Food & Function: Accepted Manuscript

Food &
View Article Online

View Journal
Function
Linking the chemistry and physics of food with health and nutrition
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: F. Gu, Y. Wu, Y.
Liu, M. Dou, Y. Jiang and H. Liang, Food Funct., 2020, DOI: 10.1039/D0FO00373E.
Volume 9
This is an Accepted Manuscript, which has been through the
Food &
Number 1
January 2018
Pages 1-658
Royal Society of Chemistry peer review process and has been
accepted for publication.
Function
Linking the chemistry and physics of food with health and nutrition Accepted Manuscripts are published online shortly after acceptance,
rsc.li/food-function
before technical editing, formatting and proof reading. Using this free
service, authors can make their results available to the community, in
citable form, before we publish the edited article. We will replace this
Accepted Manuscript with the edited and formatted Advance Article as
soon as it is available.
You can find more information about Accepted Manuscripts in the

Information for Authors.
Please note that technical editing may introduce minor changes to the
text and/or graphics, which may alter content. The journal’s standard
ISSN 2042-650X Terms & Conditions and the Ethical guidelines still apply. In no event
PAPER
Xian Wu, Hang Xiao et al.
A metabolite of nobiletin, 4' -demethylnobiletin and
shall the Royal Society of Chemistry be held responsible for any errors
atorvastatin synergistically inhibits human colon cancer cell
growth by inducing G0/G1 cell cycle arrest and apoptosis
or omissions in this Accepted Manuscript or any consequences arising
from the use of any information it contains.
rsc.li/food-function
Page 1 of 19 Food & Function
Lactobacillus casei improves depression-like behavior in chronic unpredictable mild DOI:

stress- View Article Online
10.1039/D0FO00373E
induced rats by BDNF-TrkB signal pathway and the intestinal microbiota
Fang Gua, Yanyan Wub, Ying Liuc, Mei Doub, Yushan Jiangb, Hui Liangb,*
aCollege of Mechanical and Electronic Engineering, Northwest A&F University, Yangling 712100,
China
bDepartment of Human Nutrition, College of Public Health, Qingdao University, Qingdao 266071,
China
cCollege of Basic Medicine, Qingdao University, Qingdao 266071, China
Food & Function Accepted Manuscript

Published on 08 June 2020. Downloaded by University of Western Ontario on 6/14/2020 6:12:49 PM.
* Corresponding authors. E-mail: qdlianghui@126.com; Tel: +86-532-83812434
1
Food & Function Page 2 of 19
Lactobacillus casei (L. casei), a kind of probiotics, is known as a “healthy triple benefit bacterium” View Article Online
DOI: 10.1039/D0FO00373E
along with Lactobacillus acidophilus and Bifidobacterium. L. casei is associated with the alteration
of the intestinal flora population, and the gut microbiota–brain axis has been demonstrated to
play an important role in many central nervous system diseases. The aim of this study was to
evaluate the effectiveness of L. casei intervention on ameliorating mental disorders and potential
mechanisms using a depression-like rat model induced by chronic unpredictable mild stress
(CUMS). L. casei intervention improved CUMS-induced depression-like behaviors of rats, including
reduced body growth rate, decreased sucrose preference, increased immobility time, lowered
moving distance and velocity. In addition, L. casei intervention amended gut microbiota structure

changes induced by CUMS in rats. Furthermore, L. casei intervention reversed CUMS-induced

protein expression changes of monoamines dopamine, noradrenaline and 5-hydroxytryptamine,
brain-derived neurotrophic factor (BDNF) and its receptor of tyrosine kinase receptor B (TrkB), N-
methyl-D-aspartic acid receptor 1, as well as CUMS-induced activations of ERK1/2 and p38 MAPK
signal pathways. These findings suggested that L. casei could significantly protect against
depression of rats, which was possibly associated with the alterations in the gut microbiota
composition and mediations of BDNF-TrkB signaling.
Key words: Depression-like behavior, Lactobacillus casei, Monoamines; BDNF-TrkB signaling

pathway, intestinal microbiota
2
Introduction View Article Online

DOI: 10.1039/D0FO00373E
Depression, one of the most common psychiatric disorders, is characterized by depressed mood,
low self-esteem, sleep disorder, poor concentration and lack of interest or excitement.1 This
disease has a high lifetime prevalence and recurrence rate, and potentially causes substantial
disability.2 Around 350 million people suffer from depression in the world according to World
Health Organization.3 However, the exact mechanism of depression and antidepressant action are
still hard to illuminate. Most studies were focused on monoamine levels, and antidepressants were
used to reuptake their concentrations, but these drugs had no effects on at least a quarter of
patients and had many side effects.4 Therefore, it is necessary to find new ways of depression

treatment in the future.

The connection between irritable bowel syndrome (IBS) and depression has been reported.5
IBS is considered an exemplary disorder of brain-gut communication highly comorbid with
depression. Accumulating evidence supports a key role of microbiome-gut-brain pathways also in
neuropsychiatric diseases, such as depression.6 IBS patients usually had reduced Lactobacilli,
Bifidobacterium, Coliforms and normal anaerobe/aerobe ratio, and increased aerobes in intestinal
microflora.7 This had attracted many researchers’ interests in studying the interaction of gut
microbial and psychical disorder. Many of probiotics live in a symbiotic relationship as a part of the
normal human gut flora. Probiotics are safe and appear to exert some beneficial effects in
gastrointestinal and non- gastrointestinal medical conditions, such as traveler’s diarrhea, IBS and
atopic dermatitis.8 Brain-derived neurotrophic factor (BDNF) is expressed in the adult mammalian
nervous system, and its expression level changes are implicated in the pathophysiology of
cognitive decline in depression.9 Activation of BDNF by binding its high affinity receptor tyrosine
kinase receptor B (TrkB) plays a critical role in the molecular mechanisms of antidepressants.10
Lactobacillus casei (L. casei) is a species of probiotics most commonly used to treat
gastrointestinal-related illness, however, it is unknown whether L. casei may have some beneficial
effects to depression.
Unpredictable stressors have greater side effects on humans than predictable ones for their
uncertainty.11 Chronic unpredicted mild stress (CUMS) has long been used as a model of
depression inducers by mimicking the stress in human life.12 In this study, rats were selected as
the object to explore the influence of L. casei intervention on depression-like rats induced by CUMS.
Materials and methods

