Waste Management 94 (2019) 77–84

Contents lists available at ScienceDirect

Waste Management
journal homepage: www.elsevier.com/locate/wasman

Multifunctional food waste fertilizer having the capability of

Fusarium-growth inhibition and phosphate solubility: A new horizon
of food waste recycle using microorganisms
Ahmad Mahmood, Riho Iguchi, Ryota Kataoka ⇑
University of Yamanashi, Faculty of Life & Environmental Sciences, Department of Environmental Sciences, Takeda, Kofu, Yamanashi, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Organic waste, including food leftovers and trade refuse, has been explored for its use as a nutrient source
Received 5 December 2018 through a multitude of techniques. Composting; the dominant method, is criticized due to exhaustion of
Revised 22 May 2019 nutrients used for simultaneous microbial growth. Drying of food waste to low moisture levels, besides
Accepted 24 May 2019
keeping the nutrition intact, offers the potential of growing desirable phyto-beneficial-cum-functional
Available online 30 May 2019
microbes, which can have additional benefits. Consequently, isolation of fungus from soil was carried
out followed by characterization for confrontation against Fusarium, phosphate solubilization and utiliza-
Keywords:
tion of food waste material. The food waste material was collected from University of Yamanashi
Food waste
Bio-organic fertilizers
Restaurant and dried up to approximately 3.8% moisture using Hitachi Household Garbage Dryer &
Fungus Processor (ECO-B25). A pot experiment, growing Lactuca sativa (lettuce) and Brassica rapa, in selected fun-
Phosphate solubilization gal isolate-inoculated food waste material was conducted comparing with that of chemical, and organic
fertilizer besides uninoculated food waste material. Results showed that one strain UY2015_11 (identi-
fied as Aspergillus niger) significantly inhibited the growth of Fusarium besides solubilizing hardly avail-
able iron, and calcium-type phosphates. Similarly, in a 13-week incubation experiment, mineralization of
nitrate nitrogen from the food waste and fungal strain UY2015_11-inoculated food waste, was 23.9% and
17.0%, respectively. Later pot experiment indicated that the strain UY2015_11-inoculated dried food
waste material showed same vegetable growth as chemical and organic fertilizer (rapeseed oil cake).
Concluding, Aspergillus niger strain UY2015_11 isolated from soil inhibited the growth of Fusarium and
solubilized hardly phosphate. Moreover, the strain UY2015_11 inoculated low moisture-food waste
material showed the same vegetable growth as chemical and organic fertilizer (rapeseed oil cake).
! 2019 Elsevier Ltd. All rights reserved.

1. Introduction of applied nutrients in the soil (Foley et al., 2011) is derivative of

Ever-increasing food requirements linked to intensive agricul-
ture have led to decreased fertility of the soils due to the exhaus-
tive nature of the crops, anthropogenic, and natural factors (Lal,
2006). Lack of soil fertility asks for continuous supply of fertilizers
and nutrients which are derived from other forms of these nutri-
ents and this nutrients’ extraction has depleted the resources
(Cordell et al., 2009; Smil, 2000). Phosphatic fertilizers, for exam-
ple, are prepared from available rock phosphate which is estimated
to be finished by next century (Van Kauwenbergh, 2010). Another
related problem with phosphorus is its fixation to alumina, iron
and silica in the soil (Sharma et al., 2013); making it unavailable
to the plants (Rengel and Marschner, 2005). Such unavailability
⇑ Corresponding author.
E-mail address: rkataoka@yamanashi.ac.jp (R. Kataoka).
a multitude of factors which are: (a) soil related: soil type, pH,
and moisture; (b) plant related: root architecture (Schubert and
Mengel, 1989), and water potential dynamics; and (c) nutrient
related: type applied and the solubility potential (Giehl and von
Wirén, 2014; Mengel, 1985).
Simultaneous increase in generation of domestic food waste,
leftovers and/or trade refuse per capita due to population bulge,
affluence and urbanization pose disposal problems and are difficult
to handle (Bogner et al., 2008; Neugebauer, 2018). In Japan, for
instance, food waste-recycle accounts for only 6.7% when com-
pared with that of industrial waste recycle which stands at 78%
(Environment, M.o., 2014). Diverse kind of organic wastes; partic-
ularly food waste, have been investigated, and used directly or
indirectly in crop production (reviewed by Paritosh et al., 2017).
Increasing food waste, and trade refuse situations thus can be
viewed as resource rather than waste and used in various ways

https://doi.org/10.1016/j.wasman.2019.05.046
0956-053X/! 2019 Elsevier Ltd. All rights reserved.
78 A. Mahmood et al. / Waste Management 94 (2019) 77–84

