Phylogeny of the Sphagnopsida Based on Chloroplast and Nuclear DNA Sequences

Author(s): A. Jonathan Shaw

Source: The Bryologist, 103(2):277-306. 2000.
Published By: The American Bryological and Lichenological Society, Inc.
DOI: http://dx.doi.org/10.1639/0007-2745(2000)103[0277:POTSBO]2.0.CO;2
URL: http://www.bioone.org/doi/full/10.1639/0007-2745%282000%29103%5B0277%3APOTSBO%5D2.0.CO
%3B2

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and
environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by
nonprofit societies, associations, museums, institutions, and presses.
Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s
Terms of Use, available at www.bioone.org/page/terms_of_use.
Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or
rights and permissions requests should be directed to the individual publisher as copyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries,
and research funders in the common goal of maximizing access to critical research.
 The Bryologist 103(2), pp. 277–306
Copyright 䉷 2000 by the American Bryological and Lichenological Society, Inc.

Phylogeny of the Sphagnopsida Based on Chloroplast and Nuclear

DNA Sequences

A. JONATHAN SHAW
Department of Botany, Duke University, Durham, NC 27708-0338, U.S.A.

Abstract. Most reconstructions of basal land plant relationships derived from morphological
or molecular data suggest that the Sphagnopsida form a critical clade at or near the base of the
mosses (Bryophyta s.s.). The Sphagnopsida include two orders: Sphagnales and Ambuchananiales,
each with one family. The Ambuchananiaceae is monotypic, with A. leucobryoides of Tasmania.
Nucleotide sequences from five genomic regions, two from the nuclear genome (ITS and 26S
nuclear ribosomal DNA) and three from the chloroplast genome (psbT, rpl16, trnL) were subjected
to cladistic analyses in order to assess 1) the relationship between Ambuchanania and Sphagnum,
2) the polarity of evolutionary change in Sphagnum (i.e., infer a root for the infrageneric phy-
logeny), 3) monophyly of the four large sections of Sphagnum (Acutifolia, Cuspidata, Sphagnum,
and Subsecunda) and 4) phylogenetic relationships of the smaller or monotypic sections. Ambu-
chanania is resolved as the sister group to Sphagnum and is not nested within the latter as a
highly derived species. Polarity of evolutionary change in Sphagnum is ambiguous; alternative
hypotheses suggested by molecular data place either the sect. Subsecunda or the sect. Sphagnum
as sister to all other species. The four large sections of Sphagnum are each monophyletic if
circumscribed to include species traditionally placed in monotypic sections. Sphagnum macro-
phyllum (sect. Isocladus) is nested within the Subsecunda. Sphagnum pylaesii (sect. Hemitheca)
is nested within the Cuspidata and is closely related to S. tenellum (sect. Mollusca). Sphagnum
wulfianum (sect. Polyclada) is nested within the Acutifolia, closely related to S. fimbriatum and
S. girgensohnii. Sphagnum aongstroemii (sect. Insulosa) is either nested within the Acutifolia, or
is sister to other species of Acutifolia. Molecular evidence supports a sister group relationship
between the sections Rigida and Sphagnum, and between the sections Squarrosa and Acutifolia.
Molecular data suggest that phylogenetic structure in Sphagnum can be accommodated by four
large sections without segregating morphologically distinctive taxa into smaller sections, as is
traditionally done. A revised classification is proposed in which the genus is divided into four
sections: Acutifolia, Cuspidata, Sphagnum, and Subsecunda.

The Sphagnopsida are one of the four major
groups of mosses that are often distinguished as
classes: Sphagnopsida, Andreaeopsida, Takakiop-
sida, and Bryopsida. The Sphagnopsida are char-
acterized by a suite of morphological traits pertain-
ing to both the gametophyte and sporophyte and
include basic developmental features of both gen-
erations (Ruhland 1924). The protonemata are thal-
loid after a short filamentous stage and typically
produce a single leafy gametophore (Schofield
1985). Mature gametophytes generally lack rhi-
zoids, although plants may produce rhizoids under
experimental conditions (T. Mattock, pers. comm.)
and rhizoid-bearing plants have been observed in
one species in nature (Iwatsuki 1986). There is con-
siderable diversity in gametophyte architecture, but
most typically plants of the Sphagnopsida have a
distinctive gestalt produced by fasciculate branch-
ing and the formation of a more-or-less well-de-
fined capitulum or cluster of young branches at the
stem apex. The anatomy of stems and branches is
0007-2745/00/277–306$3.15/0
unlike any other moss, often with highly differen-
tiated cortical cells that may have pores, wall fi-
brils, or both. In many species, some branch cor-
tical cells are retort shaped with an apical pore.
Elongation of the gametophyte is accomplished by
a three-sided apical cell as in other mosses, but ac-
tively dividing subapical cells form an intercalary
meristem that appears to be unique to the Sphag-
nopsida (Ligrone & Duckett 1998). One of the hall-
marks of the Sphagnopsida is the differentiation of
chlorophyllose and hyaline leaf cells. The relatively
broad hyaline cells typically have pores and fibrils
and are enclosed in a network of narrower efibril-
lose, nonporose chlorophyllose cells. Differentia-
tion of chlorophyllose and hyaline cells involves
complex patterns of asymmetric cell divisions dur-
ing leaf ontogeny (Holcombe 1984).
The sporophyte in Sphagnopsida lacks a seta and
the capsule is elevated at maturity on a pseudopo-
dium of gametophytic origin. Elevation of the cap-
sule does not occur until maturity. In Sphagnum,
278 THE BRYOLOGIST
the foot of the sporophyte is bulbous rather than
pointed, and unlike in most mosses, differentiated
transfer cells are lacking on both sides of the ga-
metophyte-sporophyte junction (Ligrone et al.
1993). The capsule has a massive central columella,
as in the Andreaeopsida, but unlike the latter,
spores are of amphithecial rather than endothecial
origin. The capsule wall of Sphagnum contains nu-
merous pseudostomata that may or may not be ho-
mologous to the stomata present in the capsule wall
of many mosses.
Morphological autapomorphies of the Sphagnop-
sida suggest an isolated phylogenetic position for
the group. Recent analyses (e.g., Bopp & Capesius
1996; Capesius 1995; Garbary & Renzaglia 1998;
Mishler et al. 1992) are ambiguous with regard to
precise relationships among the four classes of
mosses, but consistently suggest that the Sphagnop-
sida occupy a basal or near-basal position relative
to the true mosses. As such, the Sphagnopsida are
critical to an understanding of relationships among
mosses, and consequently among mosses, liver-
worts, hornworts, and tracheophytes.
Sphagnum consists of 250–450 species (Crum
1984; McQueen, pers. comm.; Paul 1924). A vari-
ety of infra-generic classification systems have
been proposed, and Isoviita (1966) provided a thor-
ough historical account (which is not repeated
here). Schimper (1876) first instituted a system in
which the genus is divided into four large groups,
the Acutifolia, Subsecunda, Cuspidata, and Cym-
bifolia (⫽ Sphagnum), plus several smaller sec-
tions. Russow (1887, cited in Isoviita 1966) pro-
posed two major subdivisions for Sphagnum: Ino-
phloea (⫽ sect. Sphagnum) and Litophloea (all oth-
er sections). Andrews (1911) supported this
two-group approach and suggested that each might
even be recognized as a separate genus. Andrews
(1937 and elsewhere) divided the Litophloea into
only two sections, Malacosphagnum (⫽ sect. Rig-
ida) and Acisphagnum.
Most recent authors recognize four large groups
of species following Isoviita (1966) and for con-
venience, these groups will be referred to as sec-
tions in this paper. The four sections are Sphagnum,
Subsecunda (Lindb.) Schlieph., Cuspidata (Lindb.)
Schieph, and Acutifolia Wils., together accounting
for more than 90% of the species diversity of peat-
mosses. In addition to these speciose groups, sev-
eral smaller sections are also generally recognized
(e.g., Crum 1984; Daniels & Eddy 1985; Eddy
1977, 1985; Isoviita 1966; Hill 1978): Rigida
Lindb., with 2–5 species, Squarrosa Russ. with two
species, Insulosa Isov. for S. aongstroemii Hartm.,
Hemitheca Braithw. for S. pylaesii Brid., Polyclada
(C. Jens.) Horrell for S. wulfianum Girg., and Iso-
cladus (Lindb.) Braithw. for S. macrophyllum Brid.
[VOL. 103
Some authors (e.g., Daniels & Eddy 1985) segre-
gate S. tenellum (Brid.) Bory as the monotypic sec-
tion Mollusca Cas.-Gil.
Several lesser known sections have been de-
scribed to accommodate morphologically divergent
tropical taxa: Cuculliformis Crum for S. cucullifome
Crum, Inretorta Crum for S. inretortum Crum, Aco-
cosphagnum C. Müll. for S. sericeum C. Müll., and
Mucronata Warnst. for S. mucronatum C. Müll. Of
these, molecular data are included in this paper
only for S. sericeum.
A highly distinctive plant, S. leucobryoides Ya-
maguchi, Seppelt, & Iwatz., was described from
Tasmania (Yamaguchi et al. 1990) and placed in its
own section, Buchanania. More recently, Crum and
Seppelt (1999) segregated this species as the mono-
typic genus, Ambuchanania Seppelt & Crum, for
which they erected a new family and order of
Sphagnopsida. Ambuchanania leucobryoides (Ya-
maguchi, Seppelt, & Iwatz.) Seppelt & Crum is
highly distinctive morphologically, characterized
by sparsely or unbranched stems (not in itself
unique) and terminal gametangia (unlike Sphag-
num, where gametangia are produced on special lat-
eral branches). A relationship to Sphagnum is evi-
denced by the differentiated hyaline and chloro-
phyllose cells, with the former ornamented by pores
and fibrils. The leaves of A. leucobryoides may be
bistratose in places, and the pattern of chlorophyl-
lose and hyaline cells is unlike any species of
Sphagnum. Although some of the sections within
Sphagnum have sometimes been recognized at the
generic level (e.g., Isocladus Lindb. for S. macro-
phyllum), Ambuchanania leucobryoides is far more
distinctive than any other species. The critical ques-
tion with regard to A. leucobryoides is whether this
species is nested within the genus Sphagnum, or
represents an independent phylogenetic lineage dis-
tinct from other peatmosses.
The purpose of this research is to clarify phylo-
genetic relationships among species, sections, and
genera within the Sphagnopsida. Taxon sampling
was not designed to permit a rigorous assessment
of relationships between the Sphagnopsida and oth-
er classes of Bryophyta. The specific goals of this
research can be presented as a series of questions.
1) Is Ambuchanania nested within Sphagnum? 2)
Is Sphagnum monophyletic? 3) Are the major sec-
tions within Sphagnum monophyletic, or can their
circumscriptions be emended such that they are
monophyletic? 4) What are the relationships of the
smaller and monotypic sections of Sphagnum to the
larger sections? 5) What is the polarity of phylo-
genetic change within Sphagnum; i.e., can the in-
frageneric phylogeny be rooted in order to clarify
directions of morphological, ecological, and bio-
geographic change?
2000] SHAW: SPHAGNOPSIDA
These questions were addressed using nucleotide
sequence variation in the chloroplast and nuclear
genomes. Sequences were obtained for three chlo-
roplast genes (in some cases including intergenic
spacers): psbT (Hong et al. 1995; Krellwitz et al.
2000), the trnL-trnF region (Taberlet et al. 1991;
hereafter, ‘‘trnL’’), and the rpl16 region (Jordan et
al. 1996; Kelchner & Clark 1997). psbT encodes a
photosystem II (PS II) subunit that helps maintain
PS II activity under adverse growth conditions
(Hong et al. 1995). The trnL region includes tRNA
coding sequences, an intron, and an intergenic
spacer between the two tRNA genes (Taberlet et al.
1991). rpl16 codes for ribosomal protein 16 and
includes an intron (Jordan et al. 1996; Kelchner &
Clark 1997). Sequences were also obtained for two
nuclear ribosomal DNA regions: ITS1-5.8S-ITS2
(Baldwin 1992; hereafter, ‘‘ITS’’), and a portion of
the 26S RNA gene. Combined, the data include
5228 characters.
MATERIALS AND METHODS
Taxon sampling.—Sequences from a total of 122 ac-
cessions were included in the analyses (Table 1). An at-
tempt was made to include taxa from throughout the
worldwide range of Sphagnopsida in order to avoid po-
tential biases introduced by making phylogenetic infer-
ences from analyses of, for example, boreal taxa only. The
analyses include species from the Northern and Southern
Hemispheres, the New and Old Worlds, and from high
and low latitude regions. Sample sizes vary among ge-
nomic regions, and between single-gene versus combined
analyses (Table 2). Samples were obtained from speci-
mens kindly provided by international collectors, from the
author’s own collections, and from the following herbaria:
DUKE, HIRO, MO, and NY. In a few instances, different col-
lections of a species were utilized to obtain sequences
when we were unable to amplify all the genes of interest
from a single collection (usually for unknown reasons).
Very small amounts of gametophytic tissue derived from
a few apical leaves of a single capitulum were sufficient
to obtain sequences, and sampling of herbarium material
was no more destructive than for the preparation of a sam-
ple for microscopic examination. We were able to obtain
sequences from almost all collections made after 1990;
plants collected in the 1980’s were often successful. We
did not make a systematic effort to determine the maxi-
mum age from which well-preserved DNA could be am-
plified, but material collected before 1980 was inconsis-
tent at best. Samples were rarely washed prior to extrac-
tion, but instances of amplifying sequences from nonbry-
ophytic contaminants were minimal (⬍ 5%). Such
contaminant sequences were readily identifiable because
of obvious differences that made them unalignable with
other Sphagnum sequences. BLAST searches in GenBank
showed that the few artifactual sequences we obtained
were from fungal contaminants.
Extraction and sequencing protocols.—DNA extraction
was accomplished according to the protocol of Doyle and
Doyle (1987), modified as described in Shaw (2000). Am-
plification of the ITS (nrDNA) and trnL (cpDNA) regions
were performed according to the specifications in Shaw
(2000) and Buck et al. (2000), respectively.
A portion of the psbB operon containing the chloroplast
279
psbT gene was amplified with the primers listed in Table
3. Primers for amplification of the chloroplast rpl16 intron
were as described by Jordan et al. (1996), and are also
listed in Table 3. We designed an additional pair of se-
quencing primers for the rpl16 intron in Sphagnum, and
another pair for sequencing the same region in Takakia
lepidozioides Hattori & H. Inoue. Primers provided by P.
Manos (Duke University) were used to amplify two seg-
ments of the large subunit rDNA. These included LS0F
and LS12R for amplification of the upstream fragment
consisting of approximately 1,000 nts at the 5⬘ end of the
gene, and LS23F and LS33R for amplifying about the
same number of bases at the 3⬘ end of the gene. In ad-
dition, internal sequencing primers LS8R and LS27F were
employed for the upstream and downstream fragments,
respectively (Table 3).
Amplification of psbT, the rpl16 intron, and the two
ribosomal DNA large subunit regions was accomplished
with a variety of reaction conditions and thermocycling
strategies. The most basic of these, which proved suitable
for the bulk of psbT and large subunit amplifications, was
similar to that described for trnL by Buck et al. (2000).
50 ␮l reactions contained 1⫻ PCR buffer (Life Technol-
ogies/Gibco BRL), 0.2 mM dNTPs in equimolar ratio, 2.5
mM MgCl2, 5% DMSO, 0.5 ␮M of each primer, and 1.0
unit Taq polymerase (Life Technologies/Gibco BRL).
Platinum Taq, a hot-start Taq polymerase from Life Tech-
nologies/Gibco BRL, was used when the standard Taq did
not produce an amplified product, with results comparable
to those obtained with the company’s regular Taq product.
Other optimization methods tried with varying success in-
cluded lower annealing temperatures (45–52⬚C), changes
in extension time (2–3 min. at 72⬚C), variations in cycle
number (25–30 cycles), and additional cleaning of the
DNA template with a Geneclean II kit (Bio101). Our strat-
egy was to use standard protocols and try various per-
mutations with samples that did not amplify the first time
around.
When these methods failed to yield an amplification
product suitable for sequencing, another Taq polymerase
product, intended for amplification of GC-rich sequences,
was utilized with considerable success. Reactions with the
Advantage-GC PCR kit (Clontech) contained 1⫻ each of
a 10⫻ PCR buffer, 50⫻ dNTPs (10 mM each), and 50⫻
Advantage-GC polymerase mix. An additional reagent,
‘‘GC-Melt,’’ was added to a concentration of 0.5 M. Prim-
ers were present in a final concentration of 0.2 ␮M each,
and 0.3–0.5 ␮l of stock DNA was added as template. Re-
actions were cycled as described above, with similar op-
timization of temperatures and times. After an initial series
of reactions with the rpl16 primers, the Advantage-GC
polymerase was found to give consistently superior re-
sults, and this was the primary method used for amplifi-
cation of this region. PCR reaction cleanup and sequenc-
ing procedures were conducted as described in Shaw
(2000) and Buck et al. (2000).
Phylogenetic analyses.—Obtaining a reliable root for
the infrageneric phylogeny proved problematic (see be-
low). Sequences obtained from Andreaea Hedw., Takakia
S. Hattori & H. Inoue, and Ambuchanania for ITS, trnL,
and rpl16 could not be aligned with those from Sphag-
num. These sequences were not artifactual (i.e., fungal),
as indicated by the existence of limited portions that could
be aligned with Sphagnum (e.g., the 5.8S rDNA gene
within ITS sequences, conserved coding regions of trnL
and rpl16), by comparisons to published and unpublished
sequences available for these taxa (see other papers in this
symposium issue), and by BLAST searches of GenBank
(which demonstrated their bryophytic origin). psbT
 TABLE 1. Collection identification, locality information, and Genbank accession numbers for specimens included in molecular analyses. 26S sequences from the 5⬘ and 3⬘

