 2005; Varma et al., 2009),
14 Escherichia coli O83:H1 SCAUFHSM 1001 –
making it impossible to distinguish between viable and dead bacteria 15 Escherichia coli O127: H6 SCAUFHSM 1002 –
with only qLAMP. In order to overcome this limitation, nucleic acid- 16 Escherichia coli O148:H28 SCAUFHSM 1003 –
intercalating dyes, such as propidium monoazide (PMA), have been 17 Vibrio parahaemolyticus ATCC 17802 –
successfully integrated with molecular detection assays. These dyes 18 Salmonella enterica CMCC(B) 50071 –
19 Pseudomonas aeruginosa ATCC 15442 –
penetrate bacteria with compromised membrane integrity and cova-
20 Pseudomonas aeruginosa CMCC(B) 10104 –
lently bind to cellular DNA to prevent interference from dead cells 21 Enterobacter sakazakii ATCC 29544 –
(Tavernier & Coenye, 2015). PMAxx™ is an improved nucleic acid 22 Enterococcus faecalis V583 SCAUFHSM 2001 –
modification dye. Compared with PMA, PMAxx is better able to dis- 23 Staphylococcus aureus ATCC 25923 –
tinguish living bacteria from dead bacteria and is more accurate 24 Listeria monocytogenes ATCC 19115 –
25 Listeria monocytogenes CMCC(B) 54002 –
quantitatively (Randazzo et al., 2018). However, for different samples,
the related influencing factors need to be re-explored (Gobert et al., NCTC: National Collection of Type Cultures; CMCC: China Medical Culture
2018). E. coli O157: H7 is a serious hazard that is harder to detect after Collection; SCAUFHSM: Food Safety and System Microbiology Laboratory of
entering VBNC state. Therefore, it is necessary to establish quantitative South China Agricultural University (These strains were isolated from various
technology for more rapid, sensitive, and specific pathogen detection. food samples and stored in our laboratory between 2003 and 2007); ATCC:
To the best of our knowledge, PMA-qLAMP technology has been American Type Culture Collection; “+/−” indicates positive and negative re-
used for the detection of food-borne pathogens (Guevara, Guevara, action.
Ornob, & Bashir, 2016; Telli & Dogruer, 2019; Zhang et al., 2018;
Zhang, Xin, Wang, & Deng, 2020), but there is only one study reported (CFU)/mL, which was then cultured at −20 °C in the dark. VBNC E. coli
the detection of food-borne pathogens in VBNC state (Zhong, Tian, O157: H7 induction was monitored by quantification using a L7012
Wang, & Wang, 2016). The use of PMAxx, improved PMA dye, com- LIVE/DEAD® BacLight™ Bacterial Viability Kit (Thermo Fisher
bined with qLAMP for the detection of VBNC food-borne pathogens was Scientific, USA). The culturable number of E. coli O157: H7 was mea-
reported only by our group (Cao et al., 2019). Using PMAxx-qLAMP for sured by the plate count method and the numbers of total and viable
the detection of VBNC E. coli O157: H7 has not been reported so far. cells were determined using the LIVE/DEAD® BacLight™ Bacterial
Therefore, the aim of this study was to optimize PMAxx treatment Viability Kit. When the number of culturable bacteria was zero, E. coli
conditions for the application of the PMAxx-qLAMP method in quan- O157: H7 had gone into a VBNC state. Three parallel experiments were
titative analysis of VBNC E. coli O157: H7 in beef. This method allows carried out.
for detection of foodborne VBNC pathogens and also provides a new
tool for on-site inspection of large quantities of food. 2.3. Detection of the respiratory activity of E. coli O157: H7 by flow
cytometry
2. Materials and methods
The respiratory activity of E. coli O157: H7 in different states was
2.1. Bacterial strains and culture conditions analyzed by flow cytometry used in combination with 5-cyano-2,3-di-
tolyl-tetrazolium chloride (CTC) fluorescent dyes, which is readily re-
The strains used in this study are listed in Table 1. Vibrio strains duced by respiratory activity of bacterial cells to form fluorescent CTC
were cultured in sterile 3% NaCl alkaline peptone water (3% NaCl formazan on the cell surface. Thus, fluorescent (respiratory active, P1)
APW; Huankai Microbial, China). All other strains were cultured in and non-fluorescent (respiratory inactive, P2) cells
Luria-Bertani (LB; HM, China) medium at 37 °C in a rotary shaker were clearly distinguished. The CTC-reduction assay was performed
(Boxun, ShangHai, China) at 180 rpm for 24 h. Cells were serial-diluted with the reagents of a Bacstain CTC Rapid Staining Kit
with 0.85% (w/w) NaCl. To enumerate the number of viable cells, (Dojindo, Kumamoto, Japan) according to the manufacturer's protocol.
bacteria were spread on LB agar plates and incubated at 37 °C for 24 h. A 1-mL bacterial suspension containing 109 CFU in one of three dif-
In order to enumerate the dead bacteria, bacterial suspensions were ferent states was washed three times with 0.85% (w/w) sterile NaCl.
heated to 85 °C for 10 min and then the bacterial viability was detected Then, 20 μL CTC solution (50 mM) and 1 μL enhancing regent A were
by the plate method. added to 1 mL cell suspension. The cells were incubated with CTC at
37 °C for 30 min and then analyzed by flow cytometry.