such in crop nutrient management. There has been increased focus
on waste recycling options (Baroutian et al., 2018; Sogn and
Haugen, 2011). The problems with conventional waste disposal
technology are high energy requirements during incineration,
complexity of composting, and adverse environmental effects,
which have necessitated a search for sustainable solution for food
waste usage (Zhang et al., 2014). Adding to the problem, local gov-
ernments here in Japan have to bear extra cost for disposing the
food waste, thus food waste management is an urgent problem.
One solution to the garbage disposal problem is for food waste to
be composted and applied to the soil. The advantages of applying
organic material in shape of composted or processed food waste
for agriculture include; improving soil structure through better soil
aggregation, reducing the runoff, enhancing the soil porosity and
water holding capacity, and fostering the cation exchange capacity
with better biological activity (Marinari et al., 2000; Shiralipour
et al., 1992). The constituents of food waste generally include car-
bohydrates, proteins, lipids, and inorganic compounds (Lin et al.,
2013), which can serve as food for microbes, thus releasing the
nutrients for the plants. Thus, integrated use of biofertilizers with
organic fertilizers offers combined benefits.
Food waste has often been used for making compost, but nutri-
tion of compost is consumed as a source of microbe growth (Zhao
et al., 2017). If the food waste is dried to lower moisture levels
instead, its nutrition can be maintained. In addition, the possibility
of growing the desired functional microbes supports the decompo-
sition of the waste material. The aims of this study were therefore
to reveal the nutrient release from low-moisture food waste with
the help of functional microbes, and solubilization of hardly sol-
uble phosphate from soil.
2. Material and methods
2.1. Isolation, and taxonomic screening of fungi
(TCCTCCGCTTATTGATATGC), and sample, and 12.5 mL of GoTaq#
Green Master Mix was used. The sequences of nucleotides were
obtained using PCR-Direct sequencing, and aligned using BioEdit
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The neighbor
joining algorithm (Saitou and Nei, 1987) was used for distance-
based phylogenetic tree (Jukes and Cantor, 1969), where the topol-
ogy of the trees was evaluated by bootstrap resampling (1000
replicates), followed by phylogenetic analyses using Clustal W pro-
vided by the DNA Data Bank of Japan (http://www.ddbj.nig.ac.jp/
Welcome-j.html).
2.2. Confrontation assay
Confrontation assay of all the post-RFLP strains was carried out
against already isolated Fusarium spp. (Accession No. LC427575)
from the soil in University of Yamanashi Research Farm. The iso-
lates were inoculated on one side of the PDA plate, and Fusarium
spp. on the other, keeping 5 cm apart. The plates were incubated
at 25 "C, and were observed visually, together with measurement
of the radius value of the contact part of Fusarium growth. The
strain UY2015_11, based on the confrontation assay, was selected
for additional analysis.
2.3. Phosphorus solubilization ability
The phosphorus solubilization capability of the isolates was
investigated using Pikovskaya (1948) Agar (pH: 6.34) containing
calcium phosphate (Ca3(PO4)2 and modified Pikovskaya agar con-
taining FePO4 as hardly soluble phosphates. Both the hardly sol-
uble phosphates were added at 0.5%. The plates were inoculated
with fungal strains and incubated for 7 days at 25 "C, and observed
for the production of clear zone. The results were compiled using
the following index: ! No clear zone, ± detectable clear zone but
very weak activity, + detectable clear zone.

Surface soil (depth: 15 cm) was collected from two different

2.4. Assay of food waste utilization through incubation, and pot
sites: University of Yamanashi Research Farm (N35.603951,
experiment
E138.578289), and Yamanashi Prefectural Research Farm
(N35.680544, E138.488359). Both the soils (0.5 g each) were sub-
Food waste (including vegetable and fruit peels, leftover food
jected to isolation through the dilution plate technique: mixing
which comes from diverse meat and vegetable menus) was col-
0.5 g of soil into 4.5 mL of sterilized distilled water (SDW), where
lected from the University of Yamanashi Restaurant on a daily
0.5 mL of the suspension was transferred in further dilutions, and
basis for 7 days, and dried up to 3.8% moisture using a Hitachi
from the 3rd dilution onwards, 50 mL of the suspension was spread
Household Garbage Dryer & Processor ECO-B25 (Hitachi, Japan),
on potato dextrose agar (PDA) media using a disposable spreader.
and then ground (Fig. 1). The chemical properties of the low-
The plates were incubated for 7 days, at 25 "C and the observed
moisture food waste are represented in Table 1.
colonies were streaked on fresh PDA plates until a single colony
An incubation experiment with low-moisture food waste mate-
per plate was obtained. Glycerol stock was prepared for all of the
rial with or without strain UY2015_11 was carried out for measure-
isolates, and stored at !80 "C.
ment of the mineralization of nutrients, i.e. nitrate nitrogen, and
The obtained strains were screened out for genotype through
restriction fragment length polymorphism (RFLP), using two differ-
ent restriction enzymes namely HinfI, and AluI (New England Bio-
labs Japan Inc., Tokyo). 4.5 mL of extracted nucleotide of the
strains was mixed with 0.5 mL of respective enzyme, 1 mL buffer,
and 4 mL SDW, incubated for 30 min at 37 "C, and loaded to 2%
Agarose gel, run for 25 min along with 100 bp ladder. The bands
of the DNA were compared, and the strains showing different pat-
terns were selected for further analysis.
Internal transcribed spacers (ITS) sequencing was carried out
for the identification of the strains, after the DNA extraction using
ZR Fungal/Bacterial DNA MiniPrep KitTM (Zymo Research Corp., CA,
USA). The ITS region was amplified using T100TM Thermal Cycler
(Bio-rad, CA, USA) consisting of 1 cycle of 95 "C for 5 min, 30 cycles
of 94 "C for 30 s, 55 "C for 30 s and 72 "C for 1 min, followed by a
final extension at 72 "C for 7 min. Standard mixture for polymerase
chain reaction (PCR) containing 9.5 mL nuclease free water, 1 mL of
each primer ITSF (TCCGTAGGTGAACCTGCGG) and ITS4 Fig. 1. Image of the food waste material after processing and grinding.
 A. Mahmood et al. / Waste Management 94 (2019) 77–84 79

Table 1
Chemical properties of the food waste material after drying, and grinding.