280
ends of the gene are given separate accession numbers (first and second numbers, respectively).

Genus Species Location Collector Coll. No. Herbarium Genes sequenced

Ambuchanania leucobryoides Tasmania Buchanan 9371 HIRO 26S (AF197094, AF198029)
Andreaea rothii North Carolina Shaw s.n. DUKE 26S (AF197062, AF198030), psbT (AF193625)
Sphagnum affine North Carolina Shaw 9198 DUKE ITS (AF193697), 26S (AF197063, AF197998), psbT
(AF193626), trnL (AF192573)
Sphagnum africanum Africa, Transkei Von Rooy 1802 DUKE ITS (AF193674), psbT (AF193658), trnL (AF192567)
Sphagnum alegrense Australia (NSW) Glime 7147 DUKE ITS (AF193729), trnL (AF192579)
Sphagnum amoenoides Brazil Buck 26422 MO ITS (AF193698)
Sphagnum andersonianum Alaska Andrus 8358 DUKE trnL (AF192589)
Sphagnum andersonianum New York Shaw 95-27-6a DUKE ITS (AF193730), rpl16 (AF194896)
Sphagnum angemanicum New York Town 2253 DUKE ITS (AF193747), rpl16 (AF914918), trnL (AF192618)
Sphagnum angustifolium Finland Shaw 9739 DUKE ITS (AF193686), 26S (AF197086, AF197021), psbT
(AF913649), rpl16 (AF194898)
Sphagnum angustifolium Norway Stenoien 41H DUKE 26S (AF197073, AF198008), psbT (AF193636), trnL
(AF192593)
Sphagnum aongstroemii Norway Andrus & Flatberg 7531 DUKE ITS (AF193748), 26S (AF197083, AF198018), psbT
(AF193646), rpl16 (AF914919), trnL (AF192619)
Sphagnum aureum Panama Dauphin 1564 MO ITS (AF193750), trnL (AF192622)
Sphagnum austinii Norway Shaw 9730 DUKE ITS (AF193735), 26S (AF197084, AF198019), psbT
(AF193647), rpl16 (AF194885), trnL (AF914576)
Sphagnum austro-americanum Colombia Churchill & Betancur 18752 MO ITS (AF193695), rpl16 (AF914221), trnL (AF192625)
Sphagnum balticum Norway Andrus & Flatberg 7488 DUKE ITS (AF193707), rpl16 (AF194899), trnL (AF192594)
Sphagnum bartlettianum New Jersey Anderson 27360 DUKE ITS (AF193727)
THE BRYOLOGIST

Sphagnum bartlettianum North Carolina Shaw 9279 DUKE rpl16 (AF914939), trnL (AF192600)
Sphagnum bordasii South Africa Buck 13594 NY rpl16 (AF914938), trnL (AF192598)
Sphagnum brasiliense Brazil Buck 26633 MO ITS (AF193716), rpl16 (AF914924), trnL (AF192629)
Sphagnum brevirameum Brazil Buck 26844 MO ITS (AF193715), rpl16 (AF914922), trnL (AF192627)
Sphagnum capense Malawi Chapman & Chapman 6771 DUKE psbT (AF193651)
Sphagnum capense South Africa Snook 7352 NY ITS (AF193664), rpl16 (AF194872), trnL (AF192563)
Sphagnum capillifolium Alaska Talbot 228 DUKE rpl16 (AF914940), trnL (AF192621)
Sphagnum capillifolium New Brunswick Belland 17944 DUKE ITS (AF193724)
Sphagnum capillifolium Norway Shaw 9739 DUKE 26S (AF197088, AF198023), psbT (AF193651)
Sphagnum compactum Maine Allen 14772 DUKE ITS (AF193706)
Sphagnum compactum North Carolina Shaw 9332 DUKE 26S (AF197069, AF198004), psbT (AF193632), rp16
(AF194887), trnL (AF192578)
Sphagnum contortum Maryland Anderson 25410 DUKE ITS (AF3669), rpl16 (AF914930), trnL (AF192636)
Sphagnum cristatum Australia (NSW) Streimann 47127 NY ITS (AF193699), rpl16 (AF194888)
Sphagnum cristatum Australia (Victoria) Streimann 50625 NY trnL (AF192580)
Sphagnum cuspidatulum Philippines Withey 951 DUKE ITS (AF193749), rpl16 (AF914934)
Sphagnum cuspidatum North Carolina Shaw 9327 DUKE ITS (AF193677), rpl16 (AF914927), trnL (AF192633)
Sphagnum cyclophyllum North Carolina Shaw 8560 DUKE ITS (AF193665), 26S (AF197067, AF198002), psbT
(AF193630), rpl16 (AF194873), trnL (AF192562)
[VOL. 103
 TABLE 1. Continued.
2000]
Genus Species Location Collector Coll. No. Herbarium Genes sequenced
Sphagnum cymbifolioides Australia (NSW) Streimann 47192 NY ITS (AF193713), 26S (AF197076, AF198011), psbT
(AF193639), rpl16 (AF194892), trnL (AF192584)
Sphagnum davidii South Africa Buck 13508 NY ITS (AF193670), psbT (AF193661), rpl16 (AF194876), trnL
(AF192566)
Sphagnum ehyalinum Chile Goffinet 5782 DUKE ITS (AF193678), rpl16 (AF914936)
Sphagnum falcatulum Tasmania Moseal 13388 NY ITS (AF193719), rpl16 (AF194894), trnL (AF192586)
Sphagnum fallax Alaska Schofield 99959 DUKE ITS (AF193725), rpl16 (AF194900), trnL (AF192595)
Sphagnum fimbriatum Alaska Andrus 8554 DUKE ITS (AF193673), trnL (AF192591)
Sphagnum fitzgeraldii North Carolina Horn s.n. DUKE ITS (AF193751)
Sphagnum flaccidum Colombia Churchill 16393 MO ITS (AF193718), trnL (AF192626)
Sphagnum flavicomans Newfoundland Schofield 101051 DUKE ITS (AF193690), rpl16 (AF195880), trnL (AF192571)
Sphagnum fuscum Minnesota Bowers 24013 DUKE rpl16 (AF914941), trnL (AF192601)
Sphagnum fuscum New York Risk 1322 DUKE ITS (AF193736)
Sphagnum fuscum Norway Shaw 9678 DUKE 26S (AF197091, AF198026), psbT (AF193654)
Sphagnum girgensohnii Alaska Schofield 101946 DUKE ITS (AF193675), rpl16 (AF194905), trnL (AF192604)
Sphagnum henryense North Carolina Wilbur 65925 DUKE ITS (AF193681), rpl16 (AF914931), trnL (AF192637)
Sphagnum jensenii Norway Shaw 9695 DUKE ITS (AF193688), 26S (AF197074, AF198009), psbT
(AF193637), rpl16 (AF194907), trnL (AF192602)
Sphagnum junghugnianum China Shevock 14370 MO ITS (AF193728), rpl16 (AF914943), trnL (AF192630)
Sphagnum khasianum China Redfearn 34401 NY ITS (AF193671), psbT (AF193660), rpl16 (AF194904), trnL
(AF192597)
Sphagnum laxirameum Colombia Linares & Churchill 3740 MO ITS (AF193703), rpl16 (AF914926), trnL (AF192632)
Sphagnum lescurii North Carolina Shaw s.n. DUKE ITS (AF3667), 26S (AF197066, AF198001), psbT
(AF193629), rpl16 (AF194875), trnL (AF192565)
SHAW: SPHAGNOPSIDA

Sphagnum lewisii Colombia Lewis 88-1446 MO ITS (AF193701)

Sphagnum liesneri Venezuela Liesner 19035 MO ITS (AF193702)
Sphagnum limbatum Costa Rica Dauphin 2065 MO ITS (AF193693), rpl16 (AF914923), trnL (AF192628)
Sphagnum macrophyllum North Carolina Shaw 9336 DUKE ITS (AF193666), 26S (AF197170, AF198005), psbT
(AF193633), rpl16 (AF194874), trnL (AF192564)
Sphagnum magellanicum Georgia Buck 27518 DUKE rpl16 (AF914932)
Sphagnum magellanicum Virginia Clampitt 1505 DUKE ITS (AF193680)
Sphagnum mendocinum British Columbia Schofield 98560 DUKE 26S (AF197082, AF198017), psbT (AF193645), trnL
(AF192620)
Sphagnum mendocinum California Andrus 7416 DUKE ITS (AF193726), rpl16 (AF194903)
Sphagnum meridense Bolivia Lewis 38738d-1 MO trnL (AF192624)
Sphagnum meridense Honduras Allen 11978 DUKE ITS (AF193692), rpl16 (AF194882)
Sphagnum molle Kentucky Risk 6629 DUKE trnL (AF192599)
Sphagnum molle South Carolina Shaw 8729 DUKE ITS (AF193723), rpl16 (AF194906)
Sphagnum n.sp2? Norway Shaw 9680 DUKE trnL (AF192603)
Sphagnum n.sp1? Ohio Andreas s.n. DUKE rpl16 (AF914937)
Sphagnum orientale Russia Afonina exsicc. MO ITS (AF193717) rpl16 (AF914925), trnL (AF192631)
Sphagnum ovatum China Tan 91-1151 H ITS (AF193736), 26S (AF197093, AF198028), psbT
281

(AF193656), rpl16 (AF194908), trnL (AF192605)

 TABLE 1. Continued.