Animal care and use
Five-week-old male Sprague-Dawley rats were purchased from Animal Experimental Center
(Qingdao, Shandong, China). All rats were kept under a 12 h light/dark cycle at a constant
temperature and humidity with ad libitum access to food and water. Rats were allowed to
acclimate to housing conditions for a week prior to further treatments. After acclimation, rats were
treated with CUMS once a day and lasted for 7 weeks. From 4th to 7th week of CUMS, rats were
administrated to L. casei (8×108 CFU/kg/day, Yakult Co. Ltd., Tianjin, China),13 paroxetine (1.8
mg/kg/day, a well-known antidepressant purchased from Beijing Solarbio Science & Technology
Co.,Ltd., Beijing, China), or equal volume of normal saline by gavage 1 h before they were treated
with CUMS, designated L. casei group, positive control group, and CUMS group, respectively. Each
rat treated with CUMS was housed separately. Rats only with gavage administration of normal
saline without CUMS treatment were used as normal control, and every 5 rats were housed
3
together. View Article Online

DOI: 10.1039/D0FO00373E
The CUMS procedure was performed according to previous publication14 with slight
modifications. In brief, rats were exposed to a randomly selected stressor daily consecutive for 7
weeks. The daily stressors include food deprivation, water deprivation, wet bedding, cage tilting,
crowded housing, swimming in 4℃or 40℃ water, squeezing tail, and reversal of the light/dark
(Table 1).
All procedures for animal study were approved by the Animal Care and Use Committee of
Medical College, Qingdao University and followed the institution’s guidelines for the care and use
of laboratory animals.

Evaluation of food consumption and body weight changes

For food consumption evaluation, 50 g food was given to each rat at 6 pm and residual food was
weighted at 6 pm the next day. Food intake = (total food-residue food)/body weight × 100%.
Body weight was recorded weekly and the body weight change was calculated by the formula
(Wn-W0 )/W0 , where Wn is the body weight at the last day of the indicated week, and W0 is the
body weight at the last of day of acclimation.
Sucrose preference test (SPT)

Rats were habituated to drink 1% sucrose solution and the presence of two drinking bottles for 3
days when the rats were allowed to acclimate to housing conditions. At the beginning of the test,
each rat was singly housed and deprived of water and food for 24 h. Then, rats had free access to
one bottle of the 1% sucrose solution and another bottle of tap water. In order to avoid habitual
drinking water, the positions of two bottles were switched daily. Water and sucrose intake was
measured daily by weighting bottles before and after the test. The sucrose preference was
calculated as a percentage of the volume of sucrose intake over the total volume of fluid intake
and averaged over the 1 week testing period. The formula of sucrose preference (%)=sucrose
consumption/(sucrose consumption + plain water consumption) × 100%.
Open field test (OFT)

OFT was performed as described previously.15 A single rat was placed into the center of an
apparatus consisted of a square 40 cm × 40 cm × 40 cm in a dimly illuminated and quiet room for
5 min, and all behavior was record by EthoVisionXT 7 system. The total distance travelled and
the velocity of the rats in an open field test were used as indicators reflecting depressive behavior.
After each test, the box was cleaned using 75% alcohol to avoid influence of the next rat by the
smell of former animal.
Forced swim test (FST)

FST was used to detect the depression-like behavior of the immobility in the forced swim as we
described before.16 In brief, each rat was placed inside a cylinder filled with water. There is a period
of vigorous activity during which the rat tries to escape, followed by a characteristic immobility in
which the rat only moves to maintain its head above water. This physical immobility is used as an
indicator of behavioral despair. The behavior of each rat was recorded using a video camera
(Handycam, Sony, Tokyo, Japan), and the immobility time was measured using SMART V3.0
software (Panlab Harvard Apparatus, Barcelona, Spain) within a test period of 6 min. Due to the
4
fact that FST itself is a kind of strong stress, all rats after the forced swim test at the 0DOI:
th and 3rd View Article Online
10.1039/D0FO00373E
weeks of CUMS modeling were not used in further experiments any more.
Detection of monoamine concentrations in frontal cortex of rat brain

Concentrations of three monoamines dopamine (DA), noradrenaline (NE) and 5-
hydroxytryptamine (5-HT) in frontal cortex were detected by high-performance liquid
chromatography with electrochemical detection (HPLC-ECD). Tissue samples were weighted and
thoroughly homogenated with 0.4 mmol/L HClO4, then the mixture was placed on the ice for an
hour and centrifuged at 12,000× g at 4℃ for 20 min. The supernatant was sufficiently mixed with

