Protein Engineering, Design & Selection vol. 19 no. 12 pp.
537–545, 2006
Published online October 25, 2006 doi:10.1093/protein/gzl041
Emulsifying performance of modular
b-sandwich proteins: the hydrophobic moment
and conformational stability
W.Stuart Annan, Michael Fairhead, Patricia Pereira and
Christopher F.van der Walle1
Department of Pharmaceutical Sciences, University of Strathclyde,
27 Taylor Street, Glasgow, UK
1
To whom correspondence should be addressed.
E-mail: chris.walle@strath.ac.uk
Our understanding of protein emulsifying properties is
largely based on analysis of emulsifiers found in milk
and seed. The 9th–10th type III fibronectin domain pair
retains full biological activity following emulsification–
encapsulation into polyester microspheres, for controlled
delivery, but the conformational criteria determining emul-
sification efficiency (EE) are unknown. Here, we have gen-
erated a series of mutants of this b-sandwich
protein, changing the hydrophobic moment and conforma-
tional stability, to investigate the structure–emulsification
relationship. Predictive modelling of the hydrophobic
moment of b-strands and mutations known to increase con-
formational stability were used to generate the series. The
proteins were tested for their emulsion stability and EE for
oil-in-water mixtures. We show that the stabilization of
emulsions by b-sandwich proteins is best predicted by con-
formational stability during equilibrium denaturation in
ionic surfactant. In contrast, the EE of these proteins is
inversely related to an increase in their surface hydropho-
bicity following unfolding in surfactant. We also describe a
novel b-sandwich emulsifier with strong EE. The require-
ment for interdomain flexibility to achieve maximum emul-
sion stability and EE is also shown. This work increases
our understanding of the mechanisms involved in protein
emulsification and will be of use to the microencapsulation
of proteins into polyester microspheres via emulsion-
extraction protocols.
Keywords: Beta-sandwich/protein/structure/emulsification/
unfolding
Introduction
Protein-stabilized emulsions have been studied extensively
with respect to the properties of milk-proteins and seed-
proteins (Creamer et al., 1998; van der Ven et al., 2001;
Burnett et al., 2002). Emulsions stabilized by proteins are
of great importance to the food industry and are becoming
increasingly important to the pharmaceutical industry; specif-
ically, protein controlled release formulations via emulsion–
encapsulation into polymeric microspheres (Carino et al.,
2000; Egilmez et al., 2000; Robertson et al., 2001). During
emulsification, proteins are generally accepted to adsorb at the
oil/water interface and undergo conformational changes, gen-
erally unfolding (Sah, 1999; van de Weert et al., 2000). These
changes promote hydrophobic and electrostatic interactions
(Dickinson and Matsumura, 1991; Damodaran et al., 1998),
and, where possible, disulphide-mediated polymerization

