Biochemistry Page 1 of 12

B 1. The inhibition in a noncompetitive reaction:

a. competes with the active site of the enzyme c. increases the rate of reaction
b. binds simultaneously with substrate other than the active site d. both b and c

A 2. The order and sequence of amino acid in a polypeptide determines what protein structure?
a. primary b. secondary c. tertiary d. quaternary

B 3. Amino acids that cannot be synthesized in the organism are called _____
a. non essential amino acids b. essential amino acids c. standard amino acids d. alpha amino acids

A 4. Which hormone regulates the level of blood sodium?

a. aldosterone b. sterol c. corticosteroid d. cortisone

B 5. It is a precursor of vitamin A
a. B-carotene b. retinol c. retinal d. opium

C 6. Which of the following is a precursor of vitamin D?

a. prostaglandin b. linoleic acid c. cholesterol d. aldosterone

A 7. Which of these class enzymes introduces a double bond by the removal of hydrogen?
a. dehydrogenase b. dehydrolase c. decarboxylase d. lipase

A 8. The ionic property of amino acid is exhibited by its

a. zwitterions form b. NH2 group c. COO group d. positively charged groups

D 9. All of the following are simple proteins except:

a. glutelins b. globulins c. albumins d. glycoproteins

C 10.The simplest monosaccharide is __________

a. erythrose b. starch c. glyceraldehydes d. arabinose

C 11. Denaturation of protein is a result of:

a. cleavage of the peptide bond b. formation of H-bond c. breaking of H-bond d. none of these

A 12. Competitive inhibition is a ______ reaction

a. reversible b. irreversible c. pH and temperature d. none of these

A 13. In the Seliwanioff’s test, the reaction of resorcinol and acid on the sugar forms
a. hydroxymethyl furfural b. pyranose c. hydrazine d. purine

A 14. High concentration of neutral salts causes the precipitation of proteins. This is called _______
a. salting out b. salting in c. coagulation d. both b and c

A 15. The type of enzyme inhibition reaction whereby the inhibitor competes with the substrate at the active site:
a. competitive inhibition b. noncompetitive inhibition c. reversible inhibition d. incomplete inhibition

C 16. The following are waxes except:

a. beeswax b. sperm oil c. bile acids d. lanolin

A 17. The inactive form of enzymes are called:

a. zymogens b. apoenzymes c. cofactor d. both b and c

D 18. Which of the following amino acids has no alpha amino group?
a. praline b. hydroxyproline c. glycine d. both a and b

B 19. An enzyme is a substance which

a. convert heat to energy b. act as a catalyst c. change chemically in reaction d. is not specific in reaction

B 20. Milk curdling enzyme present in gastric juice of infants:

a. pepsin b. rennin c. trypsin d. maltase

A 21. Carbohydrates are

a. polyhydroxyaldehydes / polyhydroxyketones c. hemiacetals
b. polyhydroxy acids d. polymers of amino acids

C 22. Insulin is usually classified as:

a. protein b. enzyme c. hormone d. carbohydrates

A 23. What amount of glucose is present in the human blood?

a. 60 to 90 mg in 100 ml blood c. 2% of the total human body weight
b. 5 to 6 g in 100 ml blood d. none of these

A 24. It is the organelle which serves as the site of the electron transport chain.
a. mitochondria b. ribosome c. nucleus d. lysosome

C 25. The end product of the hydrolysis of glycogen is:

a. galactose b. fructose c. glucose d. arabinose

C 26. Iodine test is a reaction which may be used to identify carbohydrates. The reaction is due to
a. presence of the free aldehyde group c. presence of amylose portion
b presence of alcohol group d. presence of glucose
B 27. Benedict’s reagent yield positive result to:
a. monosaccharide only b. reducing sugars c. sucrose d. polysaccharides
Biochemistry Page 2 of 12

B 28. Hypertonic solutions will cause the cell to:

a. swell b. shrink c. burst d. undergo hemolysis

A 29. Rancidity of fats maybe due to :

a. oxidation b. hydrogenation c. saponification d. condensation

C 30. The deficiency of this hormone causes diabetes mellitus:

a. progesterone b. testosterone c. insulin d. glucagons

A 31. The active proteolytic enzyme in gastric juice is:

a. pepsin b. trypsin c. maltase d. catalase

B 32. The site of oxidation reaction in electron transport chain is in the

a. nucleus b. mitochondrion c. ribosome d. golgi bodies

B 33. Protein digestion starts in the

a. mouth b. stomach c. intestine d. pancreas

A 34. The conversion of an amino acid to sugar is:

a. gluconeogenesis b. glycolysis c. glycogenesis d. glycogenolysis

B 35. Which of the following is not an amino acid?

a. leucine b. choline c. valine d. glycine

A 36. The protein part of the enzyme molecule is the:

a. apoenzyme b. coenzyme c. cofactor d. holoenzyme

C 37. Optimum temperature for enzyme activity in the body:

a. 40oC b. 60oC c. 37oC d. 10oC

B 38. Glucose is stored in the liver as:

a. galactose b. glycogen c. lactose d. fructose

B 39. The enzyme conformation adapts to the incoming substrate in

a. Lock and Key theory b. Induced fit theory c. competitive inhibition d. noncompetitive inhibition