282
Genus Species Location Collector Coll. No. Herbarium Genes sequenced
Sphagnum oxyphyllum Bolivia Lewis 89-953d-3 MO ITS (AF193685), rpl16 (AF914920), trnL (AF192623)
Sphagnum palustre North Carolina Shaw 9391 DUKE ITS (AF193679), rpl16 (AF914928), trnL (AF192634)
Sphagnum perichaetiale North Carolina Shaw 9213 DUKE ITS (AF193700), 26S (AF197064, AF197999), psbT
(AF193627), rpl16 (AF195884), trnL (AF192575)
Sphagnum planifolium Tanzania Ochyra 8812/G H ITS (AF193689), psbT (AF193663), rpl16 (AF914935), trnL
(AF192606)
Sphagnum platyphyllum Alaska Andrus & Talbot 8573 DUKE ITS (AF3667), rpl16 (AF914929), trnL (AF192635)
Sphagnum portoricense North Carolina Anderson 26770 DUKE ITS (AF193705), 26S (AF197077, AF198012), psbT
(AF193640), rpl16 (AF194886), trnL (AF192577)
Sphagnum pseudoramulinum Brazil Laundrum 2157 NY ITS (AF193752)
Sphagnum pulchrum Norway Shaw 9707 DUKE ITS (AF193687), rpl16 (AF194909), trnL (AF192607)
Sphagnum pulchrum Norway Shaw 9797 DUKE 26S (AF197087, AF198022), psbT (AF193650)
Sphagnum pulvinatum South Africa Buck 12704 NY ITS (AF193683)
Sphagnum pycnocladulum Malawi Chapman 6573 MO ITS (AF193696)
Sphagnum pylaesii Newfoundland Schofield 101031 DUKE ITS (AF193691), rpl16 (AF194881), trnL (AF192572)
Sphagnum quinquefarium Norway Shaw 9682 DUKE ITS (AF193743), 26S (AF197089, AF198024), psbT
(AF193652), rpl16 (AF194910), trnL (AF192608)
Sphagnum reclinatum Venezuela Buck 12751 MO
Sphagnum recurvum North Carolina Shaw 9196 DUKE ITS (AF193682), 26S (AF197072, AF198007), psbT
(AF193635), rpl16 (AF194878), trnL (AF192569)
Sphagnum rubellum Finland Shaw 9842 DUKE trnL (AF192614)
Sphagnum rubellum Norway Shaw 9733 DUKE ITS (AF193742), rpl16 (AF194811)
Sphagnum rubiginosum Norway Shaw 9630 DUKE ITS (AF193745), rpl16 (AF194912), trnL (AF192609)
THE BRYOLOGIST

Sphagnum russowii New York Shaw 9259 DUKE ITS (AF193732), rpl16 (AF194913)
Sphagnum russowii Washington Anderson 27411 DUKE trnL (AF192610)
Sphagnum sancto-josephense Colombia Linares & Churchill 3978 NY ITS (AF193684), 26S (AF197075, AF198010), psbT
(AF193638), rpl16 (AF194879), trnL (AF192570)
Sphagnum santanderense Colombia Lewis 88-1440 MO ITS (AF193704)
Sphagnum schofieldii British Columbia Schofield 64344 DUKE ITS (AF193733)
Sphagnum sericeum Papua New Guinea Koponen 35300 H ITS (AF193739)
Sphagnum skyense Great Britain Flatberg s.n. H ITS (AF193737), rpl16 (AF914942), trnL (AF192611)
Sphagnum sparsum Colombia Linares & Churchill 3957 NY trnL (AF192592)
Sphagnum sparsum Costa Rica McQueen 7172 MO ITS (AF193694)
Sphagnum squarrosum New Brunswick Belland & Schofield 17919 DUKE ITS (AF193708), rpl16 (AF194889), trnL (AF192581)
Sphagnum steerei Alaska Andrus 8574 DUKE ITS (AF193721), 26S (AF197081, AF198016), psbT
(AF193644), rpl16 (AF194883), trnL (AF192574)
Sphagnum strictum North Carolina Shaw 9406 DUKE ITS (AF193714), 26S (AF197068, AF198003), psbT
(AF193631), rpl16 (AF194893), trnL (AF192585)
Sphagnum subfulvum Finland Shaw 9824 DUKE trnL (AF192612)
Sphagnum subfulvum Norway Shaw 9719 DUKE ITS (AF193734), 26S (AF197085, AF198020), psbT
(AF193648), rpl16 (AF194914)
Sphagnum subnitens Norway Shaw 9658 DUKE ITS (AF193741), rpl16 (AF194915), trnL (AF192613)
[VOL. 103

Sphagnum subnitens Norway Shaw 9723 DUKE 26S (AF197092, AF198027), psbT (AF193655)
 2000]

TABLE 1. Continued.

Genus Species Location Collector Coll. No. Herbarium Genes sequenced

Sphagnum subobesum Japan S. Ono 743 H ITS (AF193736), psbT (AF193662), rpl16 (AF194916), trnL
(AF192616)
Sphagnum subtile New York Shaw 9266 DUKE ITS (AF193731), rpl16 (AF914933)
Sphagnum tenellum Finland Shaw 9792 DUKE ITS (AF193746), rpl16 (AF914917)
Sphagnum tenellum Norway Shaw 9696 DUKE trnL (AF192617)
Sphagnum tenerum North Carolina Shaw 9335 DUKE ITS (AF193672), 26S (AF197065, AF198000), psbT
(AF193628), rpl16 (AF194895), trnL (AF192588)
Sphagnum teres British Columbia Hedderson 7928 DUKE ITS (AF193720), 26S (AF197090, AF198025), psbT
(AF193563), rpl16 (AF194902), trnL (AF192596)
Sphagnum torreyanum North Carolina Shaw s.n. DUKE ITS (AF193676), 26S (AF197071, AF198006), psbT
(AF193634), rpl16 (AF194877), trnL (AF192568)
Sphagnum troendelagicum Norway Andrus & Flatberg 7503 DUKE ITS (AF193710), 26S (AF197078, AF198013), psbT
(AF193641), rpl16 (AF194890), trnL (AF192582)
Sphagnum truncatum South Africa Buck 13599 NY ITS (AF193711), 26S (AF197080, AF198015), psbT
SHAW: SPHAGNOPSIDA

(AF193643), rpl16 (AF194891), trnL (AF192583)

Sphagnum viridum Ireland Andrus 4098 DUKE trnL (AF192615)
Sphagnum viridum Massachusetts Wagner 585 DUKE ITS (AF193709)
Sphagnum warnstorfii Alaska Schofield 104094 DUKE ITS (AF193722), rpl16 (AF194897), trnL (AF192590)
Sphagnum wilfii British Columbia Schofield 83645 DUKE ITS (AF193744)
Sphagnum wulfianum Minnesota Bowers 22980 DUKE ITS (AF193712), psbT (AF193657), rpl16 (AF194901)
Sphagnum wulfianum Minnesota Bowers 22665 NY trnL (AF192587)
Takakia lepidozioides British Columbia Schofield 86563 DUKE 26S (AF197061, AF197997), psbT (AF193624)
283
284 THE BRYOLOGIST [VOL. 103

TABLE 2. Genomic regions and subregions included in the molecular analyses, the number of taxa in each data
(N), the number of characters in each aligned data set (n), the number of autapomorphic (aut) and informative (inf)
characters, the length of most parsimonious trees, and indices of support for most parsimonious reconstructions. CI
was calculated without autapomorphies.

Region Genome N n aut. inf. L CI RI RC # Trees

26S nuclear 34 2102 133 83 — — — — —
ITS nuclear 89 748 81 154 451 0.636 0.853 0.543 33
psbT chloroplast 40 480 80 49 — — — — —
rpl16 chloroplast 73 974 73 62 168 0.845 0.921 0.778 47502
trnL chloroplast 76 702 72 66 206 0.772 0.893 0.690 —
rpl16 ⫹ trnL chloroplast 68 374 142 125 374 0.786 0.883 0.694 48000
26S ⫹ psbT combined 34 2600 212 131 — — — — —
ITS ⫹ rpl16 combined 72 1695 149 230 779 0.593 0.774 0.459 22000
ITS ⫹ trnL combined 75 1434 156 240 842 0.586 0.776 0.454 9300
ITS ⫹ rpl16 ⫹ trnL combined 60 2424 221 249 959 0.634 0.764 0.484 9327
Total evidence (5 genes) combined 27 5228 371 314 984 0.760 0.724 0.550 2

(cpDNA) and 26S (nrDNA) were, however, unambigu-
ously alignable between Takakia, Andreaea, Ambuchan-
ania, and Sphagnum. These genes, unfortunately, were so
conserved that little resolution was obtained within
Sphagnum using maximum parsimony, and the consensus
trees were largely unresolved with regard to infrageneric
relationships. In order to make even preliminary inferenc-
es about directions of evolutionary change within Sphag-
num suggested by psbT and 26S sequences, neighbor join-
ing analyses were conducted using PAUP vers. 4.01
(Swofford, unpubl.). It should be noted that neighbor join-
ing utilizes an algorithm that provides a single hypothesis
of relationships based on the distance measure employed
and is not a search strategy for finding alternative topol-
ogies, as do parsimony analyses. Neighbor joining was
conducted using a maximum likelihood distance parame-
ter in which base frequencies and transition:transversion
ratios (ts : tv) were estimated from the most parsimonious
trees, and rate heterogeneity was approximated by speci-
fying a gamma distribution parameter of 0.5. Support for
clades identified by neighbor joining was estimated by
bootstrap analyses using the same likelihood parameters
(see below).
Phylogenetic analyses of the three more variable ge-
nomic regions (ITS, trnL, rpl16) were based on maximum
parsimony (MP), as implemented in PAUP. Because of the
size of the data sets, heuristic searches were necessary. In
addition to nucleotides, one 7 nt indel was scored as pre-
sent or absent in ITS1, and two indels of three and five
nts were scored in the trnL intron. The following settings
were employed for all single gene and two-gene analyses:
steepest descent off, TBR branch swapping, MULPARS
on,100 random sequence additions saving ⱕ500 trees per
replicate. For ITS (the largest dataset), an alternative
search strategy was explored in which 1,000 replicates
were run with NNI branch swapping (with MULPARS
off) and one of the MP trees was used as a starting point
for TBR branch swapping in which a maximum of 10,000
trees were saved. The strict consensus was identical to the
consensus obtained from TBR branch swapping only, and
the latter (as described above) was used for all subsequent
analyses. For the analyses of ITS ⫹ trnL ⫹ rpl16 sequenc-
es combined, the same settings were used except that up
to 1000 trees were saved per random sequence addition.
For the ‘‘total evidence analysis’’ using all five genes, no
limit was made to the number of trees saved per replicate.
Analyses of each of the five genes were conducted sep-
arately. In addition, combined psbT and 26S sequences
were analyzed using neighbor joining, as above. ITS, trnL,
and rpl16 data were each analyzed separately, as well as
in all combinations of two genes, plus combined analyses
of all three genes. Sample sizes, and therefore taxon rep-
resentation, differed among analyses. Each of the com-
bined data sets involving ITS, trnL, and rpl16, as well as
the combined psbT ⫹ 26S data set, contained only those
taxa shared by the single gene data sets; i.e., taxa for

TABLE 3. Primers used to amplify the psbT (cpDNA), rpl16 (cpDNA), and 26S (nrDNA) genomic regions. Ref-
erences for primer sequences used to amply ITS and trnL are provided in the Materials and Methods.