2.2. Preparation and counting of VBNC E. coli O157: H7
2.4. LAMP primer design
A flask with 100-mL LB broth was inoculated with a loopful of E. coli
O157: H7 and incubated overnight at 37 °C at 180 rpm. After reaching Primers were designed with the Primer Explorer V4 based on the
the midlogarithmic growth phase, 1 mL of the bacterial suspension was rfbE gene sequence of E. coli O157: H7. A set of primers consisted of a
rinsed three times with 0.85% (w/w) sterile NaCl and added to a 0.85% pair of inner primers (FIP and BIP), a pair of outer primers (F3 and B3),
NaCl solution at a cell density of 3.25 × 106 colony-forming units and a pair of loop primers (LF and LB). The specificity of all the primers

2
X. Lv, et al. Food Control 115 (2020) 107292

Table 2
Sequences used in this study.
Genes Primer Sequence (5′-3′) Size (bp)

rfbE F3 AGCGTTAGGTATATCGGAAG 20
B3 GTTCCATATCACATGGATGTC 21
FIP TGGCTCCTGTGTATTTTATAGCATTTTGAGATGAAGTTATTGTTCCAACA 50
BIP ATGAAACTTGGCAAATGTCTGTTAGTTTTAATGGACACACATAATAGCTTTA 52
LF TTAACTGATGCTATATATGTCAG 23
LB TGACATAGAACAAA 14

was evaluated before use by doing a BLAST search of sequences in in an isothermal system at 63 °C for 45 min with fluorescence images
GenBank (Table 2). recorded every minute (Cao et al., 2019).

2.5. DNA template extraction 2.8. Verification of PMAxx-qLAMP specificity

First, 500 μL of 5% Chelex-100 were added to a 1.5-mL centrifuge
tube containing 500 μL of bacterial solution. This mixture was vortexed
for 10 s and then heated in a water bath at 95 °C for 10 min. All tubes
were centrifuged at 10000 rpm for 3 min. The supernatant containing
DNA was collected and stored at −20 °C until use.
Under optimal conditions, DNA templates of 25 bacterial strains,
including 12 E. coli O157: H7 strains, 4 non-E. coli O157: H7 strains,
and 9 non-E. coli strains, were tested by PMAxx-qLAMP to assess spe-
cificity. DNA template was extracted from pure overnight cultures of
these strains that had been diluted to 106 CFU/mL.

2.6. PMAxx optimization 2.9. Analytical sensitivity of the PMAxx-qLAMP assays

The PMAxx (20 mM, Biotium, Inc.) dye was dissolved in high purity
water to make a 2-mM stock solution and stored at −20 °C in the dark.
A PMAxx stock solution series was added to E. coli O157: H7 suspension
containing 1 mL of 106 CFU/mL viable or heat-killed cells (85 °C,
10 min). The bacterial suspensions were incubated in the dark for
10 min to allow PMAxx to enter dead cells and be photoactivated for
different durations using the HG-EMA nucleic acid light marker (Huguo
science instrument Co., ltd., Shanghai, China). After photo-induced
cross-linking, the free PMAxx was removed by centrifuging the bacteria
at 8000 rpm for 5 min and then washing three times with 0.85% (w/w)
sterile NaCl. DNA was then extracted and amplified by qLAMP. The
bacterial solution without PMAxx dye was set as the negative control.
Experiments were performed three times independently.
2.7. qLAMP assay
The qLAMP reaction was performed as previously described with a
25-μL reaction mixture consisting of 5 μM each of FIP and BIP, 10 μM
each of F3 and B3, 5 μM each of LoopF and LoopB, 20 mM Tris-HCl (pH
8.8), 1.6 mM dNTPs, 10 mM (NH4)2SO4, 10 mM KCl, 0.1% Tween 20,
4 mM MgSO4.7H2O, 8 U of the Bst DNA polymerase large fragment,
0.5 μL SYTO™9 Green Fluorescent Nucleic Acid Stain, 2 μL DNA tem-
plate, and 8 μL nuclease-free water. The qLAMP was performed on a
7500 Fast Real-Time PCR System (Applied Biosystems, New York, USA)
To check the sensitivity of the assay, the VBNC E. coli O157: H7
bacterial solution was diluted ten times with sterile 0.85% NaCl solu-
tion and beef samples. Under the optimized conditions, the PMAxx-
qLAMP assay was used to amplify the genomic DNA from the bacterial
solutions.
2.10. Practical application of plate counting, qLAMP, PMA-qLAMP, and
PMAxx-qLAMP methods for artificially contaminated frozen beef
To test the practicability of the PMAxx-qLAMP and plate counting
methods, each method was evaluated by testing food samples artifi-
cially contaminated with different ratios of VBNC to dead E. coli O157:
H7 suspension. The frozen beef samples were purchased from the
Zhengfeng Supermarket (Wushan Street, Tianhe District, Guangzhou,
China). Before testing, the frozen beef samples were incubated at −5 to
2 °C for 18 h or 45 °C for 15 min to thaw according to the standard
method of NY/T 555-2002. The samples were sterilized to ensure that
the samples did not contain E. coli O157: H7 within 24 h after thawing.
