Clinica Chimica Acta 478 (2018) 140–151

Contents lists available at ScienceDirect

Clinica Chimica Acta

journal homepage: www.elsevier.com/locate/cca

High-dose of vitamin D supplement is associated with reduced susceptibility T

of monocyte-derived macrophages to dengue virus infection and pro-
inflammatory cytokine production: An exploratory study
⁎
Diana Marcela Giraldo, Andrés Cardona, Silvio Urcuqui-Inchima
Grupo Inmunovirología, Facultad de Medicina, Universidad de Antioquia UdeA, calle 70 No. 52-21, Medellín, Colombia

A R T I C L E I N F O A B S T R A C T

Keywords: Background: Dengue, one the most important public health problems in tropical and subtropical areas, is the
Vitamin D most important mosquito-borne viral infection in humans. In the absence of effective treatment and vaccine
Dengue virus against dengue, the active form of vitamin D could play a central role in protection against dengue virus (DENV),
TLRs the causal agent of dengue. Recently we reported that monocyte-derived macrophages (MDMs) differentiated in
Macrophages
the presence of vitamin D, in addition to expressing lower levels of mannose receptor, are less susceptible to
Proinflammatory cytokines
DENV infection and produce low levels of pro-inflammatory cytokines, compared to MDMs differentiated in the
absence of vitamin D.
Objective: The aim of this study was to determine that oral vitamin D supplementation exerts an effect on DENV
susceptibility and pro-inflammatory cytokine production in MDMs.
Methods: Healthy individuals were supplemented with 1000 or 4000 international units (IU)/day of vitamin D
during 10 days. Before and after vitamin D supplementation, a peripheral blood (PB) sample was taken and the
monocytes recovered were used to obtain MDMs and were challenged with DENV-2. Furthermore, the expression
of genes encoding vitamin D receptor (VDR), CYP24A1 and CAMP were analyzed using real-time quantitative
PCR.
Results: The data indicate that macrophages differentiated from monocytes obtained from healthy donors who
received higher doses of vitamin D (4000 IU/day), exhibited higher resistance to DENV-2 infection and produced
a significant decrease of pro-inflammatory cytokines and high production of interleukin-10 (IL-10). Furthermore,
a significant decrease in intracellular toll-like receptor (TLR) and CAMP mRNA was observed.
Conclusion: A supplement of 4000 IU/day of vitamin D may represent an adequate dose to control dengue
progression and DENV replication. Although the results of our study suggest that the vitamin D status can
influence the immune response, further studies are needed to determine the feasibility of vitamin D as anti-DENV
agent and immune modulator.

1. Introduction syndrome caused by endothelial dysfunction associated with an al-

According to the World Health Organization (WHO), the incidence
of dengue has increased dramatically in the last three decades and has
expanded to new geographical areas, becoming an important problem
in public health worldwide [1]. In humans, infection with dengue virus
(DENV) results in a wide spectrum of outcomes leading to diverse
clinical manifestations ranging from asymptomatic infection or mild
undifferentiated fever, to one of the following clinical manifestations,
dengue with or without warning signs and severe dengue [2]. Although
the pathology of DENV is not completely understood, one of the hall-
mark manifestations in dengue patients includes capillary leak
teration in the balance of secreted pro-inflammatory cytokines [3].
Diverse studies have reported that DENV-infected monocytes and
macrophages release soluble mediators, including interleukin (IL)-1β,
and IL-6 that exert prominent effects on the function and properties of
endothelial cells [4], suggesting that these cells play a role in DENV
pathogenesis. Toll-like receptors (TLRs), one of the most important
categories of pattern recognition receptors (PRRs), recognize viral
particles or viral components and subsequently initiate signaling for
pro-inflammatory cytokine production [5]. Interestingly, the DENV NS1
protein induces cytokine secretion through TLR4 [6], and contributes to
vascular leak in dengue patients [7]. Furthermore, DENV up-regulates

⁎
Corresponding author.
E-mail address: Silvio.urcuqui@udea.edu.co (S. Urcuqui-Inchima).