Primer name Sequence (5⬘–⬍3⬘) Reference

psbT ATGGAAGCWTTAGTWTATACWTT Krellwitz et al. (2000)
psbH GTHCCCCARCCDGGDRVHACTTTWCC Krellwitz et al. (2000)
F71 GCTATGCTTAGTGTGTGACTCGTTG Jordan et al. (1996)
R1661 CGTACCCATATTTTTCCACCACGAC Jordan et al. (1996)
rpLi-F TTTCGGGTAGGATGGTG Shaw Lab
rpLi-R ATTTCACCATCCTACCCG Shaw Lab
rpLi-F2 TATCGGACGGGATGGCG Shaw Lab
rpLi-R2 ATTTCGCCATCCCGTCCG Shaw Lab
LSOF ACCCGCTGTTTAAGCATAT Manos Lab
LS8R TGCTCACACTCGAACCCTTC Manos Lab
LS12R ATCGCCAGTTCTGCTTACCA Manos Lab
LS23F GCCAAATGCCTCGTCATCTA Manos Lab
LS27F GCGGCACATCTGTTAAAAGA Manos Lab
LS33R ATCTCAGTGGATCGTGGCAG Manos Lab
2000] SHAW: SPHAGNOPSIDA
which data were lacking for any one gene were deleted
from combined analyses. The total evidence analysis, uti-
lizing all five genes, and combined 26S ⫹ psbT analyses,
were the only exceptions to this. Total evidence analyses
included all Sphagnum taxa for which sequences were
available for each of the genes. In addition, Andreaea and
Takakia were included although data were not available
(or were unusable because of alignment difficulties) for
the more variable genomic regions (ITS, trnL, rpl16). trnL
and rpl16 sequences were scored as missing data for An-
dreaea, Takakia, and Ambuchanania. 5.8S nuclear ribo-
somal regions for these taxa were included in the total
evidence data matrix, but the ITS1 and ITS2 regions were
scored as missing data. In the combined 26S ⫹ psbT anal-
ysis, psbT was scored as missing in A. leucobryoides be-
cause a sequence was not available.
Single- and two-gene phylogenies based on ITS, trnL,
and rpl16 were rooted by specifying S. capense Hornsch.,
an African member of sect. Subsecunda, as the outgroup.
This represents a working hypothesis based on a basal
position of species in sect. Subsecunda in neighbor joining
analyses of psbT, 26S, and combined psbT ⫹ 26S data.
Moreover, Eddy (1979, 1985) suggested that sect. Subse-
cunda contains species that approach a hypothetical com-
mon ancestor for all Sphagna most closely, and specifi-
cally identified S. capense and S. davidii Warnst. as being
most similar to that ancestor. Although we do not consider
this rooting scheme to be strongly supported by our data,
species relationships inferred from the present analyses are
robust to other rooting hypotheses. It should nevertheless
be kept in mind that inferences about monophyly of the
sections within Sphagnum depend upon where the phy-
logeny is rooted. Because the total evidence analysis sug-
gested a different root for Sphagnum than that inferred
from psbT and 26S sequences alone (or in combination),
we explored the consequences of alternative rooting
schemes in the analyses of combined ITS, trnL, and rpl16
sequences. The alternatives were to root with a member
of sect. Subsecunda (S. capense) and with a member of
sect. Sphagnum (S. palustre L.).
Incongruence between data sets based on different ge-
nomic regions was assessed using the Partition Homoge-
neity Test in PAUP (also known as the ILD test; Farris et
al. 1994). ILD tests were conducted using 1,000 replicates,
each with 10 random addition replicates saving a single
MPT (MULPARS off). The ILD test compares tree
lengths from the two data sets to random partitions of
equal size. The null hypothesis is that the two data sets
do not differ significantly more than do random partitions
of the same size, in terms of the distribution of phyloge-
netically significant characters.
Evaluation of support for infrageneric clades.—Multi-
ple most parsimonious trees were summarized using the
strict consensus. Bootstrap analyses (Felsenstein 1985)
were accomplished with 300 bootstrap replicates and the
same heuristic settings used in the parsimony analyses ex-
cept with five random sequence additions per bootstrap
replicate, saving a maximum of 200 trees per random ad-
dition. Maximum likelihood neighbor joining bootstrap
analyses were based on 1,000 bootstrap replicates. Decay
analyses (Bremer support; Bremer 1988) were conducted,
but are not presented. Many of the trees presented here
contain so many taxa that the figures do not provide space
for both bootstrap and decay values.
Phylogenetic inferences made in this paper represent a
‘‘weight of the evidence’’ approach and no results are
without ambiguity. The results from neighbor joining
analyses should be considered ‘‘suggestive,’’ since the al-
gorithm does not evaluate alternative hypotheses. Pres-
285
ence of a clade in the strict consensus tree from parsimony
analyses is itself evidence of support for that clade. Strong
bootstrap support (e.g., ⬎ 70%) is additional evidence.
Resolution of the same relationship in phylogenies in-
ferred from different genes is also support. The degree of
strength in favor of specific inferences ranged from groups
that are resolved by all five genes, often with strong boot-
strap support, to those that are resolved in consensus trees
derived from one or two regions, but with little or no
bootstrap support.
RESULTS
Taxon sample sizes, total sequence length (in-
cluding gaps introduced to preserve base homolo-
gy), numbers of autapomorphic and phylogeneti-
cally informative characters, and tree statistics for
each data set are presented in Table 2. Presentation
of results are organized systematically, rather than
by genomic region analyzed. Table 4 provides a
summary of major inferences.
ILD tests of data incongruence indicated that all
pairwise combinations of data sets were signifi-
cantly incongruent at p ⬍ 0.01. Nevertheless, data
sets were analyzed in all combinations in order to
thoroughly explore any potential phylogenetic pat-
terns.
Rooting the infrageneric phylogeny and the po-
sition of Ambuchanania.—When Takakia was des-
ignated as the outgroup for neighbor joining anal-
yses of 26S rDNA sequences, Ambuchanania ⫹
Sphagnum forms a monophyletic clade with mod-
erate bootstrap support, and Sphagnum forms a
monophyletic sister group to Ambuchanania with
100% support (Fig. 1). There is no bootstrap sup-
port for relationships among sections within Sphag-
num, but species traditionally classified in the sect.
Subsecunda form a monophyletic clade sister to the
rest of Sphagnum. Although 26S sequences strong-
ly support a sister group relationship between Am-
buchanania and Sphagnum, Ambuchanania is high-
ly divergent from Sphagnum in terms of molecular
evolution (phylogram with branch lengths not
shown). Indeed, Ambuchanania is as isolated from
Sphagnum as is Andreaea.
Although Ambuchanania was not included in
analyses of psbT sequences (we were unable to ob-
tain a psbT sequence for A. leucobryoides), neigh-
bor joining analyses with Takakia specified as the
outgroup again yield Sphagnum as a monophyletic
group with 100% bootstrap support (Fig. 2). Sev-
eral species of sect. Subsecunda form a paraphy-
letic grade that is basal to the rest of Sphagnum,
although S. recurvum (sect. Cuspidata) also occurs
among these basal taxa. Most of the remaining spe-
cies of sect. Subsecunda form a clade that is more
derived (Fig. 2). This clade also includes S. torrey-
anum, another species traditionally classified in the
sect. Cuspidata. psbT sequences do not clearly re-
286 THE BRYOLOGIST [VOL. 103

TABLE 4. Phylogenetic relationships of critical species, species complexes, and small (or monotypic) sections in
Sphagnum. *** ⫽ relationship supported by a bootstrap value ⱖ70%; ** ⫽ supported by a bootstrap value 50–69%;
* ⫽ in the strict consensus but without bootstrap support; NA ⫽ insufficient data; either a particular species was not
included in the analysis or insufficient numbers of putative relatives were included to make an inference. The mean-
ing of ‘‘relationship’’ is used broadly to mean either a species is nested within another group or it has a sister-group
relationship to another species or group. ‘‘—’’ means that either a relationship is contradicted by the gene tree, or
there is no evidence for a relationship. This table is intended as an organizational force to assist the reader with
details provided in the text.

psbT rpl16 trnL ITS 26S ITS ⫹ trnL ⫹ rpL

Section Acutifolia ** — — — — **
Red acutifolia NA * * *** * *
Green Acutifolia NA ** — *** * ***
S. wulfianum ⫹ S. girgensohnii ⫹ S. fimbriatum NA *** — *** NA ***
S. meridense group ⫹ Red Acutifolia NA * *** *** NA ***
S. oxyphyllum group ⫹ Green Acutifolia NA *** * *** NA ***
Section Cuspidata * *** * ** * *
S. torreyanum ⫹ S. recurvum — — — *** *** **
S. tenellum ⫹ sect. Cuspidata NA *** * *** NA ***
S. pylaesii ⫹ sect. Cuspidata NA *** * *** NA ***
S. tenellum ⫹ S. pylaesii NA ** ** ** NA ***
Sect. Rigida ⫹ sect. Cuspidata — — — ** — —
Section Subsecunda — NA NA NA * NA
‘‘Boreal Subsecunda’’ NA ** *** *** NA ***
S. macrophyllum ⫹ sect. Subsecunda — * * * * ***
S. macrophyllum ⫹ S. cyclophyllum — ** *** * * ***
Section Sphagnum * *** — ** * —
S. steerei ⫹ S. austinii * *** *** *** ** ***
Sect. Rigida ⫹ Sect. Sphagnum * — * — * ***

solve the Subsecunda and Cuspidata as monophy-
letic groups although for the most part they are seg-
regated. psbT contains the least number of infor-
mative characters among those genomic regions in-
vestigated (Table 2), and the lack of resolution is
no doubt related to this lack of variation. Relation-
ships among the remaining sections of Sphagnum
differ from those suggested by 26S sequences (Fig.
1), but there was no bootstrap support for such re-
lationships in either case.
Combined 26S ⫹ psbT sequences, again rooted
with Takakia, places Andreaea (rather than Ambu-
chanania) as sister to Sphagnum, but with minimal
bootstrap support (Fig. 3). Sphagnum is supported
as a monophyletic group with 100% support. With-
in Sphagnum, species of sect. Subsecunda form a
paraphyletic grade basal to the remaining species.
Species in sections Acutifolia, Cuspidata, and
Sphagnum (plus Squarrosa and Rigida) form a
monophyletic group distinct from the Subsecunda,
but without bootstrap support (Fig. 3).
When data for all five genes were combined in
a parsimony analysis of 25 Sphagnum species plus
Takakia and Andreaea, a different topology was
obtained (Fig. 4). Takakia was again specified as
the outgroup, and Sphagnum forms a monophyletic
group with 100% support. However, the four (in-
cluded) species of sect. Sphagnum form an unre-
solved polytomy that is sister to the rest of the ge-
nus. Sphagnum strictum Sull. and S. compactum
DC. form a strongly supported clade that is sister
to species in sections Acutifolia, Cuspidata, and
Subsecunda (Fig. 4). Section Subsecunda forms a
monophyletic group, with moderate bootstrap sup-
port, sister to species in the sections Squarrosa,
Acutifolia, and Cuspidata. The total evidence data
set including all genes thus contradicts inferences
about rooting provided by psbT and 26S sequences,
analyzed separately (Figs. 1–2) or together (Fig. 3).
Monophyly of the large sections: Acutifolia,
Cuspidata, Sphagnum, Subsecunda.—
Acutifolia. ITS data identify two well-marked
clades of species traditionally included in the sect.
Acutifolia (Fig. 5). One clade, containing S. capil-
lifolium (Ehrh.) Hedw. and related species, forms a
monophyletic group with moderate bootstrap sup-
port (73%) whereas the other is more weakly sup-
ported (51%). The consensus tree from the ITS
analysis does not provide evidence of a monophy-
letic Acutifolia with regard to the Squarrosa. trnL
and rpl16, as well as the data set combining se-
quences from these two chloroplast regions, also do
not resolve the Acutifolia as a group (Figs. 6–8).
ITS combined with trnL data resolve a moderately
well-supported monophyletic Acutifolia (74%), but
ITS ⫹ rpl16 reveals the same two well marked
clades of Acutifolia as do ITS data alone (Figs. 5,
10). ITS ⫹ rpl16 does not, however, resolve the
inclusive sect. Acutifolia as monophyletic. When
data from the three genes are combined, the Acu-
tifolia, including S. aongstroemii, is resolved as
monophyletic, albeit with lackluster bootstrap sup-
2000] SHAW: SPHAGNOPSIDA 287