The beef sample (25 g) was added to 225 mL sterile PBS and a 1:10
beef homogenate solution was prepared after the sample was com-
pletely homogenized. In order to distinguish the detection ability of
different methods under the interference of dead bacteria, solutions
with different proportions of VBNC and dead E. coli O157: H7 (1 mL)
were used to inoculate 9-mL beef homogenate solution (Table 3).

Table 3
Comparison of quantitative detection of different proportions of VBNC E. coli O157: H7 in beef by plate counting, qLAMP, PMA-qLAMP, and PMAxx-qLAMP methods.
Sample (CFU/g) Plate counting qLAMP PMA-qLAMP PMAxx-qLAMP

VBNC Dead Log10 CFU/g Log10 CFU/g

– (Ct values)

10 5
– UD 5.05 ± 0.21 (9.43 ± 0.11) 5.00 ± 0.12 (10.15 ± 0.17) 5.24 ± 0.11 (9.65 ± 0.32)
7 × 104 3× 104 UD 5.14 ± 0.15 (9.36 ± 0.14) 4.84 ± 0.23 (10.05 ± 0.33) 4.95 ± 0.21 (10.41 ± 0.05)
5 × 104 5× 104 UD 5.15 ± 0.17 (9.19 ± 0.14) 4.56 ± 0.18 (11.54 ± 0.17) 4.65 ± 0.20 (11.33 ± 0.24)
3 × 104 7× 104 UD 5.20 ± 0.07 (9.15 ± 0.05) 4.35 ± 0.19 (11.84 ± 0.18) 4.64 ± 0.09 (10.78 ± 0.05)
104 9× 104 UD 5.28 ± 0.22 (9.24 ± 0.09) 4.28 ± 0.25 (12.09 ± 0.23) 4.05 ± 0.19 (11.07 ± 0.12)
103 105 UD 5.12 ± 0.16 (9.31 ± 0.16) 3.64 ± 0.18 (12.65 ± 0.14) 3.08 ± 0.36 (13.23 ± 0.09)
102 105 UD 5.16 ± 0.04 (9.10 ± 0.08) 2.68 ± 0.26 (14.12 ± 0.31) 2.15 ± 0.12 (15.12 ± 0.16)
101 105 UD 4.87 ± 0.45 (9.45 ± 0.36) UD (Ct > 20) UD (Ct > 20)
– 105 UD 5.15 ± 0.09 (9.32 ± 0.11) UD (Ct > 20) UD (Ct > 20)

Bacterial concentrations are presented as the average value ± standard deviation from three independent experiments; UD refers to amplified or undetected. When
the Ct value of qLAMP was greater than 20, it was considered a false positive.

3
X. Lv, et al.
Genomic DNA was then extracted and analyzed using qLAMP after
PMAxx treatment. PMA treatment was performed according to our
previously established methods (Liu, Zhong, Wang, & Lei, 2018; Zhong
et al., 2016). Uninoculated samples served as negative controls.
2.11. Analysis of actual beef samples
Beef samples (fresh beef, frozen beef and ground beef) from dif-
ferent markets were kindly provided by Guangzhou Institute of Food
Inspection. Frozen beef was thawed in accordance with section 2.10
above. All samples were analyzed according to the standard culture
method (GB 4789.36–2016, China). Then, each sample (25 g) was
mixed with 225 mL sterile PBS in sterile stomacher filter bags (Bikeman
Biotech, Changde, China) and completely homogenized by hand mas-
sage to generate sample homogenates. Subsequently, the sample
homogenates were subjected to PMAxx-qLAMP detection.
2.12. Statistical analyses
Ct values are expressed as mean ± standard deviations and were
calculated using Microsoft Excel. Origin 8.5 was used to plot graphs. All
experiments were performed in triplicate.
3. Results
3.1. Preparation and enumeration of VBNC E. coli O157: H7
To quantitatively detect total and viable VBNC E. coli O157: H7
during induction, a standard curve was generated according to the
LIVE/DEAD Baclight kit instructions. An E. coli O157: H7 suspension
was diluted to 4.7–5.9 Log10 (CFU/mL) and incubated with SYTO 9 and
propidium iodide. Standard curves between the results and bacterial
concentration were established based on EnSpire® Multimode Plate
Reader (PerkinElmer, Inc., USA) measurements of fluorescence in-
tensity (Fig. 1). The bacterial concentration gradually increased as the
fluorescence signal increased, demonstrating a good linear relationship
(R2 = 0.993).
An initial concentration of 3.25 × 106 CFU/mL E. coli O157: H7 was
induced under low temperature (−20 °C) oligotrophic conditions. The
numbers of total, viable, and culturable bacteria were counted every
three days using the plate method and LIVE/DEAD Baclight kit until the
E. coli O157: H7 entered the VBNC state. As shown in Fig. 2, the total
Fig. 1. Standard curve of total colony number and fluorescence intensity of
Escherichia coli O157: H7 assessed using a LIVE/DEAD BacLight kit.
4
Food Control 115 (2020) 107292
Fig. 2. Induction curve of VBNC E. coli O157: H7 at −20 °C. ( ) Number of total
bacteria, ( ) number of viable bacteria, and ( ) number of culturable bacteria.