The Author 2006. Published by Oxford University Press. All rights reserved.
For Permissions, please e-mail: journals.permissions@oxfordjournals.org
(Dickinson and Matsumura, 1991), which are thought to
stabilize the viscoelastic protein film around oil droplets.
Emulsifying proteins studied to date are often composed of
a-helical and/or random coil structure in aqueous solution and
may lose or gain a-helical structure during interfacial
adsorption (Caessens et al., 1999; Burnett et al., 2002). The
interfacial activity of the globular protein myoglobin has been
Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021
shown to be due to alignment of amphipathic a-helices
at the interface (Poon et al., 1999), correlating with the
calculated hydrophobic moment (Poon et al., 2001b). Thus,
secondary structure clearly plays a role in emulsion stability.
b-lactoglobulin provides an example of a b-sheet protein with
emulsifying activity, comprising mainly b-sheet and random
coil but also a-helical structure (Qin et al., 1998). The
structural criteria governing the emulsifying properties of
modular b-sandwich proteins are less clear. Recently, the
modular protein fibronectin (FN), was shown to strongly
adsorb to the oil/water interface, displacing BSA even when at
lower concentrations (Vaidya and Ofoli, 2005). This was
suggested to be a consequence of the flexibility of FN in
solution, afforded by its modular nature and cryptic self-
association sites (Johnson et al., 1999), such that energetically
favourable conformations at the interface were rapidly
adopted. Thus, the emulsifying properties of modular b-sand-
wich proteins depend upon domain–domain interactions in
addition to secondary structure criteria. An understanding
of their mechanism will be of importance to pharmaceutical
formulation via emulsification and polymer encapsulation
(Bouissou et al., 2004; Mordenti et al., 1999).
Here we have used the human fibronectin 9th–10th type III
domain pair (9-10FNIII, Figure 1) as a scaffold on which to
superpose residues bringing about change to the hydrophobic
moment and conformational stability. Starting from a scaffold
whose emulsification properties are uncharacterized may
appear counter-intuitive, but the approach has several attrac-
tions: (i) it will employ and so test current hypotheses of
protein structural criteria for emulsion stability/EE, (ii) the
FN-type III fold is structurally well characterized down to
specific contributions from individual residues (Leahy et al.,
1996; Plaxco et al., 1997; Spitzfaden et al., 1997), and this is of
great potential to the design of recombinant proteins with a
range of specific characteristics aimed at dissecting emulsifica-
tion properties at the structural level and (iii) de-novo design of
emulsifying properties has previously been reported for a
peptidic series (Saito et al., 1995), suggesting that a similar
approach with a protein series is not unfeasible.
The work described uses site-directed mutagenesis to
increase the hydrophobic moment (a measure of amphipathic-
ity) of individual b-strands within each domain. We also
explore the role of domain stability using previously described
9-10
FNIII mutants, which are progressively more stable to
chemical denaturation (van der Walle et al., 2002; Altroff
et al., 2004). We have sought to avoid residues specifically
537
W.S.Annan et al.
aimed at causing hydrophobic surface patches on natively
folded protein, because the emulsifying role of such regions
is well understood (Toren et al., 2002). Similarly, our use of
mutants of distinct conformational stability negates the use of
chemical denaturant to evaluate the emulsification properties
of partially to fully unfolded protein (Poon et al., 2001a).
Structural changes in sodium dodecyl sulphate were used to
acquire data regarding putative conformational changes and
emulsifying properties (or ‘performance’ in the case of empiri-
cal data regarding emulsion stability) in relation to protein
adsorption at the oil/water interface.
Materials and methods
Calculation of the mean hydrophobic moment and mean
hydrophobicityn
9-10
The X-ray crystallographic structure of FNIII shows each
domain having seven b-strands folded in a 3+4 arrangement
into two opposing sheets exposed to solvent to varying extents
(Leahy et al., 1996). For each b-strand the mean hydrophobic
moment, hmHi, and mean hydrophobicity, hHi, was calculated.
Table I shows those b-strands falling outside the ‘surface seek-
ing’ classification described by Eisenberg et al., i.e. a high hmHi
above 0.25 and hHi between 0.3 and
0.3 (Eisenberg et al.,
1982). In order to increase the hydrophobic moment of these
b-strands, amino acid substitutions were designed to increase
hmHi, which should accordingly produce proteins with increas-
ing surface-active potential. As shown in Table I, only local-
ized amino acids substitutions were required to bring about
3- to 14-fold increments in hmHi, bringing the b-strands into the
surface-seeking classification. Table II shows the notations
used for the resultant mutants in the following text.
Calculation of solvation energies and surface areas
Models of 9-10FNIII and the 9-10FNIII mutants expressed and
tested were built using the 3D jigsaw comparative modelling
Fig. 1. Ribbon diagram of the 3-dimensional structure of the histidine-tagged
9-10
FNIII recombinant protein (see Theoretical calculations). Beta strands are
shown as grey ribbons. Amino acid substitutions that were used in the study
are shown in black with side chains as stick diagrams (corresponding to bold
text, see Table I).
Table I. Calculation of hydrophobic moment, hmHi, and mean hydrophobicity, hHi, and mutations made to wild-type b-strands outside the surface
seeking classification
Wild-type b-strand (position) Mutated b-strand
R1371EDRVP (C0 , 9FNIII) I1371EIRVP
Y1393VVSIVALN (F, 9FNIII) Y1393VDVSIDLN
L1409IGQQS (G, 9FNIII) L1409QIQAS
R1421DLEVVA (A, 10FNIII) I1421DLEVRV
Y1483TITVYAV (F, 10FNIII) F1483TITVYVR
Calculation of hmHi was made according to the algorithm of (Eisenberg et al. (1982) interpreted in the program ’hmoment’ (European Molecular Biology Open Software
Suite) for b-sheet angles of 180 . Calculation of hHi was made using the hydrophobicity scale for amino acids as determined by Janin (1979) Substituting amino acids
are shown in bold, amino acid numbering and b-strand notation (position) is according to (Leahy et al. (1996); wt, wild-type strand; mut, mutated strand.
538
server (http://www.bmm.icnet.uk/servers/3djigsaw/) (Bates
et al., 2001). The models were refined by minimization and
molecular dynamics using the GROMACS program (Lindahl
et al., 2001). The quality of the models during refinement was
continually assessed using the biotech validation suite for
protein structures (http://biotech.ebi.ac.uk:8400/) (Laskowski
et al., 1996; Pontius et al., 1996). For the refined models, the
solvation energy and conditional hydrophobic accessible
surface area were measured using the program CHASA
(Cooper et al., 2005). Solvation energies were also compared
with calculation by other methods (see Table III), performed
using the solvation module of the Insight II program (Accelrys
Software Inc., Cambridge, UK).
Construction of cDNA clones
The 9-10FNIII wild-type cDNA cloned into pRSET-a was
Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021
received as a generous gift from Prof. H. Mardon, University
of Oxford. Mutation of the 9-10FNIII cDNA template as
directed by the amino acid substitutions described in Table I
was made following the Quickchange protocol (Stratagene,
Amsterdam, The Netherlands). The constructs 9-10FNIII-P and
9-10
FNIII-CC were created as previously described (Altroff
et al., 2004; van der Walle et al., 2002). Table I also shows
those constructs with increasing hydrophobic moment, created
in similar fashion using appropriately designed primer
pairs (Invitrogen, Paisley, UK). Showing only the sense strand,
9-10
FNIII-IEI was achieved using 50 -CACTTCAGTGGGA-
GACCTATAGAAATTCGGGTGCCCCACTCTCGG, and
9-10
FNIII-IDLEVRV was achieved in two stages using 50 -
CAGTTTCTGATGTTCCGATTGACCTGGAAGTTGTTGC
and then 50 -CCGATTGACCTGGAAGTTCGTGTTGCGAC-
CCCCACCAGCC (mutations underlined).
Expression and purification of recombinant proteins
Polyhistidine-tagged 9-10FNIII and mutants were expressed in
Escherichia coli BLR (DE3) pLysS and purified from the
cell soluble fraction using metal chelation affinity chro-
matography as previously described (Altroff et al., 2001).
Eluted protein fractions were desalted into 10 mM NaH2PO4,
50 mM NaCl pH 7 (’phosphate buffer’) and concentrated to
between 1 and 10 mg/ml. Purity was assessed by SDS–PAGE
and size exclusion chromatography using a calibrated
Superdex 75 HR 10/30 column (Amersham Biosciences);
the column was equilibrated in phosphate buffer and proteins
eluted under a flow of 0.5 ml/min, monitoring the eluate at
280 nm. Protein concentrations were calculated using the A280
value and a calculated extinction coefficient (e) of
21 620 M
1cm
1.
hmHi, wt hmHi, mut hHi, wt hHi, mut
0.133 1.165
3.8
0.4
0.053 0.789 2.3 0.3
0.057 0.823 0.0 0.1
0.113 1.253
0.7
0.2
0.262 0.887 1.0 0.2
 Emulsifying performance of modular b-sandwich proteins

Measurement of emulsion performance
The turbidimetric method of Pearce and Kinsella (1978) was
used to determine the emulsion activity index (EAI) (Pearce
and Kinsella, 1978). Proteins were diluted into phosphate
buffer to give final concentrations of 1.0 mg/ml and 1 ml added
to 0.2 ml of peanut oil and homogenized (30 s, 14 000 rpm,
IKA T18 homogenizer with a S18N 10G dispersing tool). The
emulsion was immediately diluted 100-fold into 0.1% w/v SDS
solution in phosphate buffer and the absorbance measured at
500 nm. The EAI = (2 · 2.303 · A500)/(j.C), where j = the oil
volume fraction and C = % w/v protein. Measurements were
repeated in triplicate for independently prepared samples.
The method of van der Ven et al. (2001) was used to make
quantitative measurements of EE. Emulsions were prepared by
homogenization as above and diluted into 50 ml phosphate
regular intervals up to 2 weeks, measuring the height of the
separated, coalesced oil phase relative to the height of the
remaining emulsion. The ESI was calculated as the percentage
ratio of the emulsion height to the sum of the emulsion height
plus the height of separated oil phase. The ESI value, therefore,
represents the strength of the emulsion surface. Measurements
were repeated in quadruplicate for independently prepared
samples.
Chemical denaturation and fluorescence measurement
Equilibrium unfolding experiments in guanidine.HCl (GuHCl)
were performed for the proteins as previously described
(Altroff et al., 2001), following the method of Pace and Scholtz
(1997) for the calculation of the Gibbs free energy (DG)
between the folded and unfolded states, extrapolated to 0 M

Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021

buffer within a stirred (2000 rpm) small volume sample dis- GuHCl to obtain the conformational stability of the protein,
persion unit (Malvern, UK). Oil droplet size was then mea- DG(H2O). Briefly, proteins samples were diluted in GuHCl and
sured by laser diffraction using Mie scattering theory with a fluorescence measured on a Perkin Elmer 50B spectrofluo-
laser obscurity 12% until little further change was observed rimeter, at 25 C (lex 290 nm, lem 350 6 3 nm). All fluo-
(Mastersizer 2000, Malvern Instruments, UK). The curves rescence measurements were repeated at least in duplicate for
shown represent the change in the median diameter, d(0.5), of independently prepared samples.
the oil droplets with time. Reduction of 9-10FNIII-CC was Equilibrium unfolding experiments in SDS were performed
achieved by addition of 20 mM dithiothreitol (DTT) prior to for the proteins incubated in 0 to 3 mM SDS in phosphate
homogenization. The EE (%) was calculated as the percentage buffer. The accepted critical micelle concentration (CMC) of
difference in droplet size at 75 min with respect to the droplet SDS in 50 mM NaCl is 3.8 mM. The phosphate buffer used
size at 5 min (immediately after equilibration following here contained 50 mM NaCl and 10 mM phosphate; using
dilution); negative values, therefore, indicating stronger EE microcalorimetry, measurement of the CMC was made by
than positive values. Measurements were repeated at least in repeated 10 ml injections of 50 mM SDS into 1.4 ml phosphate
duplicate for independently prepared samples. buffer (MicroCal VP-ITC, CA, USA) and gave a value of
The method of Willumsen and Karlson was used to calculate 2.5 mM. Unfolding of the recombinant proteins in increasing
the emulsion stability index (ESI) (Willumsen and Karlson, concentrations of SDS was followed for step-wise additions of
1997). Proteins were diluted appropriately into 6 ml phosphate 15 ml of 50 mM SDS into 0.2 mg/ml protein solution in phos-
buffer and 0.6 ml peanut oil added to give final protein phate buffer. Samples were allowed to equilibrate and run as
concentrations of 300, 150, 37.5 and 18.75 mg/ml, and described for unfolding in GuHCl.
emulsions prepared as above. Sedimentation and oil droplet Unfolding of the recombinant proteins in SDS over time was
coalescence (creaming) were assessed by visual inspection at monitored for addition of 0.6 mM SDS (final concentration) to
0.25 mg/ml protein solution in phosphate buffer, immediately
monitoring the change in fluorescence until no further change
Table II. Notations used for mutant 9-10
FNIII constructs (single letter was observed (around 60 min; lex, 290 nm; lem 350 nm). The
amino acid code) surface hydrophobicity of natively folded protein and SDS-
9 10
unfolded protein, following incubation in 0.6 mM SDS as
Domain FNIII FNIII Mutant above, was measured by step-wise addition of 8-anilino-1-
Substitutions P for L1408 9-10
FNIII-P naphthalenesulfonic acid ammonium salt (ANS) (Sigma,
P for L1408 and C for V1442 9-10
FNIII-CC Dorset, UK). To 2 ml of 0.1mg/ml (5 mM) protein solution,
C for A1340 15 · 5 ml additions, then 1 · 25 ml addition of 5 mM ANS, were
I1421DLEVRV for 9-10
FNIII-IDLEVRV made (0–240 mM), monitoring the change in fluorescence
R1421DLEVVA
I1371EIRVP for 9-10
FNIII-IEI using lex 350 nm and lem 490 nm. Analysis of data was
R1371EDRVP made as previously described with modification (Moro
et al., 2001). Briefly, fluorescence readings were adjusted

9-10
Table III. Calculated solvation free energies and conditional hydrophobic accessible surface area (CHASA) for FNIII and mutants

Protein (Ooi et al., 1987) (Vila et al., 1991) (Wesson and (Cooper et al., 2005) CHASA
(kcal/mol) (kcal/mol) Eisenberg, 1992) (kcal/mol) (Cooper et al., 2005)
(kcal/mol) (Å2)
9-10
FNIII
246
333
589
185 5321
9-10
FNIII-IDLEVRV
227
262
563
171 5461
9-10
FNIII-IEI
247
293
577
165 5659
9-10
FNIII-P
226
276
559
165 5439
9-10
FNIII-CC
241
281
591
194 5638
Average 6 SD
237 6 10
289 6 27
576 6 15
175 6 13 5503 6 142