FIGURES 1–4. Phylogenetic relationships of the Sphagnopsida. Maximum likelihood neighbor-joining trees obtained
from analyses of—1. nuclear-encoded 26S.—2. Chloroplast-encoded psbT—3. Combined 26S and psbT sequences.—
4. Strict consensus tree from parsimony analyses of the ‘‘total evidence’’ data set containing combined sequences from
the ITS, 26S, psbT, rpl16, and trnL regions. Outgroup taxa (Takakia and Andreaea) were scored as missing data for
trnL and rpl16. ITS1 and ITS2 were likewise scored as missing for the outgroups, but 5.8S nuclear ribosomal DNA
sequences were included. Bootstrap values for 1–3 are based on 1,000 neighbor joining replicates. Taxa traditionally
included in the section Subsecunda are shaded (including S. macrophyllum; see text). Bootstrap values for parsimony
tree (4) are based on 300 random addition replicates (see Materials and Methods).
288 THE BRYOLOGIST [VOL. 103
2000] SHAW: SPHAGNOPSIDA
port (71%; Fig. 11). Support for a monophyletic
Acutifolia is stronger (80%) when S. palustre is
used as the outgroup to root the phylogeny (Fig.
12). The sect. Acutifolia is clearly heterogeneous
with respect to the genomic regions sequenced, but
the weight of the evidence suggests that the group
is monophyletic.
Cuspidata. Monophyly of sect. Cuspidata is
strongly supported by ITS (Fig. 5), rpl16 (Fig. 6),
and trnL (Fig. 7). The two chloroplast genes com-
bined (rpl16 ⫹ trnL) likewise support monophyly
of the Cuspidata (Fig. 8), as do other two-gene
combinations (Figs. 9–10). Combined ITS ⫹ trnL
⫹ rpl16 analyses (Figs. 11–12) resolve the Cuspi-
data as a monophyletic group, although with lower
bootstrap support that appears to result from con-
flicts between nuclear versus chloroplast sequences
(discussed below). The total evidence (five gene)
analysis, also based on both chloroplast and nuclear
sequences, similarly resolves the Cuspidata but
with low bootstrap support (Fig. 4).
Sphagnum. Support for a monophyletic sect.
Sphagnum is weak (57%) in the ITS reconstruction
because S. austinii Sull. and S. steerei Andrus are
highly divergent from the remaining species sam-
pled. Bootstrap support for the clade containing all
sect. Sphagnum species other than S. austinii and
S. steerei is 100% (Fig. 5). The divergence of S.
steerei and S. austinii is evident in every genomic
region sampled, and will be discussed below. Nev-
ertheless, monophyly of section Sphagnum, includ-
ing these two species, is supported by rpl16 data
alone (Fig. 6), and combined rpl16 ⫹ trnL (Fig. 8),
although trnL data alone do not resolve the section
(Fig. 7). Data sets in which ITS sequences were
combined with either trnL (Fig. 9) or rpl16 (Fig.
10), or both trnL and rpl16 (Fig. 11), consistently
resolved the sect. Sphagnum as monophyletic with
strong bootstrap support (⬎ 85%). Although S. aus-
tinii and S. steerei are divergent, the molecular data
overwhelmingly support monophyly for sect.
Sphagnum.
Subsecunda. Phylogenetic reconstructions based
on separate ITS, trnL, and rpl16 sequences were
rooted using S. capense (sect. Subsecunda) as the
outgroup, so monophyly of the Subsecunda could
not be assessed. In these reconstructions, the Sub-
secunda form a paraphyletic grade basal to the re-
maining species of Sphagnum (Figs. 5–7). In the
total evidence tree (Fig. 4), the Subsecunda are re-
solved as monophyletic with moderate (74%) boot-
strap support. In the analysis of combined ITS ⫹
←
FIGURE 5. Strict consensus tree obtained from parsimony analyses of nuclear ribosomal ITS sequences. Sphagnum
capense was designated as the outgroup. Bootstrap support is indicated for those branches with higher than 50%.
289
trnL ⫹ rpl16 data, when S. palustre (sect. Sphag-
num) was used to root the tree, the Subsecunda are
resolved as monophyletic, with moderate (72%)
support (Fig. 12).
Relationships of the smaller sections: Hemithe-
ca, Insulosa, Isocladus, Mollusca, Polyclada, Rig-
ida, Squarrosa.—
Hemitheca. Sphagnum pylaesii, a morphologi-
cally distinctive species that is often segregated as
the sect. Hemitheca, is nested within sect. Cuspi-
data. This relationship, in which S. pylaesii appears
to be a highly derived member of the Cuspidata, is
resolved by ITS (Fig. 5), rpl16 (Fig. 6), trnL (Fig.
7), and all two- and three-way combinations of
these data sets (Figs. 8–12). Moreover, each data
set, separately and in combination, suggests a close
relationship between S. pylaesii and S. tenellum,
which is sometimes segregated at the monotypic
sect. Mollusca. These two species, which bear some
morphological similarities, are evidently derived
species nested deeply within the Cuspidata. The
two chloroplast genes (rpl16 and trnL) suggest that
within the Cuspidata, S. pylaesii and S. tenellum,
are closely related to S. troendelagicum (Figs. 6–
7). This relationship is supported with a strong
bootstrap value (96%) by trnL sequences (Fig. 7).
Nuclear DNA data from the ITS region, however,
suggest a different relationship for S. troendelagi-
cum, with S. jensenii H. Lindb., and S. balticum
(Russ.) C. Jens. (Fig. 5).
Isocladus. Sphagnum macrophyllum, generally
segregated as the sect. Isocladus, is nested within
sect. Subsecunda. A position for S. macrophyllum
within the sect. Subsecunda is indicated by all five
genomic regions sequenced, analyzed separately
and in all combinations (Figs. 1–12). Within the
Subsecunda, a close relationship between S. macro-
phyllum and S. cyclophyllum Sull. & Lesq. is re-
solved with strong bootstrap support by 26S (Fig.
1), combined 26S ⫹ psbT (Fig. 3; although not
psbT alone: Fig. 2), rpl16 (Fig. 6), and trnL (Fig.
7). Although a close relationship between these two
southeastern U.S. species is suggested by ITS, trnL,
and rpl16 in all combined data sets (Figs. 8–12),
ITS analyzed alone does not resolve them as a
monophyletic group. It is clear, nonetheless, that S.
macrophyllum is a member of the section Subse-
cunda, and that it has a close phylogenetic rela-
tionship to S. cyclophyllum.
Insulosa. Sphagnum aongstroemii, classified in
the monotypic section Insulosa, is closely related
to the sect. Acutifolia. The ITS ⫹ trnL combined
290 THE BRYOLOGIST [VOL. 103

FIGURE 6. Strict consensus tree obtained from parsimony analyses chloroplast-encoded rpl16 sequences. Sphagnum
capense was designated as the outgroup. Bootstrap support is indicated for those branches with higher than 50%. The
plant labeled ‘‘S. n.sp. 1’’ was collected in Ohio by B. Andreas. It is close to or conspecific with S. girgensohnii based
on morphological features.
2000] SHAW: SPHAGNOPSIDA 291

FIGURE 7. Strict consensus tree obtained from parsimony analyses chloroplast-encoded trnL sequences. Sphagnum
capense was designated as the outgroup. Bootstrap support is indicated for those branches with higher than 50%. The
plants labeled ‘‘S. n.sp.2’’ was collected in Norway (Shaw 9680; DUKE) mixed with S. fuscum, and K. I. Flatberg (pers.
comm.) suggested it might represent a new species.
292 THE BRYOLOGIST [VOL. 103

FIGURE 8. Strict consensus tree obtained from parsimony analyses of combined chloroplast-encoded rpl16 and trnL
sequences. Sphagnum capense was designated as the outgroup. Bootstrap support is indicated for those branches with
higher than 50%.
2000] SHAW: SPHAGNOPSIDA 293
294 THE BRYOLOGIST
data set (Fig. 9) and the ITS ⫹ trnL ⫹ rpl16 anal-
yses (Figs. 11–12) group S. aongstroemii with the
Acutifolia and suggest a sister group relationship
between S. aongstroemii and the rest of the section.
trnL and rpl16 alone or in combination do not re-
solve the affinities of S. aongstroemii (Figs. 6–7).
Data from psbT (Fig. 2), psbT ⫹ 26S (Fig. 3), and
the total evidence analysis, suggest that S. aongs-
troemii is nested within the Acutifolia (Fig. 4, with
⬎ 85% support). ITS data alone do not resolve the
Acutifolia as monophyletic, and suggest a sister
group relationship between S. aongstroemii and one
of the two Acutifolia clades (Fig. 5). The same re-
lationship is resolved in the consensus tree from
analyses of the ITS ⫹ rpl16 combined data set (Fig.
10). The weight of the evidence suggests that S.
aongstroemii is either sister to the inclusive sect.
Acutifolia, or is nested within the section, possibly
sister to one of the two major clades that comprise
it.
Polyclada. Sphagnum wulfianum, consistently
segregated as the monotypic section, Polyclada, is
nested within the sect. Acutifolia. A close relation-
ship between S. wulfianum, S. fimbriatum Wils. &
Hook. f., and S. girgensohnii Russ. is strongly sup-
ported by ITS (Fig. 5), rpl16 (Fig. 6), rpl16 ⫹ trnL
(Fig. 8), ITS ⫹ trnL (Fig. 9), ITS ⫹ rpl16 (Fig.
10), and all three data sets combined (Figs. 11–12).
All three species are not included in every data set,
but when they are, S. fimbriatum is sister to a clade
consisting of S. girgensohnii and S. wulfianum
(Figs. 5, 9).
Rigida. Section Rigida, represented by S. com-
pactum and S. strictum, forms a monophyletic
group in all analyses of ITS, rpl16, and trnL, sep-
arately and in combination (Figs. 5–12). Bootstrap
support for monophyly of section Rigida in sepa-
rate analyses of each gene is weak or moderate,
although the clade is in each of the strict consensus
trees. In every case where two or more of these
data sets were combined, bootstrap support for a
monophyletic section Rigida is very strong (⬎
90%).
ITS data suggest a sister group relationship be-
tween sections Rigida and Cuspidata, although with
only 53% bootstrap support (Fig. 5). The relation-
ship between sect. Rigida and the larger sections of
Sphagnum is unresolved in reconstructions derived
from trnL and rpl16, as well as in all two-way com-
binations of these data sets and ITS (Figs. 6–10).
When all three data sets are combined; however, a
←
FIGURE 9. Strict consensus tree obtained from parsimony analyses of combined nuclear-encoded ITS and chloro-
plast-encoded trnL sequences. Sphagnum capense was designated as the outgroup. Bootstrap support is indicated for
those branches with higher than 50%. The plant labeled ‘‘S. n.sp.2’’ is discussed in the legend to Figure 7.
[VOL. 103
sister group relationship between the sections Rig-
ida and Sphagnum is resolved in the consensus tree,
although without bootstrap support (Fig. 11). Data
from the 26S and psbT regions also support a re-
lationship between sections Rigida and Sphagnum,
although again without support (Figs. 1–3).
Squarrosa. Section Squarrosa, represented by S.
squarrosum Crome and S. teres (Schimp.) Aongstr.
is strongly supported as a monophyletic group by
separate analyses of ITS and trnL data (Figs. 5, 7).
Data sets including two-way combinations of ITS
⫹ trnL, and ITS ⫹ rpl16 sequences, resolve the
sect. Squarrosa with bootstrap values of ⬎ 95%
(Figs. 9–10). The three-way combined data set (ITS
⫹ trnL ⫹ rpl16) resolve the Squarrosa with a boot-
strap value of 100%. Oddly, rpl16 alone separates
S. squarrosum and S. teres, and positions the latter
among species of sect. Acutifolia (Fig. 6). This
same separation of S. squarrosum and S. teres is
retained in the combined rpl16 ⫹ trnL reconstruc-
tion (Fig. 8). There is little question that S. squar-
rosum and S. teres form a monophyletic clade.
Sect. Squarrosa forms a polytomy with the two
groups of Acutifolia species in analyses of ITS se-
quences alone (Fig. 5) and the combined ITS ⫹
rpl16 data set (Fig. 10). trnL data resolve the
Squarrosa as the sister group to a clade that in-
cludes species of sections Acutifolia, Sphagnum,
and Rigida (which are not resolved), but without
bootstrap support (Fig. 7). Combined ITS ⫹ trnL
data, and the three-way combination of ITS ⫹ trnL
⫹ rpl16, suggest a sister group relationship be-
tween sections Squarrosa and Acutifolia (Figs. 9,
11–12). Bootstrap support for this relationship is
moderate at best, although when the three-way
analysis was rooted using S. palustre as the out-
group, bootstrap support is 72% (Fig. 12).
Species relationships within sections Acutifolia,
Cuspidata, and Sphagnum.—Limited taxon sam-
pling precludes detailed analyses of species level
relationships within the sections Cuspidata and
Sphagnum, although sampling was more exhaustive
in the Acutifolia. Nevertheless, species level pat-
terns do emerge in each section, and selected phy-
logenetic relationships are described briefly below.
Acutifolia. The section Acutifolia, as tradition-
ally defined morphologically and supported by two-
and three-gene combined analyses (Figs. 9, 11–12),
includes at least two well-marked clades. Indeed,
these clades are resolved in single- and two-gene
phylogenies even when the inclusive Acutifolia is
2000] SHAW: SPHAGNOPSIDA 295