buffer (20 mmol/L potassium citrate, 300 mmol/L dipotassium phosphate, and 2 mmol/L
EDTA·2Na) and placed on ice for an hour. The mixture then was centrifuged at 12,000× g at 4℃
for 20 min. Finally, the supernatant was collected and used as the sample solution prior to HPLC-
ECD analysis.
Forty microliter sample solution was automatically injected into a high-performance liquid
chromatographer (Agilent 1260, Santa Clara, CA) equipped with a diode-array detector and
chemstation workstation. A mixture of 20 mmol/L citric acid, 50 mmol/L sodium acetate, 0.134
mmol/L EDTA·2Na·2H2O, 3.75 mmol/L Sodium octyl sulfonate, 1 mmol/L Dibutylamine and 5% (v/v)
methanol was used as a mobile phase. A ZORBAX SB-C18 column (4.6 mm × 250 mm, 5 μm size of
particle) was eluted with the mobile phase at a flow rate of 1 ml/min and at a voltage of 0.65 V.
The column oven temperature was 40 °C. The elution was monitored by absorption at 210 nm. To
construct calibration curves, the three standard substances were dissolved into mobile phase to
prepare standard solutions at a series of concentration gradients 0, 6.25, 12.5, 25, 50, 100, 200,
400, 800 ng/ml.
Western blot
The whole protein was extracted from frontal cortex of rat brain by the Whole Cell Lysis Assay kit
(KGP250, KeyGEN BioTECH, Nanjing, Jiangsu, China) as the manufacture’s instruction. Protein
concentration was measured by Bradford Protein Quantitation Assay (KeyGEN BioTECH). Equal
amounts of protein were separated by 10% SDS-PAGE gel and transferred to PVDF membranes.
The membranes were blocked with 10% non-fat milk and respectively incubated with antibodies
brain-derived neurotrophic factor (BDNF, sc-33904, Santa Cruz Biotechnology, Dallas, TX), N-
methyl-D-aspartic acid receptor 1 (NR1, ab109182, Abcam, Cambridge, UK), Tyrosine Kinase
receptor B (TrkB, OST00128G, ThermoFisher Scientific, Shanghai, China) phosphor-ERK1/2
(bs3016R, Biosynthesis Biotechnology, Beijing, China), ERK1/2 (bs-2637R, Biosynthesis
Biotechnology), Phospho-p38 (KGYP0338-7, KeyGEN BioTECH) and p38MAPK (KG30244-2, KeyGEN
BioTECH,) respectively. After washing, the membranes were then incubated with HRP-conjugated
secondary antibodies. Finally, immunoreactive proteins were visualized with an ECL Western
Blotting Detection System (KeyGEN BioTECH) and a G: BOX chemiXR5 imaging machine.
Fecal DNA extraction and 16S rDNA sequencing

The fecal samples were taken from 6 rats with CUMS treatment, 6 rats with L. casei intervention
before CUMS, and 5 normal control rats, and Fecal DNA was extracted by using TIANamp Stool
DNA Kit (TianGen Biotech, Beijing, China). The differences of intestinal flora among groups were
validated by High-throughput sequencing of 16S rDNA V3-V4 region via Illumina HiSeq 250
5
platform. The 341F/806R primer set (341F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVG GView Article Online
DOI: 10.1039/D0FO00373E
GTWTCTAAT) was used to targeting the V3-V4 region. Principal coordinate analysis and similarities
analysis was performed using QIIME software. The relative abundance at the phylum, class, order,
family and genus levels in intestinal flora was determined by the RDP classifier version 2.2. Linear
discriminant analysis (LDA) and effect size (LEfSe) analyses were performed to determine
differences among groups.
Statistical analysis
Quantitative data were presented as mean ± standard deviation, and statistical analyses were
performed using ANOVA with the Bonferroni post hoc test. The significance of comparisons

between groups for non-parametric and parametric data with abnormal distribution was
determined using the Kruskal–Wallis test, followed by the Mann–Whitney test. (SPSS 11.5, IBM
Corporation, Armonk, NY). P < 0.05 was regarded as statistically significant.
Results
Effects of L. casei on food consumption and body weight gain
Rats in each group were regularly fed on diets, and body weight and food intake were monitored
for 7 weeks. As showed in Fig. 1A, no significant difference was observed in food intake of rats
among all groups during the whole experimental period.
CUMS treatment had no effect on body weight gain of rats from 1st to 3rd week, whereas CUMS-
treated rats exhibited a slight reduction of body weight gain compared to normal control from 4th
to 7th week. On the other hand, both L. casei and paroxetine administration could alleviate CUMS-
induced reduction of body weight gain, suggesting L. casei has a similar effect in maintaining a
healthy body weight gain under CUMS treatment as the antidepressant of paroxetine did (Fig. 1B).
L. casei relieved the depression-like behaviors of rats induced by CUMS

To investigate whether L. casei can improve depression-like behaviors of CUMS-challenged rats,
including decreased sucrose preference, increased immobility time, and lowered moving distance
and velocity, we performed SPT, FST, and OFT, respectively.
Rodents are born with an interest in sweet solution. Reduced preference for sweet solution
in SPT represents anhedonia, while this reduction can be reversed by treatment with
antidepressants, such as paroxetine. Results of SPT showed that a 3-week CUMS treatment
induced a significant decrease of the sucrose consumption in rats compared to normal control. But
administration of L. casei alleviated this reduced sucrose consumption induced by CUMS as the
antidepressant of paroxetine did. No difference was found between L. casei and paroxetine
administration (Fig. 2A).
Immobility induced by forced swimming is well known as an animal model of depression. As
expected, CUMS caused significant increase in immobility time in the FST compared with the levels
of normal control. Administration of L. casei significantly attenuated the increase of the immobility
time of rats induced by CUMS. A similar alleviative effect of in immobility time increase induced
by CUMS was observed in those rats with the paroxetine administration (Fig. 2B).
Furthermore, CUMS-treated rats exhibited a robust decrease in moving distance (Fig. 2C) and
velocity (Fig. 2D) in the OFT, while CUMS-induced decrease of moving distance and velocity were
ameliorated by L. casei administration, and the improvement degree was even higher than that of
paroxetine as positive control. All these data indicated that L. casei had a beneficial effect on
6
CUMS-induced depression-like behaviors of rats. View Article Online