539
W.S.Annan et al.
such that 240 mM ANS gave a reading of 1. The maximum
fluorescence value for the protein sample (Fmax), found at
saturating ANS concentrations, is a function of the number
of ANS binding sites per protein molecule. The ANS concen-
tration at half Fmax is equal to the apparent dissociation con-
stant of the protein–ANS complex (Kd), with the Fmax/Kd ratio
being the protein surface hydrophobicity index (PSH), the
higher the index the more hydrophobic the protein surface.
Results
Domain surface hydrophobicity is not perturbed by
IDLEVRV/IEI mutations
In creating the 9-10FNIII-IEI and 9-10FNIII-IDLEVRV mutants
the aim was to increase the hydrophobic moment of 9FNIII and
10
FNIII, respectively, rather than patching a hydrophobic
surface to 9-10FNIII. Of the five b-strands in 9-10FNIII falling
outside the surface seeking classification (Eisenberg et al.,
1982) (Table I), only the IDLEVRV and IEI mutations
proved compatible with the expression system. The calculated
expression levels of the purified recombinant proteins were as
follows (units, mg/l culture): 9-10FNIII, 10; 9-10FNIII-
IDLEVRV, 3; 9-10FNIII-IEI, 19; 9-10FNIII-CC, 12; 9-10FNIII-P,
20. The purification of all mutants and 9-10FNIII proceeded to
homogeneity and ran as a single peak on size-exclusion
chromatography with elution times matching the internal
9-10
FNIII standard (Figure 2).
Change to the surface hydrophobicity of natively folded
proteins was measured experimentally by ANS titration and
theoretically by molecular modelling. For 9-10FNIII and all
mutants tested, titration of ANS into protein solution was
indistinguishable from titration of ANS into phosphate buffer.
Since the proteins in aqueous solution did not interact with
ANS this suggested that the mutations made negligible change
to surface hydrophobicity; 9-10FNIII-IDLEVRV and 9-10FNIII-
IEI mutations, therefore, selectively conferred increased
hydrophobic moment as intended. These fluorescence data
were supported by calculation of the solvation energies of
Fig. 2. (A) Coomassie stained SDS–PAGE analysis of the expression
and purification of recombinant 9-10FNIII and mutant 9-10FNIII proteins
from E.coli lysates. The asterisk denotes the position of recombinant 9-10FNIII
proteins. Lanes are marked as follows: M, molecular weight markers
(size in kDa shown on the left); 1, 9-10FNIII; 2, 9-10FNIII-P; 3, 9-10FNIII-CC;
4, 9-10FNIII-IDLEVRV; 5, 9-10FNIII-IEI. (B) Size exclusion chromatography
elution profile for 9-10FNIII-P stock solution, eluate monitored at 280 nm.
540
the proteins. Comparison across the data generated by all the
modelling protocols used showed that the solvation energies
for the proteins did not differ substantially from one another
(Table III). A slight increase to the conditional hydrophobic
accessible surface area for 9-10FNIII-IEI and 9-10FNIII-CC
was observed. This is probably due to the two isoleucine
substitutions in 9-10FNIII-IEI and formation of the cystine upon
disulphide oxidation in 9-10FNIII-CC. (The conditional
hydrophobic accessible surface area takes into account sol-
vation of neighbouring polar atoms and is more sensitive to
hydrophobicity than conditional accessible surface area
calculations (Cooper et al., 2005).
Emulsion stability is dominated by conformational stability
The mutants 9-10FNIII-CC and 9-10FNIII-P have previously
Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021
been demonstrated to remain natively folded in solution, the
disulphide bridge altering interdomain tilt angle (Altroff et al.,
2004). The two-step unfolding curves for 9-10FNIII-IDLEVRV
and 9-10FNIII-IEI in GuHCl are in good agreement with these
previous studies (Figure 3) (van der Walle et al., 2002); a large
difference in 9FNIII and 10FNIII thermodynamic stability
being observed (Table IV). It is reasonable then to believe
that the mutants, like 9-10FNIII, maintained their modular
nature.
Unfolding of the wild-type and mutant domain pairs in SDS
occurred over one transition (Figure 4) and was, therefore,
modelled as a two-state process (Table IV). Unfolding in
SDS was clearly more dependent on concentration compared
with unfolding in GuHCl: values for m being an order of three
greater (the denaturant concentration at 50% protein unfolding,
[SDS]1/2, being in the mM range). The free energy of 9-10FNIII-
CC unfolding was greater than for the other mutants and
9-10
FNIII. Comparing the equilibrium parameters for the
proteins in SDS to GuHCl showed a somewhat altered trend
for conformational stability of the series. The DG(H2O) values
for 9-10FNIII and 9-10FNIII-P are remarkably similar but m
for the same pair are different (4140 and 2990 kcal/mol/M,
respectively).
Fig. 3. Equilibrium denaturation of 9-10FNIII-IEI (solid up triangles)
and 9-10FNIII-IDLEVRV (empty down triangles) in GuHCl followed by
Trp fluorescence. The two transition regions relate to the initial unfolding
of the 9FIII module followed by the unfolding of 10FIII (Spitzfaden et al.,
1997). INSERT: DG as a function of [GuHCl] for the first denaturation step
for both proteins, and also the second denaturation step for 9-10FNIII-
IDLEVRV (solid down triangles). Linear regression analysis was used
to calculate the slope (m) and y-axis intercept (DG(H2O)), presented in
Table IV.
 Emulsifying performance of modular b-sandwich proteins

9-10
Table IV. Equilibrium denaturation parameters for the FNIII domain pairs

Protein Domain(s) DG(H2O) (kcal/mol) m (kcal/mol/M) [D]1/2 (M) Source

9-10 9
FNIII FNIIIa 4.9 4.3 1.1 van der Walle et al. (2002)
9-10 9
FNIII-P FNIIIa 7.2 2.8 2.6 van der Walle et al. (2002)
9-10 9-10
FNIII-CC FNIIIa,b 11.71 1.41 4.43 Altroff et al. (2004)
9-10 9
FNIII-CC (reduced) FNIIIa 8.25 1.61 3.12 Altroff et al. (2004)
9-10 9
FNIII- IDLEVRV FNIIIa 4.48 2.48 1.81 This study
9-10 9
FNIII- IEI FNIIIa 7.33 3.36 2.18 This study
9-10 10
FNIII FNIIIa 12.6 2.8 4.5 van der Walle et al. (2002)
9-10 10
FNIII- IDLEVRV FNIIIa,c 12.80 2.34 5.47 This study
9-10
FNIII 9-10
FNIIIb 2.78 4140 0.67 · 10
3 This study
9-10
FNIII-P 9-10
FNIIId 2.76 2990 0.92 · 10
3 This study
9-10
FNIII-CC 9-10
FNIIId 3.32 4500 0.74 · 10
3 This study
9-10
FNIII- IDLEVRV 9-10
FNIIId 2.54 4280 0.59 · 10
3 This study
9-10
FNIII- IEI 9-10
FNIIId 2.18 2910 0.75 · 10
3 This study
a
Unfolding measured in GuHCl.

Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021

b
Unfolds co-operatively in GuHCl.
c
Comparison of 10FNIII is also made since the I1421DLEVRV mutations lie within this domain.
d
Two-state unfolding measured in SDS—the lack of a baseline (Figure 4) for the transition leads to uncertainty in the estimation of the equilibrium constants,
although this is comparable between the proteins.