C (%) N (%) C/N P2O5 (%) K2O (%) CaO (%) MgO (%) Na2O (%) S (%) Mn (mg kg!1) Zn (mg kg!1) Cu (mg kg!1) Fe (mg kg!1)
48.3 3.26 14.8 0.63 0.77 0.18 0.11 1.56 0.23 6.24 26.5 3.29 30.0

phosphate from the food waste material and soil, respectively. The
method was modified from (Ogawa, 1997). Moreover, the effect of
strain UY2015_11 on the solubilization of hardly soluble phosphate
in soil was investigated. 7.62 g (estimated based on mineralization
of nitrogen from the material, see Fig. 4a) of material was weighed
in a 100-mL beaker, and was inoculated with the strain
UY2015_11 by cutting the fungal disc from pre-grown petri-plate,
and putting it on the material with moisture adjusted to 30% (v/
w). The covered beakers were incubated for 7 days at 25 "C, and then
mixed with 300 g of soil (obtained from Site I; pH 6.79 ± 0.33; EC
(mS/cm) 0.11 ± 0.08; nitrate nitrogen 23.1 ± 3.13 mg kg!1; available
phosphate 421 ± 86.8 mg kg!1) adding 60 mg of FePO4 (based on
phosphorus required per pot) as a hardly soluble phosphate, and
incubated for 13 weeks. The rapeseed cake was treated as the con-
trol. Nitrate nitrogen, and available phosphate were measured by
Alkali Reduction Diazo Dye Method (Soil Environmental Analytical
Method, 1997) and Truog Method (Soil Environmental Analytical
Method, 1997), respectively. Moreover, the release of hardly soluble
phosphate from soil was calculated by the following formula: Solu-
bilized phosphate concentration = Available phosphate in soil, and
food waste material ! Phosphate in low-moisture food waste mate-
rial ! Soil Phosphate in soil without fertilizer.
For the pot experiment (High density poly styrene plastic Neu-
bauer Pot, Size: 100 cm2, Fujiwara Seisakusho, Ltd. Tokyo, Japan) a
similar pattern was followed, i.e. uninoculated low-moisture food
waste material, low-moisture food waste material with strain
UY2015_11, seedcake and chemical fertilizer (HYPONeX Japan
Corp., Ltd. Osaka, Japan. Liquid Fertilizer, N:P:K = 6:10:5) as a con-
trol mixed with 500 g soil (obtained from Site I), with four repli-
cates, and incubated for 7 days at 25 "C. Then the seeds of
Lactuca sativa var. crispa (lettuce), and Brassica rapa var. perviridis
were planted. After 50 days of growth, the plants were harvested,
and were subjected to above and below ground plant parts’ weight
for the morphological parameters. The Dunnett’s test for multiple
comparison was conducted as statistical analysis of pot experiment
data. Also, colony forming units (CFU) of bacteria, and fungi from
the experimental units were measured for a better picture of influ-
spp. Together, the sites contributed a total of 157 strains of fungi
on PDA media. The strains were screened on colony appearance
and growing pattern, and were also subjected to screening through
RFLP. The strains were further identified using Internal transcribed
spacers (ITS) sequencing. The genus level identification gave a total
of 26 genera, though 48.4% were found as unknown. The frequency
of the isolates based on the ITS region amplification according to
genus is summarized in Table 2. Aspergillus spp. showed maximum
frequency of 8.9%, while Alternaria, Dothideomycete, Eurotiomycetes,
Neosartorya, Paecilomyces, Phoma, Plectosporium, Torula, and Trichu-
rus genera were recorded minimum at 0.6% each. The prevalence of
Fusarium spp. was also observed as a higher isolate, which was tar-
geted as the pathogen to be controlled. One strain (named
UY2015_11) significantly inhibited the growth of Fusarium spp.
The sequence of this strain (314 bp; GenBank accession No.
LC427574) was compared with other fungal nucleotide sequences
in GenBank, and exhibited a high sequence similarity to Aspergillus
niger. The highest sequence similarity (99%) of the ITS gene was
found in Aspergillus niger strain M2 (MH622753). The ITS of strain
UY2015_11 was aligned with those of the representative strains of
the Aspergillus spp., and a phylogenetic dendrogram was con-
structed (Fig. 2). Based on the genetic and morphological charac-
teristics, strain UY2015_11 was designated Aspergillus niger strain
UY2015_11.
3.2. Confrontation assay
Arising interest in sustainable plant production technologies
has brought forward the biocontrol, aimed for in this study. Fusar-
ium spp. has a high incidence in wide habitats as for this study, and
its virulence to many crop species is another problem. The strains
Table 2
Identification of the isolates classified on the basis of Restriction Fragment Length
Polymorphism.
RFLP Closely related genus Frequency (%)