https://doi.org/10.1016/j.cca.2017.12.044
Received 5 October 2017; Received in revised form 19 December 2017; Accepted 28 December 2017
Available online 29 December 2017
0009-8981/ © 2017 Published by Elsevier B.V.
D.M. Giraldo et al.
the expression of TLR3 and TLR8 in HepG2 cells and increase the ex-
pression interferon-beta and pro-inflammatory cytokines [8]. Taken
together, these results show that DENV infection induces TLR activation
and consequently that the interaction of DENV-TLRs can result in
dengue disease progression.
It is known that 1,25-dihydroxyvitamin D [1,25(OH)2D3], the ac-
tive metabolite of vitamin D, acts at multiples levels, including cell
proliferation and cell differentiation, and has potent im-
munomodulatory activities [9]. However, the inactive form of vitamin
D (25-hydroxyvitamin D) is hydroxylated to its active form by 25(OH)
D-1alfa-hydroxylase (CYP27B1) [10]. The active form of vitamin D then
binds to the intracellular vitamin D receptor (VDR) and induces the
expression of 1,25(OH)2D- 24-hydroxylase (24-OHase; CYP24A1)
which initiates the degradation of the physiologically active form of
vitamin D3 [11]. The human antimicrobial peptide LL-37, which is
produced as part of the innate immunity, is induced by 1,25(OH)2D3
macrophages [12],and has received considerable attention due to its
antimicrobial activity against diverse pathogens [13]. However, our
understanding of the impact of vitamin D on the immune response,
including cytokine production by regulating the innate immune re-
ceptors is more limited. To date it is well known that vitamin D me-
tabolites down-regulate pro-inflammatory cytokine production, but
their impact on virus or viral PRR-stimulated response is very limited.
Some studies reported that patients with Hepatitis C virus (HCV) and
with vitamin D deficiency present severe manifestations such as hepatic
cirrhosis, chronic liver disease and severe hepatic fibrosis [14,15].
Likewise, it was reported that vitamin D supplementation increases the
probability of achieving a sustained viral response following antiviral
treatment, suggesting a relationship between vitamin D and HCV in-
fection [16]. Epidemiological studies have also provided evidence that
vitamin D deficiency could be associated with a risk of viral infections
including influenza virus (IV), respiratory tract infections and human
immunodeficiency virus 1 (HIV-1) [17]. Other reports strongly point
towards vitamin D as having significant beneficial effects in the pre-
vention of infectious diseases [18]. This is highly interesting, since vi-
tamin D is one of the most cost-effective supplements used to improve
overall human health [19,20]. Puerta-Guardo et al., (2012) demon-
strated that vitamin D treatment resulted both in a significant decrease
in the percentage of U937- and Huh-7-cells infected with DENV and a
reduction in the production of pro-inflammatory cytokines including
TNF-α, IL-1β and IL-6 [21]. Moreover, an association between the
polymorphism of the vitamin D receptor (VDR) gene and the risk of
symptomatic dengue requiring hospitalization was reported [22]. While
these results show an association between vitamin D and clinical out-
comes of DENV infection including decreased levels of pro-in-
flammatory cytokines, the importance of vitamin D supplementation in
the context of dengue patients is unknown.
Although vitamin D has been assigned functions in monocytes and
macrophages [23], the macrophage cell type resulting in response to
vitamin D treatment has not been sufficiently characterized. It has been
established that the differentiation state of monocytes and macrophages
is crucial in determining the susceptibility and productive infection by
different viruses [24], but the influence of these differentiations on
DENV infection has been sparsely examined. We observed that mono-
cyte-derived macrophages (MDMs) differentiated in the presence of
vitamin D, in addition to expressing lower levels of mannose receptor,
are less susceptible to DENV infection and produce low levels of pro-
inflammatory cytokines compared with MDMs differentiated in the
absence of vitamin D (submitted manuscript). Therefore, based on these
results the aim of the present study was to explore if oral vitamin D
supplementation exerts an effect on DENV susceptibility and pro-in-
flammatory cytokine production in MDMs. To accomplish this, the
healthy individuals received 1000 or 4000 international units (IU)/day
of vitamin D supplement during 10 days. Then, from each individual,
before and after the vitamin D supplement, a PB sample was taken and
the monocytes isolated. They were used to obtain MDMs in the presence
141
Clinica Chimica Acta 478 (2018) 140–151
of autologous serum, and were then challenged with DENV-2. The data
indicated that macrophages differentiated from monocytes obtained
from healthy donors who received higher doses of vitamin D (4000 IU/
day), exhibited higher resistance to DENV-2 infection and produced a
significant decrease of pro-inflammatory cytokines and high production
of IL-10. Furthermore, a significant decrease of intracellular TLR mRNA
was observed. Although the results of our study suggest that the status
of vitamin D can influence the immune response and DENV resistance/
susceptibility to infection, further studies are required to determine the
feasibility of vitamin D as anti-DENV agent and immune modulator.
2. Materials and methods
2.1. Ethics statement
The protocols for patient enrollment and sample collection were
approved by the Committee of Bioethics Research of the Sede de
Investigación Universitaria, Universidad de Antioquia (Medellín,
Colombia) and an individual's inclusion was preceded by a signed in-
formed consent form, according to the principles expressed in the
Declaration of Helsinki.
2.2. Study subjects
Since two oral daily doses (4000 and 7000 IU) of cholecalciferol
(D3) over a 12-week period was reported safe and effective [25], our
design was to enroll 2 groups, both with 10 healthy volunteer subjects.
Each group was randomized to 1000 or 4000 IU vitamin D (chole-
calciferol)/day, during 10 days. The 1000 IU/day group (1000VitD)
received one gelatin capsule and the 4000 IU/day group (4000VitD)
received two 2000 IU vitamin D gelatin capsules (Farma D, Colombia)
per day. The 20 healthy individuals (HIs) from Medellin voluntarily
agreed to participate in this study and signed a written informed con-
sent before participation. Furthermore, HIs were negative for the DENV
NS1 antigen and DENV IgM/IgG antibodies according to the Dengue
NS1 Antigen kit (Bio-Rad Laboratories, Marnes La Coquette, France)
and had not been vaccinated against yellow fever virus. The inclusion
criteria included individuals between 18 and 50 years of age, and for
each individual the C-reactive protein (CRP) concentration was quan-
tified to rule out any active infectious process. The HIs declared that
they were nonsmokers and were not taking any medication. The ex-
clusion criteria included any clinical presentation associated with in-
fectious disease and pregnancy. Subjects taking supplements that con-
tained vitamin D or calcium supplements were excluded of the study.
2.3. Sample collection
After removing 50 ml (VD0) of PB collected with a syringe and 8 ml
of PB in red top tube for clotted blood that was used to obtain auto-
logous serum, the participants who agreed to take the supplement were
assembled in the 1000VitD and 4000VitD groups. Immediately after the
first blood sample was removed, the participants started taking the
daily doses for 10 days. Not incidents were reported to us by the par-
ticipants during the course of the experiment. The second 50 ml of PB
collected was taken on day 10 (VD10).
2.4. Monocyte purification and monocyte-derived macrophage
differentiation
The PB samples, VD0 and VD10, from each subject were mixed with
EDTA 2% v/v and peripheral blood mononuclear cells (PBMCs) were
isolated by Ficoll-Histopaque (Sigma-Aldrich, St. Louis, USA) gradient
at 650 g during 30 min as described [26]. Platelet depletion was per-
formed by washing with PBS (Sigma-Aldrich, St. Louis, USA) three
times at 250 g during 10 min. The percentage of CD14 + cells (mono-
cytes) was then determined by staining 1′000.000 of PBMCs with 1 μl of
D.M. Giraldo et al.
anti-CD14 (eBiosciences, San Diego, CA) for 30 min. Monocytes were
isolated from each donor of PBMCs (VD0 and VD10) by plastic ad-
herence as described [26]. Briefly, 5 × 105 CD14 + cells from total
PBMCs were plated in 24 well plastic plates and were allowed to adhere
during 4 h in 500 μl of 1640 RPMI medium (Sigma-Aldrich, St. Louis,
USA) supplemented with 0.5% autologous serum at 37 °C and 5% CO2.
Non-adhering cells were removed by washing twice with PBS and MDM
differentiation was allowed to occur for 6 days in 500 μl of 1640 RPMI
medium supplemented with 10% autologous serum at 37 °C and 5%
CO2.
2.5. DENV stocks and titration
DENV-2 New Guinea C (NGC) strain was provided by the Center for
Disease Control (CDC, Co, USA) and was propagated in C6/36 cells, as
described previously [27]. Briefly, monolayers of C6/36 HT cells in 75-
cm2 tissue culture flasks were inoculated with DENV-2 at a multiplicity
of infection (MOI) of 0.05 in 1 mL of L-15 medium (Thermo Fisher
Scientific (GIBCO), Wilmington, DE, USA) supplemented with 2% Fetal
Bovine Serum (FBS). After 3 h, 10 mL of L-15 medium and 2% FBS were
added and the cells were cultured for 5 days at 34 °C without CO2. The
supernatants were centrifuged for 5 min at 1800 rpm to pellet cellular
debris, and then aliquoted for storage at −70 °C for future use. Virus
titration was performed by flow cytometry, Indirect intracellular
staining detection of DENV E protein with the monoclonal antibody
4G2 (Millipore, Darmstadt, Germany) and the secondary goat anti-
mouse IgG-FITC antibody (Invitrogen, Life Technologies, CA) was per-
formed as previously described [28].
2.6. DENV-2 infection of MDMs
After differentiation, the MDM monolayers obtained from the VD0
and VD10 samples were washed with warm PBS and subsequently, the
cells were challenged with wild-type DENV-2, at a MOI of 5, for 2 h at
37 °C in 5% CO2. Spinning down and shaking of the plates were per-
formed to allow homogenous interaction of the virus with the MDM
monolayers. Three hours hpi, the cells were washed with warm PBS to
remove unbound virus and were left at 37 °C with 5% CO2 in RPMI
1640 medium and 10% autologous serum for 24 h.
2.7. Quantification of DENV-2 infection by flow cytometry
DENV-2 infection was measured by intracellular detection of the
envelope E virus protein by flow cytometry. To accomplish this, 24 hpi
the MDM monolayers were harvested and then fixed and permeabilized
using a Fixation/Permeabilization buffer (eBioscience, San Diego, CA).
Incubation with the 4G2 antibody was then performed according to the
manufacturer's instructions and was followed by incubation with the
secondary goat anti-mouse IgG-FITC antibody. Unstained cells, mock-
infected cells plus secondary antibody only was included as controls in
every experiment. The cells were analyzed in a FACScanto flow cyt-
ometer. The percentage of infected cells is expressed as percentage
positive E cells over the total number of cells analyzed.
2.8. Quantification of DENV-2 genomic RNA by real-time PCR
Isolation of viral RNA from cell culture supernatants was performed
using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), ac-
cording to the manufacturer's instructions. The number of genome
equivalent copies (GEc) was estimated by RT-qPCR using DENV-2-
specific primers (forward: 5´ CAATATGCTGAAACGCGAGAGAAA 3′
and reverse: 5´CCCCATCTATTCAGAATCCCTGCT 3′) as previously de-
scribed [29]. The calculation of GEc was performed based on a standard
curve, as previously reported [30].
142
Clinica Chimica Acta 478 (2018) 140–151
2.9. Quantification of TLR expression by flow cytometry
Flow cytometry was used to evaluate the expression of TLR2, TLR3
and TLR9 in MDMs as previously described [31]. Briefly, to stain ex-
tracellular receptors (here, TLR2), DENV-infected MDMs were surface-
stained with the appropriate antibodies for 25 min. To stain in-
tracellular receptors (here, TLR3 and TLR9), the cells were treated with
fixation/permeabilization buffer and stained with the appropriate an-
tibodies for 25 min (eBiosciences, San Diego. CA) following the man-
ufacturer's recommendations. TLR acquisition was performed im-
mediately using a FACScan flow cytometer (BD Biosciences, San Jose,
CA). The acquired events were analyzed using FACS Diva software
version 6.1.2. Unstained cells and conjugated isotype antibodies were
used as controls. Expression is expressed as the mean fluorescent in-
tensity (MFI) of the overall cell sub-population after subtraction of the
isotype control.
2.10. RNA isolation, cDNA synthesis and analysis of mRNA of TLR, VDR,
CYP24A1 and CAMP by real-time PCR
The mRNA quantification for TLR2, TLR3 and TLR9 was performed
in MDMs by real-time PCR as previously described [31]. To prepare
total RNA, Trizol reagent was used (Invitrogen, Life Technologies, CA).
cDNA was synthesized using the RevertAid Minus First Strand cDNA
Synthesis Kit (Thermo scientific, Wilmington, DE, USA) according to
the manufacturer's instructions. The primers used to quantified the
TLRs mRNA were previously reported [31]. Primers used for amplifying
the VDR transcript were 5′-TGCTATGCACTGTGAAGGCGT-3′ [forward
(fw)] and 5′-AGTGGCGTCGGTTGTCCTT-3′ (reverse (rev); for CYP24A1
5′-CGCAAATACGACATCCAGGC-3′ (fw) and 5′-AATACCACCATCTGAG
GCGT-3′ (rev) and for CAMP 5′-GGATGCTAACCTCTACCGC-3′ (fw) and
5′-AGGGTCACTGTCCCCATACA-3′ (rev). The relevant transcripts of
each target gene was normalized to the unstimulated control and to the
housekeeping gene β-actine (ΔΔCt) and reported as the fold change.
2.11. ELISA
MDM culture supernatants were tested for the production of TNF-α,
IL-6, IL-1β, IL-8 and IL-10 using ELISA kits (BD Biosciences, San Jose,
CA) according to the manufacturer's instructions.
2.12. Statistical analyses
All data were plotted and analyzed using GraphPad Prism 5.0
(GraphPad Software Inc. San Diego, CA). The statistical tests are in-
dicated in the figure legends. Significant results are defined as
p < 0.05 (*), p < 0.01 (**) and highly significant results as
p < 0.001 (***).
3. Results
3.1. High dose of vitamin D supplementation decreases the percentage of
MDM-positives for DENV E antigen
The resistance/susceptibility to DENV infection was monitored in
MDMs before (VD0) and after 10 days of vitamin D supplementation
(VD10). To accomplish this, the expression of the DENV E antigen in
MDMs and of the viral RNA in the challenge-MDM supernatants was
measured. The effect was determined in macrophages differentiated
from monocytes obtained from both groups 1000VitD and 4000VitD, as
described in the Materials and methods section. MDMs were then in-
fected with DENV-2 at a MOI 5 for 24 h. In the 1000VitD group, a
statistically significant increase in the percentage of MDMs infected
with DENV-2 was noted in the VD10 MDMs compared with the VD0
MDMs, suggesting that a supplement with a low dose of vitamin D may
result in a major susceptibility of MDMs to DENV infection (Fig. 1A).
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