DOI: 10.1039/D0FO00373E
L. casei attenuated CUMS-induced changes of monoamine, BDNF and related proteins in frontal
cortex of rat brain
The concentration of three types of monoamines 5-HT, DA and NE was measured by HPLC-ECD in
frontal cortex. As expected, CUMS treatment significantly reduced the levels of 5-HT (Fig. 3A), DA
(Fig. 3B) and NE (Fig. 3C) in frontal cortex compared to normal control, whereas L. casei or
paroxetine administration reversed CUMS-induced decrease of their levels in frontal cortex.
The protein expressions of BDNF, NR1 and TrkB significantly decreased in frontal cortex of rats

exposed to CUMS, while L. casei or paroxetine intervention prevented the CUMS-induced decrease
of these proteins in frontal cortex (Fig. 3D). In addition, the proteins of ERK1/2 and p38 were
significantly activated in frontal cortex of rats exposed to CUMS, as indicated by elevated
expression levels of phosphorylated ERK1/2 and p38 compared with that in normal control, while
L. casei intervention attenuated these changes induced by CUMS, but the effects of L. casei were
weaker than that of antidepressant of paroxetine (Fig. 3D).
L. casei amended structural changes of the gut microbiota of rats induced by CUMS
To investigate the effects of L. casei on microbiota structure of rats, we performed a high-
throughput sequencing of 16S rDNA V3-V4 region via Illumina HiSeq 250 platform for fecal samples
collected from rats. The alpha diversity analysis was used to evaluate the species distribution of a
single sample. The Chao 1 index and Shannon index were used to evaluate richness and diversity,
respectively. Results showed that both Chao 1 value (Fig .4A) and Shannon value (Fig. 4B) were not
significantly different among all groups, which suggested that gut microbiota abundance and
diversity were comparable in all samples.
Beta diversity analysis was then performed based on a weighted UniFrac analysis. Scores (PC1 =
46.43%, PC2 = 12.91%, PC3 = 9.73%) of principal coordinates analysis (PCoA) based on Weighted
UniFrac Distance clearly separated three groups of normal control, CUMS, and L. casei intervention
group, and the microbiota composition of the CUMS group account for 46.43% of the gut
microbiota profile compared to the normal control and L. casei intervention group, and the
distribution of plots representing samples from L. casei intervention group was closer to that from
normal control group compared with CUMS group (Fig. 4C), and analysis of similarities (ANOSIM)
derived from PCoA scores confirmed a statistically significant separation among all three groups
(Fig. 4D, R = 0.3458, P =0.001).
In addition, LDA coupled LEfSe measurements indicated that the microbial community structure
in CUMS group was different from that in normal control group and L. casei intervention group.
We demonstrated 16 gut bacterial clades with significant differences, among which, the
prevotellaceae was the predominant family in rats with CUMS treatment, which was modified by
L. casei intervention (Fig. 5A). Therefore, the L. casei shifted the structure of CUMS-disrupted gut
microbiota toward that of rats in normal control.
The intestinal flora of rats were mainly divided into 12 phyla, and Bacteroidetes and Firmicutes
were the most abundant phyla in each group (Fig. 5B). Fig. 5B showed that CUMS caused a taxa
abundance increase of intestinal Bacteroidetes from 0.58 to 0.68 and a decrease of Firmicutes from
0.33 to 0.18 compared with the levels of normal control, while administration of L. casei
attenuated these CUMS-induced changes of taxa abundances. It should be pointed out that these
7
change trends were not statistically significant among these three groups (P>0.05). Considering View Article Online
DOI: 10.1039/D0FO00373E
that Bacteroidetes to Firmicutes ratio (B/F ratio) has been extensively examined for human and
mouse gut microbiota, and it has been showed by multiple studies that the B/F ratio is correlated
with some diseases, we therewith calculated the abundance ratio of B/F based on taxa abundances.
B/F ratio was 3.84 in CUMS group, which was higher than that in both normal control and L. casei
intervention group (2.57 and 2.55, respectively, P< 0.05), and no difference was observed between
normal control and L. casei intervention group. Especially, Prevotella, belonging to Prevotellaceae
family and Bacteroidetes phynum, was the predominant bacterial genus in CUMS group with an
abundance of 0.75, but its relative abundance in normal control and L. casei intervention group

was 0.24 and 0.45, respectively (Fig. 5C, left), indicating CUMS induced an increase of Prevotella
abundance in gut microbiota compared with normal control, while L. casei alleviated this
Prevotella abundance increased induced by CUMS. Similarly, L. casei alleviated CUMS-induced
abundance decrease of Blautia and Roseburia, two members of Lachnospiraceae family, Firmicutes
phynum (Fig. 5C, middle and right). These data suggest that L. casei intervention could modify the
dysbacteriosis caused by CUMS and restore the homeostasis of intestinal flora microecology.
Furthermore, we analyzed the correlation between differentially bacteria genera Prevotella,
Blautia, Roseburia and biochemical parameters. The results indicated that the abundances of
Prevotella was negatively correlated with sucrose preference, moving distance and monoamines
levels (p<0.05), while the abundances of Blautia were positively correlated with 5-HT (p<0.05), and
no correlation was found between Roseburia abundance and these examined parameters (Table
2).
Discussion
Depression is a very common mental illness and shows a great psychological and mental burden
for both family and society.17 WHO predicted that depression would be the first leading cause of
death by 2030.18 There has been a growing awareness of that microbiota has an influence on brain
through the communication between gut and brain. Studies on the impact of microbiota on brain
have been carried out through different approaches, including antibiotic use, probiotic treatment,
fecal microbiota transplantation, gastrointestinal infection, and germ free studies, and it proved
that mental health can be influenced by microbiota greatly.19 However, the mechanism has not
been fully elucidated. In this study, depression-like rat models were successfully induced by
exposure to CUMS, as indicated by depression-like behavior, such as reduced body growth rate,
decreased sucrose preference, increased immobility time, and lowered moving distance and
velocity. Notably, L. casei intervention diminished the effect of CUMS on rats as the antidepressant
of paroxetine did, suggesting L. casei might have an antidepressant function.
There is a proportional relationship between depression and anorexia nervosa in patients
reported in a literature,20 but Lazarevich et al. reported that depression is frequently accompanied
by overeating and a preference for certain foods.21 In this study, we did not observe a change in
food consumption of rats under CUMS compared to normal control during the 7-week
experimental period. This finding was consistent with a previous study in which alcohol-induced
depress-like behavior was not always accompanied with food consumption decrease in rats during
a 10-week experimental period.
Deficiency of monoamines has been widely accepted as a main reason of depression. Most
antidepressant drugs worked out by ballooning the accessibility of monoamines. However, drugs
8
targeting to increase monoamines in brain had some limits and showed many side-effects inView Article Online
DOI: 10.1039/D0FO00373E
clinical.22 To address if L. casei affects monoamine secretion, we measured the levels of DA, 5-HT
and NE in frontal cortex. We found that L. casei can elevate monoamines DA, 5-HT and NE in the
frontal cortex of rats, which was similar to the finding in a previous publication.23 Therefore,
administration of L. casei might be a potentially alternative for depression-like behavior treatment
without side-effects because probiotic bacteria such as Lactobacillus are generally regarded as safe
(GRAS) for consumption.24
Mitogen-activated protein kinase (MAPK) is a large protein kinase family and was found to have
a close relationship with neurological disorder.25, 26 ERK1/2 and p38 were the most characterized