FIGURE 10. Strict consensus tree obtained from parsimony analyses of combined nuclear-encoded ITS and chloro-
plast-encoded rpl16 sequences. Sphagnum capense was designated as the outgroup. Bootstrap support is indicated for
those branches with higher than 50%. The plant labeled ‘‘S. n.sp.1.’’ is discussed in the legend to Figure 5.
296 THE BRYOLOGIST [VOL. 103

FIGURE 11. Strict consensus tree obtained from parsimony analyses of combined nuclear-encoded ITS and chloro-
plast-encoded rpl16 and trnL sequences. Sphagnum capense was designated as the outgroup. Bootstrap support is
indicated for those branches with higher than 50%.
2000] SHAW: SPHAGNOPSIDA 297

FIGURE 12. Strict consensus tree obtained from parsimony analyses of combined nuclear-encoded ITS and chloro-
plast-encoded rpl16 and trnL sequences. Sphagnum palustre was designated as the outgroup. Bootstrap support is
indicated for those branches with higher than 50%.
298 THE BRYOLOGIST
not (Figs. 10–11). One of these groups includes S.
subnitens Russ. & Warnst. S. subfulvum Sjörs, S.
molle Sull., and S. angermanicum Melin, among
others, and also two Neotropical species, S. laxi-
rameum Crum and S. oxyphyllum Warnst. Sphag-
num wulfianum, S. girgensohnii, and S. fimbriatum
may be part of this group (Figs. 5, 9–10), or it may
have a sister group relationship to the two major
clades (Figs. 11–12).
The other major clade within the Acutifolia in-
cludes S. capillifolium and related species, S. rus-
sowii Warnst., S. warnstorfii Russ., S. fuscum
(Schimp.) Klinggr., and S. quinquefarium
(Braithw.) Warnst., plus another group of Neotrop-
ical species including S. limbatum Mitt., S. sparsum
Hampe, S. austro-americanum Crum, and S. meri-
dense (Hampe) C. Müll. (Figs. 5–7, 9–12). The ‘‘S.
capillifolium complex’’ itself forms a well-marked
clade in almost all analyses.
Cuspidata. A sister group relationship between
S. torreyanum Sull. and S. recurvum is supported
by 26S (Fig. 1), combined 26S ⫹ psbT (Fig. 3),
total evidence analyses (Fig. 4), ITS (Fig. 5), ITS
⫹ rpl16 (Fig. 10), and ITS ⫹ trnL ⫹ rpl16 (Figs.
11–12). The Neotropical S. sancto-josephense
Crum & Crosby forms a clade with S. recurvum
and S. torreyanum in reconstructions from 26S
(Fig. 1), combined 26S ⫹ psbT (Fig. 3), total evi-
dence (Fig. 4), ITS (Fig. 5), ITS ⫹ trnL (Fig. 9),
ITS ⫹ rpl16 (Fig. 10), and the combined ITS ⫹
rpl16 ⫹ trnL analyses (Figs. 11–12).
Sphagnum. A close relationship between the cir-
cumtropical S. perichaetiale Hampe and the Neo-
tropical endemics, S. brevirameum Hampe and S.
brasiliense Warnst. is supported by ITS (Fig. 5),
trnL (Fig. 7), ITS ⫹ trnL (Fig. 9). ITS ⫹ rpl16
(Fig. 10), and the three data sets combined (Figs.
11–12). In every case, S. brevirameum and S. bras-
iliense form a clade that is sister to S. perichaetiale.
Other Neotropical species including S. aureum
McQueen, and the more widespread S. portoricense
Hampe are part of a different clade within the sect.
Sphagnum. Sphagnum crispatum Andrus and S. al-
egrense Warnst., based on samples from Australia,
are also members of this group, as are the such
northern species as S. affine Ren & Card., S. pal-
ustre, and S. henryense Warnst. (Figs. 5–6, 8–11).
DISCUSSION
Ambuchanania and the polarity of evolutionary
change in Sphagnum.—Certainly one of the most
significant inferences gained from molecular anal-
yses of the Sphagnopsida is that Ambuchanania
leucobryoides and the genus Sphagnum appear to
be sister groups. DNA sequence data indicate that
A. leucobryoides is not a highly derived species
[VOL. 103
nested within the true peatmosses, nor is it a basal
species within Sphagnum. This is in contrast to oth-
er morphologically distinctive species of Sphagnum
such as S. macrophyllum and S. pylaesii, which are
clearly nested within the genus as highly derived
elements. Species of Sphagnum (exclusive of A.
leucobryoides) share numerous synapomorphic
base substitutions that unite them as a monophyletic
group. The specific branching sequence at the base
of reconstructions from analyses in which A. leu-
cobryoides, Andreaea, and Takakia are included is
not resolved and the combined 26S ⫹ psbT recon-
struction actually places Andreaea rothii Web. &
Mohr rather than A. leucobryoides as the sister
group to Sphagnum. Ambuchanania shares signifi-
cant morphological features (discussed below) with
Sphagnum, and ambiguity in molecular reconstruc-
tions result from the fact that A. leucobryoides is
so highly divergent from Sphagnum. Molecular
data clearly support the taxonomic separation of A.
leucobryoides as a separate genus, family, and or-
der of Sphagnopsida, as proposed by Crum and
Seppelt (1999). Morphological data link it to the
Sphagnales.
The high level of divergence between A. leucob-
ryoides and Sphagnum was observed in 26S se-
quences, which are highly conserved within Sphag-
num. Moreover, although A. leucobryoides se-
quences from other genomic regions were not for-
mally included in the phylogenetic analyses, data
from ITS and trnL also support an isolated position
for A. leucobryoides relative to all other Sphagnum
species. Sequences from these regions in A. leu-
cobryoides were obtained, but could not be aligned
with those from any Sphagnum species because of
their high levels of divergence. Short portions of
ITS and trnL that are alignable between A. leucob-
ryoides and species of Sphagnum show that the A.
leucobryoides sequences are not artifactual (i.e.,
from fungal or algal contaminants), and the con-
served 5.8S gene within ITS sequences was fully
alignable with those from Sphagnum. Other por-
tions of these sequences, although readily alignable
across all species of Sphagnum sampled, are too
highly divergent in A. leucobryoides to safely infer
base homology between A. leucobryoides and
Sphagnum. Data from the chloroplast-encoded rps4
gene (Cox & Hedderson 1999), not included in the
present analyses because there is very little varia-
tion within Sphagnum (unpubl. data), provides
more evidence of an isolated position for A. leu-
cobryoides. Although an rps4 sequence is not pres-
ently available for A. leucobryoides, the amplified
fragment is substantially smaller than that obtained
for any Sphagnum species. All of these genomic
regions thus strongly support an isolated position
for A. leucobryoides outside the genus Sphagnum.
2000] SHAW: SPHAGNOPSIDA
Ambuchanania leucobryoides was first described
in 1990, and placed in its own monotypic section,
Buchanania, of Sphagnum (Yamaguchi et al. 1990).
It is still known from only two Tasmanian collec-
tions, the holotype from a coastal locality in south-
western Tasmania, and a subsequent one made in
1986 from an inland site in the Tasmanian central
plateau (Crum & Seppelt 1999). Ambuchanania
leucobryoides shares morphological features with
Sphagnum that clearly place it in the Sphagnopsida:
branches sometimes weakly fasciculate, differenti-
ation of chlorophyllose and hyaline leaf cells, de-
velopment of fibrils and pores in the hyaline cells,
sporophyte with a massive, dome-shaped columella
overarched by sporogenous tissue, absence of a
seta, and elevation of the sporophyte on a game-
tophytic pseudopodium. However, morphological
differences between A. leucobryoides and Sphag-
num are also significant. Unlike Sphagnum, both
hyaline and chlorophyllose cells of A. leucobryoi-
des are sometimes bistratose, archegonia and an-
theridia are borne terminally on stems rather than
on separate lateral branches, and the antheridia are
oblong rather than globose. Significantly, anther-
idial shape in A. leucobryoides is a closer match to
those of true mosses (Bryopsida) than to Sphag-
num. Additional characters that distinguish A. leu-
cobryoides from Sphagnum include the absence of
a differentiated wood cylinder and enlarged cortical
cells in the stem, leaves bordered by narrow thin-
walled (rather than thick-walled) cells, and poor de-
velopment of fasciculate branching. Although some
derived species of Sphagnum lack or nearly lack
fasciculate branching (e.g., S. pylaesii), this appears
to represent a secondary loss from a fasciculate an-
cestral condition, whereas sparsely branched stems
in A. leucobryoides may represent a plesiomorphic
condition.
Polarity of evolutionary change within Sphag-
num inferred from outgroup rooting of molecular
data is ambiguous and this important issue requires
additional work. Separate and combined analyses
of 26S and psbT sequences suggest that species tra-
ditionally classified in the sect. Subsecunda are bas-
al, but total evidence analyses including all five
genes resolve the sect. Sphagnum as sister to re-
maining species, and place the Subsecunda in a
more derived position as sister to a clade containing
the Acutifolia and Cuspidata. Both of these con-
trasting inferences should be viewed with caution.
Reconstructions that suggest the Subsecunda as
basal are based on neighbor joining analyses and
the topologies are without bootstrap support. Sim-
ilarly, resolution of sect. Sphagnum as basal in total
evidence parsimony analyses is without bootstrap
support. Moreover, Sphagnum is the most patristi-
cally isolated section of the genus. Midpoint root-
299
ing, which places the root along the longest branch,
resolves sect. Sphagnum as the sister group to other
species of the genus (not shown). This raises the
possibility that long branch attraction (Felsenstein
1978) between sect. Sphagnum and the outgroups
could be involved in the basal placement of sect.
Sphagnum in the total evidence analyses, and may
be erroneous. Furthermore, the total evidence anal-
ysis included both Andreaea and Takakia, but data
for the more variable regions (ITS, trnL, rpl16)
were scored as missing in the outgroups. (The 5.8S
gene in ITS sequences were included for the out-
groups because this region was alignable with the
ingroup, but the spacer regions were scored as
missing.) Large amounts of missing data can also
lead to unpredictable and possibly erroneous out-
comes.
Eddy (1977, 1979) considered species of the
sect. Subsecunda as least modified from the ances-
tral condition in Sphagnum, and speculated that de-
spite its morphological isolation, the section Sphag-
num is highly derived and related to the Acutifolia.
Andrews (1937) also interpreted sect. Sphagnum as
derived within the genus. Eddy (1977) suggested
that the sect. Acutifolia is paraphyletic, with sect.
Sphagnum derived from within it. Evidence in fa-
vor of a basal position for the Subsecunda include
the wide distribution and high level of morpholog-
ical diversity relative to other sections (Eddy 1985,
p. 80). Eddy (1977) further argued that unbranched,
isophyllous stems with serially and/or randomly ar-
ranged pores in leaf hyaline cells provides further
evidence of primitivity in the Subsecunda. Such un-
branched isophyllous forms are common in the
Subsecunda (e.g., S. cyclophyllum, S. simplex Fife,
some forms of S. subsecunda Nees and S. lescurii
Sull.), and the fact that Ambuchanania also has
non- or weakly fasciculate branching may support
Eddy’s hypothesis. Sampling of Subsecunda is in-
sufficient at present to resolve patterns of evolution
within the section, but S. simplex, recently de-
scribed by Fife (1996) from New Zealand, should
be examined carefully because of its simple mor-
phology and geographic proximity to Ambuchan-
ania.
Circumscription of sections Acutifolia, Cuspi-
data, Sphagnum, and Subsecunda, and relation-
ships of the smaller sections.—A revised classifi-
cation for Sphagnum is presented below, but first
some modifications of sectional circumscriptions
that are well-supported by molecular data are pro-
posed.
Acutifolia. Molecular evidence derived from the
combined analyses of multiple genes (ITS, trnL,
rpl16) supports a monophyletic origin for the sect.
Acutifolia, although the two major clades that com-
prise it are so distinct that single-gene phylogenies
300 THE BRYOLOGIST
fail to combine them as a monophyletic group. The
two groups correspond closely (although not iden-
tically) to the ‘‘green- and red-Acutfolia’’ that are
resolved by isozyme loci (Cronberg 1996). (Red
pigmentation can be developed in species of both
groups, although the ‘‘red’’ Acutifolia are more typ-
ically red in color.) The green Acutifolia include S.
subnitens, S. subfulvum, S. angermanicum, and S.
molle, among others, whereas the red Acutifolia in-
clude S. capillifolium and related species, S. fus-
cum, S. quinquefarium, and S. meridense. There
may be ecological correlates to this division as
well, with the red Acutifolia typical of ombrotroph-
ic habitats and the green Acutifolia more typical of
minerotrophic wetlands (Cronberg 1996). There is
ecological heterogeneity within each group, how-
ever.
Schimper (1876) included S. aongstroemii in his
sect. Mollia, with S. molle and S. compactum (as S.
rigidum (Nees & Hornsch.) Schimp.). Andrews
(1913), Isoviita (1966), and Daniels and Eddy
(1985), noted morphological similarities between S.
aongstroemii and the Squarrosa. Nevertheless,
most recent authors have separated S. aongstroemii
as the monotypic sect. Insulosa (e.g., Crum 1984;
Daniels & Eddy 1985; Isoviita 1966). The position
of S. aongstroemii is not fully resolved by molec-
ular data, but the species is clearly either nested
within the Acutifolia, or sister to the rest of the
section. In either case, segregation of S. aongstroe-
mii in its own section is not justified. The sect. In-
sulosa should be abandoned and S. aongstroemii
should be included within a monophyletic sect.
Acutifolia.
Sphagnum sericeum, a species of uncertain affin-
ities sometimes grouped with S. macrophyllum be-
cause of the absence of leaf cell fibrils (e.g., Warns-
torf 1911), has been segregated in its own section,
Acocosphagnum C. Müll. (Isoviita 1966). Molecu-
lar data strongly suggest that S. sericea is nested
within the sect. Acutifolia. The only sequence avail-
able for S. sericea comes from the ITS region. If
this relationship is true, S. sericea must be included
in the sect. Acutifolia for the latter to be monophy-
letic. The same is true for S. wulfianum, for which
there is strong multigenic molecular evidence of
membership in the Acutifolia. The section Polycla-
da should be abandoned.
Cuspidata. The sect. Cuspidata is clearly re-
solved by molecular data. Furthermore, there is lit-