Fig. 1. The infection percentage and DENV replication in MDMs is differentially regulated by supplementation with vitamin D (cholecalciferol). 5 × 105 MDMs obtained from healthy
individuals who were supplemented with 1000 (n = 9) or 4000 (n = 10) IU/daily of vitamin D (cholecalciferol) for 10 days were infected with DENV-2, MOI 5 for 24 h. Infection
percentage and replication were assessed by flow cytometry and real time RT-PCR, respectively. The results are presented as % of positive E cells for viral infection and RNA copies/μl for
viral replication. The analysis was performed both before (VD0) and after (VD10) vitamin D treatment. A total of 10 individuals were included in each group (1000VitD and 4000Vitd
groups); comparisons were performed using the Wilcoxon test and the level of significance was p = 0.05 (*).

Interestingly, in the 4000VitD group, the opposite effect was observed,
i.e. the effects of supplementation with a daily high-dose of vitamin D
significantly decreased the percentage of VD10 MDMs infected with
DENV-2, compared to VD0 MDMs (Fig. 1B), suggesting that a high dose
of vitamin D supplementation has a protective effect against DENV
infection.
To confirm the effect of vitamin D on DENV replication, we ad-
ditionally quantified the number of GEc in the VD0 and in the V10
MDMs supernatants; i.e. before and after vitamin D supplementation.
We consistently observed that the 1000vitD group presented a sig-
nificant increase in the copy number of GEc in the VD10 MDMs com-
pared to the VD0 MDMs (Fig. 1C). Moreover, we also observed that the
number of GEc in MDMs obtained from individuals supplemented with
4000 IU/day of vitamin D (VD10 MDMs) tended to decrease, compared
with VD0 MDMs (Fig. 1D). These results suggest that supplement with a
high dose of Vitamin D has an effect on percentage of MDMs-infected
and in the number of viral RNA copies.
3.2. Intracellular TLR expression is altered in VD0 MDMs and VD10 MDMs
obtained from healthy donors supplemented with low or high doses of
vitamin D and infected with DENV-2
Since we observed that a high dose of vitamin D supplement has an
effect on infection/replication of DENV-2, the transcriptional response
and protein expression of TLR2, TLR3 and TLR9 were next evaluated in
VD0 MDMs and VD10 MDMs, and challenged with DENV-2. There was
statistically a significant decrease in the amount of TLR3 mRNA in the
VD10 MDMs obtained from both groups of individuals (1000VitD and
4000VitD) compared to VD0 MDMs (Fig. 2C and D). We also observed a
statistically significant decrease in the TLR9 mRNA expression in the
VD10 MDMs versus the VD0 MDMs, but only in the 1000VitD group
and not in the 4000VitD group (Fig. 2E and F, respectively). However,
we observed no changes in transcriptional response of TLR2 in neither
of the 2 groups when comparing the expression in VD0 MDMs versus
VD10 MDMs (Fig. 2A and B). Next, we evaluated the expression of
TLR2, TLR3 and TLR9 at the protein level by flow cytometry. However,
we found no statistically significant changes in the protein levels of
these TLRs in both groups, before (VD0 MDMs) or after vitamin D
supplementation (VD10 MDMs; Fig. 3).
3.3. Vitamin D supplementation diminishes the pro-inflammatory cytokine
response in VD0 MDMs and VD-10 MDMs infected with DENV-2
Innate immune cytokines are critical in the control of DENV infec-
tion, and TNF-α, IL-1β and IL-6 constitute important soluble mediators
on monocytes and macrophages; it has been suggested that they play a
pivotal role in the development of dengue progression [32]. To evaluate
the effect of vitamin D supplementation on TLR-induced responses in
MDMs, cytokine gene expressions were evaluated before (VD0 MDMs)
and after (VD10 MDMs) 10 days of vitamin D supplementation, in both,
the 1000VitD and 4000VitD groups.
As shown above, supplementation with a low or high dose of

143
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

Fig. 2. Intracellular TLR expression is altered in both VD0 MDMs and VD10 MDMs infected with DENV-2. MDMs (5 × 105) obtained from 12 healthy individuals who were supplemented
with 1000 or 4000 IU/daily of vitamin D for 10 days were infected with DENV-2, at a MOI of 5 for 24 h. Quantification of TLR2 (A and B), TLR3 (C and D) and TLR9 (E and F) mRNA
expression was assessed by real time RT-PCR. The results are shown as the ΔCt of each sample compared to the constitutive gene of β-actin, represented as relative units of transcripts. The
analysis was performed both before (VD0) and after (VD10) vitamin D treatment. A total of 10 individuals were included in each group (1000VitD and 4000Vitd groups); comparisons
were performed using the Wilcoxon test and the level of significance was p = 0.05 (*).