ence of organic amendments on soil biology. Type 1 Actinomucor spp. 3.8

Type2 Alternaria spp. 0.6
Type 3 Aspergillus spp. 8.9
2.5. Organic acid production assay Type 4 Chaetomium spp. 1.9
Type 5 Cladosporium spp. 1.9
Organic acid production assay was carried out using high per- Type 6 Clonostachys spp. 1.3
Type 7 Cunninghamella spp. 1.9
formance liquid chromatography (HPLC). Twenty ml of Pikovskaya
Type 8 Dothideomycete spp. 0.6
broth media (pH 6.34) was prepared in a 50-ml Falcon Tube. A fun- Type 9 Eurotiales spp. 3.8
gal disk of strain UY2015_11 was inoculated to each tube and incu- Type 10 Eurotiomycetes spp. 0.6
bated for 0, 4, 7, 14 and 21 days at 25 "C. The pH and citric acid in Type 11 Fusarium spp. 3.2
spent media was measured periodically. The experiment was con- Type 12 Humicola spp. 2.5
Type 13 Mucor spp. 1.9
ducted in triplicates. Citric acid was determined by HPLC (column: Type 14 Neosartorya spp. 0.6
Intersil OPS-SP, 4.6 " 250 mm, pore size 5 lm; mobile phase: Type 15 Paecilomyces spp. 0.6
10 mM NH4H2PO4 (pH 2.6), flow rate: 1.0 mL min!1, oven temper- Type 16 Penicillium spp. 1.3
ature: 40 "C, detection: UV–VIS detector at 210 nm, Injection vol- Type 17 Phoma spp. 0.6
Type 18 Plectosphaerella spp. 0.6
ume: 10 lL).
Type 19 Plectosporium spp. 1.3
Type 20 Pseudozyma spp. 1.3
3. Results Type 21 Rhizopus spp. 1.3
Type 22 Talaromyces spp. 3.2
Type 23 Torula spp. 0.6
3.1. Isolation, and taxonomic screening of fungi Type 24 Trichoderma spp. 2.5
Type 25 Trichurus spp. 0.6
Soil samples from two locations were taken for the recovery of Type 26 Zygorhynchus spp. 3.8
Unknown 48.4
potential fungi having the ability to control the growth of Fusarium
80 A. Mahmood et al. / Waste Management 94 (2019) 77–84
Fig. 2. The distance-based phylogenetic tree of strain UY2015_11 used in the study; constructed using the neighbor-joining algorithm based on the ITS sequencing.
selected post-RFLP were investigated for confrontation, and it was
observed that 16 out of 112 strains inhibited the growth of Fusar-
ium spp. The extent of inhibition was, however, varied, but strain
UY2015_11 was found to be the most inhibiting.
3.3. Phosphorus solubilization ability
The other function after the biocontrol was to check the strains
for potential traits, and the phosphate solubility potential of strain
UY2015_11 was explored. The petri plate assay was used for check-
ing phosphorus solubilization potential. It was observed that the
strain had the ability to solubilize phosphorus. The clear zone pro-
duced was compared with control, and other strains tested, and
based on the index, the UY2015_11 was marked +. The solubiliza-
tion potential, investigated using the petri plate assay showed the
extent of phosphate solubilization, and is illustrated in Fig. 3.
3.4. Assay of food waste utilization through incubation, and pot
experiment
Laboratory scale assay for observing food waste utilization by
the strain was carried out, and nutrient release from the food waste
material was also observed. The food waste material as sole energy
source was used by the fungus, and extensive growth was observed
visually. The growth pattern showed fungi occupying more surface
area, and within 7 days the entire exposed surface of the material
was covered. Significant differences were observed among the
investigated treatments, where rapeseed cake showed quickest
release of nitrate nitrogen followed by fungus inoculated food
waste material, and then no inoculation material (Fig. 4a). The
nitrate nitrogen release from the rapeseed started immediately
after the start of incubation. The mineralization of food waste
material with strain UY2015_11 was slower than food waste mate-
rial only. The release from food waste material with strain
UY2015_11 was not observed until the 4th week of measurement.
The nitrate nitrogen generation of each material in the 13-week
incubation was 464 mg kg!1 (mineralization rate: 36.5%),
330 mg kg!1 (mineralization rate: 23.9%) and 235 mg kg!1 (miner-
alization rate: 17.0%) in rapeseed, food waste material and food
waste material with strain UY2015_11, respectively. In contrast,
the trend in phosphate availability also followed that of nitrate
(Fig. 4b). The phosphate availability escalated quickly in rapeseed
cake material, whereas no release in food waste material only
and small release in food waste material with strain UY2015_11
was observed. Fungal inoculation resulted in significant increase
in phosphate availability from the soil which started from the
2nd week, and continued up to 7 weeks showing a stable availabil-
ity post-4th week measurement (Fig. 5).
In the pot experiment, the lettuce and B. rapa growth was
observed after 50 days, and summarized in Fig. 6. In terms of
means, all of the treatments resulted in an increase over controls
in all parameters studied. In the case of lettuce, the fresh weight
of above ground parts (stem and leaves) was recorded higher in
all the treatments against controls. However, the treatment with