proteins in this family. ERK1/2 had a function of regulation neuron by remodeling and plasticity of
synaptic, which can be damaged in depressive animal model.27 The protein of p38 can be simulated
by stressors and regulate central nervous system development and neuroplasticity.28 Chronic
administration of fluoxetine, an inhibition of 5-HT, reduced ERK1/2 phosphorylation in the
hippocampus, frontal cortex and striatum, suggesting that activated ERK1/2 signaling cascade was
more likely to induce depression.29 Based on these findings, ERK1/2 was strongly suggested to
response with antidepressants. We detected that both p38 and pERK1/2 were dramatically
activated by CUMS, which is the similar to previous studies,30 suggesting that ERK1/2 and p38
pathways were involved in the process to promote depression-like behavior. L. casei intervention
inhibited CUMS-induced activation of ERK1/2 and p38 proteins suggesting that MAPK signaling
cascades may play a vital role in the antidepressant effects of L. casei.
BDNF is a major neurotrophic factor that functions in the maintenance and the survival of
neurons.31 TrkB plays a vital role in depression and antidepressant responses.32 BDNF-TrkB
signaling through Erk1/2 phosphorylation mediates the enhancement of fear memory of mice and
rats.33 We observed that both BDNF and TrkB in brain were reduced under CUMS treatment, which
is consistent with the findings in other depression studies.22, 34 The expression levels were
increased after administration of L. casei, indicating that L. casei treatment may activate ERK1/2
via BDNF-TrkB signaling.
NMDA attracted extensive attention for their crucial role in psychiatric disorders as well as its
pharmacological treatments.35, 36 The subunits of NMDA receptors(NR), NR1 and NR2 were
reduced in the hippocampus of prenatally stressed juvenile offspring rats that showed depression-
like behavior.37 Prebiotic feeding can increase the expression level of NR1 subunit in the dentate
gyrus of the hippocampus.38 A link between NR and phosphorylation of p38 MAPK has been
reported in murine primary neurons.39 Here, we found that NR1 expression decreased in frontal
cortex of rats exposed to CUMS, while phosphorylated p38 expression was enhanced. L. casei
intervention can reverse these changes, suggesting that p38 might be closely related to NR1, but
mechanism is still unknown, and further research is needed to be done.
It has been reported that gut microbiota plays a causal role in the development of features
of depression.16, 40 Firmicutes and bacteroidetes are two major phyla of the domain bacteria and
dominant in human and mouse gut microbiota, and the B/F ratio has been extensively examined
for diseases.39, 41 Indeed, we found that CUMS altered the composition of intestinal microbiota of
rats, which mainly manifested in the structural imbalance of the gram-negative bacteria led by
Bacteroidetes and the gram-positive bacteria represented by Firmicutes, and the changes in
abundance of several bacterial genus, such as Prevotella, Blautia and Roseburia. It is noteworthy
that the abundance of Prevotella was considered a potential characteristic parameters for major
9
depressive disorder.42 Alterations of Blautia and Roseburia in the gut have been reported inView Article Online
DOI: 10.1039/D0FO00373E
neurological and psychiatric disorders.43 The results of this study indicated that Prevotella is
positively correlated with the depression-like behavior, while the abundance of Blautia and
Roseburia significantly decreased when rats were exposed to CUMS, and CUMS-induced the
abundance changes of all these three genera were alleviated by L. casei intervention. In all, the
novel findings of this study is that intestinal microbiota composition changes induced by CUMS
can be ameliorated by L. casei intervention, indicating that L. casei supplementation could improve
the dysbacteriosis caused by depression and restore the homeostasis of intestinal flora
microecology.

Conclusion
In summary, our findings demonstrated that CUMS-induced depression-like behaviors in rats could
be beneficially ameliorated by L. casei intervention, which was possibly through the up-regulation
of expression levels of monoamines 5-HT, DA and NE, activation of BDNF-TrkB signaling, inhibition
of phosphorylation of EKR1/2 and P38 in frontal cortex, and amending structural changes of the
intestinal microbiota of rats. These findings might provide a foundation for the development of
novel strategies for the prevention and treatment of depression.
Conflict of interest
There are no conflicts of interest to declare.
Acknowledgements
We really appreciate the financial aid of National Natural Science Foundation of China (grant
number: 81872605).
Notes and references

