See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/322438689

Phylogenetic relationships of the Orang Asli (Proto Malay) tribe based on the
HVS II gene sequences

Article  in  Malaysian Applied Biology · December 2017

CITATIONS READS

3 572

5 authors, including:

Badrul munir Md zain Khai Ang

Universiti Kebangsaan Malaysia Penn State Hershey Medical Center and Penn State College of Medicine
137 PUBLICATIONS   930 CITATIONS    27 PUBLICATIONS   247 CITATIONS   

SEE PROFILE SEE PROFILE

Lee-Sim Lim Salmah Yaakop

Universiti Sains Malaysia Universiti Kebangsaan Malaysia
23 PUBLICATIONS   145 CITATIONS    135 PUBLICATIONS   400 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

TAXONOMY AND PHYLOGENETIC OF REDUVIIDAE View project

Population Genetics of Asian Elephant in Taman Negara National Parks, Peninsular Malaysia View project

All content following this page was uploaded by Badrul munir Md zain on 13 January 2018.

The user has requested enhancement of the downloaded file.

Malays. Appl. Biol. (2017) 46(4): 35–42

PHYLOGENETIC RELATIONSHIPS OF THE ORANG ASLI

(PROTO MALAY) TRIBE BASED ON THE HVS II
GENE SEQUENCES

MD-ZAIN, B.M.1*, TEH, M.S.1, ANG, K.C.1,2, LIM, L.S.1,3 and YAAKOP, S.1

1School of Environmental and Natural Resource Sciences, Faculty of Science and Technology,
Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor
2Division of Experimental Pathology, Penn State College of Medicine,

Hershey, Pennsylvania 17033, USA

3School of Distance Education, Universiti Sains Malaysia,

11800, Penang, Malaysia

*
E-mail: abgbadd@ukm.edu.my, abgbadd1966@yahoo.com

Accepted 2 November 2017, Published online 31 December 2017

ABSTRACT

The Proto Malays are the second largest Orang Asli tribe in Peninsular Malaysia. There are six subtribes of Proto Malays,
namely the Jakun, Kanaq, Kuala/Laut, Seletar, Temuan and Semelai. Very little is known about the phylogenetic relationships
among the Proto Malay subtribes. This study aims to reveal the phylogenetic relationships of the Proto Malays using HVS II
D-Loop sequences. Blood samples were collected from all six subtribes. DNA was extracted and 369 bp of HVS II (D-Loop
region) was amplified. Phylogenetic trees were constructed using Maximum Parsimony (MP) and the Neighbour Joining
(NJ) method. The HVS II D-Loop gene sequence analysis revealed close phylogenetic relationships between all the Proto
Malay subtribes as they can be assembled into a single clade. Amongst all the Proto Malay subtribes, the Kanaq shared the
closest phylogenetic relationships among themselves with the lowest pairwise genetic distance of 0.0055 and they also formed
a monophyletic clade in the NJ and MP tree. The NJ tree explained the phylogenetic relationships of the Proto Malay subtribes
the best, as it portrayed the genetic distances of the subjects involved apart from the branching patterns. This study provides
an insight into how different Proto Malay subtribes are genetically related to each other although their physical attributes may
differ. It also distinguishes the uniqueness of each subtribe based on their genetics.

Key words: Proto Malay, Orang Asli, HVS II, D-loop, Aboriginal Malaysians

INTRODUCTION Southeast Asian region through the Philippines

The Proto Malays are the second largest Orang Asli
tribe after the Senoi. They encompass 42.03% of
the Orang Asli population or 55,852 people. Proto
Malays can be further divided into six subtribes
namely the Jakun, Kanaq, Kuala, Seletar, Temuan
and Semelai (Lim et al., 2010; Ang et al., 2011).
Most of the Proto Malays are settled in the middle
and southern parts of Peninsular Malaysia. Based
on their culture, linguistic history and artifacts,
Proto Malays are believed to have migrated from
the middle part of Asia (Yunnan) (Fix, 1995).
Archeology and linguistic findings suggest that
proto-Austronesian speakers settled in Taiwan about
4000 B.C. before migrating southwards to the
* To whom correspondence should be addressed.
into Borneo, Sulawesi, Central Java, and Eastern
Indonesia 2500 years ago. The second wave of
migration occurred from central Java back to the
north and into peninsular Malaysia via the Straits
of Malacca between 1500 and 500 B.C. (Andaya,
2001). Orang Kuala are believed to have migrated
from Sumatra Island and the Kanaq migrated from
the Riau Islands.
Mitochondrial DNA (mtDNA) is an ideal
molecule for the analysis of ancient DNA, forensic
and conservation purposes (Alves-Silva et al., 2000;
Ang et al., 2012a). Owing to its strict maternal
inheritance (Rosli et al., 2011; Vun et al., 2011),
mtDNA allows studies of ancient lineages to be
conducted, revealing maternal ancestry that
excludes any recombination (Alves-Silva et al.,
2000). MtDNA analysis has contributed to a better
36 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES

understanding of the migrations that shaped global modified from Fucharoen et al. (2001) with 40
human populations (Shurr et al., 1990; Silva et al., cycles of amplification that involved denaturation
2003). To date, genetic studies of the Orang Asli in before PCR at 94ºC for 180 seconds, denaturation
Peninsular Malaysia has yet to be considered as at 94ºC for 30 seconds, annealing of primers at 54ºC
absolutely comprehensive (Ang et al., 2012b). Many for 30 seconds, elongation at 72ºC for 30 seconds
previous studies involving mtDNA analysis are and final elongation at 72ºC for 600 seconds.
still unable to provide a clear picture that clearly Amplification was performed in an Eppendorf
describes the evolution and dispersion of the Orang PCR machine using 25 μl of total volume per
Asli (Ang et al., 2011). reaction with 13 μl of double distilled water
There is less understanding of the Proto Malays (ddH2O), 5 μl of PCR buffer, 2.5 μl of MgCl, 1 μl of
compared to the Negrito and Senoi because of their dNTPs, 0.5 μl of the forward and reverse primers
similarities with the Deutero-Malays which are respectively, 0.5 μl of Taq Polymerase and 2 μl of
considered the direct ancestors of present-day Malay DNA sample. Successful amplification products
people (Lim et al., 2010). Although a study on the were purified before sequencing.
human genetic diversity of Asia was conducted by The DNA sequences obtained were edited
the HUGO Pan-Asian SNP Consortium (2009), it manually with the aid of Bioedit (Hall, 1999) and
only managed to show that the Negrito and non- aligned using Clustal W software (Thompson et al.,
Negrito populations of Southeast and East Asia 1994). Phylogenetic trees were constructed using
entered the continent via a single primary wave PAUP version 4.0b10 (Swofford, 2002) with two
of entry. They, however, did not explore the methods of analysis, Neighbor-Joining (NJ) with
phylogenetic relationships of all three Orang Asli
main tribes especially in Malaysia. Hill et al. (2006)
provided ideas on the people of Southeast Asia by Table 1. List of Proto-Malay genetic samples used in this
study
looking at the genetic history of the Orang Asli
based on the analysis of the coding and non-coding
Subtribe Code Location
regions of mtDNA. However, they were still unable
to clearly explain the phylogenetic relationships Seletar PMA3 Kg. Sg. Temon, Johor Bharu
between the different sub-tribes of the three major PMA4 Kg. Sg. Temon, Johor Bharu
tribes, specifically the sub-tribes of the Proto PMA5 Kg. Sg. Temon, Johor Bharu
PMA7 Kg. Sg. Temon, Johor Bharu
Malays. PMA12 Kg. Sg. Temon, Johor Bharu
Molecular systematic studies of the Proto
Malays by Ang (2009), Ang et al. (2012c) and Lim Jakun PMJ1 Kota Tinggi, Johor
et al. (2010) were able to expose new clues on the PMJ2 Kota Tinggi, Johor
PMJ3 Kota Tinggi, Johor
phylogenetic relationships between the subtribes of PMJ5 Kota Tinggi, Johor
the Proto Malays. Ang (2009) only used the HVS I, PMJ8 Kota Tinggi, Johor
Cyt b and SRY genes whereas Lim et al. (2010) only PMJ13 Kota Tinggi, Johor
included HVS I of the D-loop region segment and PMJ15 Kota Tinggi, Johor
9 bp deletion of the intergenic region of COII/ Kanaq PMK8 Sg Selangi, Johor
tRNALys of mtDNA. Thus, in this study we have PMK11 Sg Selangi, Johor
included the HVS II gene of the D-Loop region to PMK12B Sg Selangi, Johor
see its effectiveness in portraying Proto Malay PMK17 Sg Selangi, Johor
phylogenetic relationships. Kuala/Laut PML1 Sg. Layau, Johor
PML2 Sg. Layau, Johor
PML5 Sg. Layau, Johor
MATERIALS & METHODS PML6 Sg. Layau, Johor
PML13 Sg. Layau, Johor
PML14 Sg. Layau, Johor
Blood samples of Proto Malay (Jakun, Temuan,
Semelai, Kuala, Seletar, and Kanaq) populations Semelai PMS2B Pos Iskandar, Pahang
were collected at Orang Asli settlements (Table 1) PMS5 Pos Iskandar, Pahang
PMS9 Pos Iskandar, Pahang
through collaboration with Hospital Universiti PMS10 Pos Iskandar, Pahang
Kebangsaan Malaysia and Hospital Jabatan Hal PMS11 Pos Iskandar, Pahang
Ehwal Orang Asli. At least three generations were PMS13 Pos Iskandar, Pahang
confirmed for their origin and ethnicity through a
Temuan PMT1 Bkt. Manchong, Selangor
simple interview. Genomic DNA was extracted using PMT2 Mantin, Negeri Sembilan
QIAamp DNA Blood mini kits. PMT5 Bkt. Manchong, Selangor
In order to amplify the HVS II gene of the D- PMT6 Bkt. Manchong, Selangor
loop region, a set of primers was used (Table 2). PMT10 Bkt. Manchong, Selangor
PMT12A Bkt. Manchong, Selangor
Primers used were based on PCR conditions
 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES 37