Fig. 3. Solubilization of hardly soluble phosphates by strain UY2015_11, (a) iron phosphate, (b) Calcium phosphate in potato dextrose agar media.
50
Soil nitrate nitrogen (mg /100g of soil)
40
30
20
10
0
0 2 4 6
-10
Incubation week
b 120
100
Soil phosphate (mg/100g of soil)
80
60
40
20
0 Organic acid production using the liquid media inoculated with
0 2
-20
Incubation week
Fig. 4. (a) Measurement of soil nitrate nitrogen and (b) soil phosphate release from;
only food waste material indicated by j, food waste material + strain UY2015_11
indicated by N, and rapeseed oil cake indicated by d.
the fungus showed no statistical difference. The means of dry
weight of above ground parts were 1.95, 2.6, 2.35, 2.48 g in chem-
ical fertilizer, low-moisture food waste material, low-moisture
food waste material with strain UY2015_11, and rapeseed oil cake,
respectively. The trend among treatments was the same as fresh
weight. The fresh weight of the root showed similar results but
did not differ significantly in any treatments. The means of dry
weight of root were 0.42, 0.53, 0.39, and 0.53 g, in chemical fertil-
izer, low-moisture food waste material, low-moisture food waste
material with strain UY2015_11, and rapeseed oil cake, respec-
tively. On the other hand, B. rapa showed significant increase in
above ground parts’ fresh weight, except for the fungal inoculated
treatment, and contrarily, the root fresh weight was significantly
affected by the application of fungal inoculated food waste mate-
A. Mahmood et al. / Waste Management 94 (2019) 77–84 81
12
solubilization of soil hardly soluble
10
phosphate P2O5 mg/100g
8
6
4
2
8 10 12 14 0
0 5 10 15
-2
Incubation week
Fig. 5. Solubilization of hardly soluble phosphate by the strain UY2015_11 in the
soil indicated by j and the uninoculated food waste material indicated by N.
rial while there was no significant difference in the dry weight
among the treatment.
3.5. Organic acid production assay
4 6 8 UY2015_11 was measured, along with pH during the incubation
days. The results indicated that where control showed no change
in the pH from the starting value of 6.3, the inoculated culture
showed significant decrease, and the minimum pH measured
was 2.06 (Fig. 7a). The decrease in pH was inversely proportional
to the citric acid production (Fig. 7b). It was observed that the citric
acid production showed variation: increasingly linearly to reach
the highest concentration (7 days), and showing a slight increase,
not statistically significant among the incubation days, and reach-
ing the maximum in 14 days (2062 ± 976.1 mg L-1). The production
started to decrease once reaching the maximum (Fig. 7a).
4. Discussion
The prospects of using food waste as a fertilizer are still limited
by slow release of nutrients, large volumes, risk of pathogens, mul-
tiple factors affecting slower decomposition (Sundberg and
Jönsson, 2008) and unintended composition. However, the integra-
tion of biofertilizers, and organic fertilizers, enhancing the nutrient
release (Rashid et al., 2016), and decomposition of organic wastes
(in this case, food waste), through the application of biofertilizers
82 A. Mahmood et al. / Waste Management 94 (2019) 77–84

a 40 b c
7 3

Dry weight of root, stem and leaves (g)

Fresh weight of stem and leaves (g)

35 * *

Fresh weight of root (g)

6 2.5
30
5
25 2
4
20 1.5
3
15
1
2
10
1 0.5
5
0 0 0
d 30 e 7
f 3

Dry weight of root, stem and leaves (g)

Fresh weight of stem and leaves (g)

6 *
25 * Fresh weight of root (g) 2.5
* 5
20 * 2
4
15 1.5
3
10 2 1

5 1 0.5

0 0 0

Fig. 6. The effect of different fertilizer/nutrient sources on the fresh weight of aboveground and belowground parts of lettuce (a & b), and Brassica (d & e), and dry weight of
aboveground (transparent bar) and belowground (colored bar) parts of lettuce (e), and Brassica (f). Error bar mean standard deviation and asterisk mean significant different
compared with control using Dunnett’s test (P < 0.05). Note; there is no error bar in the (c) and (f) because of using one sample out of 3 samples for analysis of vitamin C (Data
not shown).

a b
7 3500
6 3000
Citric acid (mg kg-1)

5 2500
4 2000
pH

3 1500
2 1000
1 500
0 0
0 10 20
Incubation day

Fig. 7. (a) Change of pH with the inoculation of UY2015_11, and production of citric acid in the liquid media. j indicates the citric acid production, N indicates the pH change,
and d indicates the uninoculated treatment serving as control. (b) The chromatograph of 5 ppm standard of citric acid assay (i), and the fungus inoculated media (ii) by HPLC.

can significantly address the associated problems. In this study, with specific microorganisms. We investigated hardly soluble
functional fungi were selected from 157 strains isolated from soil, phosphate solubilization in soil and nitrogen mineralization of
to create functional organic fertilizer using food waste material food waste material using the food waste materials inoculated
 A. Mahmood et al. / Waste Management 94 (2019) 77–84 83