Fig. 4. Equilibrium denaturation of the proteins in SDS followed by Trp

fluorescence. Symbols: empty diamonds = 9-10FNIII; solid squares
= 9-10FNIII-P; empty down triangles = 9-10FNIII-IDLEVRV; solid up
triangles = 9-10FNIII-IEI; solid circles = 9-10FNIII-CC. INSERT: DG as a
function of [SDS] for the denaturation step. Linear regression analysis was
used to calculate the slope (m) and y-axis intercept (DG(H2O)), presented in
Table IV.
The emulsifying stability index (ESI) for the proteins at
concentrations of 18.75 mg/ml clearly showed that emulsions
stabilized with 9-10FNIII-P or 9-10FNIII-CC were most stable
(Figure 5). The trend for decreasing emulsion stability placed
the more conformationally stable mutants ahead of those
conferring increased hydrophobic moment and 9-10FNIII (wild-
type). By linear regression analysis, equilibrium parameters for
protein unfolding in GuHCl were poor indicators of emulsion
stability. However, regression analysis of the proteins’ ESI
values versus respective [SDS]1/2 values gave an R2 value
of 0.900 (Table V). Thus, for b-sandwich proteins, prior
knowledge of protein unfolding in SDS would appear to be
a reasonable predictor of emulsion stability.
Observed differences in EE for the protein series
Figure 6 shows the change to the median emulsion oil droplet
size over time. A monomodal size-distribution for each data
point shown was observed (data not shown). The emulsions,
therefore, did not consist of two individual populations of
droplet size as is observed for heterogeneous preparations of
protein or peptide emulsifiers (van der Ven et al., 2001). This is
Fig. 5. Emulsion stability, shown as the emulsion stability index (ESI) as
a function of time for protein concentrations of 18.75 mg/ml in oil/water
mixtures (1:10). Symbols: empty diamonds = 9-10FNIII; solid
squares = 9-10FNIII-P; empty down triangles = 9-10FNIII-IDLEVRV; solid
up triangles = 9-10FNIII-IEI; solid circles = 9-10FNIII-CC. Error bars represent
the standard deviation.
likely to reflect the relatively high purity that can be achieved
with recombinant proteins.
For 9-10FIII-stabilized emulsions droplet size was seen
to transiently decrease. Although this decrease may have been
due to removal of larger drops from the system by surface
adsorption, this was unlikely given the absence of a fall for
BSA-stabilised emulsions and the monomodal droplet size-
distribution. The decrease in droplet size was more prolonged
for 9-10FNIII-CC and 9-10FNIII-P stabilized emulsions
(15–20 min) before levelling off. In contrast, for 9-10FNIII
and 9-10FNIII-IEI stabilized emulsions, the transient fall was
followed by a prolonged increase in droplet size, presumably
due to coalescence, with 9-10FNIII-IDLEVRV lying in-
between. The distinct changes in droplet size over time seen
between the 9-10FNIII proteins indicated clear differences in
their EE.
Table V shows the overall percentage change in droplet size
(EE, %); the larger the decrease in size the stronger the EE.
9-10
FNIII-CC and particularly 9-10FNIII-P showed good EE,
9-10
FNIII-IDLEVRV was comparable to BSA [a known
541
W.S.Annan et al.

Table V. Comparison of emulsion function parameters versus surface hydrophobicity and rate of unfolding

Protein EE (%) ESI (%) 6 S.D. EAI 6 S.D. Kd (mM) PSH Ku (· 10
3 s
1)
9-10
FNIII +81.0 71.9 6 6.2 83.3 6 3.9 20.0 249.5 2.06 6 0.26
9-10
FNIII-P
38.9 97.1 6 0.6 118.7 6 4.7 27.2 59.1 2.63 6 0.70
9-10
FNIII-CC
10.5 88.4 6 9.5 112 6 6.7 40.7 66.6 3.02 6 0.58
9-10
FNIII-IEI +23.3 87.4 6 1.7 93.4 6 4.9 24.2 172.2 1.19 6 0.18
9-10
FNIII-IDLEVRV +11.9 60.8 6 3.0 86.3 6 3.5 26.2 111.4 6.00 6 0.93

EE, emulsification efficiency; ESI 6 SD, emulsion stability index (for protein concentrations of 18.75 mg/ml following 24 h standing) 6 standard deviation;
EAI 6 SD, emulsion activity index 6 standard deviation; Kd, apparent dissociation constant for ANS binding to protein; PSH, protein surface hydrophobicity
index; Ku, rate constant of unfolding in SDS 6 standard error of fit. Linear regression was used to find the dependence between emulsion function
and structural parameters (Figure 9).

Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021

Fig. 6. Measurement of the EE as the change in the median oil droplet size
over time. Symbols: empty diamonds = 9-10FNIII; filled squares = 9-10FNIII-P;
empty down triangles = 9-10FNIII-IDLEVRV; filled up triangles = 9-10FNIII-
IEI; filled circles = 9-10FNIII-CC; empty circles = 9-10FNIII-CC + 20 mM
DTT; filled diamonds = BSA.
Fig. 7. Transient change of Trp fluorescence with time, for equilibration of
the proteins in phosphate buffer containing 0.6 mM SDS (final concentration).
Symbols: empty diamonds = 9-10FNIII; solid squares = 9-10FNIII-P; empty
down triangles = 9-10FNIII-IDLEVRV; solid up triangles = 9-10FNIII-IEI;
solid circles = 9-10FNIII-CC. The data were fitted to a mono-exponential
function (y = ymin + (ymax
ymin) · (1
exp(
k.x)) using Prism,
GraphPad, CA, USA, to give the rate constants (Ku) in Table V.