144
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

Fig. 3. VitD supplementation does not affect the protein expression of TLRs in both VD0 MDMs and VD10 MDMs infected with DENV-2. MDMs (5 × 105) obtained from 12 healthy
individuals supplemented with 1000 or 4000 IU/daily of vitamin D for 10 days were infected with DENV-2, at a MOI of 5 for 24 h. Protein expression of TLR2 (A and B), TLR3 (C and D)
and TLR9 (E and F) was assessed by flow cytometry and is represented as mean fluorescence intensity (MFI) of each TLR. The analysis was performed both before (VD0) and after (VD10)
vitamin D treatment. A total of 10 individuals were included in each group (1000VitD and 4000Vitd groups); comparisons were performed using the Wilcoxon test and the level of
significance was p = 0.05 (*).

vitamin D results in transcriptional decreases of TLR3 mRNA, in addi-
tion to a decrease of TLR9 mRNA in the 1000VitD group. Thus, we
wanted to determine whether vitamin D supplementation can alter the
expression pattern of cytokines in VD0 MDMs and VD10 MDMs, chal-
lenged with DENV-2. Interestingly, we observed that macrophages
differentiated from monocytes obtained from donors who received a
high dose of vitamin D supplementation (4000VitD group) produced
high levels of IL-10 and IL-8 (Fig. 4F and J), but low levels of TNF-α
(Fig. 4H), after 10 days of vitamin D supplementation (VD10 MDMs)
compared with the sample taken before initiating the treatment (VD0

145
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

Fig. 4. Vitamin D supplementation diminishes the pro-in-

flammatory cytokine response in VD0 MDMs and VDT10
MDMs infected with DENV-2. MDMs (5 × 105) obtained from
12 healthy individuals supplemented with 1000 or 4000 IU/
daily of vitamin D for 10 days were infected with DENV-2, at
a MOI of 5 for 24 h. The production of IL-6 (A and B), IL-1β (C
and D), IL-10 (E and G), TNF-α (G and H) and IL-8 (I and J)
was determined by ELISA in MDM culture supernatants. The
analysis was performed both before (VD0) and after (VD10)
vitamin D treatment. A total of 10 individuals were included
in each group (1000VitD and 4000VitD groups); comparisons
were performed using the Wilcoxon test and the level of sig-
nificance was p = 0.05 (*).

146
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

MDMs). Conversely, as observed in Fig. 4, the MDMs differentiated
from monocytes obtained from health donors who received a low dose
of vitamin D as supplement (1000VitD group), produced statistically
significantly increased levels of TNF-α (Fig. 4G) and a statistically
significant decrease of IL-8 (Fig. 4I) after 10 days of vitamin D sup-
plementation (compare VD0 MDMs versus VD10 MDMs). For IL-6 and
Il-1β (Fig. 4A to D), we did not observe significant changes between the
two groups of individuals. These results suggest that supplementation
with low or high doses of vitamin D alter the expression of pro- and of
anti-inflammatory cytokines in MDMs infected with DENV-2.
3.4. The transcription response of suppressors of cytokine signaling is
altered in a vitamin D-dependent dose in MDMs challenged with DENV-2
Interestingly, it has been reported that active vitamin D increases
the expression of suppressor of cytokine signaling-3 (SOCS-3) in an IL-
10-dependent manner to decrease the expression of pro-inflammatory
cytokines [33], by negative regulation of Janus kinases [34]. Besides,
IL-10 can reduce the activation of macrophages by activating SOCS-3.
Subramanian et al., (2017) also reported that vitamin D induces SOCS-1
and SOCS-3 expression leading to the suppression of NF-κB signaling
[35]. Thus, we wanted to determine whether vitamin D3-induced ex-
pression of IL-10 increased the SOCS3 and SOCS-1 mRNAs in VD0
MDMs and VD10 MDMs, in both the 1000VitD and 4000VitD groups.
Interestingly, we found statistically significant increases in SOCS-1
mRNA in VD10 MDMs compared with the transcription response in
VD0 MDMs, in the 1000VitD group (Fig. 5A). Although we observed an
increase of SOCS-1 mRNA in VD10 MDMs in the 4000VitD group, the
change was not statistically significant (Fig. 5B). Conversely, we
observed a statistically significant increase of SOCS-3 mRNA in VD10
MDMs compared to VD0 MDMs in the 4000VitD group (Fig. 5D), but no
in the MDMs obtained from the 1000VitD group (Fig. 5C). Our results
suggest that in response to DENV infection, vitamin D up-regulates
SOCS-1 and SOCS-3 in VD10 MDMs, possibly leading to alteration of
cytokine production.
3.5. VDR, CYP24A1 and CAMP expression level
Next, we evaluated the expression of VDR and VDR target genes,
specifically CYP24A1 and CAMP. Compared with VD0 MDMs, VDR,
CYP24A1 and CAMP expression level in VD10 MDMs showed increases,
however, none reach statistical significance, in the 1000VitD group
(Fig. 6A, B and C). In the 4000VitD group we found slight increases only
in the CYP24A1 expression comparing VD0 MDMs vs VD10 MDMs, but
it also does not reach statistical significance (Fig. 6D). We did not ob-
serve changes in VDR and CAMP expression in this group (Fig. 6E and
F).
3.6. Correlative analysis
As shown in Fig. 7A and B, in the 1000VitD group the percentage of
DENV E protein MDMs was negatively correlated with the ratio of TLR3
(r = − 0.6442, p = 0.045) and the ratio of TLR9 (r = − 0.7547,
p = 0.0129). Conversely, the TLR2 mRNA was positively correlated
with the ratio of IL-8 (r = 0.7333, p = 0.0254 (Fig. 7C). In the
4000VitD group, viral RNA copies were negatively correlated with the
ratio of TLR3 (r = − 0.8500, p = 0.0061; Fig. 7D). We also observed
that the percentage of E MDMs was negatively correlated with the ratio

Fig. 5. The transcription response of suppressors of cytokine signaling-1 and -3 is altered in a vitamin D-dependent dose in MDMs infected with DENV-2. MDMs (5 × 105) obtained from
12 healthy individuals supplemented with 1000 or 4000 IU/daily of vitamin D for 10 days were infected with DENV-2, at a MOI of 5 for 24 h. Quantification of SOCS-1 (A and B) and
SOCS-3 (C and D) mRNA expression was performed by real time RT-PCR. The results are presented as the ΔCt of each sample compared to the constitutive gene of β-actin, and are
represented as relative units of transcripts. The analysis was performed both before (VD0) and after (VD10) vitamin D treatment. A total of 10 individuals were included in each group
(1000VitD and 4000VitD groups); comparisons were performed using the Wilcoxon test and the level of significance was p = 0.05 (*).