tle question that S. tenellum (sect. Mollusca) and S.
pylaesii (sect. Hemitheca) are nested within the
Cuspidata as highly derived, morphologically di-
vergent species. Although most authors (e.g., An-
drus 1980; Crum 1984; Isoviita 1966) include S.
tenellum in the sect. Cuspidata, Daniels and Eddy
(1985) classified it in the monotypic sect. Mollusca.
[VOL. 103
Some authors include S. pylaesii in the Subsecunda
(e.g., Andrus 1980; Isoviita 1966) whereas others
segregate it as the sect. Hemitheca (Braithwaite
1878; Crum 1984). Daniels and Eddy (1985) rec-
ognized the sect. Hemitheca, but considered it a
segregate of the Subsecunda. Lindberg (1882, cited
in Isoviita 1966) grouped S. cyclophyllum with S.
pylaesii in the sect. Hemitheca. Sphagnum pylaesii
has a number of autapomorphic morphological
characters including isophyllous, nonfasciculate
stems; immersed or emergent, hemispheric capsules
that are borne on slender side branches below the
capitulum; and the absence of pseudostomata
(Braithwaite 1878; Crum 1984). Nevertheless, se-
quence data are unambiguous in placing S. pylaesii
deeply within the Cuspidata, and provide no evi-
dence of a relationship to the Subsecunda. Mor-
phological similarities between S. pylaesii and S.
tenellum, including the broadly concave, more or
less isophyllous leaves, is apparently synapomorph-
ic, as these species appear to have a sister group
relationship within the Cuspidata. The sections
Mollusca and Hemitheca should be abandoned in
favor of a monophyletic sect. Cuspidata.
Andrews (1911, 1913), among others, has sug-
gested that the sections Cuspidata and Subsecunda
intergrade morphologically. DNA sequence data,
however, indicate that the two sections are distinct
and each monophyletic. On the other hand, several
species, including S. mendocinum Sull. & Lesq. of
the North American Pacific northwest, the subant-
arctic S. falcatulum Besch., and S. ehyalinum Shaw
& Goffinet from Patagonia, provide evidence of
past hybridization involving members of the Sub-
secunda and Cuspidata (unpubl. data). Similar ev-
idence of past reticulation has been reported in var-
ious angiosperm groups (Rieseberg & Wendel
1993) and does not negate evidence for a mono-
phyletic origin of the groups.
Sphagnum. The sect. Sphagnum is well-marked
morphologically and molecular evidence corrobo-
rates a monophyletic origin for the group. The de-
gree of isolation of S. austinii and S. steerei from
other members of sect. Sphagnum is surprising, es-
pecially considering the close morphological rela-
tionships between these species and S. affine Ren.
& Card. Indeed, Crum (1984) considered S. austinii
to be a synonym of S. imbricatum Russ. which he
defined broadly to include S. affine and closely re-
lated taxa that Flatberg (1986) recognized at the
specific level. The species in this group, including
both S. austinii and S. steerei, are distinguished by
relatively minor differences in hyaline cell orna-
mentation, as well as general aspect and color. No
obvious explanation can be provided for the mo-
lecular divergence of S. steerei and S. austinii, and
their isolation is not limited to sequences from a
2000] SHAW: SPHAGNOPSIDA
single gene. Nevertheless, in analyses of combined
data from multiple genes, the sect. Sphagnum is
resolved as a monophyletic group despite the di-
vergence of these two species. Molecular data from
additional collections of S. austinii and S. steerei
might shed light on this surprising situation.
Subsecunda. In analyses of 26S and psbT se-
quences in which outgroup taxa were included, spe-
cies traditionally classified in the sect. Subsecunda
form either a monophyletic clade without bootstrap
support (26S) or a paraphyletic grade (psbT). Sin-
gle-gene analyses based on ITS, trnL, and rpl16
were arbitrarily rooted with a member of the Sub-
secunda as the outgroup, so monophyly of the Sub-
secunda could not be independently evaluated. The
only test of monophyly for the Subsecunda comes
from the combined ITS ⫹ trnL ⫹ rpl16 analysis in
which S. palustre was designated as the outgroup,
and in that case the Subsecunda were resolved as a
monophyletic group, albeit with weak bootstrap
support.
Virtually all permutations of the molecular data
indicate a close relationship between S. cyclophyl-
lum and S. macrophyllum. Both species are mor-
phologically atypical and Lindberg (1862, cited in
Isoviita 1966) raised S. macrophyllum to generic
rank as Isocladus. Andrews (1937) suggested a re-
lationship for S. macrophyllum to the Subsecunda.
Maass (1967) noted similarities between S. macro-
phyllum and the Cuspidata. Isoviita (1966) sug-
gested that the sect. Isocladus should be classified
between the Subsecunda and Cuspidata. The mo-
lecular evidence is unambiguous that S. cyclophyl-
lum is a member of the Subsecunda, and is closely
related to S. macrophyllum. The high level of con-
sistency across all five genes representing both the
nuclear and chloroplast genomes argue strongly
that S. macrophyllum, however atypical morpho-
logically, belongs in the Subsecunda. The section
Isocladus should be abandoned.
Phylogenetic relationships among the sections
of Sphagnum.—Only two previous phylogenetic
trees for Sphagnum have been published. He and
Aur (1991) provided a cladogram illustrating their
hypothesis of relationships among species of
Sphagnum represented in Northeast China. The tree
shows two main branches, one with the sections
Squarrosa and Sphagnum as sister groups, and the
other including species of sections Subsecunda, Po-
lyclada, Acutifolia, and Cuspidata. Sphagnum wul-
fianum (sect. Polyclada) is shown as sister to the
Subsecunda in a monophyletic clade, and this clade
is in turn sister to the Acutifolia plus Cuspidata.
These relationships are not supported by molecular
analyses.
Daniels and Eddy (1985) provided a phyloge-
netic tree illustrating their hypothesis of relation-
301
ships among European species of Sphagnum. Their
tree also divides Sphagnum into two major clades.
One consists of the sections Rigida, Mollusca (S.
tenellum), Cuspidata, Subsecunda, and Hemitheca,
and the other consists of sections Polyclada, Insu-
losa, Squarrosa, Acutifolia, and Sphagnum. In the
first clade, section Rigida is featured as sister to the
clade including sections Cuspidata, Subsecunda,
and Hemitheca. Sphagnum pylaesii (Hemitheca)
and S. tenellum (Mollusca) represent isolated clades
unrelated to each other, and outside the Cuspidata
s.s. This is in conflict with strong molecular evi-
dence, which suggests that S. pylaesii and S. tenel-
lum are derived sister species nested within the
Cuspidata. The other of the two major infrageneric
clades hypothesized by Daniels and Eddy (1985)
shows S. wulfianum as sister to a clade that contains
the sections Insulosa (S. aongstroemii), Squarrosa,
Acutifolia, and Sphagnum. This also is in conflict
with the molecular data. Sequences from three
genes provide strong support for a position for S.
wulfianum within the Acutifolia, closely related to
S. fimbriatum and S. girgensohnii. Daniels and
Eddy (1985) showed S. aongstroemii as sister to
the Squarrosa, whereas molecular data suggest that
it is either sister to the Acutifolia or nested within
that section. However, the Squarrosa and Acutifolia
may have a sister group relationship, so although
the weight of the evidence places S. aongstroemii
closer to the Acutifolia, the hypothesis of Daniels
and Eddy should not be dismissed. Andrews (1913)
also hypothesized a sister group relationship be-
tween S. aongstroemii and the sect. Squarrosa. Iso-
zyme data suggested a close relationship between
the Acutifolia and Squarrosa, and in fact support a
position for the Squarrosa nested within the Acu-
tifolia (Cronberg 1996). Unfortunately, S. aongs-
troemii was not included in the isozyme analyses.
Morphological and biogeographic implica-
tions.—Morphological evolution. A formal cladis-
tic analysis of morphological variation in the
Sphagnopsida has not yet been completed, but phy-
logenetic hypotheses derived from molecular data
permit a few preliminary statements about the evo-
lution of morphological characters. Based on the
inference that Ambuchanania leucobryoides is the
sister group to Sphagnum, unbranched or sparsely
branched stems appear to be plesiomorphic in
Sphagnum. Nonfasciculate forms are especially
common in the sect. Subsecunda, but it is unclear
at present which, if any, represent retained ancestral
states and which are derived by secondary reduc-
tion from fasciculate ancestors. It is clear that non-
fasciculate branching is not homologous across
Sphagnum. The simplex growth form of S. pylaesii,
nested within the Cuspidata, evolved independently
of similar morphologies in the Subsecunda. Al-
302 THE BRYOLOGIST
though it could be that nonfasciculate branching is
plesiomorphic in the sect. Subsecunda, it is almost
certainly derived in the Cuspidata. The fact that
many species in the Subsecunda have a propensity
to display isophyly and nonfasciculate branching
under some environmental conditions, and that the
growth form is fixed in such species as S. cyclo-
phyllum and S. simplex, may well result from ho-
mologous genes or gene combinations shared by
the Subsecunda.
It is noteworthy that A. leucobryoides does not
have fibrillose stem or branch cortical cells, as is
diagnostic (or near diagnostic) for the sect. Sphag-
num. Evidently, fibrillose cortical cells are not ple-
siomorphic in the genus Sphagnum, and are instead
a synapomorphy for the sect. Sphagnum. Other sig-
nificant morphological states shared by species of
sect. Sphagnum include the presence of a marginal
resorption furrow on the branch leaves, and an ab-
sence of retort-shaped branch cortical cells. A sister
group relationship between the sections Sphagnum
and Rigida is suggested by several of the molecular
analyses, and although that relationship does not
have strong support, it shows up in the results from
multiple genes and makes sense in terms of mor-
phological evolution. A sister group relationship
implies that the marginal resorption furrow shared
by species in these two sections is homologous.
Species of the sect. Rigida have poorly developed
retort cells in the branch cortex, another feature that
suggests a relationship to the sect. Sphagnum. An
alternative hypothesis suggested by ITS sequences,
that sections Rigida and Cuspidata have a sister
group relationship, is less parsimonious in terms of
the evolution of these morphological traits. Phylo-
genetic inferences derived from the molecular anal-
yses, on the other hand, indicate that the resorption
furrow found in S. molle of the sect. Acutifolia
evolved independently of those in sections Rigida
and Sphagnum. Sphagnum costae Crum & Da Cos-
ta, from Brazil, also has a resorption furrow and is
thought to be related to S. molle (Crum & Da Costa
1994).
Biogeography. More extensive sampling of spe-
cies within sections and resolution of polarity for
the Sphagnum phylogeny are crucial for making
biogeographic inferences. Nevertheless, prelimi-
nary inferences suggest that Sphagnum will provide
a valuable model for biogeographic studies.
Sphagnum-dominated peatlands are most exten-
sive in boreal regions of the Northern Hemisphere
and most people think of boreal regions as the
‘‘home’’ to Sphagnum. While it is true that the bio-
mass produced by species of Sphagnum is by far
greatest in the boreal zone, the highest species di-
versity is not found in northern areas (Halsey et al.
2000). Howard Crum has been especially active in
[VOL. 103
studying peatmoss diversity in South America, and
his unpublished treatment for the Flora Neotropica
recognizes more than 180 species (Crum, pers.
comm.). Crum has suggested that the Neotropics
may in fact be the center of diversity for Sphagnum,
even though they do not form extensive peatlands
there. Gams (1932) considered Brazil a center of
diversity for Sphagnum and suggested that many
‘‘old’’ species have survived there. Andrews
(1937), on the other hand, argued that most South
American taxa are closely related or identical to
northern species. The exceptionally broad species
concepts of Andrews are well known, and molec-
ular data do not support the contention that Neo-
tropical Sphagna are conspecific with boreal taxa.
Even if Crum’s estimate, based in an inadequate
number of collections (at no fault of Crum’s), is off
by 50%, the diversity of Sphagnum in South Amer-
ica may be greater than in any other region of the
world. Some of the questions that arise are what
are the phylogenetic relationships between tropical
and boreal species? Where did the genus originate?
Is the dominance of Sphagnum in many boreal hab-
itats a relatively recent development (in the context
of Sphagnum evolution)? Were there multiple dis-
persal events between low and high latitudes? What
were the directions of such dispersal events?
Eddy (1985) hypothesized that Sphagnum origi-
nated in Africa and that species of sect. Subsecun-
da, specifically the ‘‘S. capense group,’’ are most
similar to the hypothetical ancestor of all Sphagna.
He further suggested that the sections of Sphagnum
diversified prior to the breakup of Pangaea, thus
accounting for the worldwide distributions of the
large sections. The sect. Acutifolia, which is not
diverse in tropical or Southern Hemisphere regions,
may have diversified later, after the breakup of
Laurasia and Gondwanaland (Eddy 1977, 1979).
Eddy (1985) pointed out that in tropical regions,
most species are endemic to particular continental
areas, notwithstanding the occurrence of a few such
pantropical species as S. perichaetiale and S. stric-
tum (the latter also widespread at northern lati-
tudes). He (Eddy 1977) suggested that boreal taxa
are derived relative to basal species, especially Af-
rican, in the genus.
The geographic origin of Sphagnum remains un-
clear because of uncertainty about rooting the in-
frageneric phylogeny. The question of ultimate or-
igins has to await resolution of this problem. There
are, however, geographic patterns that support
Eddy’s view of regional speciation in some groups.
In the Subsecunda, although polarity of evolution
is not resolved for the section as a whole, it is clear
that S. macrophyllum and S. cyclophyllum, both
species of the southeastern U.S., are closely related
2000] SHAW: SPHAGNOPSIDA 303