Plotted values are the means ± standard deviations. Data are from three in-
dependent experiments.
number of bacteria remained unchanged during the induction, but the
number of viable bacteria decreased in the first 9 days, and then began
to fluctuate within a small range, when the E. coli O157: H7 in the
bacterial suspension was induced. After entering the VBNC state, the
number of viable bacteria varied between 5.5 Log10 CFU/mL and 6.5
Log10 CFU/mL within 27 d, there was little change in viable cells, and
the increase of dead cells was not obvious. At the same time, the
number of culturable bacteria in the bacterial suspension decreased
sharply as the incubation duration at low temperatures increased. Up
until the 27th day, the number of cultivable bacteria in bacterial sus-
pension was 0 CFU/mL, but the numbers of total and viable bacteria in
the bacterial suspension were almost 6.5 and 6.0 Log10 CFU/mL, re-
spectively, indicating quite a few E. coli O157: H7 cells were in a VBNC
state.
3.2. Confirmation of respiratory activity of cells in VBNC state
To further verify whether the VBNC E. coli O157: H7 retained cel-
lular activity, bacterial suspensions were evaluated using flow cyto-
metry. Bacterial cells with respiratory activity are able to reduce CTC,
resulting in the production of an insoluble fluorescent CTC formazan
product, which gives the fluorescent intensity signal along the x-axis.
The P1 and P2 regions were divided according to threshold of active
cells that determined by positive experiments. The x-axis in Fig. 3 is the
fluorescent intensity. The respiratory active cells presented in P1, and
the respiratory inactive cells in P2. Fig. 3(a) shows most of the viable
cells (91.43%) were located in the P1 region, indicating cells in this
region still have respiratory activity. During assessment of heat-in-
activated bacteria, a few living cells (23.15%) were located in the P1
region, which may be due to insufficient heat treatment allowing a
subset of bacteria to remain viable in the solution, as shown in Fig. 3(b).
More than half of the VBNC E. coli O157: H7 in the induction solution
were in the P1 region as shown in Fig. 3(c). The number of cells in the
P1 region in the VBNC induction solution was lower than that in the
viable bacterial solution, which may be due to the death of some bac-
teria during induction. The more cells in the P1 region, the more cells
with respiratory activity in the bacterial fluid. Combined with the
evaluation of the activity of cells in the three states presented in
Fig. 3(a–c), most of the cells in the VBNC induction fluid were still
located in the P1 region, indicating E. coli O157: H7 in the VBNC state
X. Lv, et al.
Fig. 3. Respiratory activity of E. coli O157: H7 in three states. (a–c) Respiratory activity of (a) viable, (b) dead, and (c) VBNC E. coli O157: H7. The active cells
were gated in the right rectangle (P1); and non-active cells were in the left rectangle (P2).
still had respiratory activity.
3.3. PMAxx dye optimization
To enhance the ability of PMAxx dyes to distinguish viable from
dead bacteria and improve the accuracy and reliability of the detection
results, this study optimized treatment with PMAxx dyes, including
final concentration and exposure duration (Fig. 4). Samples not treated
with PMAxx were used as negative controls.
The results from optimization of the final concentration of PMAxx
are shown in Fig. 4 (a). For dead E. coli O157: H7, an increase in PMAxx
dye concentration was associated with an increase in Ct value. The Ct
value plateaued when the PMAxx concentration was 5 μM, where the Ct
value of 10 μM PMAxx dye was similar to that of 5 μM PMAxx dye.
However, a final concentration of 10 μM PMAxx dye was selected for
further experiments to ensure the PMAxx dye could enter the dead
bacteria to the greatest extent and inhibit DNA amplification of dead
bacteria.
The results from optimization of exposure time are shown in Fig. 4
(b), where the Ct values from qLAMP of DNA obtained from VBNC E.
coli O157: H7 after different exposure durations (0, 1, 2, 5, and 10 min)
to PMAxx are presented. It was seen the Ct value increased as the ex-
posure duration increased. When the exposure time was 5 min, the Ct
values plateaued. To ensure the surplus PMAxx dye was photolysed to a
greater extent without affecting DNA amplification to prevent the
PMAxx dye from affecting the detection results, the optimum exposure
duration selected was 10 min.
3.4. Verification of PMAxx-qLAMP specificity
Using rfbE as the target gene, the PMAxx-qLAMP technique was
established for rapid detection of VBNC E. coli O157: H7 and then used
to amplify the genomic DNA of 25 bacterial strains. The results are
shown in Table 1, where 12 strains were positive and 13 were negative.
5
Food Control 115 (2020) 107292
Only the specific gene in E. coli O157: H7 was amplified based on the
target DNA curve, indicating the PMAxx-qLAMP method is specific for
this E. coli O157: H7 gene.