emulsifier, (Rampon et al., 2004)], with 9-10FNIII and

9-10
FNIII-IEI showing poor EE. Therefore, the b-sandwich
structure does not prohibit robust EE despite this conformation
being poorly represented in typical protein emulsifiers.
Interestingly, reduction of the disulphide bridge of 9-10FNIII-
CC improved EE such that droplet size closely matched the
9-10
FNIII-P stabilized emulsion. The coalescence observed
after 60 min is likely to have been due to re-oxidation, which
occurs rapidly for 9-10FNIII-CC. This clearly demonstrates the
dependence on interdomain flexibility for EE.
Determination of the EAI provided a complementary
measure of the proteins’ EE. Table V shows that EAI was
greatest (EE was higher) for 9-10FNIII-P and 9-10FNIII-CC and
lowest for wild type 9-10FNIII, with 9-10FNIII-IDLEVRV and
9-10
FNIII-IEI lying in-between; the trend matching the EE data.
EAI was greater for 9-10FNIII-P and 9-10FNIII-CC than for
BSA, providing further evidence of their good emulsifying
efficiency. However, linear regression analysis of EE (%)
and EAI against equilibrium parameters did not suggest strong
dependence between conformational stability and EE (data not
shown). In order to enable further interpretation of the EE data
we investigated the rate of protein unfolding and subsequent
surface hydrophobicity.
Emulsification efficiency is dependent on protein surface
hydrophobicity (PSH)
The rate of unfolding of 9-10FNIII in phosphate buffer
containing 0.6 mM SDS (2.06 · 10
3 s
1) was around 300
542
times slower than unfolding of 10FNIII in 2.5 M guanidine
isothiocyanate (0.742 s
1) (Cota and Clarke, 2000). Broadly
similar rates of unfolding were observed for the mutant
9-10
FNIII proteins (Figure 7 and Table V). The slow rates of
protein unfolding in SDS versus guanidinium is typical
(Ternstrom et al., 2005), there being orders of magnitude
difference in denaturant concentrations. The rate constants of
protein unfolding did not correlate with respective ESI values
or EE data. However, with respect to the extent of unfolding
(seen as the relative increase in fluorescence intensity over 1 h
incubation in SDS, Figure 7), a general trend was noted to
correspond to EE—the smaller the extent of unfolding
the greater the EE. The extent of unfolding in SDS was, there-
fore, studied in more detail using the aromatic hydrophobic
probe, ANS.
Following equilibration in SDS, ANS bound to the unfolded
proteins to varying degrees, implying that the proteins
unfolded exposing buried hydrophobic residues (Figure 8).
After reaching saturated levels of bound ANS, it was noted that
fluorescence subsequently tended to fall. This has been pre-
viously noted and is suggested to represent ANS-induced
oligomerization of the protein species, reducing the number
of available binding sites (Peri et al., 1990). Given that PSH
reflects the cumulative index of unfolding (Moro et al., 2001),
this was most extensive for 9-10FNIII and least for 9-10FNIII-P
and 9-10FNIII-CC. Regression analysis of the PSH values
versus EE (%) and EAI gave R2 values of 0.932 and 0.809,