1 S. Hyman, D. Chisholm, R. Kessler, V. Patel and H. Whiteford, Disease Control Priorities in
Developing Countries, Oxford University Press, Washington (DC), 2nd edn, 2006.
2 S. H. Zhu, R. L. Shi, J. H. Wang, J. F. Wang and X. M. Li, Neuroreport, 2014, 25, 1151-1155.
3 K. Smith, Nature, 2014, 515, 181.
4 D. J. Kupfer, E. Frank and M. L. Phillips, Lancet, 2012, 379, 1045-1055.
5 P. Fitzgerald, M. Cassidy Eugene, G. Clarke, P. Scully, S. Barry, M. M. Quigley Eamonn, F.
Shanahan, J. Cryan and G. Dinan Timothy, Neurogastroenterol. Motil., 2008, 20, 1291-1297.
6 A. Icenhour, S. Tapper, O. Bednarska, S. T. Witt, A. Tisell, P. Lundberg, S. Elsenbruch and S.
Walter, Sci. Rep., 2019, 9, 13590.
7 A. C. Logan and M. Katzman, Med. Hypotheses, 2005, 64, 533-538.
8 S. U. Islam, Medicine (Baltimore), 2016, 95, e2658.
9 J. R. Kelly, Y. Borre, C. O'Brien, E. Patterson, S. El. Aidy, J. Deane, P. J. Kennedy, S. Beers, K.
Scott, G. Moloney, A. E. Hoban, L. Scott, P. Fitzgerald, P. Ross, C. Stanton, G. Clarke, J. F. Cryan
and T. G. Dinan, J. psychiatr. res., 2016, 82, 109-118.
10 T. X. Yan, B. S. He, S. T. Wan, M. J. Xu, H. L. Yang, F. Xiao, K. S. Bi and Y. Jia, Sci. Rep., 2017, 7,
6903.
11 C. O. Bondi, G. Rodriguez, G. G. Gould, A. Frazer and D. A. Morilak, Neuropsychopharmacology,
2008, 33, 320-331.
10
12 R. J. Katz, K. A. Roth and B. J. Carroll, Neurosci. Biobehav. Rev., 1981, 5, 247-251. DOI: 10.1039/D0FO00373E
View Article Online
13 G. L. Mi, L. Zhao, D. D. Qiao, W. Q. Kang, M. Q. Tang and J. K. Xu, Antonie Van Leeuwenhoek,
2015, 107, 1547-1553.
14 P. Willner, A. Towell, D. Sampson, S. Sophokleous and R. Muscat, Psychopharmacology, 1987,
93, 358-364.
15 J. C. B. Sáenz, O. R. Villagra and J. F. Trías, Behav. brain res., 2006, 169, 57-65.
16 Y. S. Jiang, Y. Liu, M. Q. Gao, M. L. Xue, Z. L. Wang and H. Liang, Food Funct., 2020, 11, 378-
391.
17 E. Hedman, E. Andersson, B. Ljótsson, G. Andersson, C. Rück and N. Lindefors, Behav. res. ther.,

2011, 49, 729-736.

18 J. S. Tian, B. Y. Shi, H. Xiang, S. Gao, X. M. Qin and G. H. Du, PLoS One, 2013, 8, e75721.
19 T. G. Dinan and J. F. Cryan, Neurogastroenterol. Motil., 2013, 25, 713-719.
20 K. K. Miller, T. L. Wexler, A. M. Zha, E. A. Lawson, E. M. Meenaghan, M. Misra, A. B. Binstock,
D. B. Herzog and A. Klibanski, J. Clin. Psychiatry, 2007, 68, 959-965.
21 I. Lazarevich, M. E. I. Camacho, M. C. Velazquez-Alva, N. L. Flores, O. N. Medina and M. A. Z.
Zepeda, Nutr. Hosp., 2018, 35, 620-626.
22 Y. Chen, J. Liu, X. T. Wu and E. C. Nice, Evid. Based Complement. Alternat. Med., 2013, 2013,
309262.
23 W. H. Liu, H. L. Chuang, Y. T. Huang, C. C. Wu, G. T. Chou, S. Wang and Y. C. Tsai, Behav. brain
res., 2016, 298, 202-209.
24 M. T. Liong and N. P. Shah, J. Dairy Sci., 2006, 89, 1390-1399.
25 M. Cargnello and P. P. Roux, Microbiol. Mol. Biol. Rev., 2011, 75, 50-83.
26 G. Borges, E. Berrocoso, J. A. Mico and F. Neto, Prog. Neuropsychopharmacol. Biol. Psychiatry,
2015, 60, 77-92.
27 T. M. Sanderson, E. L. Hogg, G. L. Collingridge and S. A. L. Corrêa, J. Neurochem., 2016, 139
Suppl 2, 200-214.
28 A. P. Costa, M. W. Lopes, D. K. Rieger, S. G. R. Barbosa, F. M. Gonçalves, J. C. Xikota, R. Walz
and R. B. Leal, Neurochem. Res., 2016, 41, 1160-1169.
29 F. Fumagalli, R. Molteni, F. Calabrese, A. Frasca, G. Racagni and M. A. Riva, J. Neurochem.,
2005, 93, 1551-1560.
30 C. Todorovic, T. Sherrin, M. Pitts, C. Hippel, M. Rayner and J. Spiess,
Neuropsychopharmacology, 2009, 34, 1416-1426.
31 G. Y. Choi, H. B. Kim, E. S. Hwang, S. Lee, M. J. Kim, J. Y. Choi, S. O. Lee, S. S. Kim and J. H. Park,
Mediators Inflamm., 2017, 2017, 6280925.
32 H. Koike, K. Fukumoto, M. Iijima and S. Chaki, Behav. Brain Res., 2013, 238, 48-52.
33 J. M. Revest, A. L. Roux, V. Roullot-Lacarriere, N. Kaouane, M. Vallee, F. Kasanetz, F. Rouge-
Pont, F. Tronche, A. Desmedt and P. V. Piazza, Mol. Psychiatry, 2014, 19, 1001-1009.
34 O. Aydemir, A. Deveci and F. Taneli, Prog. Neuropsychopharmacol. Biol. Psychiatry, 2005, 29,
261-265.
35 A. Kumar, Front. Neurosci., 2015, 9, 473.
36 K. L. Strong, Y. Jing, A. R. Prosser, S. F. Traynelis and D. C. Liotta, Expert Opin. Ther. Pat., 2014,
24, 1349-1366.
37 H. L. Sun, L. X. Guan, Z. L. Zhu and H. Li, PLoS One, 2013, 8, e81775.
38 H. M. Savignac, G. Corona, H. Mills, L. Chen, J. P. E. Spencer, G. Tzortzis and P. W. J. Burnet,
11
Neurochem. Int., 2013, 63, 756-764. View Article Online