with/without fungi. Prior to the screening of functional fungi, the UY2015_11, respectively. This delay in the turn to mineralization
fungal community was analyzed with focus on the rhizosphere soil suggested that strain UY2015_11 grew in the soil using low-
due to an abundance of plant growth promoting fungi (PGPF), and moisture food waste material and took in nitrogen more than
the pathogens. Souza-Motta et al. (2003) showed an abundance of indigenous microorganisms.
certain genera from soil habitats and isolation of 49 strains with a The pot experiment resulted in enhanced plant growth in the
majority of Penicillium spp., and Aspergillus spp. observed. In the treatment where food waste with strain UY2015_11 was applied,
present study, a total of 157 strains from both locations investi- even though the estimated available nitrogen in low-moisture food
gated were isolated, with Aspergillus spp. leading the frequency waste with strain UY2015_11 is much lower than that of chemical
with 8.9% after identification through the PCR-RFLP classification fertilizer (Table 3, Fig. 4a). Strain UY2015_11 can be said to have
and sequences (Table 1). plant growth promoting ability, but the exact details remain
The confrontation showed varying responses, with the strain unclear. In contrast, the enhancement of growth in food waste
UY2015_11 showing maximum inhibition, where others were material and rapeseed oil cake corresponds to nitrogen input to
found to be insufficient to be termed as biocontrol agents. The the soil. That said, the low-moisture food waste material showed
results thus suggest the rare incidence of biocontrol characteristics, a fertilizer effect equivalent to chemical fertilizer and commonly
even for the variety of genera isolated in this study. Similarly, stud- used organic fertilizer (Rapeseed oil cake). Also, it is clear that
ies of confrontation, and antagonism of bacteria against fungi the low-moisture food waste material cultured strain UY2015_11
(Mille-Lindblom et al., 2006), and fungi against fungi (Grosch can be used as a fertilizer without having an adverse impact on
et al., 2006) have been reported. The genus Aspergillus has also the growth of vegetables and soil microbes (Table 4). To date, sim-
been reported to inhibit the growth of other fungal strains, includ- ilar instances of organic fertilizers integrated with biofertilizers,
ing Colletotrichum acutatum (Landum et al., 2016), Sclerotinia scle- also termed bio-organic fertilizers, have been applied, and plant
rotiorum (Melo et al., 2006), and Fusarium solani (Akhtar and growth promotion (PGP), along with control of certain diseases,
Azam, 2014). has been reported (Huang et al., 2017; Liu et al., 2015; Zhang
As a result of culturing strain UY2015_11 on media containing et al., 2017). The potential of co-application thus provides insights
hardly soluble phosphate, a clear zone was formed (Fig. 3). There- towards better soil and crop management, and suggests better
fore, it is suggested that this fungus solubilizes hardly soluble nutrient supply to the plants along with different mechanisms
phosphate. For instance, the pH decrease of the media inoculated associated with microbes applied.
with UY2015_11 showed that the pH decreased with the growth Food waste studied here is being produced increasingly and is
of strain UY2015_11 (Fig. 7a). Certain acids are produced by best get rid of locally rather collection by the municipality. There
microbes with several objectives and have been widely docu- are instances of subsidy on food waste processing apparatus in
mented (Li et al., 2016; Liaud et al., 2014). The organic acid produc- Japan (https://www.city.kofu.yamanashi.jp/genryo/kurashi/gomi/
tion is also linked to enhanced phosphorus solubility. Thus, the hojo/nama.html) same as the one used in this study, thus its appli-
production of citric acid in the media rose in inverse proportion cation on small-scale is seen economical and practical. For the
to pH variation. These results suggest that strain UY2015_11 pro- large-scale application however, collection can be systemized, pro-
duced citric acid and solubilized the hardly soluble phosphate by cessed at government subsidized-plant, and the energy costs can
lowering the pH. Studies have reported isolation of phosphorus be met by renewable sources. Comparing with the bulky organic
solubilizing fungi from the rhizosphere, and their application in fertilizers and costly chemical fertilizers, this bio-organic fertilizer
crop production, documenting positive results (Elias et al., 2016; is deemed best-suited because of its multiple roles and utilization
Wahid and Mehana, 2000). The P-solubilization potential of fungi of waste. Cautious application of Aspergillus niger, however, is
is linked to production of organic acids including citric (Mendes
et al., 2013), gluconic (Chuang et al., 2007), oxalic (Li et al.,
2016), and succinic acids (Jain et al., 2012). The mechanism behind
Table 3
the release of phosphorus is the acidic proton recovery. The fixed
The amount of fertilizer/nutrient sources added to soil, the nitrogen percentage, and
phosphate, unavailable under normal circumstances, was solubi- estimated available nitrogen to the plants. The estimation of available nitrogen is
lized by the fungus, and corresponds to several studies where the based on the mineralization study through 13-week incubation experiment.
solubilization of phosphorus has been reported in laboratory cul-
Input Total Estimated available
tures (Nelofer et al., 2016), waste material (Ogbo, 2010) and soil amount (g/pot) nitrogen (%) nitrogen (mg/pot)