3.5. Verification of PMAxx-qLAMP sensitivity in pure cultures and
artificially contaminated samples
To evaluate the sensitivity of the PMAxx-qLAMP method, DNA
amplification curves of suspensions with 3 × 101 to 3 × 105 CFU/mL
VBNC E. coli O157: H7 were obtained. The qLAMP reaction was per-
formed at a constant temperature and fluorescence images were taken
every minute in a 45 min period. Thus, the time threshold was the same
thing as cycle threshold values (Ct) in general RT-PCR. As shown in
Fig. 5(a), bacteria in the samples containing 3 × 101 CFU/mL VBNC E.
coli O157: H7 were still detected by PMAxx-qLAMP, indicating the
method had high sensitivity and a minimum detection limit of 30 CFU/
mL.
To further explore the application of this method in practical si-
tuations, frozen meat samples were artificially contaminated with
VBNC E. coli O157: H7 suspensions containing different bacterial con-
centrations and the results are presented in Fig. 5(b). Bacteria in meat
contaminated with the suspension containing 3 × 102 CFU/g VBNC E.
coli O157: H7 could still be detected by PMAxx-qLAMP. However, when
the concentration was further decreased to 3 × 101 CFU/g, the Ct value
of DNA amplification curves was much higher than 20. Therefore, the
detection limit for artificially contaminated meat samples was
3 × 102 CFU/g. In addition to having good sensitivity results, another
advantage of the established PMAxx-qLAMP method is that it is fast and
the sample detection could be finished in a short time.
3.6. Comparison of the practicability of the plate counting, qLAMP, PMA-
qLAMP, and PMAxx-qLAMP methods
To study the practical applications of the established technology,
Fig. 4. PMAxx dye optimization. Error bars in dia-
grams represent the standard deviations from three
independent replicates. Ct values obtained by
qLAMP after exposing viable and dead E. coli O157:
H7 cells to (a) various concentrations (0, 1, 2, 5, and
10 μM) of PMAxx for (b) different durations (0, 1, 2,
5, and 10 min) of light.
X. Lv, et al.
Fig. 5. Sensitivity of VBNC E. coli O157: H7 detection in pure culture and artificially contaminated samples by PMAxx-qLAMP assay. (a–b) Sensitivity of VBNC E. coli
O157: H7 in pure culture (a) and beef (b).
bacteria in beef samples contaminated with different proportions of
VBNC and dead E. coli O157: H7 were quantitatively detected by plate
counting, qLAMP, PMA-qLAMP, and PMAxx-qLAMP and the results
were analyzed and compared. As shown in Table 3, VBNC bacteria
could not be detected by the plate counting method for any proportion
of VBNC to dead E. coli. This is because neither VBNC nor dead cells can
grow on any medium and these results further confirm that the plate
counting method is not suitable for the detection of pathogenic mi-
croorganisms in a VBNC state.
The quantitative results from qLAMP, PMA-qLAMP, and PMAxx-
qLAMP were 5.05, 5.00, and 5.24 Log10 CFU/g, respectively, when the
beef samples were inoculated with 105 CFU/g VBNC E. coli O157: H7.
In beef samples inoculated with 105 CFU/g heat-killed E. coli O157: H7,
only qLAMP detected 5.15 Log10 CFU/g, while PMA-qLAMP and
PMAxx-qLAMP both yielded negative results. Therefore, there is no
doubt that qLAMP cannot distinguish between VBNC and dead cells,
leading to an overestimation of the number of living cells and, in some
cases, even producing false positive results. However, when qLAMP is
combined with PMAxx and PMA, E. coli O157: H7 in the VBNC state can
be effectively detected.
PMA and PMAxx dyes play an important role in inhibiting the de-
tection of dead cells. When the VBNC E. coli O157: H7 concentration
was as low as 102 CFU/g, PMAxx-qLAMP detected 2.15 Log10 CFU/g.
Whereas after PMA treatment, qLAMP detected 2.68 Log10 CFU/g, in-
dicating PMAxx-qLAMP is significantly more accurate for quantitative
detection of VBNC E. coli O157: H7 in beef compared to PMA-qLAMP.
One potential reason for this is that PMA cannot completely eliminate
the fluorescent signals produced by DNA in dead cells and, thus, may
yield false positive results when the levels of VBNC microorganisms are
low in beef samples. PMAxx, as an alternative dye, is more accurate
than PMA. Therefore, the PMAxx-qLAMP method is more effective than
the plate counting, qLAMP, and PMA-qLAMP methods for detecting
VBNC E. coli O157: H7, and can better distinguish between viable and
dead bacteria and thus prevent false positive results.
3.7. Application of the PMAxx-qLAMP in actual beef samples
The above-evaluated PMAxx-qLAMP was applied on actual food
samples and the results were presented in Table 4. The difference in
positive detection rates between the standard culture method and the
PMAxx-qLAMP may be due to the formation of VBNC bacteria. For
frozen beef samples, the positive ratio was 4.71% (four out of eighty-
five were positive) by PMAxx-qLAMP method and the mean measured
value of positive samples was 2.04 ± 0.08 Log10 CFU/g. This further
confirmed the conventional culture-based methods may have led to an
underestimate of the contamination levels in the samples, making the
presence of the VBNC pathogen a potentially serious threat to food
safety and public health.
6
Food Control 115 (2020) 107292
Table 4
Quantification of total viable E. coli O157: H7 present in actual beef samples by
PMAxx-qLAMP.