B 40. The process of converting glucose into glycogen is called:

a. gluconeogenesis b. glycogenesis c. glycolysis d. glycogenolysis

A 41. All are pyrimidine bases except:

a. guanine b. cytosine c. uracil d. thymine

B 42. Glucose, amino acid and fatty acid enter the citric acid cycle by their conversion into:
a. pyruvate b. acetyl CoA c. acetoacetyl CoA d. palmitic acid

A 43. A hormone which stimulates glycogenesis:

a. insulin b. glucagons c. epinephrine d. vasopressin

A 44. Chemicals extracted from organism such as bacteria and can inhibit growth or destroy other microorganism:
a. antibiotic b. enzyme c. hormone d. vitamins

C 45. The gland or tissue that regulates the blood glucose level:
a. parathyroid b. thyroid c. pancreas d. adrenal

D 46. Which vitamin is formed in the body by exposure to ultraviolet irradiation or sunlight?
a. vitamin A b. vitamin B c. Vitamin C d. vitamin D

C 47. Excess vitamin A and D is stored in the body, but excess vitamin B and C is readily excreted. What
property shows this?
a. vit. C and B are water-soluble b. vit. A and D are fat –soluble c. both a and b d. none of these

A 48. It is the entire genetic make up of an organism

a. gene b. anticodon c. codon d. mutation

B 49. The vitamin which is used in the prevention of degenerative changes in the central nervous system:
a. vit. A b. vit. B complex c. vit. C d. vit. D

A 50. It is a model which best explains the enzyme-substrate action:

a. lock and key b. molecular c. VSEPR d. Kreb

D 51. The activation of pepsinogen requires:

a. pepsin b. NaOH c. enterokinase d. HCl

B 52. DNA is primarily found in the

a. cytosol b. nucleus/mitochondriac. cell wall d. endoplasmic reticulum

B 53. It is the enzyme which hydrolyzes starch to dextrin and maltose:

a. catalase b. amylase c. pepsin d. lactase

D 54. A synthetic DNA is called

a. replicated DNA b. plasmid c. Gene d. recombinant DNA
Biochemistry Page 3 of 12
B 55. Hydrolysis of ATP is an
a. energy requiring reaction b. energy producing reaction c. no energy is involved d. energy is absorbed

C 56. Which of the following is a characteristic of lipid?

a. zwitterions b. amphiphilic c. hydrophobic d. hydrophilic

A 57. It is a condition that results when sugar level is below normal

a. hypoglycemia b. hyperglycemia c. ketonuria d. uremia

A 58. An example of globular protein

a. albumin b. collagen c. fibrin d. silk

A 59. Complementary base pairs in the DNA double helix are bonded by
a. H-bond b. ester bond c. Van der Waals d. dipole- dipole

C 60. Which nitrogen base is not found in DNA?

a. thymine b. cytosine c. uracil d. guanine

C 61. An organic cofactor in an enzyme

a. vitamins b. coenzymes c. a and b d. none of these

B 62. At what stage of glucose oxidation is most of the energy produced?

a. glycolysis b. aerobic stage c. glycogenesis d. glygenolysis

D 63. The best known building blocks of RNA and DNA are:
a. purines b. pyrimidines c. fatty acids d. a and b

C 64. It is responsible for the storage and transmission of genetic information

a. adenine b. RNA c. DNA d. nucleic acid

C 65. Build up of urea in the kidney is called

a. ketonuria b. glycemia c. uremia d. all of these

A 66. The transfer of genetic information from DNA by the formation of mRNA
a. transcription b. translation c. trans-amination d. replication

D 67. What is the end product of electron transport chain?

a. oxygen b. hydrogen c. carbon dioxide d. water

B 68. The energy producing reaction

a. metabolic b. catabolic c. anabolic d. all of these

A 69. It is the molecule that directs the activity of the cells

a. DNA b. RNA c. nucleoproteins d. hormones

C 70. The sugar involved in DNA

a. ribose b. pentose c. deoxyribose d. xylose

C 71. The common metabolic pathway is

a. glycolysis b. beta oxidation c. Kreb’s cycle d. glucogenesis

B 72. Rosenheim’s test is used to detect the presence of:

a. ethanolamine b. choline c. cholesterol d. glycone moiety

C 73. Detects the presence of alpha amino acids:

a. Biuret b. Molisch c. Ninhydrin d. Hopkins-cole

B 74. The process of producing fats from acetyl Co-A is called:

a. glycolysis b. lipogenesis c. glycogenolysis d. glucogenesis

A 75. The following are test reagents to detect the presence of amino acids, except:
a. Grignard’s b. Xanthoproteic c. Millon-Nasse d. Sakaguchi