DOI: 10.1039/D0FO00373E
39 R. E. Ley, F. Bäckhed, P. Turnbaugh, C. A. Lozupone, R. D. Knight and J. I. Gordon, Proc. Natl.
Acad. Sci. U. S. A., 2005, 102, 11070-11075.
40 J. R. Kelly, Y. Borre, C. O'. Brien, E. Patterson, S. El. Aidy, J. Deane, P. J. Kennedy, S. Beers, K.
Scott, G. Moloney, A. E. Hoban, L. Scott, P. Fitzgerald, P. Ross, C. Stanton, G. Clarke, J. F. Cryan
and T. G. Dinan, J. Psychiatr. Res., 2016, 82, 109-118.
41 R. E. Ley, P. J. Turnbaugh, S. Klein and J. I. Gordon, nature, 2006, 444, 1022-1023.
42 P. Lin, B. Y. Ding, C. Y. Feng, S. W. Yin, T. Zhang, X. Qi, H. Y. Lv, X. K. Guo, K. Dong, Y. Z. Zhu and
Q. T. Li, J. Affect. Disord., 2017, 207, 300-304.

43 T. C. Fung, C. A. Olson and E. Y. Hsiao, Nat. Neurosci., 2017, 20, 145-155.
Table 1. Schedule of CUMS procedures
Stressors Day of CUMS procedures
Food deprivation for 24 h 13 19 24 33 38

Water deprivation for 24 h 4 10 17 32 41 44
Wet bedding for 24 h 1 5 14 29 39 47
Cage tilting 45 degree for 24 h 11 23 26 34 40
Crowded housing for 24 h 2 20 28 35 48
Swimming in 4℃ water for 5 min 3 6 12 15 25 42
Swimming in 40℃ water for 5 min 8 16 21 30 45
Day and night upside-down for 24 h 18 27 31 37 46
Squeezing tail for 2 min 7 9 22 36 43 49
Table 2. Correlation between differentially bacteria genus and biochemical parameters

Prevotella Blautia Roseburia
Genera
r p r p r p
Body weight -0.41 0.10 0.33 0.19 0.08 0.77
Food consumption -0.08 0.76 0.02 0.93 -0.19 0.45
Sucrose preference
-0.57 0.02 0.35 0.16 0.07 0.78
Percentage
Moving distance -0.51 0.04 0.35 0.16 0.31 0.22
Moving velocity -0.40 0.11 0.25 0.34 -0.03 0.92
DA -0.68 0.01 0.37 0.14 0.12 0.65
5-HT -0.52 0.03 0.52 0.03 0.32 0.22
NE -0.55 0.02 0.28 0.28 0.24 0.36
Note: r: correlation coefficient; p: probability, significant correlations (P< 0.05) are in bold.
12
View Article Online

DOI: 10.1039/D0FO00373E
Figure legends
Fig. 1 Food consumption and body weight changes of rats with different treatments within 7
weeks. (A) The body weight changes of rats. No difference was observed among all groups. (B)
The food consumption ratio in rats. *p<0.05, CUMS group vs. normal control; △p<0.05, L. casei
+CUMS group vs. CUMS group.
Fig. 2 L. casei relieved the depression-like behaviors of rats induced by CUMS. (A) Anhedonia was

assessed in the sucrose preference test. Sucrose preference was reduced with CUMS, while L.
casei increased sucrose preference. (B) Immobility time of rats was evaluated in forced swim
test. Immobility time was increased after CUMS exposure, whereas L.casei intervention
decreased time spent immobile. (C and D) The moving distance and velocity of rats were
evaluated in open field test. Moving distance and velocity was decreased after CUMS exposure,
whereas L.casei intervention alleviated these changes, *p<0.05.
Fig. 3 L. casei attenuated CUMS-induced changes of monoamines and some certain proteins in
frontal cortex of rats. (A) The 5-hydroxytryptamine (5-HT), (B) dopamine (DA), and (C)
noradrenaline (NE) levels in frontal cortex in rats examined by high-performance liquid
chromatography with electrochemical detection, *p<0.05. (D) Protein expression levels and
statistic analysis data of brain-derived neurotrophic factor (BDNF), N-methyl-D-aspartic acid
receptor 1 (NR1), Tyrosine Kinase receptor B (TrkB), phospho-ERK, total-ERK, phospho-p38, and
total-p38 l in frontal cortex of rats examined by western blot.
Fig. 4 Diversity analysis of the gut microbiota. (A) Chao 1 index was used to measure richness. The
significance of comparisons between groups was determined using the Kruskal–Wallis test. P>0.05.
(B) Shannon index was used to estimate diversity. The significance of comparisons between groups
was determined using the Kruskal–Wallis test. P>0.05 (C) Principal coordinates analysis (PCoA) of
Weighted Unifrac distances of microbial communities. Each point represents the fecal microbiota
of a rat. (D) Analysis of similarities (ANOSIM) derived from PCoA scores. When an R-value is over
that 0, it indicates a significant difference in the inter-group population compared with the intra-
group population. A P-Value <0.05 indicate a significantly different level between groups. NS
indicates that the inter-group differences were not statistically significant.
Fig. 5 L. casei amended structural changes of the gut microbiota of rats induced by CUMS. (A)
Taxonomic cladogram generated by LEfSe analysis illustrating significant shifts in the gut
microbiota of rat in all groups. Bacteroidetes and Firmicutes were the most abundant under phyla
level in each group, but the composition was different. (B) Scatter plot describing the taxa
abundance of 12 key phyla across all groups. (C) The graph of box & wiisers showing relative
abundance of three key bacterial genera prevotella, roseburia and blautia in each group. *p<0.05.
13
View Article Online
DOI: 10.1039/D0FO00373E