(Singh and Reddy, 2011). In this study, therefore, the solubilization
Chemical fertilizer 1.33 6.00 79.8
of fixed or hardly soluble phosphate in soil was also investigated, Dried food waste 12.7 3.26 98.9
and the strain UY2015_11 showed high competency in solubiliza- Dried food waste with 12.7 3.26 23.5
tion as it was dissoluble and released up to 80 mg kg!1 in the soil strain UY2015_11
(Fig. 5). These results advocate the use of such waste materials in Rapeseed oil cake 12.7 3.00 139
crop production, where there are phosphate-deficient soils with
fixed phosphate.
The mineralization of low-moisture food waste was measured
Table 4
by incubation assay. The food waste material with and without
Fungal, and bacterial CFUs recovered from the soil at the end of the experiment.
the strain UY2015_11, further mixed with soil was monitored reg- The ± values are standard deviation among replicates.
ularly for nitrate, and available phosphate release in soil. The avail-
Brassica rapa Lactuca sativa
able phosphate produced a negligible amount because of the small
amount of phosphorus in low-moisture food waste material. How- Fungi Bacteria Fungi Bacteria
(10 4) (10 6) (10 4) (10 6)
ever, the mineralization of low-moisture food waste in the low-
moisture food waste without fungus was different from that with (cfu/g of soil)
fungus due to the impact of fungus application (Fig. 4). As soil Chemical fertilizer 50 ± 6 9±3 1±1 5±5
microorganisms grew in the soil using food waste material, nitro- Dried food waste 101 ± 0 72 ± 20 3±1 23 ± 8
gen in the soil was taken up by the microorganisms. It turned to Dried food waste with strain 21 ± 6 46 ± 11 31 ± 13 280 ± 200
UY2015_11
mineralization after 2 and 5 weeks in the food waste material Rapeseed oil cake 71 ± 95 49 ± 43 3 ± 13 16 ± 3
without fungus and in the food waste material with strain
84 A. Mahmood et al. / Waste Management 94 (2019) 77–84
needed due to its sporulation capacity. Investigation of such bio-
organic fertilizers for their safety to soil environments should be
carried out before commercialization.
5. Conclusion
This study focused on the usage of food waste material as a
functional fertilizer using specific microorganisms. Aspergillus sp.
strain UY2015_11 was isolated and revealed to inhibit fungal
(Fusarium spp.) growth and solubilize hardly soluble phosphate
due to production of citric acid. Moreover, it may be possible to
use food waste material as fertilizer when the strain UY2015_11
grows in the food waste. The results suggest the strain
UY2015_11 can be efficiently used in food waste, and biological
trade refuse recycling.
Acknowledgement
This work is financially supported by the Yanmar Environmen-
tal Sustainability Support Association (K30010).
References
Akhtar, M.S., Azam, T., 2014. Effects of PGPR and antagonistic fungi on the growth,
enzyme activity and Fusarium root-rot of pea. Archiv. Phytopathol. Plant
Protect. 47, 138–148.
Baroutian, S., Munir, M.T., Sun, J., Eshtiaghi, N., Young, B.R., 2018. Rheological
characterisation of biologically treated and non-treated putrescible food waste.
Waste Manage. 71, 494–501.
Bogner, J., Pipatti, R., Hashimoto, S., Diaz, C., Mareckova, K., Diaz, L., Kjeldsen, P.,
Monni, S., Faaij, A., Gao, Q., Zhang, T., Ahmed, M.A., Sutamihardja, R.T.M.,
Gregory, R., 2008. Mitigation of global greenhouse gas emissions from waste:
conclusions and strategies from the Intergovernmental Panel on Climate
Change (IPCC) Fourth Assessment Report. Working Group III (Mitigation).
Waste Manage. Res. 26, 11–32.
Chuang, C.-C., Kuo, Y.-L., Chao, C.-C., Chao, W.-L., 2007. Solubilization of inorganic
phosphates and plant growth promotion by Aspergillus niger. Biol. Fertil. Soils
43, 575–584.
Cordell, D., Drangert, J.-O., White, S., 2009. The story of phosphorus: Global food
security and food for thought. Global Environ. Change 19, 292–305.
Elias, F., Woyessa, D., Muleta, D., 2016. Phosphate Solubilization Potential of
Rhizosphere Fungi Isolated from Plants in Jimma Zone, Southwest Ethiopia. Int.
J. Microbiol. 11.
Environment, M.o., 2014. 食品リサイクル関連｜食品ロスの削減・食品廃棄物等の発生抑制.
Foley, J.A., Ramankutty, N., Brauman, K.A., Cassidy, E.S., Gerber, J.S., Johnston, M.,
Mueller, N.D., O’Connell, C., Ray, D.K., West, P.C., Balzer, C., Bennett, E.M.,
Carpenter, S.R., Hill, J., Monfreda, C., Polasky, S., Rockström, J., Sheehan, J.,
Siebert, S., Tilman, D., Zaks, D.P.M., 2011. Solutions for a cultivated planet.
Nature 478, 337.
Giehl, R.F.H., von Wirén, N., 2014. Root nutrient foraging. Plant Physiol. 166, 509–
517.
Grosch, R., Scherwinski, K., Lottmann, J., Berg, G., 2006. Fungal antagonists of the
plant pathogen Rhizoctonia solani: selection, control efficacy and influence on
the indigenous microbial community. Mycol. Res. 110, 1464–1474.
Huang, N., Wang, W., Yao, Y., Zhu, F., Wang, W., Chang, X., 2017. The influence of
different concentrations of bio-organic fertilizer on cucumber Fusarium wilt
and soil microflora alterations. Plos One 12, e0171490.
Jain, R., Saxena, J., Sharma, V., 2012. Solubilization of inorganic phosphates by
Aspergillus awamori S19 isolated from rhizosphere soil of a semi-arid region.
Ann. Microbiol. 62, 725–735.
Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. Mammalian Protein
Metabolism 3, 132.
Lal, R., 2006. Enhancing crop yields in the developing countries through restoration
of the soil organic carbon pool in agricultural lands. Land Degrad. Dev. 17, 197–
209.
Landum, M.C., Félix, M.D.R., Alho, J., Garcia, R., Cabrita, M.J., Rei, F., Varanda, C.M.R.,
2016. Antagonistic activity of fungi of Olea europaea L. against Colletotrichum