A 76. The condition that lowers the pH of the blood due to starvation is called
a. acidosis b. alkalosis c. hyperglycemia d. glycosuria

B 77. The substance responsible for the emulsion of fats is:

a. HCl b. bile acids c. pepsin d. trypsin

B 78. Hubl’s solution if used to ascertain degree of:

a. saturation b. unsaturation c. peroxidation d. acidity

B 79. IUPAC name of acrolein:

a. pentenal b. propenal c. hexanal d. acetone

C 80. The positive indication for the presence of glycerol in acrolein test:
a. yellow colored solution c. silver mirror formed in the test tube
b. black markings in filter paper d. play of colors from blue to shades of red
B 81. Cerebrosides are positive in the following tests, except:
a. Molisch b. Biuret c. Lassaigne’s d. none of the above

B 82. Osmic test is used to detect the presence of ____ in lipids:

a. metals b. prostate groups c. unsaturated groups d. glycerol
Biochemistry Page 4 of 12

A 83. The most sensitive chemical test to detect the presence of cholesterol:
a. Liebermann-Burchard c. Formaldehyde-sulkfuric acid
b. Salkowski reaction d. Colorimetric spectrophotometry

D 84. The following are phopholipids, except:

a. plasmalogen b. lecithin c. cephalin d. choline

C 85. A mixed triglyceride contains:

a. three similar fatty acids esterified with glycerol c. three different fatty acids esterified with glycerol
b. two similar fatty acids esterified with glycerol d. all of the above choices

B 86. The central compound found in the structure of sphingolipids:

a. glycerol b. sphingosine c. ceramide d. phosphocholine

A 87. Lipid whose specific test is the Furter-Meyer test:

a. tocopherol b. retinal c. sphingomyelin d. cerebroside

A 88. Precipitate of _____ indicates the presence of phospholipids in the lipid sample:
a. ammonium phosphomolybdate c. phosphorus triiodide
b. phosphorus periodate d. phospho-ammonium sulfate complex

B 89. The following are glycolipids, except:

a. globosides b. phosphatides c. gangliosides d. cerebrosides

B 90. The parent compound of phospholipids:

a. glycerol b. phosphatidic acid c. ethanolamine d. none of the above

D 91. A non-pentose sugar which is also positive for Tollen’s phloroglucinol test:
a. galactose b. glucose c. fructose d. cellobiose

C 92. The reagent present in Molisch test which is responsible for the dehydration reaction:
a. sodium canbonate b. magnesiumstearate c. sulfuric acid d. NaOH

C 93. ID test to detect the presence of glycogen:

a. phloroglucinol b. molisch c. iodine d. seliwanoff

C 94. The only sugar readily forms insoluble osazone crystals:

a. lactose b. sucrose c. mannose d. sucrose

D 95. Important structural material found in the exoskeletons of many lower animals:
a. chnondroitin b. heparin c. hyaluronic acid d. chitin

B 96. Hydrolysis of osazones produce:

a. phenylhydrazones b. ozones c. sugars d. none of the above

C 97. General term for a group of polysaccharides present on the primary cell wall:
a. xanthan b. mucilage c. pectin d. carageenan

C 98. Specific test for galactose, due to the formation of highly insoluble crystals:
a. phenylhydrazine test b. fermentation c. mucic acid d. molisch

A 99. Type of RNA which serves as template for the amino acid sequence being synthesized:
a. mRNA b. tRNA c. rRnNA d. none of the above

B 100. Positive indication for Anthrone test:

a. purple ring b. blue-green color c. effervescence d. yellow ppt

B 101. Differentiating test between helical and linear polysaccharides:

a. Molisch b. iodine c. Schweitzer d. fermentation
C 102. The difference between Benedict’s and Barfoed’s test reagent lies in:
a. sequestering agent used b. active component used c. pH of the solution d. alkali used

C 103. Hydrolytic product of chitin:

a. iduronatet b. acetylgalactosamine c. acetylglucosamine d. glucuronic acid

C 104. Glucose and fructose are:

a. anomers b. epimers c. geometric isomers d. allosteres

B 105. The complementary strand of CGACCTTGATCGACGTCGA:

a. TCGTTCCAGCTAGTAACTAG c. AGCAAGGTCGATCATGATC
b. GCTGGAACTAGCTGCAGCT d. ATCAAGGTCGATCATGATC

C 106. Alkaline bismuth reagent is used to detect the presence of:

a. polysaccharides b. disaccharides c. reducing sugars d. glycitols

D 107. Action of dilute alkali on sugars:

a. dehydration b. hyperconjunction c. hydrolysis d. tautomerization

A 108. The following are the components of DNA nucleosides, except:

a. phosphoric acid b. sugar c. adenine d. cytosine
A 109. Central dogma concept wherein the RNA molecule is used as template for the synthesis of DNA molecule:
a. transcription b. translation c. mutation d. none of the above
Biochemistry Page 5 of 12