Fig. 8. Titration of 5 mM ANS against 5 mM solutions of the proteins
equilibrated in 0.6 mM SDS, shown as relative units of fluorescence,
described in the methods. Symbols: empty diamonds = 9-10FNIII; solid
squares = 9-10FNIII-P; empty down triangles = 9-10FNIII-IDLEVRV; solid up
triangles = 9-10FNIII-IEI; solid circles = 9-10FNIII-CC. The data were analysed
to give PSH in Table V (Moro et al., 2001).
Fig. 9. Linear regression analysis between emulsion function and structural
parameters shown in Table V. Left, emulsion stability index (ESI, %) versus
[SDS]1/2 (Table IV); centre, EE (%) versus PSH; right, emulsion activity
index (EAI) versus PSH; corresponding analysis of goodness of fit gave
R2 values of 0.900, 0.932 and 0.809, respectively. Error bars represent the
standard deviation.
respectively (Table V and Figure 9). Therefore, the interpreta-
tion of the EE data is consistent with the EAI data. Thus, the
EE of the proteins was dependent on limited, rather than
extensive, unfolding and exposure of hydrophobic surface.
Discussion
The value in increasing the hydrophobic moment of b-strands
was found to be limited with respect to improving emulsion
stability (ESI). Our results showed that 9-10FNIII-IEI stabilized
the emulsion somewhat better than 9-10FNIII (2-fold), but
this was not the case for 9-10FNIII-IDLEVRV. It is possible
that the IEI mutation on the 9FNIII C0 strand contributed to
stabilization of the protein interfacial film, whereas the
IDLEVRV mutation on the 10FNIII A strand did not (see Leahy
et al., 1996, for strand notations). Although in situ structural
analysis would be required to prove this, the data suggest that
10
FNIII unfolding at the interface was not complete. This
would be in agreement with the much greater conformational
stability of 10FNIII over 9FNIII; the IDLEVRV and IEI
mutations did not appreciably alter the conformational stability
of 10FNIII and similar DG(H2O) values for 9FNIII were found
with respect to the wild-type. Although the dependence of
unfolding on denaturant concentration (m) for 9-10FNIII-
IDLEVRV was lower compared with the wild-type, m may
Emulsifying performance of modular b-sandwich proteins
vary noticeably between single amino acid mutants (Shirley
et al., 1989).
In contrast, a large increase in the ESI was found for
9-10
FNIII-P (P1408 mutation increasing the conformational
stability but not the hydrophobic moment), with a similar but
smaller increase for 9-10FNIII-CC. Although 9-10FNIII-CC
includes P1408 it also includes the disulphide, which strongly
restricts interdomain mobility (Altroff et al., 2004). This
suggests that interdomain flexibility is required for maximal
emulsion stability. It is interesting to note that FN was shown
to displace BSA from the oil/water interface and the flexibility
of its modular nature may play a role in this observation
(Vaidya and Ofoli, 2005). The dependence of the proteins’ ESI
on its respective [SDS]1/2 value implies that a certain degree of
conformational stability in b-sandwich proteins tends to favour
emulsion stability. This may initially appear contrary to protein
Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021
unfolding upon interfacial adsorption but does not necessarily
involve a complete loss of secondary structure. For example,
b-casein is predominantly random coil in solution but adopts
a-helical structure on adsorption (Caessens et al., 1999),
adsorption of 2S albumins involves loss of a-helical and
disordered structure in favour of b-sheet (Burnett et al., 2002)
and AlnA requires maintenance of its b-barrel structure in
order to stabilize oil-in-water emulsions (Toren et al., 2002). In
contrast, Poon et al. (2001a) demonstrated that chemical dena-
turation of globular and milk proteins in most cases increased
EE. However, the denaturation used was mild, disrupting
quaternary structure, and the authors concluded that the effect
was protein-specific and depended on the relative importance
of disulfide bonds, which is in agreement with the observed
differences in ESI for 9-10FNIII-P and 9-10FNIII-CC.
Emulsification efficiency was quantified by the change
in droplet size during shear. The initial transient fall in droplet
size seen in the 9-10FNIII-stabilized emulsions possibly
represented break-up of bridged flocs following the initial dilu-
tion of the emulsion on addition to the dispersion unit.
The subsequent changes in droplet size, followed by a
leveling-off (except for wild type 9-10FNIII) would have
been dependent on the shear of the mixer in the dispersion
unit limiting droplet coalescence till equilibration, determined
by the relative emulsification efficiencies of the proteins.
Comparing the trends in droplet size for 9-10FNIII-IDLEVRV
and 9-10FNIII-IEI versus 9-10FNIII suggested that the
hydrophobic moment of the b-strands in either domain some-
what improved EE, particularly the IDLEVRV mutation.
However, the relative improvement in EE was greatest for
9-10
FNIII-P and, to a lesser extent, 9-10FNIII-CC. This trend
initially appeared to reflect the ESI data, though linear regres-
sion did not show dependence on [SDS]1/2 values, suggesting a
somewhat different mechanism underpins the ESI and EE data.
This may not be surprising since emulsion stability relies on a
measure of the strength of the emulsion surface, which may
not necessarily have been directly related to the interfacial
activity of the proteins. In contrast the measurement of
droplet size with shear may be more sensitive to protein
adsorption or desorption from the oil/water interface, stabiliz-
ing or destabilizing the viscoelastic film surrounding the
oil droplets.
Emulsification efficiency was clearly dependent on PSH
(Table V and Figure 9). This is not to say that complete
attenuation of protein unfolding would yield a strong
emulsifying (b-sandwich) protein. It is clear from earlier
543
W.S.Annan et al.
work that surface hydrophobicity is correlated to EE and
interfacial tension (Kato and Nakai, 1980). Similarly, where
notable hydrophobic stretches in primary structure are evident
these may be associated with EE (Toren et al., 2002).
However, recent reports demonstrate that the relationship is
not straightforward, as also seen in our data. Losso and Nakai,
(2002) described protein bridging as destabilizing with respect
to the dispersion of oil droplets, conjugation of (hydrophilic)
poly ethyleneglycol to the protein reduced bridging-
destabilization, implicating protein association via exposed
hydrophobic domains. Creamer et al. (1998) showed that
stabilization of the k-casein interfacial film involved oligomer-
ization, which may have been as much dependent on
disulphide interchange as hydrophobic interaction. Moreover,
hydrophobic domains drive the oligomerization of b-casein
(Caessens et al., 1999) but in doing so this limits EE (Poon
et al., 2001a). Thus, it becomes apparent that there exists an
optimal surface hydrophobicity for each protein emulsifier,
which may exist either for the native or unfolded conformer.
In the case of the b-sandwich domain pair studied here, the
optimal hydrophobicity for EE is best represented by
SDS-unfolded 9-10FNIII-P.
The dependence of the EE data on PSH was corroborated by
the same trend being observed for the EAI data, which
provided a complementary measure of the EE of the protein
(Pearce and Kinsella, 1978). In both EE and EAI data sets the
EE of 9-10FNIII-CC was slightly less than 9-10FNIII-P,
suggesting that restricted domain–domain mobility reduced EE
(as with emulsion stability). Reduction of the disulphide bond
elegantly confirmed this by increasing the EE to that of
9-10
FNIII-P; upon reoxidation the EE returned to that seen
for 9-10FNIII-CC (Figure 6). In aiming to achieve maximum
emulsion stability, it is noteworthy to relate the emulsion
performance to the interdomain flexibility between the 9th
and 10th FNIII domains, which is relatively high on the
basis of an unusually low buried surface area of 333 s2
(Leahy et al., 1996), and the tilt and twist of the 9-10FNIII-P
and 9-10FNIII-CC domain pairs, which is 28 and 349 and 5
and 355 , respectively (Altroff et al., 2004). The conforma-
tional changes to FN, a modular b-sandwich protein, observed
during interfacial adsorption to hydrophilic or hydrophobic
surfaces (Renner et al., 2005) also points to the importance
of interdomain flexibility in emulsion stability. It is currently
unclear how the kinetics of b-sandwich domain unfolding
during emulsification relate to interfacial adsorption or
desorption. This will form the basis of further work, focusing
on conformational changes to b-sandwich proteins upon
adsorption to an interface.
It should be noted that the emulsifying performance of
the protein series has been related to fundamental properties
of conformational stability and unfolding but not directly to
an understanding of protein surface area and interfacial
tension. Similarly, it is not yet possible to assign a ‘hydrophile–
lipophile balance’ (HLB) value, as is the case for typical
sufactants (e.g. Tweens/Spans), on the basis of a protein’s
physico-chemical properties; this has been previously noted
by (Poon et al., 2001a). Ideally, the oil/water interfacial ten-
sions for the proteins would have supported the emulsion data.
However, application of the Langmuir–Blodgett trough proved
problematic because of dilution of the stock protein into the
bulk such that the formation of a film was non-evident. To
address this issue, we are currently investigating the behaviour
544
of the proteins at surfaces via neutron scattering and Dual
Polarisation Interferometry. Similarly, measurements of force
distance profiles for b-sandwich proteins acquired by Atomic
Force Microscopy (Ng et al., 2005) may provide a mechanistic
link between the protein’s fundamental properties and its
emulsifying performance.
Acknowledgements
This work was supported by the Biotechnology and Biological Sciences
Research Council, grant no. 86/E19380 to C.V.D.W. We thank M. Nutley
and A. Cooper (BBSRC Microcalorimetry facility, Glasgow, UK), and
E. Schmidt for support in protein analysis.
References
Altroff,H., van der Walle,C.F., Asselin,J., Fairless,R., Campbell,I.D. and
Mardon,H.J. (2001) J. Biol. Chem., 276, 38885–38892.
Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021
Altroff,H., Schlinkert,R., van der Walle,C.F., Bernini,A., Campbell,I.D.,
Werner,J.M. and Mardon,H.J. (2004) J. Biol. Chem., 279, 55995–56003.
Bates,P.A., Kelley,L.A., MacCallum,R.M. and Sternberg,M.J.E. (2001)
Proteins, pp. 39–46.
Bouissou,C., Potter,U., Altroff,H., Mardon,H. and van der Walle,C. (2004)
J. Control. Release, 95, 557–566.
Burnett,G.R., Rigby,N.M., Mills,E.N.C., Belton,P.S., Fido,R.J., Tatham,A.S.
and Shewry,P.R. (2002) J. Colloid Interf. Sci., 247, 177–185.
Caessens,P.W., De,J ongh,H.H., Norde,W. and Gruppen,H. (1999) Biochim.
Biophys. Acta, 1430, 73–83.
Carino,G.P., Jacob,J.S. and Mathiowitz,E. (2000) J. Control. Release, 65,
261–269.
Cooper,A., Kennedy,M.W., Fleming,R.I., Wilson,E.H., Videler,H.,
Wokosin,D.L., Su,T.J., Green,R.J. and Lu,J.R. (2005) Biophys. J., 88,
2114–2125.
Cota,E. and Clarke,J. (2000) Protein Sci., 9, 112–120.
Creamer,L.K., Plowman,J.E., Liddell,M.J., Smith,M.H. and Hill,J.P. (1998)
J. Dairy Sci., 81, 3004–3012.
Damodaran,S., Anand,K. and Razumovsky,L. (1998) J. Agric. Food Chem., 46,
872–876.
Dickinson,E. and Matsumura,Y. (1991) Int. J. Biol. Macromol., 13, 26–30.
Egilmez,N.K., Jong,Y.S., Sabel,M.S., Jacob,J.S., Mathiowitz,E. and
Bankert,R.B. (2000) Cancer Res., 60, 3832–3837.
Eisenberg,D., Weiss,R.M. and Terwilliger,T.C. (1982) Nature, 299, 371–374.
Janin,J. (1979) Nature, 277, 491–492.
Johnson,K.J., Sage,H., Briscoe,G. and Erickson,H.P. (1999) J. Biol. Chem., 274,
15473–15479.
Kato,A. and Nakai,S. (1980) Biochim. Biophys. Acta, 624, 13–20.
Laskowski,R.A., Rullmannn,J.A., MacArthur,M.W., Kaptein,R. and
Thornton,J.M. (1996) J. Biomol. NMR, 8, 477–486.
Leahy,D.J., Aukhil,I. and Erickson,H.P. (1996) Cell, 84, 155–164.
Lindahl,E., Hess,B. and van der Spoel,D. (2001) J. Mol. Model., 7, 306–317.
Losso,J.N. and Nakai,S. (2002) J. Agric. Food Chem., 50, 1207–1212.
Mordenti,J. et al. (1999) Toxicol. Sci., 52, 101–106.
Moro,A., Gatti,C. and Delorenzi,N. (2001) J. Agric. Food Chem., 49,
4784–4789.
Ng,S.P., Rounsevell,R.W., Steward,A., Geierhaas,C.D., Williams,P.M., Paci,E.
and Clarke,J. (2005) J. Mol. Biol., 350, 776–789.
Ooi,T., Oobatake,M., Nemethy,G. and Scheraga,H.A. (1987) Proc. Natl Acad.
Sci. USA, 84, 3086–3090.
Pace,C.N. and Scholtz,J.M. (1997) In: Creighton, T.E. (ed.), Protein Structure, A
Practical Approach. IRL Press, Oxford, pp. 299–321.
Pearce,K.N. and Kinsella,J.E. (1978) J. Agric. Food Chem., 26, 716–723.
Peri,C., Pagliarini,E., Iametti,S. and Bonomi,F. (1990) J. Dairy Res., 57,
101–108.
Plaxco,K.W., Spitzfaden,C., Campbell,I.D. and Dobson,C.M. (1997) J. Mol.
Biol., 270, 763–770.
Pontius,J., Richelle,J. and Wodak,S.J. (1996) J. Mol. Biol., 264, 121–136.
Poon,S., Clarke,A.E. and Schultz,C.J. (1999) J. Colloid Interf. Sci., 213,
193–203.
Poon,S., Clarke,A.E. and Schultz,C.J. (2001a) J. Agric. Food Chem., 49,
281–286.
Poon,S., Clarke,A., Currie,G. and Schultz,C. (2001b) Biosci. Biotechnol.
Biochem., 65, 1713–1723.
Qin,B.Y., Bewley,M.C., Creamer,L.K., Baker,H.M., Baker,E.N. and
Jameson,G.B. (1998) Biochemistry, 37, 14014–14023.
Rampon,V., Brossard,C., Mouhous-Riou,N., Bousseau,B., Llamas,G. and
Genot,C. (2004) Adv. Colloid Interf. Sci., pp. 108–109, pp. 87–94.
 Emulsifying performance of modular b-sandwich proteins