Sample type Sample Positive ratio Measured values
number (Log10 CFU/g)
Standard PMAxx- PMAxx-qLAMP
culture method qLAMP (Mean ± SD)
frozen beef 85 0.00% 4.71% 2.04 ± 0.08
fresh beef 90 5.56% 6.67% 2.11 ± 0.09
ground beef 70 5.71% 7.14% 2.12 ± 0.07
Note.
Standard curve (Ct values versus Log10 CFU/mL) was obtained using ten-fold
serial dilutions of E. coli O157: H7 cultures. The equation for the linear
trendline was y = −1.972x + 19.096 with R2 = 0.991. Based on the standard
curves, the number of total viable cells could be calculated using the Ct values
obtained from PMAxx-qLAMP.
The values in the table are mean values from positive samples.
4. Discussion
In this study, E. coli O157: H7 at an initial concentration of
3.25 × 106 CFU/mL was induced into a VBNC state by simulating the
conditions of low-temperature cold-chain food transportation and sto-
rage (−20 °C) of food. During induction, the numbers of total, viable,
and culturable E. coli O157: H7 were determined by the coating stan-
dard curve method of fluorescence intensity and plating. The number of
culturable cells decreased from 3.25 × 106 to 0 CFU/mL within 27 d of
incubation, while the number of viable cells decreased by only 10%
(Fig. 2). The difference between these numbers was due to the forma-
tion of VBNC bacteria. Concurrently, the cellular activity of the VBNC
bacteria was verified by flow cytometry, and the results were similar to
those reported previously (Liu et al., 2018). The results suggest that in
order to ensure food safety, a rapid and effective method for detecting
VBNC cells should be established.
In this study, a PMAxx-qLAMP-based detection method was estab-
lished to detect VBNC E. coli O157: H7 in beef products. To increase the
efficacy of this method, the concentration and exposure duration to
PMAxx dye were optimized. A final concentration of 10 μM and ex-
posure duration of 10 min effectively inhibited DNA amplification of E.
coli O157: H7 without affecting qLAMP amplification. In previous re-
ports, the optimal dye concentration for distinguishing live and dead
cells for various bacteria ranged from 4 to 50 μM (Cao et al., 2019; Dinu
& Bach, 2013). Several studies have found this dose could be lower
(Guevara et al., 2016) or higher (Yoon, Moon, Choi, Ryu, & Lee, 2019)
and similar inhibitory results have been obtained. It has been observed
that the optimal PMAxx treatment conditions are different for different
detection systems. The PMAxx concentration used in this experiment
was within a reasonable range and treatment conditions when using
PMAxx are different for different detection systems.
Although PMA-qPCR (Duarte et al., 2015), EMA-qPCR (Reyneke,
X. Lv, et al.
Ndlovu, Khan, & Khan, 2017), and PMA-LAMP (Yan et al., 2017) have
been assessed in previous studies, there are few reports on PMAxx-
qLAMP technology. In this study, the PMAxx-qLAMP method was es-
tablished by combining optimized treatment with PMAxx dye and
qLAMP. The sensitivity of this method to VBNC E. coli O157: H7 was
30 CFU/mL for pure culture and 300 CFU/g for artificially con-
taminated food samples. This method detected trace VBNC E. coli O157:
H7 within only 60 min without any preconcentration steps. In previous
studies in our laboratory, tlh-based PMAxx-qLAMP was established to
detect VBNC Vibrio parahaemolyticus in pure culture and artificially
contaminated shrimp samples, which had a sensitivity of 10.5 and
280 CFU/g, respectively. This demonstrates that it is reasonable for us
to establish a method for detecting VBNC E. coli O157: H7. In addition,
the accuracy of the PMAxx-qLAMP method in the presence of low
concentrations of VBNC E. coli O157: H7 (Table 3) and its applicability
in actual samples (Table 4) were evaluated. This further demonstrated
that the improved PMAxx dye was better able to distinguish viable
bacteria in the presence of high concentrations of dead bacteria. Al-
though this method will be affected by some matrix components in
food, it still has high specificity and stability and is effective for the
detection of food-borne pathogens that endanger human safety and
health.
To our knowledge, this is the first report that PMAxx-qLAMP has
been used to detect and quantify VBNC E. coli O157: H7 in beef sam-
ples. PMAxx-qLAMP, which shows more accurately quantify the E. coli
O157: H7 than standard culture method in actual beef samples, is a very
promising technique for detecting potential pathogenic bacteria. And
this method has great practical significance and prospective applica-
tions in the detection of viable bacteria in large quantities of food
samples in the field.
CRediT authorship contribution statement
Xinrui Lv: Conceptualization, Formal analysis, Writing - original
draft. Li Wang: Methodology, Validation. Jingfeng Zhang:
Investigation, Formal analysis. Haiyan Zeng: Resources. Xun Chen:
Writing - review & editing, Visualization. Lei Shi: Writing - review &
editing. Hualing Cui: Validation. Xiaoxin He: Validation. Lichao
Zhao: Supervision, Project administration.
Declaration of competing interest
We wish to confirm that there are no known conflicts of interest
associated with this publication and there has been no significant fi-
nancial support for this work that could have influencued its outcome.
Acknowledgments
This work was supported by grants from National Natural Science
Foundation of China (31771940) and the Natural Science Foundation of
Guangdong Province (2020A1515011561). The authors acknowledge
to the Guangzhou Institute of Food Inspection for providing beef sam-
ples.