147
D.M. Giraldo et al. Clinica Chimica Acta 478 (2018) 140–151

Fig. 6. VDR, CYP24A1 and CAMP expression levels. MDMs (5 × 105) obtained from healthy individuals supplemented with 1000 or 4000 IU/daily of vitamin D for 10 days were infected
with DENV-2, at a MOI of 5 for 24 h. Quantification of VDR, CYP24A1 and CAMP mRNA was performed by real time RT-PCR. The results are presented as the ΔCt of each sample
compared to the constitutive gene of β-actin, and are represented as relative units of transcripts. The analysis was performed both before (VD0) and after (VD10) vitamin D treatment. A
total of 6 individuals were included in 1000VitD group, for each mRNA. In the 4000VitD group we included 5, 4 and 5 individuals for VDR, CYP24A1 and CAMP mRNA, respectively.
Comparisons were performed using the Wilcoxon test; however, none reach statistical significance.

of TLR3 and IL-10 (r = −0.8500, p = 0.0061 and r = −0.7333,
p = 0.0311, respectively; Fig. 7E and F).
4. Discussion
In this study, we observed that macrophages differentiated from
monocytes and obtained from healthy donors who received high doses
of vitamin D supplementation are more resistant to DENV-2 infection.
Indeed, there resulted a significant reduction in the percentage of
DENV-2-infected macrophages and a decrease in the number of viral
RNA copies. Conversely, when the macrophages were differentiated
from monocytes obtained from donors who received a low dose of vi-
tamin D, a statistically significant increase in the percentage of DENV-2-
infected macrophages, but also in the number of viral RNA copies was
observed. Taken together, these results suggest that vitamin D supple-
mentation can promote inhibition of DENV infection/replication in a
vitamin D dose-dependent manner. Our study is the first to explore the
effect of vitamin D on DENV infection in human primary macrophages.
Furthermore, previously we also found that MDMs differentiated in the
presence of vitamin D are less susceptible to DENV infection possibly