Renner,L., Pompe,T., Salchert,K. and Werner,C. (2005) Langmuir, 21,

4571–4577.
Robertson,A., MacColl,G.S., Nash,J.A., Boehm,M.K., Perkins,S.J. and
Bouloux,P.M. (2001) Biochem. J., 357, 647–659.
Sah,H. (1999) J. Pharm. Sci., 88, 1320–1325.
Saito,M., Ogasawara,M., Chikuni,K. and Shimizu,M. (1995) Biosci. Biotechnol.
Biochem., 59, 388–392.
Shirley,B.A., Stanssens,P., Steyaert,J. and Pace,C.N. (1989) J. Biol. Chem., 264,
11621–11625.
Spitzfaden,C., Grant,R.P., Mardon,H.J. and Campbell,I.D. (1997) J. Mol. Biol.,
265, 565–579.
Ternstrom,T., Svendsen,A., Akke,M. and Adlercreutz,P. (2005) Biochim.
Biophys. Acta, 1748, 74–83.
Toren,A., Segal,G., Ron,E.Z. and Rosenberg,E. (2002) Environ. Microbiol., 4,
257–261.
Vaidya,S.S. and Ofoli,R.Y. (2005) Langmuir, 21, 5852–5858.
van de Weert,M., Hoechstetter,J., Hennink,W.E. and Crommelin,D.J. (2000)
J. Control. Release, 68, 351–359.
van der Ven,C., Gruppen,H., de Bont,D.B. and Voragen,A.G. (2001) J. Agric.

Downloaded from https://academic.oup.com/peds/article/19/12/537/1473742 by guest on 19 March 2021

Food Chem., 49, 5005–5012.
van der Walle,C.F., Altroff,H. and Mardon,H.J. (2002) Protein Eng., 15,
1021–1024.
Vila,J., Williams,R.L., Vasquez,M. and Scheraga,H.A. (1991) Proteins, 10,
199–218.
Wesson,L. and Eisenberg,D. (1992) Protein Sci., 1, 227–235.
Willumsen,P.A. and Karlson,U. (1997) Biodegradation, 7, 415–423.

Received March 13, 2006; revised June 28, 2006;

accepted September 09, 2006

Edited by Hagan Bayley

545