References
Albright, S. N., Kendall, P. A., Avens, J. S., & Sofos, J. N. (2003). Pretreatment effect on
inactivation of Escherichia coli O157: H7 inoculated beef jerky. Lebensmittel-
Wissenschaft und -Technologie- Food Science and Technology, 36(4), 381–389. https://
doi.org/10.1016/s0023-6438(03)00042-2.
Ayrapetyan, M., & Oliver, J. D. (2016). The viable but non-culturable state and its re-
levance in food safety. Current Opinion in Food Science, 8, 127–133. https://doi.org/
10.1016/j.cofs.2016.04.010.
Ayrapetyan, M., Williams, T. C., & Oliver, J. D. (2015). Bridging the gap between viable
but non-culturable and antibiotic persistent bacteria. Trends in Microbiology, 23(1),
7–13. https://doi.org/10.1016/j.tim.2014.09.004.
Cao, X., Zhao, L. C., Zhang, J. F., Chen, X., Shi, L., Fang, X., et al. (2019). Detection of
viable but nonculturable Vibrio parahaemolyticus in shrimp samples using improved
7
Food Control 115 (2020) 107292
real-time PCR and real-time LAMP methods. Food Control, 103, 145–152. https://doi.
org/10.1016/j.foodcont.2019.04.003.
Dinu, L. D., & Bach, S. (2011). Induction of viable but nonculturable Escherichia coli O157:
H7 in the phyllosphere of lettuce: A food safety risk factor. Applied and Environmental
Microbiology, 77(23), 8295–8302. https://doi.org/10.1128/AEM.05020-11.
Dinu, L., & Bach, S. (2013). Detection of viable but non-culturable Escherichia coli O157:
H7 from vegetable samples using quantitative PCR with propidium monoazide and
immunological assays. Food Control, 31(2), 268–273. https://doi.org/10.1016/j.
foodcont.2012.10.020.
Duarte, A., Botteldoorn, N., Coucke, W., Denayer, S., Dierick, K., & Uyttendaele, M.
(2015). Effect of exposure to stress conditions on propidium monoazide (PMA)-qPCR
based Campylobacter enumeration in broiler carcass rinses. Food Microbiology, 48,
182–190. https://doi.org/10.1016/j.fm.2014.12.011.
Gobert, G., Cotillard, A., Fourmestraux, C., Pruvost, L., Miguet, J., & Boyer, M. (2018).
Droplet digital PCR improves absolute quantification of viable lactic acid bacteria in
faecal samples. Journal of Microbiological Methods, 148, 64–73. https://doi.org/10.
1016/j.mimet.2018.03.004.
Guevara, P. D., Guevara, C. D., Ornob, A., & Bashir, R. (2016). On-chip PMA labeling of
foodborne pathogenic bacteria for viable qPCR and qLAMP detection. Microfluidics
and Nanofluidics, 20(8), https://doi.org/10.1007/s10404-016-1778-2.
Kakagianni, M., & Koutsoumanis, K. P. (2019). Assessment of Escherichia coli O157: H7
growth in ground beef in the Greek chill chain. Food Research International, 123,
590–600. https://doi.org/10.1016/j.foodres.2019.05.033.
Li, L., Mendis, N., Trigui, H., Oliver, J. D., & Faucher, S. P. (2014). The importance of the
viable but non-culturable state in human bacterial pathogens. Frontiers in
Microbiology, 5, 258. https://doi.org/10.3389/fmicb.2014.00258.
Liu, J. Y., Zhou, R., Li, L., Peters, B. M., Li, B., Lin, C. W., ... Shirtliff, M. E. (2017). Viable
but non-culturable state and toxin gene expression of enterohemorrhagic Escherichia
coli O157 under cryopreservation. Research in Microbiology, 168(3), 188–193. https://
doi.org/10.1016/j.resmic.2016.11.002.
Liu, Y., Wang, C., Tyrrell, G., & Li, X. F. (2010). Production of shiga-like toxins in viable
but nonculturable Escherichia coli O157: H7. Water Research, 44(3), 711–718. https://
doi.org/10.1016/j.watres.2009.10.005.
Liu, Y. F., Zhong, Q. P., Wang, J., & Lei, S. W. (2018). Enumeration of Vibrio para-
haemolyticus in VBNC state by PMA-combined real-time quantitative PCR coupled
with confirmation of respiratory activity. Food Control, 91, 85–91. https://doi.org/
10.1016/j.foodcont.2018.03.037.
Ouf, J. M. M., Yuan, Y., Singh, P., & Mustapha, A. (2017). Detection of viable but non-
culturable Escherichia coli O157: H7 in ground beef by propidium monoazide real-
time PCR. International Journal of Agricultural Science and Food Technology, 3(2),
26–31. https://doi.org/10.17352/2455-815x.000018.
Ramamurthy, T., Ghosh, A., Pazhani, G. P., & Shinoda, S. (2014). Current perspectives on
viable but non-culturable (VBNC) pathogenic bacteria. Frontiers in Public Health, 2,
103. https://doi.org/10.3389/fpubh.2014.00103.