acutatum. Microbiol. Res. 183, 100–108.
Li, Z., Bai, T., Dai, L., Wang, F., Tao, J., Meng, S., Hu, Y., Wang, S., Hu, S., 2016. A study
of organic acid production in contrasts between two phosphate solubilizing
fungi: Penicillium oxalicum and Aspergillus niger. Sci. Rep. 6, 25313.
Liaud, N., Giniés, C., Navarro, D., Fabre, N., Crapart, S., Gimbert, I.H., Levasseur, A.,
Raouche, S., Sigoillot, J.-C., 2014. Exploring fungal biodiversity: organic acid
production by 66 strains of filamentous fungi. Fungal Biol. Biotechnol. 1, 1.
Lin, C.S.K., Pfaltzgraff, L.A., Herrero-Davila, L., Mubofu, E.B., Abderrahim, S., Clark, J.
H., Koutinas, A.A., Kopsahelis, N., Stamatelatou, K., Dickson, F., 2013. Food waste
as a valuable resource for the production of chemicals, materials and fuels.
Current situation and global perspective. Energy Environ. Sci. 6, 426–464.
Liu, L., Sun, C., Liu, S., Chai, R., Huang, W., Liu, X., Tang, C., Zhang, Y., 2015. Bioorganic
fertilizer enhances soil suppressive capacity against bacterial wilt of tomato.
Plos One 10, e0121304.
Marinari, S., Masciandaro, G., Ceccanti, B., Grego, S., 2000. Influence of organic and
mineral fertilisers on soil biological and physical properties. Bioresour. Technol.
72, 9–17.
Melo, I.S., Faull, J.L., Nascimento, R.S., 2006. Antagonism of Aspergillus terreus to
Sclerotinia sclerotiorum. Br. J. Microbiol. 37, 417–419.
Mendes, G.O., Dias, C.S., Silva, I.R., Júnior, J.I.R., Pereira, O.L., Costa, M.D., 2013.
Fungal rock phosphate solubilization using sugarcane bagasse. World J.
Microbiol. Biotechnol. 29, 43–50.
Mengel, K., 1985. Dynamics and availability of major nutrients in soils. In: Stewart,
B.A. (Ed.), Advances in Soil Science. Springer, New York, New York, NY, pp. 65–
131.
Mille-Lindblom, C., Fischer, H., Tranvik, L.J., 2006. Antagonism between bacteria and
fungi: substrate competition and a possible tradeoff between fungal growth and
tolerance towards bacteria. Oikos 113, 233–242.
Nelofer, R., Syed, Q., Nadeem, M., Bashir, F., Mazhar, S., Hassan, A., 2016. Isolation of
Phosphorus-Solubilizing Fungus from Soil to Supplement Biofertilizer. Arab. J.
Sci. Eng. 41, 2131–2138.
Neugebauer, M., 2018. The use of biological waste as a source of low-temperature
heat for hotbeds in spring in north-eastern Poland. J. Environ. Manage. 225,
133–138.
Ogawa, Y., 1997. Soil chemistry. In: Tadano, T. (Ed.), Soil and Environmental
Analysis Methods. Hakuyuusha, Tokyo, Japan, pp. 257–259.
Ogbo, F.C., 2010. Conversion of cassava wastes for biofertilizer production using
phosphate solubilizing fungi. Bioresour. Technol. 101, 4120–4124.
Paritosh, K., Kushwaha, S.K., Yadav, M., Pareek, N., Chawade, A., Vivekanand, V.,
2017. Food waste to energy: an overview of sustainable approaches for food
waste management and nutrient recycling. BioMed. Res. Int. 19.
Rashid, M.I., Mujawar, L.H., Shahzad, T., Almeelbi, T., Ismail, I.M.I., Oves, M., 2016.
Bacteria and fungi can contribute to nutrients bioavailability and aggregate
formation in degraded soils. Microbiol. Res. 183, 26–41.
Rengel, Z., Marschner, P., 2005. Nutrient availability and management in the
rhizosphere: exploiting genotypic differences. New Phytol. 168, 305–312.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425.
Schubert, S., Mengel, K., 1989. Important factors in nutrient availability: Root
morphology and physiology. Zeitschrift für Pflanzenernährung und
Bodenkunde 152, 169–174.
Sharma, S.B., Sayyed, R.Z., Trivedi, M.H., Gobi, T.A., 2013. Phosphate solubilizing
microbes: sustainable approach for managing phosphorus deficiency in
agricultural soils. SpringerPlus 2, 587.
Shiralipour, A., McConnell, D.B., Smith, W.H., 1992. Physical and chemical properties
of soils as affected by municipal solid waste compost application. Biomass
Bioenergy 3, 261–266.
Singh, H., Reddy, M.S., 2011. Effect of inoculation with phosphate solubilizing
fungus on growth and nutrient uptake of wheat and maize plants fertilized with
rock phosphate in alkaline soils. Eur. J. Soil Biol. 47, 30–34.
Smil, V., 2000. Phosphorus in the environment: natural flows and human
interferences. Annu. Rev. Energy Environ. 25, 53–88.
Sogn, T.A., Haugen, L.E., 2011. Predicting mineral N release during decomposition of
organic wastes in soil by use of the SOILN_NO Model. Appl. Environ. Soil Sci. 16.
Souza-Motta, C.M.D., Cavalcanti, M.A.D.Q., Fernandes, M.J.D.S., Lima, D.M.M.,
Nascimento, J.P., Laranjeira, D., 2003. Identification and characterization of
filamentous fungi isolated from the sunflower (Helianthus annus L.)
rhizosphere according to their capacity to hydrolyse inulin. Br. J. Microbiol.
34, 273–280.
Sundberg, C., Jönsson, H., 2008. Higher pH and faster decomposition in biowaste
composting by increased aeration. Waste Manage. 28, 518–526.
Van Kauwenbergh, S.J., 2010. World phosphate rock reserves and resources. IFDC
Muscle Shoals.
Wahid, O., Mehana, T., 2000. Impact of phosphate-solubilizing fungi on the yield
and phosphorus-uptake by wheat and faba bean plants. Microbiol. Res. 155,
221–227.
Zhang, C., Su, H., Baeyens, J., Tan, T., 2014. Reviewing the anaerobic digestion of food
waste for biogas production. Renew. Sustain. Energy Rev. 38, 383–392.
Zhang, N., Pan, R., Shen, Y., Yuan, J., Wang, L., Luo, X., Raza, W., Ling, N., Huang, Q.,
Shen, Q., 2017. Development of a novel bio-organic fertilizer for plant growth
promotion and suppression of rhizome rot in ginger. Biol. Control 114, 97–105.
Zhao, K., Xu, R., Zhang, Y., Tang, H., Zhou, C., Cao, A., Zhao, G., Guo, H., 2017.
Development of a novel compound microbial agent for degradation of kitchen
waste. Br. J. Microbiol. 48, 442–450.