Food consumption and body weight changes of rats with different treatments within 7 weeks. (A) The body
weight changes of rats. No difference was observed among all groups. (B) The food consumption ratio in
rats. *p<0.05, CUMS group vs. normal control; △p<0.05, L. casei +CUMS group vs. CUMS group.
81x70mm (300 x 300 DPI)

View Article Online
DOI: 10.1039/D0FO00373E

L. casei relieved the depression-like behaviors of rats induced by CUMS. (A) Anhedonia was assessed in the
sucrose preference test. Sucrose preference was reduced with CUMS, while L. casei increased sucrose
preference. (B) Immobility time of rats was evaluated in forced swim test. Immobility time was increased
after CUMS exposure, whereas L.casei intervention decreased time spent immobile. (C and D) The moving
distance and velocity of rats were evaluated in open field test. Moving distance and velocity was decreased
after CUMS exposure, whereas L.casei intervention alleviated these changes, *p<0.05.
159x91mm (300 x 300 DPI)

View Article Online
DOI: 10.1039/D0FO00373E

L. casei attenuated CUMS-induced changes of monoamines and some certain proteins in frontal cortex of
rats. (A) The 5-hydroxytryptamine (5-HT), (B) dopamine (DA), and (C) noradrenaline (NE) levels in frontal
cortex in rats examined by high-performance liquid chromatography with electrochemical detection,
*p<0.05. (D) Protein expression levels and statistic analysis data of brain-derived neurotrophic factor
(BDNF), N-methyl-D-aspartic acid receptor 1 (NR1), Tyrosine Kinase receptor B (TrkB), phospho-ERK, total-
ERK, phospho-p38, and total-p38 l in frontal cortex of rats examined by western blot.
129x129mm (300 x 300 DPI)

View Article Online
DOI: 10.1039/D0FO00373E

Diversity analysis of the gut microbiota. (A) Chao 1 index was used to measure richness. The significance of
comparisons between groups was determined using the Kruskal–Wallis test. P>0.05. (B) Shannon index was
used to estimate diversity. The significance of comparisons between groups was determined using the
Kruskal–Wallis test. P>0.05 (C) Principal coordinates analysis (PCoA) of Weighted Unifrac distances of
microbial communities. Each point represents the fecal microbiota of a rat. (D) Analysis of similarities
(ANOSIM) derived from PCoA scores. When an R-value is over that 0, it indicates a significant difference in
the inter-group population compared with the intra-group population. A P-Value <0.05 indicate a
significantly different level between groups. NS indicates that the inter-group differences were not
statistically significant.
129x110mm (300 x 300 DPI)

View Article Online
DOI: 10.1039/D0FO00373E

L. casei amended structural changes of the gut microbiota of rats induced by CUMS. (A) Taxonomic
cladogram generated by LEfSe analysis illustrating significant shifts in the gut microbiota of rat in all groups.
Bacteroidetes and Firmicutes were the most abundant under phyla level in each group, but the composition
was different. (B) Scatter plot describing the taxa abundance of 12 key phyla across all groups. (C) The
graph of box & wiisers showing relative abundance of three key bacterial genera prevotella, roseburia and
blautia in each group. *p<0.05.
149x214mm (300 x 300 DPI)

Page 19 of 19
Food & Function
54x38mm (300 x 300 DPI)

DOI: 10.1039/D0FO00373E
View Article Online

Food & Function: Accepted Manuscript

Uploaded by

Copyright:

Available Formats

You might also like

Food & Function: Accepted Manuscript

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Food & Function: Accepted Manuscript

Uploaded by

Copyright:

Available Formats

Food &

View Article Online

You can find more information about Accepted Manuscripts in the

Lactobacillus casei improves depression-like behavior in chronic unpredictable mild DOI:

Food & Function Accepted Manuscript

* Corresponding authors. E-mail: qdlianghui@126.com; Tel: +86-532-83812434

Food & Function Accepted Manuscript

changes induced by CUMS in rats. Furthermore, L. casei intervention reversed CUMS-induced

Key words: Depression-like behavior, Lactobacillus casei, Monoamines; BDNF-TrkB signaling

Introduction View Article Online

Food & Function Accepted Manuscript

treatment in the future.

Materials and methods

together. View Article Online

Food & Function Accepted Manuscript

Evaluation of food consumption and body weight changes

Sucrose preference test (SPT)

Open field test (OFT)

Forced swim test (FST)

Detection of monoamine concentrations in frontal cortex of rat brain

Food & Function Accepted Manuscript

Fecal DNA extraction and 16S rDNA sequencing

Food & Function Accepted Manuscript

L. casei relieved the depression-like behaviors of rats induced by CUMS

CUMS-induced depression-like behaviors of rats. View Article Online

Food & Function Accepted Manuscript

Food & Function Accepted Manuscript

Food & Function Accepted Manuscript

Food & Function Accepted Manuscript

Notes and references

Food & Function Accepted Manuscript

2011, 49, 729-736.

Neurochem. Int., 2013, 63, 756-764. View Article Online

Food & Function Accepted Manuscript

43 T. C. Fung, C. A. Olson and E. Y. Hsiao, Nat. Neurosci., 2017, 20, 145-155.

Table 1. Schedule of CUMS procedures

Stressors Day of CUMS procedures

Food deprivation for 24 h 13 19 24 33 38

Table 2. Correlation between differentially bacteria genus and biochemical parameters

View Article Online

Food & Function Accepted Manuscript

Food & Function Accepted Manuscript

81x70mm (300 x 300 DPI)

Food & Function Accepted Manuscript

159x91mm (300 x 300 DPI)

Food & Function Accepted Manuscript

129x129mm (300 x 300 DPI)

Food & Function Accepted Manuscript

129x110mm (300 x 300 DPI)

Food & Function Accepted Manuscript

149x214mm (300 x 300 DPI)

54x38mm (300 x 300 DPI)

Food & Function Accepted Manuscript

You might also like