D 110. The following proteins are present in egg white, except:

a. ovomucin b. ovoglobulin c. albumin d. osseomucoid

C 111. Anaerobic glycolysis occurs in the:

a. nucleus b. mitochondria c. cytoplasm d. lysosomes

D 112. Ketogenic amino acids:

a. leucine b. tyrosine c. phenylalamine d. all of the above

B 113. Osazone test is also known as:

a. Nylander’s test b. Kowarsky test c. Trommer’s test d. Folin’s test

A 114. Genetic defect characterized by mental retardation and cataract, since theunmetabolized sugar is toxic to the
lens of the eyes:
a. galactosemia b. fructosemia c. pentosuria d. fructosuria

D 115. Body functions of lipids:

a. transformation into proteins and carbohydrates c. insulation and paddings for organs
b. catabolism to provide body with heat and energy d. all of the above

B 116. Pyridoxine is a compound of this enzyme:

a. enolase b. decarboxylase c. hydrogenase d. isomerase

B 117. The following are neutral amino acids, except:

a. methionine b. lysine c. threonine d. leucine

A 118. In man, the principal end product of protein metabolism is:

a. uric acid b. lactic acid c. pyruvic acid d. urea
B 119. Condition wherein acetone accumulates in the blood:
a. ketosuria b. ketonemia c. ketosis d. ketonuria

B 120. Glutamine is a _____ amino acid :

a. neutral b. basic c. acidic d. racemin

B 121. Oxidation product of ketone bodies:

a. reduced sugars b. carbon dioxide c. alcohols d. aldehydes

C 122. Phosphoprotein found in egg yolk:

a. ovocasein b. tendomucoid c. vitelin d. avidin

C 123. Amino acids positive for Sakaguchi reaction:

a. gelatin b. alanine c. arginine d. tyrosine

B 124. Histidine is negative for:

a. Pauly reaction b. Sodium Nitroprusside c. Ninhydrine d. Xanthoproteic

C 125. An official simple protein obtained from corn:

a. glutelion b. gliadin c. zein d. maize
C 126. Principle involved in the isolation of casein milk:
a. salting in b. salting out c. isoelectric precipitation d. none of the above

A 127. Process of converting liver glycogen into blood glucose:

a. glycogenolysis b. gluconeogenesis c. glycolysis d. glycogenesis
B 128. Genetic information is stored and carried in all cells by:
a. single-stranded DNA c. double-stranded RNA
b. double-stranded DNA d. single-stranded circular DNA

B 129. Principal site for the synthesis of urea:

a. kidney b. liver c. spleen d. intestinal mucosa

C 130. Pentose present in gum Arabic:

a. xylose b. ribose c. arabinose d. threose

C 131. Which of the following is responsible for the transfer of genetic information?
a. ATP b. GTP c. DNA d. RNA

C 132. Only form of inorganic nitrogen which can be utilized by living cells:
a. urea b. ornithine c. ammonia d. nitrogen gas

A 133. The following are essential amino acids, except:

a. tyrosine b. lysine c. methionine d. arginine

C 134. The chief end product of purine metabolism in man:

a. CO b. urea c. uric acid d. ammonia

D 135. The principal end product of protein metabolism:

a. carbon dioxide b. ammonia c. hippuric acid d. urea

B 136. Presence of glucose in appreciable amounts in the urine:

a. Hematuria b. glycosuria c. glycosemia d. albuminuria
D 137. The following are the tests for kidney efficiency, except:
a. phenylsulfophthelein test b. urea clearance test c. water output test d. crystallization method
Biochemistry Page 6 of 12

B 138. Growth hormone is also known as:

a. thyrotropic hormone b. somatotropin c. gonadotropin d. interstitial stimulating hormone

A 139. What is the anti-codon in tRNA that corresponds to the codon ACG in mRNA?
a. UGC b. TGC c. GCA d. CGU

A 140. Condition wherein bile pigment is present in excess in the blood:

a. jaundice b. hepatitis c. cirrhosis d. cystic fibrosis

B 141. The following are non-essential amino acids, except:

a. glycine b. leucine c. cysteine d. glutamine

B 142. Principal digestive constituent of the gastric juice:

a. trypsin b. pepsin c. gastrin d. enterokinase

B 143. Condition wherein the concentration of uric acid accumulates in blood reaches as high as 15 mg. Percent:
a. leukemia b. gout c. murexia d. any of the above

C 144. The study of the composition and the chemical processes occurring in the living matter is:
a. qualitative chemistry c biochemistry e. inorganic chemistry
b. organic chemistry d. quantitative chemistry

A 145. What is wobble?

a. the ability of certain anticodons to pair with codons that differ at the third base
b. an error in translation induced by streptomycin
c. a mechanism that allows for a peptide extension in the 50S sub-unit of the ribosome
d. thermal motions leading to local denaturation of the DNA double helix

C 146. The most important function of HCl in the stomach is:

a. hydrolysis of protein c. activation of pepsinogen e. stimulation of pancreatic
secretion
b. neutralization of chyme d. destruction of bacteria