Randazzo, W., Khezri, M., Ollivier, J., Guyader, F. S. L., Diaz, J. R., Aznar, R., et al.
(2018). Optimization of PMAxx pretreatment to distinguish between human nor-
ovirus with intact and altered capsids in shellfish and sewage samples. International
Journal of Food Microbiology, 266, 1–7. https://doi.org/10.1016/j.ijfoodmicro.2017.
11.011.
Reyneke, B., Ndlovu, T., Khan, S., & Khan, W. (2017). Comparison of EMA-, PMA- and
DNase qPCR for the determination of microbial cell viability. Applied Microbiology and
Biotechnology, 101(19), 7371–7383. https://doi.org/10.1007/s00253-017-8471-6.
Rudi, K., Moen, B., Dromtorp, S. M., & Holck, A. L. (2005). Use of ethidium monoazide
and PCR in combination for quantification of viable and dead cells in complex
samples. Applied and Environmental Microbiology, 71(2), 1018–1024. https://doi.org/
10.1128/AEM.71.2.1018-1024.2005.
Smith, B. A., Fazil, A., & Lammerding, A. M. (2019). A risk assessment model for
Escherichia coli O157: H7 in ground beef and beef cuts in Canada: Evaluating the
effects of interventions. Food Control, 29. https://doi.org/10.1016/j.foodcont.2012.
03.003.
Tavernier, S., & Coenye, T. (2015). Quantification of Pseudomonas aeruginosa in multi-
species biofilms using PMA-qPCR. PeerJ, 3, e787. https://doi.org/10.7717/peerj.787.
Telli, A. E., & Dogruer, Y. (2019). Discrimination of viable and dead Vibrio para-
haemolyticus subjected to low temperatures using Propidium Monoazide - quantita-
tive loop mediated isothermal amplification (PMA-qLAMP) and PMA-qPCR. Microbial
Pathogenesis, 132, 109–116. https://doi.org/10.1016/j.micpath.2019.04.029.
Varma, M., Field, R., Stinson, M., Rukovets, B., Wymer, L., & Haugland, R. (2009).
Quantitative real-time PCR analysis of total and propidium monoazide-resistant fecal
indicator bacteria in wastewater. Water Research, 43(19), 4790–4801. https://doi.
org/10.1016/j.watres.2009.05.031.
Wang, L., Zhong, Q. P., & Li, Y. (2012). Ethidium monoazide-Loop mediated isothermal
amplification for rapid detection of Vibrio parahaemolyticus in viable but non-cul-
turable state. Energy Procedia, 17, 1858–1863. https://doi.org/10.1016/j.egypro.
2012.02.323.
Wei, C., & Zhao, X. H. (2018). Induction of viable but nonculturable Escherichia coli O157:
H7 by low temperature and its resuscitation. Frontiers in Microbiology, 9, 2728.
https://doi.org/10.3389/fmicb.2018.02728.
Yan, M., Xu, L., Jiang, H., Zhou, Z. W., Zhou, S. S., & Zhang, L. (2017). PMA-LAMP for
rapid detection of Escherichia coli and shiga toxins from viable but non-culturable
state. Microbial Pathogenesis, 105, 245–250. https://doi.org/10.1016/j.micpath.2017.
02.001.
Yoon, J. H., Moon, S. K., Choi, C., Ryu, B. Y., & Lee, S. Y. (2019). Detection of viable but
nonculturable Vibrio parahaemolyticus induced by prolonged cold-starvation using
propidium monoazide real-time polymerase chain reaction. Letters in Applied
Microbiology, 68(6), 537–545. https://doi.org/10.1111/lam.13157.
Zhang, Y., Xin, C. X., Wang, X., & Deng, Y. L. (2020). Detection of microorganism from
X. Lv, et al.
China's spacecraft assembly cleanroom. Acta Astronautica, 166, 545–547. https://doi.
org/10.1016/j.actaastro.2018.08.024.
Zhang, Y., Xin, C. X., Zhang, L. T., Deng, Y. L., Wang, X., Chen, X. Y., et al. (2018).
Detection of fungi from low-biomass spacecraft assembly clean room Aerosols.
Astrobiology, 18. https://doi.org/10.1089/ast.2017.1803.
Zhao, L. C., Lv, X. R., Cao, X., Zhang, J. F., Gu, X. K., Zeng, H. Y., et al. (2020). Improved
quantitative detection of VBNC Vibrio parahaemolyticus using immunomagnetic se-
paration and PMAxx-qPCR. Food Control, 110. https://doi.org/10.1016/j.foodcont.
Food Control 115 (2020) 107292
2019.106962.
Zhao, X. H., Li, Y. M., Wang, L., You, L. J., Xu, Z. B., Li, L., ... Yang, L. S. (2010).
Development and application of a loop-mediated isothermal amplification method on
rapid detection Escherichia coli O157 strains from food samples. Molecular Biology
Reports, 37(5), 2183–2188. https://doi.org/10.1007/s11033-009-9700-6.
Zhong, Q. P., Tian, J., Wang, B., & Wang, L. (2016). PMA based real-time fluorescent
LAMP for detection of Vibrio parahaemolyticus in viable but nonculturable state. Food
Control, 63, 230–238. https://doi.org/10.1016/j.foodcont.2015.11.043.