Table 2. Primers used for the PCR process

Gene Primers Primer Sequence

HVS II Forward conL4 (5' GGTCTATCACCCTATTAACCAC 3')

Reverse conH4 (5' CTGTTAAAAGTGCATACCGCCA 3')

Table 3. Genetic Distances of the Proto Malay subtribes and African

African Seletar Jakun Kanaq Kuala Semelai Temuan

African –
Seletar 0.0149 0.0122
Jakun 0.0199 0.0595 0.0438
Kanaq 0.0214 0.0185 0.0472 0.0055
Kuala 0.0201 0.0416 0.0684 0.0556 0.0323
Semelai 0.0208 0.0361 0.0672 0.0403 0.0557 0.0245
Temuan 0.0168 0.0472 0.0542 0.0487 0.0482 0.0474 0.0178

Kimura 2 parameter algorithms and Maximum
Parsimony (MP) with Stepwise Addition of 1000
replicates in heuristic search (Nei & Kumar, 2000;
Swofford, 2002). All trees were subjected to
bootstrap analysis with 1000 replicates.
RESULTS
A PCR reaction was successfully performed with
optimum PCR conditions. Of the 369 bp characters,
348 (94.31%) characters were found to be constant
and the 11 (2.98%) variable characters detected
were parsimony-uninformative. The number of
parsimony-informative characters was 10 (2.71%).
Based on the genetic distances (Table 3) computed
using the Kimura 2-parameter model, it was found
that the genetic distances between and among the
subtribes were low as the value did not exceed 0.1.
Within the same subtribe, the Jakun subtribe has the
highest genetic distance amongst themselves which
is 0.0438 compared to other subtribes. The Kanaq
subtribe showed the lowest genetic distance value
among themselves (0.0055). The Kuala subtribe
came in as the second furthest among themselves
with a genetic distance of 0.0323, followed by the
Semelai (0.0245), Temuan (0.0178) and Seletar
(0.0122). As for the genetic distance between the
subtribes of the Proto Malay, Jakun and Kuala
showed the highest value at 0.0684. The Seletar
and Kanaq showed the lowest genetic distance at
0.0185 and followed by Seletar and Semelai with
the value of 0.0361.
The NJ tree (Figure 1) showed close relationships
among Proto Malay subtribes with three main
subclades derived. In subclade A, three Kanaq
samples were found to cluster together supported by
a bootstrap value of 55%. A close relationship
between the Jakun and Semelai can also be depicted
supported by 50% bootstrap value. In subclade B,
polytomy occurred, thus the genetic relationships
between the Seletar, Jakun, Semelai, Kanaq and
Temuan could not be determined. However, a close
relationship between the Kuala, Semelai and
Temuan can be observed with an even closer
relationship between the Semelai and Temuan.
Subclade C showed that the Jakun, Semelai and
Temuan are closely related.
The bootstrap tree for MP analysis (Figure 2)
was obtained with a heuristic search of 1000
replicates has a Consistency Index (CI) of 0.7097,
Rescaled Consistency Index (RC) of 0.5766 and
Homoplasy Index (HI) of 0.2903. Two main clades
were shown in this tree. In clade I, all the subtribes
of the Proto Malay were present. Subclade A
consisted of all the subtribes except for the Temuan
and within this subclade, the Kanaq are found to
form a monophyletic group, supported by a 41%
bootstrap value. Such clustering was also found in
the NJ tree. In addition, subclade A also showed a
monophyletic grouping of the Jakun with the
Semelai. This subclade also showed a certain degree
of closeness between the Kanaq, Kuala and Seletar.
As for subclade B, all the ingroups are in polytomy
condition. In clade II, polytomy occurred for
Jakun, Semelai and Temuan and thus their genetic
relationship could not be clearly inferred. However,
clade II still exposed a close grouping for the Jakun
and Temuan.
38 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES

Fig. 1. Neighbour-Joining phylogenetic tree of the Proto Malay. Numbers indicate bootstrap values (%).

DISCUSSION believed to have originated from Africa 100,000 –

This study consisted of 35 samples whereby 34
samples encompassed ingroups of the Proto Malay
subtribes (Seletar, Jakun, Kanaq, Kuala/Laut,
Semelai and Temuan) and an African tribe as the
outgroup. The African tribe made a good outgroup
as all human beings living at the present time are
200,000 years ago before migrating to Eurasia and
other continents, as depicted from the ‘Out of Africa’
theory (Stringer & Andrews, 1988). As much
evolution has occurred since the departure and
dispersal from Africa, the genetic constitution of the
Proto Malay may have greatly varied from the
Africans. Nonetheless they are still close enough to
 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES 39

Fig. 2. Bootstrap MP tree of the HVS II gene sequences of the Proto Malay using heuristic search. Numbers at the branches
indicate bootstrap values (%).

be categorized under the same species of Homo
sapien as the Africans. This then makes the Africans
an ideal and uncontroversial outgroup that will
allow for a clear genetic relationship between the
ingroups to be inferred. However, results showed that
genetic distance between ingroup and outgroup was
quite closed that may due to genetic variation is
lower in HVS II as compared to HVS I.
Based on the phylogenetic trees constructed
using the NJ and MP analysis, the clustering of the
Kanaq samples was most evident from the trees. Such
clustering of the Kanaq was also observed in the
study of Ang (2009) using HVS I and Cyt b genes.
The pairwise distances computed in this study also
revealed that the genetic distance within the Kanaq
are the lowest when compared to the genetic
40 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES
distances within other Proto Malay subtribes.
Factors that contributed to such a result may be
owing to the social lifestyle of the Kanaq. They are
well-known for being reserved and have minimal
interaction with other ethnic groups including other
Orang Asli subtribes; they often live in isolation.
Furthermore, intermarriage with other ethnic groups
is also strictly prohibited in their culture (Carey,
1976). The Kanaq is the smallest Orang Asli
tribe in Peninsular Malaysia with a population of
approximately 83 individuals (JHEOA, 2002).
Being the smallest Orang Asli subtribe in Peninsular
Malaysia, continuous intermarriage within the
same subtribe may give rise to inbreeding leading
to individuals with very similar genetics and
decreasing genetic variation in the gene pool. Low
genetic diversity decreases the genetic differences
amongst the individuals of the Kanaq subtribe.
Continuous inbreeding may lead to inbreeding
depression which will also lead to the expression of
recessive genes (Lim et al., 2010).
The tree topologies also revealed a close
relationship between the Kanaq, Kuala and Seletar
as also depicted by Ang (2009). The closeness
between them may be due to the fact that they are
all dwell in southern Johor (Ang, 2009). The
pairwise genetic distance showed that the Kanaq
has the lowest genetic distance with the Seletar
which is in accordance with the study by Lim et al.
(2010) using the HVS I gene, which grouped the
Seletar and Kanaq under one clade as they shared
the same haplotype. The closeness of the Kuala with
the Seletar is higher compared to the Kuala with the
Kanaq may be owing to the fact that the Kuala are
river estuary and coastal dwellers whereas the Seletar
are sea voyagers and both depend on marine and
aquatic products as a source of economy (Carey,
1976; Macaulay et al., 2005). Intermarriages
between the Kuala and Seletar may occur, especially