148
D.M. Giraldo et al.
Fig. 7. Correlative analysis. The non-normal distribution Spearman correlation test was applied to the data obtained in the study. The level of significance used was p = 0.05 (*).
due to down-regulation of some C-type lectins, such as the mannose
receptor (submitted manuscript). Our results are in line with the results
by [21], who also reported that vitamin D treatment of monocytes or
hepatic cells results in a significant decrease in the number of infected
cells. In addition, the authors reported a correlation between the dose
of vitamin D and inhibition of infection in both cells lines, with the
highest inhibition observed in cells exposed to the highest vitamin D3
concentration.
Although in the present study we did not quantify vitamin D levels
in plasma or serum before (VD0) and after (VD10) supplementation, in
another study we found that around 65% of individuals who partici-
pated voluntarily presented vitamin D deficiency (manuscript in pre-
paration). These low levels of vitamin D are in line with previously
reported healthy middle-aged to elderly adults [36]. Furthermore, we
also observed in a other previously study that after 10 days of supple-
mentation, individuals receiving 4000 IU/day reached the optimum
vitamin D levels in the target serum (> 30 ng/ml), but not individuals
receiving 1000 IU/day (manuscript in preparation). These results are in
line with previously reported HIV+ subjects, who after supplementa-
tion with 4000 or 7000 IU vitamin D/day produced increased vitamin D
in the serum [25]. Another study showed that weekly doses of
25,000 IU (~ 3570 IU/day) of cholecalciferol effectively achieved the
optimal target serum of vitamin D concentration in HIV-infected pa-
tients [37]. The antiviral effect of vitamin D against HIV-1 has been
documented and the increased risk or severity of HIV-infection is linked
to low levels of vitamin D [38]. Since several studies have reported that
the effect of vitamin D on diverse macrophage functions can be asso-
ciated with the degree of macrophage differentiation and activation, in
addition to the amount of stimulus [39], we postulate that differences
in the degree of macrophage differentiation and activation can help
explain the results observed with the two doses of vitamin D used here
to supplement the healthy donors. Our findings suggest that vitamin D
may inhibit DENV infection in a dose of vitamin D-dependent manner,
but the mechanism involved is still unclear.
The activity of vitamin D in the regulation of the innate response is
best-known as stimulator of antimicrobial peptide production in mac-
rophages [40]. Furthermore, TLR4 activation by bacterial infection
increases the local production of vitamin D and VDR leading to the
expression of antimicrobial peptides [40]. However, despite extensive
investigations on vitamin D, its potent immunomodulatory effect to the
149
Clinica Chimica Acta 478 (2018) 140–151
innate immune response during DENV infection has been scantly stu-
died. TLR plays a major role in the initiation of protective immune
responses, but the extensive release of TLR-triggered pro-inflammatory
cytokines may harm the host organism as it becomes clinically overt, as
has been observed in dengue patients. In this study, we found that vi-
tamin D supplementation not only modulates the expression of TLR3
and TLR9, but also the expression of pro- and anti-inflammatory cyto-
kines. Although divers murine studies and several with primary human
or other cell lines, convincingly demonstrated that vitamin D inhibits
pro-inflammatory cytokine production, much less has been reported of
its impact on intra-cellular TLR-stimulation and cytokine production
[41]. reported that TLR9 expression is down-regulated in monocytes
exposed to vitamin D, with a functional consequence, since TLR9 in-
duces less IL-2 production; TLR3 expression was remained unchanged.
In the present study we found that supplement with a high dose of
vitamin D (VD10 MDMs) improves the expression of IL-10 and IL-8,
while it decreased the production level of TNF-α, but that in macro-
phages obtained from individuals supplemented with 1000 IU/day of
vitamin D, the production of TNF-α was significantly increased and that
of IL-8 was decreased. These results suggest that the production of pro-
and anti-inflammatory cytokines is vitamin D dose-dependent [42]. also
reported that the addition of vitamin D to lipopolysaccharide-stimu-
lated microglia reduced the expression of pro-inflammatory cytokines
and increased the expression of IL-10 [43]. reported that HCV core
protein- and poly(I:C)-stimulated monocytes secreted TNF-α, IL-1β, IL-
10 and IFN-α/β. The authors observed that IL-10 plays a pivotal role in
the down-regulation of TNF-α and of IL-1β induced by the HCV core. In
the presence of vitamin D, Theiler's murine encephalomyelitis virus-
infected microglia also decreased the expression of pro-inflammatory
cytokines and increased the expression of IL-10, in addition to IFN-α/β
[42]. The fact that high doses of vitamin D decrease the level of TNF,
but low doses increase it, is noteworthy since the role of TNF in pro-
moting vascular leakage is well established [44]. Furthermore, several
lines of evidence support the idea that TNF-α secretion contributes to
hemorrhage development in dengue patients [45,46]. This is very in-
teresting because if so, our results would suggest that treatment with
high doses of vitamin D could contribute to the risk of developing se-
vere dengue.
However, increased levels of several vasoactive factors such as IL-10
have been reported in the bloodstream of patients with dengue
D.M. Giraldo et al.
hemorrhagic fever (DHF), and serum IL-10 has been proposed as a
marker of severe dengue infection [47]. Other studies reported that the
timing of IL-10 production is dynamic and varies throughout the course
of the illness, i.e. IL-10 levels peaking around defervescence of DHF
patients, but less in dengue fever (DF) patients [48]. In addition to the
increase in IL-10, IL-6 and IL-8 were also increased in dengue patients,
and without hemorrhagic manifestations, a significant positive corre-
lation between IL-6 and IL-8 and IL-10 was reported, whereas not in
patients with hemorrhagic manifestations [49]. The reduction in the
levels of IL-8 and IL-10 were identified as the most significant markers
of recovery from severe disease. Yet, [50] reported increased levels of
IL-10, and TNF-α in patients with DF, DHF and dengue shock syndrome
(DSS) versus patients with other febrile illnesses. Various TLR signaling
suppressors have been identified including SOCS proteins, that play an
important role in maintaining homoeostasis both in pathogen titer and
in cytokine-mediated hyper-inflammation. Subramanian et al., [35]
reported that vitamin D lowered inflammatory cytokine production in
neutrophils, inducing the expression of the SOCS proteins, SOCS-1 and
SOCS-3, leading to the suppression of NF-κB signaling. Here, we found
that as for IL-10, vitamin D supplementation increased the level of the
SOCS-1 and SOCS-3 mRNAs; hence, we suggested that their expression
might depend on IL-10 as was reported in microglia [33]. Conse-
quently, we propose that vitamin D increases the expression of IL-10
which in turn increases the expression of SOCSs, leading to a decrease
in the expression of pro-inflammatory cytokines. Although our results
indicate that vitamin D contributes to the regulation of pro- and anti-
inflammatory cytokines, it is unclear what mechanism is involved in the
inhibition of these cytokines. However, although IL-10 plays a pivotal
role in the balance of pro-inflammatory response and inflammation
suppression, we are aware that the exact effect of IL-10 in vivo requires
further analysis. Since vitamin D also regulates the expression of LL-37
through VDR-mediated response elements, and LL-37 inhibit DENV-2
replication at the stage of entry into the cells by binding to the E protein
[51], we evaluated the expression of CAMP and its association with
vitamin D levels. However, the expression of CAMP was not sig-
nificantly increased in VD10 MDMs of both groups evaluated. Previous
studies have shown that VD is required for LL-37 synthesis [40], and a