C 147. Transamination is:

a. conversion of amino acid to hydroxy acid c. conversion of amino acids to keto acids
b. loss of ammonia from amino acid d. formation of ammonium salt from ammonia

A 148. The lipid that is converted to Vitamin D12 upon irradiation:

a. ergosterol b. glycerol c. cholesterol d. all of the above

A 149. The metabolic degradation of hemoglobin takes place principally in:

a. the reticuloendothilial system c. the white blood cells
b. the red blood cells d. the liver cell

C 150. The amino acid that is an important precursor of hemoglobin is:

a. alanine b. proline c. glycine d. cysteine
C 151. Serine is converted to ethanolamine by the removal of:
a. oxygen b. ammonia c. carbon dioxide d. a carboxyl group

C 152. Ninhydrin gives a blue coloration with:

a. proteins b. carbohydrates c. amino acids d. simple sugars

A 153. Which is the monomer unit of proteins?

a. amino acid b. monosaccharide c. fatty acid d. purine

A 154. The proteinase that is found mostly in gastric juice of young animals:
a. rennin c. steapsin e. none of the above
b. pepsin d. ptyalin

B 155. Conjugated proteins which are a combination of amino acids and carbohydrates:
a. nucleoproteins b. glycoproteins c. phosphoproteins d. chromoproteins

A 156. Gamma decarboxylation of aspartic acid produces:

a. alanine b. asparagines c. glutamic acid d. glycine

B 157. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine

A 158. It is a disease due to protein deficiency:

a. Kwashiorkor b. diabetes c. albuminuria d. jaundice

C 159. Which of the following amino acids is not essential in mammals?

a. phenylaline b. lysine c. tyrosine d. methionine

D 160. The following are examples of chromopretien, except:

a. chlorophyll b. hemoglobin c. cytochromes d. heparin

D 161. For the amino acid cysteine, choose the appropriate description of its side chain:
a. acidic b. basic c. aromatic d. sulfur-containing

C 162. Which of the following amino acids has a net positive charge at physiologic pH?
a. cysteine b. glutamic acid c. lysine d. valine
Biochemistry Page 7 of 12

D 163. Sickle cell anemia is the clinical manifestation of homozygous genes for an abnormal hemoglobin molecule.
The mutational event responsible for the mutation in the beta chain is:
a. crossing over b. insertion c. deletion d. point mutation

C 164. When starches are heated , they produce:

a. sugars b. glycogen c. dextrins d. disaccharides

B 165. Check the incorrect statement:

a. ribose is an aldopentose c. galactose is an aldohexose
b. maltose is a ketohexose d. glucose is an aldohexose

A 166. The reducing property of sugars is due to this group:

a. aldehyde b. nitro c. carboxyl d. methyl

D 167. The monosaccharide most rapidly absorbed from the small intestine is:
a. glucose b. fructose c. mannose d. galactose

C 168. A condition known as atherosclerosis results as an accumulation in the blood vessels of

a. calcium b. pathogens c. cholesterol d. ketones

C 169. Ketoses can be differentiated from aldoses by this test:

a. Molisch’s test b. Benedict’s test c. Seliwanoff’s test d. Tollen’s test

C 170. The clinical test for the determination of cholesterol:

a. Liebermann-Burchard b. Salkowski c. both a and b d. none of the above

C 171. Concentrated dehydrating acids change monosaccharides to:

a. simple sugars b. saccharic acids c. furfurals d. uronic acids e. aldaric acids

C 172. A mucopolysaccharide which possesses an anticoagulant property:

a. pectin b. hyaluronic acid c. heparin d. chitin e. chondroitin sulfate

A 173. Which of the following is the test for reducing sugars for urine?
a. Benedict’s test b. acrolein test c. Biuret test d. Brown Ring test
B 174. Lactose can be differentiated from fructose by:
a. Mucic acid test b. Barfoed’s test c. Fehling’s test d. Iodine test e. Tollen’s test

B 175. Polymers that are responsible for the metabolic capabilities and morphology of organisms are:
a. carbohydrates b. proteins c. polysaccharides d. nucleic acid

B 176. The product obtained from the partial hydrolysis of collagen:

a. myosin b. gelatin c. actin d. fibrinogen e. thrombin

B 177. The main carbohydrate of the blood is:

a. D-fructose b. D-glucose c. mannitol d. sorbitol

B 178. A normal value of glucose in the blood:

a. 100 to 200 mg% b. 80–120 mg% c. 50–75 mg% d. 200–300 mg%

B 179. Butter becomes rancid upon exposure to air due to formation of:
a. acetic acid b. butyric acid c. formic acid d. propionic acid

C 180. The cholesterol molecule is:

a. an aromatic ring b. a straight chain acid c. a steroid d. A tocopherol

C 181. Which of the following is a phospholipid?

a. glycogen b. prostaglandin c. sphingomyelin d. oleic acid

C 182. The passage of the end products of digestion from the small intestine into the blood stream:
a. metabolism b. digestion c. absorption d. oxidation e. reduction