after the conversion of the Kuala to Islam (JHEOA,
2002). The Kuala and Kanaq are supposed to be
close from an anthropological point of view as the
Kanaq is believed to have originated from Riau
and the Kuala from Sumatera (JHEOA, 2002). The
Kanaq may also be descendants of the Kuala (Lim
et al., 2010), hence intermarriages between the
Kuala with the Seletar may give rise to Seletar
descendants that are genetically closer to Kanaq
than the Kuala.
The Seletar, also known as sea nomads, are fully
dependent on sea produce as their main source of
economy (Carey, 1676; Macaulay et al., 2005) and
are the second smallest Proto Malay subtribe (Lim
et al., 2010). However, owing to their nomadic
lifestyle and the lack of prohibitions towards
intermarriages, this subtribe is still able to maintain
a higher haplotype variation compared to the Kanaq.
As intermarriages between the Seletar and non-Orang
Asli ethnic groups such as the Chinese, Duetero-
Malay and Borneo aborigines are not uncommon
(Lim et al., 2010), the early splitting of the Seletar
from the other ingroups for all phylogenetic trees
constructed may be explained. A rather close genetic
distance between the Seletar and the Semelai may
also be explained by intermarriages between these
2 subtribes (Lim et al., 2010).
The Jakun are the largest subtribe of the Proto
Malay, and this is expressed in the furthest genetic
distance within the tribe as supported by Ang
(2009). One factor that may contribute to this is the
size of the Jakun subtribe, being the largest and
most widespread, enhanced by their culture and
practices which restricts marriages to respective
locations or villages. Thus, different populations of
Jakun dwelling in different areas may diverge
independently of other populations. This gives rise
to a different gene pool within the same Jakun
subtribe and thus contributes to high genetic
distances within the Jakun. The Jakun subtribe has
the highest genetic distance (0.0684) from the Kuala
indicating a very distant relationship (Lim et al.,
2010). This finding could also be explained by
anthropological studies that reveal that the two
subtribes originated from two different geographical
locations. The Jakun are believed to have originated
from Yunan 5000 years ago (Kasimin, 1991; JHEOA,
2002) whereas the Kuala were from the Riau-Lingga
and Sumatera islands (Carey, 1976; JHEOA, 2002).
Since both subtribes dwelled in different
geographical areas once, hence they may evolve
differently in order to adapt to their environment
and this may contribute to the high genetic
differences between them.
The Semelai is closely grouped with either the
Jakun or the Temuan. Lim et al. (2010) also found
that the haplotypes of these three subtribes can be
found in one clade although no sign of a close
relationship could be observed among the three
subtribes. Pairwise distance obtained in this study
for the Temuan and Semelai were found to be lower
compared to the Semelai and the Jakun, indicating
a closer genetic relationship between the former two
subtribes. Results from Ang (2009) also portrayed a
higher degree of closeness between the Semelai and
Temuan. The close grouping of the Jakun and
Semelai in the tree topologies may be due to their
geographical location, both being situated in
southern Johor, allowing for the possibility of
intermarriage or migration between the two
subtribes, giving rise to the closeness. Furthermore,
based on the study by Baer (1999) using Duffy A
allele, the Jakun and the Semelai share 2 haplotypes
whereas the Semelai and the Temuan only share 1
haplotype and this contribute to a closer
relationship between the Semelai and the Jakun.
 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES
Locus effectiveness
The HVS II gene can be found in the non-coding
D-Loop region of mtDNA with the second highest
mutational rate after HVS I (Ang, 2009). Although
it has the second highest mutational rate, this gene
is still useful in unleashing the lineage history of
human. For example, Yao et al. (2002) found that
the analysis of HVS II further enhanced the
information obtained to differentiate two
macrohaplogroups (M and N) in the Han Chinese.
In this study, the HVS II gene was still able to
produce a clear picture of the phylogenetic
relationships among and within the subtribes of the
Proto Malay looking at tree topologies. However,
bootstrap values supporting these branching
patterns were still found to be rather low, with most
of them below 50%. This may be caused by the fact
that the subjects are all of the same main tribe (Proto
Malay) and hence it is still difficult to unravel their
phylogenetic relationships as they are closely
related. HVS I is one of the three most variable
regions in the D-loop of mtDNA (Ang et al., 2011).
However, in this study, HVS II also managed to
reveal Malay-Proto phylogenetic relationships.
MtDNA will help to define the relationships
between the tribes at various points in history and
subsequently map migration routes.
ACKNOWLEDGMENTS
We would like to thank the Jabatan Hal Ehwal Orang
Asli and the various health clinics, Ministry of
Health Malaysia and Forensic Department of Pusat
Perubatan Universiti Kebangsaan Malaysia, for their
assistance and help in accessing the various villages.
Research supported by grants ST-007-2003; ST-008-
2003; UKM-GUP-ASP-07-04-146; GUP-2014-084
and AP-2015-004. Written consent was obtained
from each participant and this study was approved
by the IRB committees of Universiti Kebangsaan
Malaysia (UKM 1.5.3.5/244/FST-001-2010) and
proceeded with permission from Jabatan Hal Ehwal
Orang Asli, Malaysia (JHEOA) (PP.30.032 Jld
15(16).
REFERENCES
Alves-Silva, J., Da Silva Santos, M., Guimaraes,
P.E.M., Ferreira, A.C.S., Bandelt, H., Pena, S.D.J.
& Ferreira, P.V. 2000. The Ancestry of Brazilian
mtDNA Lineages. American Journal of Human
Genetics, 67(2): 444-461.
Andaya, L.Y. 2001. The Search for the origins’ of
Melayu. Journal of Southeast Asian Studies, 32:
315-330.
41
Ang, K.C. 2009. Sistematik Molekul Orang Asli di
Semenanjung Malaysia. Ph.D thesis, Universiti
Kebangsaan Malaysia, Malaysia.
Ang, K.C., Leow, J.W.H., Yeap, W.K., Hood, S.,
Mahani, M.C. & Md-Zain, B.M. 2011.
Phylogenetic relationships of the Orang Asli
and Iban of Malaysia based on maternal
markers. Genetics and Molecular Resources, 10:
640-649.
Ang, A., Srivasthan, A., Md-Zain, B.M., Ismail,
M.R.B. & Meier, R. 2012a. Reproduction and
infant pelage colouration of the banded leaf
monkey (Mammalia: Primates: Cercopithecidae)
in Singapore. Raffles Bulletin of Zoology, 60(2):
589-594.
Ang, K.C., Ngu, M.S., Reid, K.P., Teh, M.S., Aida,
Z.S., Koh, D.X.R., Berg, A., Oppenheimer, S.,
Salleh, H., Clyde, M.M., Md-Zain, B.M.,
Canfield, V.A. & Cheng, K.C. 2012b. Skin
colour variation in Orang Asli tribes of
Peninsular Malaysia. Plos One, 7(8): e42752.
Ang, K.C., Lim L.S., Md-Zain, B.M. & Mahani, M.C.
2012c. Molecular systematics of Orang Kanaq
(Proto Malays) inferred from maternal and
paternal markers. In Zainuddin, Z. (eds) Genetic
and Dental Profiles of Orang Asli of Peninsular
Malaysia. Universiti Sains Malaysia Press,
Penang. 41-52 pp.
Baer, A. 1999. Health, disease and survival: a
biomedical and genetic analysis of the Orang
Asli of Malaysia. Center for the Orang Asli
Concern, Kuala Lumpur.
Carey, I. 1976. Orang Asli the aboriginal tribes of
Peninsular Malaysia. Oxford University Press.
Fix, A.G. 1995. Malayan paleo sociology:
Implications for patterns of genetics variation
among the Orang Asli. American Anthro-
pologist, 97(2): 313-323.
Fucharoen, G., Fucharoen, S. & Horai, S. 2001.
Mitochondrial DNA polymorphisms in
Thailand. Journal of Human Genetics, 46: 115-
125.
Hall, T.A. 1999. BioEdit: a user-friendly biological
sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids
Symposium Series, 41: 95-98.
Hill, C., Soares, P., Mormina, M., Macaulay, V.,
Meehan, W., Blackburn, J., Clarke, D., Raja,
J.M., Ismail, P., Bulbeck, D., Oppenheimer, S. &
Richards, M. 2006. Phylogeography and
ethnogenesis of aboriginal Southeast Asian.
Molecular Biology and Evolution, 23: 2480-
2491.
HUGO Pan-Asian SNP Consortium. 2009. Mapping
Human Genetic Diversity in Asia. Science, 326:
1541.
 42 THE ORANG ASLI (PROTO MALAY) TRIBE BASED ON THE HVS II GENE SEQUENCES
JHEOA, 2002. Kehidupan, Budaya dan Pantang
Larang Orang Asli. Kementerian Pembangunan
Luar Bandar. Jabatan Hal Ehwal Orang Asli,
Kuala Lumpur.
Kasimin, A. 1991. Religion and Social Change
Among the Indigenous People of the Malay
Peninsular. Dewan Bahasa dan Pustaka, Kuala
Lumpur.
Lim, L.S., Ang, K.C., Mahani, M.C., Shahrom, A.W.
& Md-Zain, B.M. 2010. Mitochondrial DNA
Polymorphism and Phylogenetic Relationships
of Proto Malays in Peninsular Malaysia.
Journal of Biological Sciences, 10: 71-83.
Macaulay, V., Hill, C., Achilli, A., Rengo, C.,
Clarke, D., Meehan, W., Blackburn, J., Semina,
O., Scozzari, R., Cruciani, F., Taha, A., Kassim
Shaari, N., Maripa Raja, J., Ismail, P., Zainuddin,
Z., Goodwin, W., Bulbeck, D., Bandelt, H.J.,
Oppenheimer, S., Torroni, A. & Richards, M.
2005. Single, rapid coastal settlement of Asia
revealed by analysis of complete mitochondrial
genome. Science, 308: 1034-1036.
Nei, M. & Kumar, S. 2000. Molecular evolution and
phylogenetics. Oxford University Press, New
York.
Rosli, M.K., Zakaria, S.S., Syed-Shabthar, S.M.,
Zainal, Z.Z., Shukor, M.N., Mahani, M.C., Abas-
Mazni, O. & Md-Zain, B.M. 2011. Phylogenetic
relationships of Malayan gaur with other
species of the genus Bos based on cytochrome
b gene DNA sequences. Genetics and Molecular
Research, 10: 482-493.
Schurr, T.G., Ballinger, S.W., Gan, Y.-Y., Hodge, J.A.,
Merriwether, D.A., Lawrence, D.N., Knowler,
W.C., Weiss, K.M. & Wallace, D.C. 1990.
Amerindian mitochondrial DNAs have rare
Asian mutations at high frequencies, suggesting
they derived from four primary maternal
lineages. American Journal of Human Genetics,
46: 613-623.
View publication stats
Silva, W.A. Jr., Bonatto, S.L., Holanda, A.J., Ribeiro-
dos-Santos, A.K., Paixão, B.M., Goldman, G.H.,
Abe-Sandes, K., Rodriguez-Delfin, L., Barbosa,
M., Paçó-Larson, M.L., Petzl-Erler, M.L.,
Valente, V., Santos, S.E.B. & Zago, M.A. 2003.
Correction: mitochondrial DNA variation in
Amerindians. American Journal of Human
Genetics, 72: 1346-1348.
Stringer, C.B. & Andrews, P. 1988. Genetic and
fossil evidence for the origin of modern humans.
Science, 239: 1263-1268.
Swofford, D.L. 2002. Phylogenetic analysis using
parsimony and other methods version 4.0 beta
version. Sinauer Associates, Sunderland.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. 1994.
CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignment
through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic
Acids Research, 22: 4673-4680.
Vun, V.F., Mahani, M.C., Lakim, M., Ampeng, A. &
Md-Zain, B.M. 2011. Phylogenetic relation-
ships of leaf monkeys (Presbytis; Colobinae)
based on cytochrome b and 12S rRNA genes.
Genetics and Molecular Research, 10: 368-381.
Yao, Y.-G., Kong, Q.-P., Man, X.-Y., Bandelt, H.-J.
& Zhang, Y.-P. 2003. Reconstructing the
evolutionary history of China: A caveat about
inferences drawn from ancient DNA. Molecular
Biology and Evolution, 20(2): 214-219.