lower level of VD was linked with lower expression of LL-37 and in-
creased susceptibility to several infectious diseases. Matsumura et al.,
(2016) [52] also reported the anti-HCV activity of LL-37 using a HCV
cell culture system and the effect was independent of interferon-sti-
mulated genes induction. LL-37 suppressed the production of TNF-α
and IL-6 in IAV infected monocytes [53]]. Similar suppression of pro-
inflammatory cytokines in the lungs of mice infected with influenza
virus was observed when treated with LL-37 [54]. Since pro-in-
flammatory cytokines are known to play a major role in dengue disease
pathogenesis [55], the role of LL-37 in modulating the immune re-
sponse during DENV infection needs further investigation. Further-
more, in the present report we failed to detect any association between
VDR and expression of CYP24A1, the enzyme catalyzing the conversion
of 25OHD to the biologically active metabolite of 25OHD, although we
observed slight increase in the VDR and CYP24A1 in VD10 MDMs of
1000VitD group but not in 4000VitG group, suggesting that the vitamin
D catabolism is not affected. This might reflect the fact that CYP24
mRNA is induced at later time point after vitamin D administration
[56]. However, our results clearly demonstrate at the gene that human
MDMs possess functionally active CYP24A1 as was previously reported
[57]. Earlier reports employing human DCs also observed induction of
CYP24A1 mRNA levels after stimulation with 1,25-(OH)2D3 [58].
In conclusion, the findings of our study indicate that vitamin D can
both inhibit DENV-infection and induce a down-regulation of pro-in-
flammatory cytokine expression, while improving the expression of the
anti-inflammatory cytokines, maybe through the expression regulation
of SOCSs proteins and TLRs. Thus, we suggest that vitamin D might
establish negative feedback mechanisms to control the duration and
intensity of inflammatory reactions induced by DENV infection.
150
Clinica Chimica Acta 478 (2018) 140–151
Although the exact mechanism involved is not clear, we consider that
our results are promising and worthy of further study.
Conflict of interest
None of the authors has any potential financial conflict of interest
related to this manuscript.
Acknowledgements
This study was supported by COLCIENCIAS grant number
111556933443 from Colombia and the Universidad de Antioquia UdeA.
The funders played no role in the study design, data collection and
analysis, decision to publish, or preparation of the manuscript. The
authors wish to acknowledge the individuals who participated in this
study and the personnel at the institutions where the study was per-
formed. We acknowledge Anne-Lise Haenni for critically reviewing the
manuscript.
References
[1] WHO, Global Alert and Response: Impact of Dengue, (2017).
[2] S.N. Hammond, A. Balmaseda, L. Pérez, Y. Tellez, S.I. Saborío, J.C. Mercado,
E. Videa, Y. Rodriguez, M.A. Pérez, R. Cuadra, S. Solano, J. Rocha, W. Idiaquez,
A. Gonzalez, E. Harris, Differences in dengue severity in infants, children, and
adults in a 3-year hospital-based study in Nicaragua, Am. J. Trop. Med. Hyg. 73 (6)
(2005) 1063–1070.
[3] R. Appanna, S.M. Wang, S.A. Ponnampalavanar, L.C. Lum, S.D. Sekaran, Cytokine
factors present in dengue patient sera induces alterations of junctional proteins in
human endothelial cells, Am. J. Trop. Med. Hyg. 87 (5) (2012) 936–942.
[4] M.F. Shaio, S.N. Cheng, Y.S. Yuh, K.D. Yang, Cytotoxic factors released by dengue
virus-infected human blood monocytes, J. Med. Virol. 46 (3) (1995) 216–223.
[5] A. Iwasaki, R. Medzhitov, Toll-like receptor control of the adaptive immune re-
sponses, Nat. Immunol. 5 (10) (2004) 987–995.
[6] N. Modhiran, D. Watterson, A. Blumenthal, A.G. Baxter, P.R. Young, K.J. Stacey,
Dengue virus NS1 protein activates immune cells via TLR4 but not TLR2 or TLR6,
Immunol. Cell Biol. (2017).
[7] N. Modhiran, D. Watterson, D.A. Muller, A.K. Panetta, D.P. Sester, L. Liu,
D.A. Hume, K.J. Stacey, P.R. Young, Dengue virus NS1 protein activates cells via
Toll-like receptor 4 and disrupts endothelial cell monolayer integrity, Sci. Transl.
Med. 7 (304) (2015) 304ra142.
[8] T.M. Conceição, T. El-Bacha, C.S. Villas-Bôas, G. Coello, J. Ramírez, M. Montero-
Lomeli, A.T. Da Poian, Gene expression analysis during dengue virus infection in
HepG2 cells reveals virus control of innate immune response, J. Inf. Secur. 60 (1)
(2010) 65–75.
[9] S. Nagpal, S. Na, R. Rathnachalam, Noncalcemic actions of vitamin D receptor li-
gands, Endocr. Rev. 26 (5) (2005) 662–687.
[10] P.J. Malloy, J.W. Pike, D. Feldman, The vitamin D receptor and the syndrome of
hereditary 1,25-dihydroxyvitamin D-resistant rickets, Endocr. Rev. 20 (2) (1999)
156–188.
[11] J. Smolders, K.G. Schuurman, M.E. van Strien, J. Melief, D. Hendrickx, E.M. Hol,
C. van Eden, S. Luchetti, I. Huitinga, Expression of vitamin D receptor and meta-
bolizing enzymes in multiple sclerosis-affected brain tissue, J. Neuropathol. Exp.
Neurol. 72 (2) (2013) 91–105.
[12] J.F. Love, H.J. Tran-Winkler, M.R. Wessels, D. Vitamin, The human antimicrobial
peptide LL-37 enhance group a streptococcus resistance to killing by human cells,
MBio 3 (5) (2012).
[13] A. Fabisiak, N. Murawska, J. Fichna, LL-37: cathelicidin-related antimicrobial
peptide with pleiotropic activity, Pharmacol. Rep. 68 (4) (2016) 802–808.
[14] J.A. Gutierrez, N. Parikh, A.D. Branch, Classical and emerging roles of vitamin D in
hepatitis C virus infection, Semin. Liver Dis. 31 (4) (2011) 387–398.
[15] L.Y. Lim, N. Chalasani, Vitamin d deficiency in patients with chronic liver disease
and cirrhosis, Curr. Gastroenterol. Rep. 14 (1) (2012) 67–73.
[16] D. Bitetto, C. Fabris, E. Fornasiere, C. Pipan, E. Fumolo, A. Cussigh, S. Bignulin,
S. Cmet, E. Fontanini, E. Falleti, R. Martinella, M. Pirisi, P. Toniutto, Vitamin D
supplementation improves response to antiviral treatment for recurrent hepatitis C,
Transpl. Int. 24 (1) (2011) 43–50.
[17] J.A. Beard, A. Bearden, R. Striker, Vitamin D and the anti-viral state, J. Clin. Virol.
50 (3) (2011) 194–200.
[18] E. Røsjø, A. Lossius, N. Abdelmagid, J.C. Lindstrøm, M.T. Kampman, L. Jørgensen,
P. Sundström, T. Olsson, L.H. Steffensen, Ø. Torkildsen, T. Holmøy, Effect of high-
dose vitamin D3 supplementation on antibody responses against Epstein-Barr virus
in relapsing-remitting multiple sclerosis, Mult. Scler. 23 (3) (2017) 395–402.
[19] P. Pludowski, M.F. Holick, S. Pilz, C.L. Wagner, B.W. Hollis, W.B. Grant,
Y. Shoenfeld, E. Lerchbaum, D.J. Llewellyn, K. Kienreich, M. Soni, Vitamin D effects
on musculoskeletal health, immunity, autoimmunity, cardiovascular disease,
cancer, fertility, pregnancy, dementia and mortality-a review of recent evidence,
Autoimmun. Rev. 12 (10) (2013) 976–989.
[20] J.C. Souberbielle, J.J. Body, J.M. Lappe, M. Plebani, Y. Shoenfeld, T.J. Wang,
D.M. Giraldo et al.
H.A. Bischoff-Ferrari, E. Cavalier, P.R. Ebeling, P. Fardellone, S. Gandini, D. Gruson,
A.P. Guérin, L. Heickendorff, B.W. Hollis, S. Ish-Shalom, G. Jean, P. von
Landenberg, A. Largura, T. Olsson, C. Pierrot-Deseilligny, S. Pilz, A. Tincani,
A. Valcour, A. Zittermann, Vitamin D and musculoskeletal health, cardiovascular
disease, autoimmunity and cancer: Recommendations for clinical practice,
Autoimmun. Rev. 9 (11) (2010) 709–715.
[21] H. Puerta-Guardo, F. Medina, S.I. De la Cruz Hernández, V.H. Rosales, J.E. Ludert,
R.M. del Angel, The 1α,25-dihydroxy-vitamin D3 reduces dengue virus infection in
human myelomonocyte (U937) and hepatic (Huh-7) cell lines and cytokine pro-
duction in the infected monocytes, Antivir. Res. 94 (1) (2012) 57–61.
[22] K. Alagarasu, T. Honap, A.P. Mulay, R.V. Bachal, P.S. Shah, D. Cecilia, Association
of vitamin D receptor gene polymorphisms with clinical outcomes of dengue virus
infection, Hum. Immunol. 73 (11) (2012) 1194–1199.
[23] M. Hewison, Vitamin D and immune function: an overview, Proc. Nutr. Soc. 71 (1)
(2012) 50–61.
[24] M. Temonen, H. Lankinen, O. Vapalahti, T. Ronni, I. Julkunen, A. Vaheri, Effect of
interferon-alpha and cell differentiation on Puumala virus infection in human
monocyte/macrophages, Virology 206 (1) (1995) 8–15.
[25] K.A. Dougherty, J.I. Schall, B.S. Zemel, F. Tuluc, X. Hou, R.M. Rutstein,