A 183. Endocrine gland that is a small oval body situated at the base of the brain:
a. hypophysis b. pancreas c. adrenal d. none of the above

A 184. Cellular elements of the blood devoid of nucleus:

a. RBC b. WBC c. thrombocytes d. all of the above

C 185. Is the sum total of all activities directed towards the maintenance of life:
a. catabolism b. anabolism c. metabolism d. photosynthesis e. fermentation

C 186. This substance accumulates in the muscles as a result of vigorous exercise:

a. muscle glycogen b. amino acids c. lactic acid d. glucose

B 187. A common intermediate of metabolism of carbohydrates, fatty acids and amino acids is:
a. glycerol b. acetyl CoA c. acetoacetate d. oxaloacetate e. acetylcholine

B 188. The principal site of glucose production in the human body is the :
a. blood b. liver c. pituitary gland d. small intestine

A 189. The major buffer of the extracellular fluid:

Biochemistry Page 8 of 12
a. bicarbonate-carbon dioxide b. amino acids c. phosphate d. none of the above

C 190. Separates from cells when blood is coagulated:

a. fibrinogen b. plasma c. serum d. thrombin e. none of the above

C 191. Glycolipids found in high concentrations in the brain and nerve cells especially in the myelin sheath:
a. lecithin b. cephalins c. cerebrosides d. sphingolipids

A 192. Alcohol in the body is :

a. oxidized to CO2 and HOH c. excreted by kidneys
b. excreted mainly by lungs d. excreted by large intestine

C 193. Which of the following tissues contains the enzyme glucose-6-phosphatase and is able to supply glucose to
the blood?
a. heart b. brain c. liver d. none of the above

D 194. Complete digestion of all foodstuffs occurs in the :

a. large intestine b. stomach c. mouth d. small intestine e. pancreas

B 195. This compound is not a normal constituent of urine:

a. sodium chloride b. albumin c. urea d. uric acid

A 196. Decomposition of carbohydrates brought about by the action of enzymes liberating ethyl alcohol and CO2:
a. fermentation b. adsorption c. detoxification d. hydrolysis e.
saponification

C 197. Blood clotting can be prevented by:

a. sodium chloride b. potassium chloride c. sodium citrate

D 198. This hormone elevates blood sugar concentration:

a. insulin b. progesterone c. estrogen d. glucagons
B 199. Deficiency in this vitamin causes red blood cell fragility:
a. vitamin A b. vitamin K c. Vitamin D d. vitamin E

C 200. The end-product in the hydrolysis of glycogen is:

a. galactose b. mannose c. glucose d. arabinose

A 201. In which form is glucose stored in the liver?

a. glycogen b. glucose (unchanged) c. sucrose d. starch

B 202. Which of the following is NOT an ID test for proteins and amino acids?
a. Ninhydrin b. Bial’s c. Biuret d. Xanthoproteic

D 203. What vitamin deficiency causes pellagra?

a. riboflavin b. thiamin c. pantothenic acid d. nicotinic acid

D 204. All are pyrimidine base, except:

a. cytosine b. thymine c. uracil d. guanine

B 205. The sugar that yields only glucose when hydrolyzed is:
a. galactose b. maltose c. fructose d. sucrose

D 206. Which is not a B-complex vitamin?

a. folic acid b. nicotinic acid c. riboflavin d. ascorbic acid

A 207. The following sugars are aldohexoses except:

a. fructose b. galactose c. glucose d. mannose

D 208. All the amino acid below contain sulfur, except:

a. cystine b. methionine c. cysteine d. glycine

A 209. The following are essential fatty acids, except:

a. oleic acid b. linoleic acid c. linolenic acid d. arachidonic acid

D 210. This test detects the presence of two or more peptide bonds:
a. Ninhydrin b. Fehling’s c. Tollen’s d. Biuret

B 211. This vitamin easily undergoes oxidation:

a. vitamin A b. vitamin C c. vitamin B12 d. vitamin B1

B 212. The end product of anaerobic glucose metabolism is:

a. pyruvate b. lactate c. carbon dioxide d. water

A 213. The inactive form of an enzyme is sometimes called:

a. zymogen b. holoenzyme c. apoenzyme d. coenzyme

D 214. Photosynthesis is a process involved in the manufacture of:

a. carbohydrates b. fats c. proteins d. all of the above

B 215. The major extracellular cation is:

a. potassium b. sodium c. calcium d. iron
Biochemistry Page 9 of 12
B 216. Which sugar will not give a red precipitate with cupric oxide when heated with Benedict’s solution?
a. glucose b. sucrose c. maltose d. fructose

A 217. Night blindness is a symptom of a deficiency in this vitamin:

a. vitamin A b. vitamin C c. vitamin B d. vitamin D

D 218. The activation of pepsinogen requires:

a. NaOH b. bicarbonate c. acetic acid d. HCl

D 219. Nucleosides upon hydrolysis will yield:

a. adenine + phosphate b. quanine + phosphate c. histones + ribosed. cytosine + ribose