V.A. Stallings, Safety and efficacy of high-dose daily vitamin D3 supplementation in
children and young adults infected with human immunodeficiency virus, J. Pediatr.
Infect. Dis. Soc. 3 (4) (2014) 294–303.
[26] S. Eligini, M. Crisci, E. Bono, P. Songia, E. Tremoli, G.I. Colombo, S. Colli, Human
monocyte-derived macrophages spontaneously differentiated in vitro show distinct
phenotypes, J. Cell. Physiol. 228 (7) (2013) 1464–1472.
[27] S. Torres, J.C. Hernández, D. Giraldo, M. Arboleda, M. Rojas, J.M. Smit, S. Urcuqui-
Inchima, Differential expression of toll-like receptors in dendritic cells of patients
with dengue during early and late acute phases of the disease, PLoS Negl. Trop. Dis.
7 (2) (2013) e2060.
[28] C.R. Lambeth, L.J. White, R.E. Johnston, A.M. de Silva, Flow cytometry-based assay
for titrating dengue virus, J. Clin. Microbiol. 43 (7) (2005) 3267–3272.
[29] P.Y. Shu, S.F. Chang, Y.C. Kuo, Y.Y. Yueh, L.J. Chien, C.L. Sue, T.H. Lin, J.H. Huang,
Development of group- and serotype-specific one-step SYBR green I-based real-time
reverse transcription-PCR assay for dengue virus, J. Clin. Microbiol. 41 (6) (2003)
2408–2416.
[30] L.A. Sachs, D. Schnurr, S. Yagi, M.E. Lachowicz-Scroggins, J.H. Widdicombe,
Quantitative real-time PCR for rhinovirus, and its use in determining the relation-
ship between TCID50 and the number of viral particles, J. Virol. Methods 171 (1)
(2011) 212–218.
[31] D.M. Giraldo, J.C. Hernandez, P. Velilla, S. Urcuqui-Inchima, HIV-1-neutrophil in-
teractions trigger neutrophil activation and toll-like receptor expression, Immunol.
Res. 64 (2016) 93–103.
[32] A. Levy, N. Valero, L.M. Espina, G. Añez, J. Arias, J. Mosquera, Increment of in-
terleukin 6, tumour necrosis factor alpha, nitric oxide, C-reactive protein and
apoptosis in dengue, Trans. R. Soc. Trop. Med. Hyg. 104 (1) (2010) 16–23.
[33] H. Qin, C.A. Wilson, K.L. Roberts, B.J. Baker, X. Zhao, E.N. Benveniste, IL-10 in-
hibits lipopolysaccharide-induced CD40 gene expression through induction of
suppressor of cytokine signaling-3, J. Immunol. 177 (11) (2006) 7761–7771.
[34] B.J. Baker, L.N. Akhtar, E.N. Benveniste, SOCS1 and SOCS3 in the control of CNS
immunity, Trends Immunol. 30 (8) (2009) 392–400.
[35] K. Subramanian, P. Bergman, B. Henriques-Normark, Vitamin D promotes pneu-
mococcal killing and modulates inflammatory responses in primary human neu-
trophils, J. Innate Immun. 9 (4) (2017) 375–386.
[36] M. Haimi, R. Kremer, Vitamin D deficiency/insufficiency from childhood to
adulthood: insights from a sunny country, World J. Clin. Pediatr. 6 (1) (2017) 1–9.
[37] A.L. Khoo, H.J. Koenen, M. Michels, S. Ooms, M. Bosch, M.G. Netea, I. Joosten,
A.J. van der Ven, High-dose vitamin D3 supplementation is a requisite for mod-
ulation of skin-homing markers on regulatory T cells in HIV-infected patients, AIDS
Res. Hum. Retrovir. 29 (2) (2013) 299–306.
[38] J.P. Viard, J.C. Souberbielle, O. Kirk, J. Reekie, B. Knysz, M. Losso, J. Gatell,
C. Pedersen, J.R. Bogner, J.D. Lundgren, A. Mocroft, E.S. Group, Vitamin D and
clinical disease progression in HIV infection: results from the EuroSIDA study, AIDS
25 (10) (2011) 1305–1315.
[39] M. Kreutz, R. Andreesen, S.W. Krause, A. Szabo, E. Ritz, H. Reichel, 1,25-dihy-
droxyvitamin D3 production and vitamin D3 receptor expression are devel-
opmentally regulated during differentiation of human monocytes into macro-
phages, Blood 82 (4) (1993) 1300–1307.
[40] P.T. Liu, S. Stenger, H. Li, L. Wenzel, B.H. Tan, S.R. Krutzik, M.T. Ochoa,
151
Clinica Chimica Acta 478 (2018) 140–151
J. Schauber, K. Wu, C. Meinken, D.L. Kamen, M. Wagner, R. Bals, A. Steinmeyer,
U. Zügel, R.L. Gallo, D. Eisenberg, M. Hewison, B.W. Hollis, J.S. Adams, B.R. Bloom,
R.L. Modlin, Toll-like receptor triggering of a vitamin D-mediated human anti-
microbial response, Science 311 (5768) (2006) 1770–1773.
[41] L.J. Dickie, L.D. Church, L.R. Coulthard, R.J. Mathews, P. Emery, M.F. McDermott,
Vitamin D3 down-regulates intracellular toll-like receptor 9 expression and toll-like
receptor 9-induced IL-6 production in human monocytes, Rheumatology (Oxford)
49 (8) (2010) 1466–1471.
[42] M. Boontanrart, S.D. Hall, J.A. Spanier, C.E. Hayes, J.K. Olson, Vitamin D3 alters
microglia immune activation by an IL-10 dependent SOCS3 mechanism, J.
Neuroimmunol. 292 (2016) 126–136.
[43] X. Pang, Z. Wang, N. Zhai, Q. Zhang, H. Song, Y. Zhang, T. Li, H. Li, L. Su, J. Niu,
Z. Tu, IL-10 plays a central regulatory role in the cytokines induced by hepatitis C
virus core protein and polyinosinic acid:polycytodylic acid, Int. Immunopharmacol.
38 (2016) 284–290.
[44] J.E. Cardier, E. Mariño, E. Romano, P. Taylor, F. Liprandi, N. Bosch, A.L. Rothman,
Proinflammatory factors present in sera from patients with acute dengue infection
induce activation and apoptosis of human microvascular endothelial cells: possible
role of TNF-alpha in endothelial cell damage in dengue, Cytokine 30 (6) (2005)
359–365.
[45] Y.T. Yen, H.C. Chen, Y.D. Lin, C.C. Shieh, B.A. Wu-Hsieh, Enhancement by tumor
necrosis factor alpha of dengue virus-induced endothelial cell production of re-
active nitrogen and oxygen species is key to hemorrhage development, J. Virol. 82
(24) (2008) 12312–12324.
[46] H.C. Chen, F.M. Hofman, J.T. Kung, Y.D. Lin, B.A. Wu-Hsieh, Both virus and tumor
necrosis factor alpha are critical for endothelium damage in a mouse model of
dengue virus-induced hemorrhage, J. Virol. 81 (11) (2007) 5518–5526.
[47] G.N. Malavige, L. Gomes, L. Alles, T. Chang, M. Salimi, S. Fernando,
K.D. Nanayakkara, S. Jayaratne, G.S. Ogg, Serum IL-10 as a marker of severe
dengue infection, BMC Infect. Dis. 13 (2013) 341.
[48] T.N. Adikari, L. Gomes, N. Wickramasinghe, M. Salimi, N. Wijesiriwardana,
A. Kamaladasa, N.L. Shyamali, G.S. Ogg, G.N. Malavige, Dengue NS1 antigen
contributes to disease severity by inducing interleukin (IL)-10 by monocytes, Clin.
Exp. Immunol. 184 (1) (2016) 90–100.
[49] F.C. Iani, S. Caldas, M.M. Duarte, A.L. Cury, A.B. Cecílio, P.A. Costa, L.R. Antonelli,
K.J. Gollob, Dengue patients with early hemorrhagic manifestations lose coordinate
expression of the anti-inflammatory cytokine IL-10 with the inflammatory cytokines
IL-6 and IL-8, Am. J. Trop. Med. Hyg. 95 (1) (2016) 193–200.
[50] S. Chunhakan, P. Butthep, S. Yoksan, K. Tangnararatchakit, A. Chuansumrit,
Vascular leakage in dengue hemorrhagic fever is associated with dengue infected
monocytes, monocyte activation/exhaustion, and cytokines production, Int. J. Vasc.
Med. 2015 (2015) 917143.
[51] K. Alagarasu, P.S. Patil, P. Shil, M. Seervi, M.B. Kakade, H. Tillu, A. Salunke, In-
vitro effect of human cathelicidin antimicrobial peptide LL-37 on dengue virus type
2, Peptides 92 (2017) 23–30.
[52] T. Matsumura, N. Sugiyama, A. Murayama, N. Yamada, M. Shiina, S. Asabe,
T. Wakita, M. Imawari, T. Kato, Antimicrobial peptide LL-37 attenuates infection of
hepatitis C virus, Hepatol. Res. 46 (9) (2016) 924–932.
[53] M.R. White, S. Tripathi, A. Verma, P. Kingma, K. Takahashi, J. Jensenius, S. Thiel,
G. Wang, E.C. Crouch, K.L. Hartshorn, Collectins, H-ficolin and LL-37 reduce in-
fluence viral replication in human monocytes and modulate virus-induced cytokine
production, Innate Immun. 23 (1) (2017) 77–88.
[54] P.G. Barlow, P. Svoboda, A. Mackellar, A.A. Nash, I.A. York, J. Pohl, D.J. Davidson,
R.O. Donis, Antiviral activity and increased host defense against influenza infection
elicited by the human cathelicidin LL-37, PLoS One 6 (10) (2011) e25333.
[55] B.E. Martina, Dengue pathogenesis: a disease driven by the host response, Sci. Prog.
97 (Pt 3) (2014) 197–214.
[56] M. Tomon, H.S. Tenenhouse, G. Jones, Expression of 25-hydroxyvitamin D3-24-
hydroxylase activity in Caco-2 cells. An in vitro model of intestinal vitamin D
catabolism, Endocrinology 126 (6) (1990) 2868–2875.
[57] S.E. Tulk, K.C. Liao, D.A. Muruve, Y. Li, P.L. Beck, J.A. MacDonald, Vitamin D₃
metabolites enhance the NLRP3-dependent secretion of IL-1β from human THP-1
monocytic cells, J. Cell. Biochem. 116 (5) (2015) 711–720.
[58] G. Penna, S. Amuchastegui, N. Giarratana, K.C. Daniel, M. Vulcano, S. Sozzani,
L. Adorini, 1,25-Dihydroxyvitamin D3 selectively modulates tolerogenic properties
in myeloid but not plasmacytoid dendritic cells, J. Immunol. 178 (1) (2007)
145–153.