C 220. Protein digestion starts in the:

a. mouth b. small intestine c. stomach d. large intestine

C 221. Major form of utilizable energy in all cells:

a. ADP b. GDP c. ATP d. GTP

A 222. Which of the following supplies the highest amount of energy per gram?
a. fat b. glycogen c. protein d. starch

A 223. The following are proteins in milk, except:

a. rennin b. casein c. lactoalbumin d. lactoglobulin

A 224. The conversion of beta carotene to vitamin A is carried out in the:

a. liver b. small intestine c. lungs d. pancreas

A 225. This sugar is also called an “invert sugar”:

a. sucrose b. fructose c. glucose d. galactose

A 226. What type of sugar is found in nucleic acids?

a. riboses b. glucoses c. mannoses d. galactoses

D 227. The biochemical function of hemoglobin is:

a. defense b. regulatory c. structural d. oxygen transport

C 228. The following enzymes catalyze hydrolysis reactions, except:

a. proteases b. esterases c. transaminases d. nucleases

C 229. Porphyrins are involved in the building of:

a. bones b. muscles c. blood d. connective tissue

B 230. Which among the following sugar is sweetest?

a. glucose b. fructose c. sucrose d. galactose

A 231. Information and control centers of the cell:

a. nucleoproteins b. enzymes c. carbohydrates d. lipids

A 232. Hydrolysis of nucleoproteins will yield:

a. Nucleic acids and histones c. nucleic acid and purines
b. nucleic acid and sugar d. nucleic acid and pyrimidines

C 233. The condition wherein protein is found in the urine is:

a. glycosuria b. ketonuria c. proteinuria d. dysuria

A 234. Alpha-hydroxy propionic acid is:

a. lactic acid b. aminoacetic acid c. ascorbic acid d. pyruvic acid

B 235. This test detects the presence of indole rings:

a. Molisch b. Hopkin’s cole c. Millon’s d. Ninhydrin

C 236. The steps of central states:

a. replication, translation and transcription c. replication, transcription and translation
b. replication, transcription and transmission d. transcription, translation and replication

B 237. Reverse transcription takes place in:

a. bacteria b. viruses c. algae d. molds

D 238. The number of chromosomes in the human cells is:

a. 41 b. 42 c. 43 d. 46

A 239. Digestion of starch starts in the :

a. mouth b. stomach c. small intestine d. large intestine

D 240. The ordered steps in protein synthesis is:

a. transcription, transplantation, activation, elongation c. initiation, activation, elongation, termination
b. activation, elongation, initiation, termination d. activation, initiation, elongation, termination

D 241. Genetic code is:

a. universal b. composed of 3 nucleotides c. continuous d. all are correct

B 242. Which of the following is called transamination?

a. conversion of amino acids to hydroxy acids c. lose of ammonia from amino acids
Biochemistry Page 10 of 12
b. conversion of amino acids to keto acids d. formation of ammonium salts from ammonia
A 243. Dextran is:
a. carbohydrate b. glucose polymer c. glycoside d. protein

B 244. A genetic disease due to defective mechanism for pyrimidine dimmers:

a. phenyl ketonuria b. xeroderma pigmentosum c. albinism d. N-glycosyl linkage

D 246. The type of RNA molecule that brings amino acids to the site of protein synthesis is:
a. rRNA b. aRNA c. mRNA d. tRNA

D 247. Most allergies are caused by:

a. Error in the immune system b. histamines produced by the body c. dust d. all of the above

B 248. RNA which plays an important role in the structure and biosynthetic function of ribosome:
a. mRNA b. rRNA c. tRNA d. DNA

D 249. In the secondary structure of RNA:

a. adenine will always pair with thymine c .cytosine will always pair with uracil;
b. cytosine will always pair with thymine d. adinine will always pair with uracil

D 250. A nucleic acid is made up of:

a. sugar, nucleoside and a base c. nitrogenous base, amino acid and sugar
b. proteins, sugar and a phosphate group d. nitrogenous base, phosphate and sugar

C 251. Bond between 2 amino acids

a. glycosidic bond b. N-glycosyl linkage c. peptide bond d. hydrogen bond

A 252. Which of the following is not a test for protein?

a. acrolein b. Biuret c. Millons d. xanthoproteic

A 253. Acetyl CoA combines with oxaloacetate to form:

a. citrate b. carnitine c. acyl-carnitine d. none of the above

B 254. The proteins that make the fur, wool, claws and feathers:
a. collagen b. keratin c. silk d. none of the above

B 255. Liquid vegetable oils may be transformed into solid fats by the process of:
a. oxidation b. hydrogenation c. substitution d. reduction

B 256. The chemical messengers produced by the endocrine glands:

a. genes b. hormones c. vitamins d. enzymes

A 257. It is the sugar found in milk:

a. lactose b. maltose c. sucrose d. raffinose

C 258. Prostaglandins are synthesized from:

a. oleic b. stearic c. essential fatty acid d. non-essential fatty acid

C 259. Amino acid at an isoelectric point exists as:

a. acid b. base c. zwitterions d. none of the above

B 260. The color of the skin, hair and eyes is due to pigment called:
a. cytochrome b. melanin c. keratin d. heparin

B 261. Starches are partially digested in the mouth by:

a. protease b. ptyalin c. pepsionogen d. pepsin

C 262. The only element in living matter from strong multiple bonds readily are:
a. oxygen b. nitrogen c. carbon d. all of the above

A 263. Serotonin, a neurotransmitter, is derived from the amino acid:

a. tryptophan b. threonine c. tyrosine d. phenylalanine

A 264. Alkaline hydrolysis of fat:

a. saponification b. hydrogenation c. alkalinization d. hydroxylation e. all of the above

C 265. The main center of biosynthesis of nucleic acid is the:

a. cell wall b. cytoplasm c. nucleus d. none of the above

A 266. Normal pH of the blood:

a. 7.4-7.45 b. 6.6-6.9 c. 5.5-6.6 d. 4.8-8

A 267. Known as good cholesterol:

a. HDL b. ergocalciferol c. ACTH d. LDL

A 268. Blood minus its cellular components:

a. plasma b. serum c. hemoglobin d. fibrin

B 269. Which of the following is not an amino acid:

a. leucine b. choline c. valine d. lysine

A 270. Are globular proteins, except:

Biochemistry Page 11 of 12
a. collagen b. serum albumins c. serum globulins d. hemoglobin

D 271. The precursor of vitamin A is:

a. arachidonic acid b. isoprene c. naphtoquinone d. carotene

B 272. Are fibrous proteins, except:

a. keratin b. histones c. elastin d. collagen

C 273. A type of antibodies that plays an important role in allergic response which causes anaphylactic shock,
hayfever and asthma:
a. IgA b. IgM c. IgE d. IgG

C 274. An inherited disease that affect red blood cells:

a. albinism b. hyperglycemia c. sickle cell anemia d. hypoglycemia

D 275. Are esters of fatty acids with glycerol:

a. phospholipids b. glycolipids c. waxes d. fats

A 276. The metallic salt of a high fatty acid:

a. soap b. detergent c. inorganic salt d. glycerin

A 277. The following are enzymes found in pancreatic juice, except:

a. papain b. trypsin c. chymotrypsin d. carboxypolypepticase

C 278. The following are pathological constituents of urine, except:

a. glucose b. albumin c. creatinine d. blood

D 279. All of the following carbohydrates are considered to be polysaccharide, except:

a. heparin b. starch c. glycogen d. maltose

C 280. Which of the following hormones promotes rapid glycogenolysis in both liver and muscle:
a. ACTH b. glutemine c. epinephrine d. prolactin

D 281. Fruity odor of urine is indicative of acetone bodies, a diagnostic value in case of acidosis in:
a. diabetes insipidus b. porphyria c. cretinism d. diabetes mellitus

B 282. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine

C 283. The precursor of vitamin D3:

a. ergosterol b. stigmasterol c. 7-dehydrocholesterol d. cholesterol

B 286. The enzyme present in the stomach which hydrolyzes proteins:

a. trypsin b. pepsin c. amylopsin d. enterokinase

B 287. The reaction that takes place in cytoplasm:

a. aerobic b. anaerobic c. oxidation d. reduction

C 288. Compounds of protein with a carbohydrate component:

a. lipoproteins b. phosphoproteins c. glycoproteins d. nucleoproteins

D 289. What amino acid functions as a hormone?

a. valine b. leucine c. alanine d. thyroxine

C 290. The pathway that occurs in the mitochondria:

a. urea cycle b. citric acid cycle c. glycolysis d. fatty acid cycle

C 291. Carbohydrates that cannot be hydrolyzed to compounds with simpler molecules:

a. oligosaccharides b. disaccharides c. monosaccharides d. polysaccharides

D 292. In the metabolism of protein, the liver:

a. synthesizes amino acids b. breaks down amino acid c. absorbs blood d. stores amino acid

B 293. What is the stage of glucose oxidation that requires oxygen?

a. anaerobic b. aerobic c. catabolic d. anabolic

B 294. An important protein in contractile muscle:

a. keratin b. myosin c. elastin d. fibrin

C 295. Which is the main constituent of the group substance in the connective tissue?
a. heparin b. fructosan c. hyaluronic acid d. mannosan

C 296. Raffinose, an important non-reducing sugar, is a:

a. monosaccharide b. disaccharide c. trisaccharide d. tetrasaccharide

A 297. Non-protein molecules that are often associated with proteins are called:
a. prosthetic group b. side chain c. zwitterions d. casein

A 298. They are chemical messengers:

a. hormones b. enzymes c. vitamins d. amino acids

C 299. It is a polysaccharide:
a. lactose b. maltose c. amylose d. fructose
Biochemistry Page 12 of 12

B 300. Which sugar contains an aldehyde group?

a. ketose b. aldose c. sorbitol d. mannitol