and probably sister taxa. Boreal Subsecunda, in-
cluding S. orientale Sav.-Ljub., S. platyphyllum
(Braithw.) Warnst., and S. contortum Schultz form
a clade distinct from southern species of this sec-
tion in most analyses. Sphagnum lescurii of eastern
North America is not a part of that clade. (S. sub-
secundum s.s. was not included in the analyses.)
African and Asian species appear to have a closer
relationship among themselves than to any boreal
or New World species, although it should be men-
tioned that none of the numerous South American
Subsecunda have been included in the analyses yet.
In the sections Cuspidata and Sphagnum, sam-
pling is too restricted to date to make many gen-
eralizations, and in particular, to determine if boreal
versus low latitude taxa are basal in the section. It
is clear, however, that at least two of the endemic
South American species of sect. Sphagnum (S. bre-
virameum and S. brasiliense) are closely related to
the pantropical species, S. perichaetiale. Another
tropical species of sect. Sphagnum, S. portoricense,
is not closely related to the S. perichaetiale group,
but rather to such boreal species as S. affine. Such
a relationship was suggested by Warnstorf (1889)
and Andrews (1912). Andrews (1912) provided a
diagram illustrating his concepts of relationships
among species of sect. Sphagnum, and showed S.
portoricense as the most derived species, descend-
ed directly from S. imbricatum. Interestingly, the
Australian S. cristatum is also apparently related to
this group. A specimen collected in Australia and
labeled as S. alegrense, a species otherwise restrict-
ed to the Neotropics, is also a member of this clade.
More extensive sampling of species will undoubt-
edly show that the Sphagnum flora of particular re-
gions such as northern South America have com-

FIGURE 13. Strict consensus tree obtained from parsimony analyses of combined nuclear-encoded ITS and chloro-
plast-encoded rpl16 and trnL sequences, as an unrooted network.
304 THE BRYOLOGIST
plex biogeographic origins that involve multiple
lineages, even within sections.
Some species of sect. Cuspidata are widespread
at high latitudes of the Southern Hemisphere and
these species invite additional investigations at the
population level to elucidate patterns of dispersal
and vicariance. It is noteworthy that the present
analyses corroborate a close relationship between
S. cuspidatum and such Southern Hemisphere spe-
cies as S. falcatulum and S. cuspidatulum C. Müll.,
which comprise the ‘‘S. cuspidatum complex’’
based on morphological similarities. This relation-
ship is evident even though the sample of S. cus-
pidatum sequenced for this study was collected in
North Carolina. Population-based sampling of such
widespread Sphagna as S. cuspidatum, S. magellan-
icum, and the bipolar S. fimbriatum, would un-
doubtedly prove to be informative.
Basal species of the section Acutifolia are un-
ambiguously northern. The northern distribution of
species in sect. Squarrosa, which is probably the
sister group to Acutifolia, supports a northern origin
for both sections. The Acutifolia are not diverse in
most tropical areas, but in his unpublished Flora
Neotropica treatment, Crum (pers. comm.) recog-
nized 34 species in Central and South America.
Molecular phylogenetic analyses suggest at least
two origins of Neotropical Acutifolia from boreal
ancestors. One group, including S. meridense, S.
austro-americanum, S. lewisii Crum, S. limbatum,
and S. sparsum, are derived within the ‘‘red Acu-
tifolia.’’ The other group, represented by S. laxi-
rameum and S. oxyphyllum, are derived within the
‘‘green Acutifolia.’’ Sphagum junghunianum Dozy
& Molk., a widespread species in Asia as well as
the New World may be part of this group. Crum
(1993) compared S. austro-americanum to S. sub-
nitens, but the affinites of this species appear to be
with the red Acutifolia. Evidently, there have been
at least two dispersal events from boreal to tropical
latitudes within the Acutifolia, independently within
the red and green clades. Tropical green Acutifolia
are closely related to S. subnitens, S. subfulvum,
and the eastern North American S. flavicomans
(Card.) Warnst. Sampling of additional Acutifolia
from the Neotropics may require hypothesizing ad-
ditional dispersal from boreal to low latitude areas.
An overview of evolutionary patterns in the
Sphagnopsida.—Several general patterns are evi-
dent from molecular analyses. In agreement with
morphological inferences, molecular data support
an isolated position for the Sphagnopsida. The
Sphagnopsida are characterized by a suite of mor-
phological autapomorphies and it is difficult to po-
larize characters in the Sphagnopsida because ho-
mologies with any potential outgroup are obscure.
Highly conserved DNA regions such as 26S nucle-
[VOL. 103
ar ribosomal DNA and the psbT chloroplast gene
can be compared between Sphagum and outgroups,
but more variable genomic regions are so different
in Sphagnum that comparisons cannot be made.
The same problems encountered in rooting any
phylogeny of Sphagnum based on morphology are
also encountered with molecular data. The Sphag-
nopsida are so highly divergent that homologies are
obscure.
An unrooted network showing relationships
based on combined ITS ⫹ rpl16 ⫹ trnL data (Fig.
13) suggests that phylogenetic diversity in Sphag-
num is ‘‘packaged’’ in four major lineages, even if
sister-group relationships among these lineages are
unresolved. A classification for the genus that in-
cludes the four large sections, without segregation
of any of the smaller groups from these, would re-
flect phylogenetic relationships accurately.
Molecular results are unambiguous in placing the
sections, Hemitheca, Isocladus, Insulosa, and Poly-
clada within the larger sections. A case could be
made, however, for recognizing the sections Squar-
rosa and Rigida. Squarrosa may be sister to the rest
of the Acutifolia and, as such, could be afforded sec-
tional rank. Nevertheless, in the context of the whole
genus, it makes more sense to define the Acutifolia
in the more inclusive way to include the Squarrosa
as well. Placement of the sect. Rigida relative to oth-
er sections is less clear, but the weight of the mo-
lecular evidence argues for a sister group relation-
ship with sect. Sphagnum. This placement is consis-
tent with morphological characters. Andrews (1937)
argued that sect. Rigida shares significant features
with the sections Acutifolia, Cuspidata, and Subse-
cunda, and consequently separated it from the sect.
Sphagnum (as subgenus Litophloea) and included it
in a subgenus with those sections (as subg. Lito-
phloea). The phylogenetic placement of Rigida as
sister to the sect. Sphagnum is consistent with the
hypothesis that morphological character states
shared by Rigida and the sections Acutifolia, Cus-
pidata, and Subsecunda are plesiomorphic. Rigida
appears to simply lack the autapomorphic morpho-
logical features that characterize sect. Sphagnum.
The following classification for Sphagnum, including
a partial list of synonymy, is proposed based on the
results of molecular analyses.
Sphagnum L.
section ACUTIFOLIA Wils. Synonyms:
sect. Insulosa Isoviita
sect. Polyclada (C. Jens.) Horrell
sect. Sericea (Warnst.) Fleischer
sect. Squarrosa (Russ.) Schimp.
section CUSPIDATA (Lindb.) Schlieph. Synonyms:
sect. Mollusca Cas-Gil.
sect. Hemitheca Braithw.
section SPHAGNUM Synonym:
2000] SHAW: SPHAGNOPSIDA
sect. Rigida Lindb.
section SUBSECUNDA Synonym:
sect. Isocladus (Lindb.) Braithw.
LITERATURE CITED
ANDREWS, A. L. 1911. Notes on North American Sphag-
num. I. The groups. THE BRYOLOGIST 14: 72–75.
. 1912. Notes on North American Sphagnum. II.
The subgenus Inophloea Russow. THE BRYOLOGIST 15:
1–9, 63–74.
. 1913. Notes on North American Sphagnum. V.
The section Acisphagnum Carl Müller. THE BRYOLO-
GIST 16: 59–62, 74–76.
. 1937. Notes on the Warnstorf Sphagnum-herbar-
ium. I. Annales Bryologici 9: 3–12.
ANDRUS, R. E. 1980. Sphagnaceae (peat moss family) of
New York State. New York State Bulletin 443: 1–89.
BALDWIN, B. G. 1992. Phylogenetic utility of the internal
transcribed spacers of nuclear ribosomal DNA in
plants: an example from the Compositae. Molecular
Phylogenetics and Evolution 1: 3–16.
BOPP, M & I. CAPESIUS. 1996. New aspects of bryophyte
taxonomy provided by a molecular approach. Botanica
Acta 109: 368–372.
BRAITEWAITE, R. 1878. The Sphagnaceae or Peatmosses
of Europe and North America. Hardwicke and Bogue,
London.
BREMER, K. 1988. The limits of amino acid sequence data
in angiosperm phylogenetic reconstruction. Evolution
42: 795–803.
BUCK, W. R., B. GOFFINET & A. J. SHAW. 2000. Testing
morphological concepts of orders of pleurocarpous
mosses (Bryophyta) using phylogenetic reconstruc-
tions based on trnL-trnF and rps4 sequences. Molec-
ular Phylogenetics and Evolution 10: (in press).
CAPESIUS, I. 1995. A molecular phylogeny of bryophytes
based on nuclear encoded 18S rRNA genes. Journal
of Plant Physiology 146: 59–63.
COX, C. J. & T. A. HEDDERSON. 1999. Phylogenetic rela-
tionships among the ciliate mosses: evidence from
chloroplast and nuclear DNA sequences. Plant Sys-
tematics and Evolution 215: 119–139.
CRONBERG, N. 1996. Isozyme evidence of relationships
within Sphagnum sect. Acutifolia (Sphagnaceae, Bry-
ophyta). Plant Systematics and Evolution 203: 41–64.
CRUM, H. A. 1984. Sphagnopsida Sphagnaceae. North
American Flora, series II, Part 11. The New York Bo-
tanical Garden, NY.
. 1993. New species of Sphagnum from South
America. Journal of the Hattori Botanical Laboratory
74: 145–154.
& P. DA COSTA. 1994. Sphagnum costae, a new
Brazilian species related to S. molle Sull. Cryptoga-
mie, Bryologie, et Lichénologie 15: 111–115.
& R. D. SEPPELT. 1999. Sphagnum leucobryoides
reconsidered. Contributions from the University of
Michigan Herbarium 22: 29–31.
DANIELS, R. E. & A. EDDY. 1985. Handbook of European
Sphagna. HMSO, London.
DOYLE, J. J. & J. L. DOYLE. 1987. A rapid DNA isolation
for small quantities of fresh tissue. Phytochemical Bul-
letin 19: 11–15.
EDDY, A. 1977. Sphagnales of tropical Asia. Bulletin of
the British Museum (Natural History) Botany 5: 357–
445.
. 1979. Taxonomy and evolution of Sphagnum,
pp.109–121. In G. C. S. Clarke & J. G. Duckett (eds.),
Bryophyte Systematics. Academic Press, London.
305
. 1985. A revision of African Sphagnales. Bulletin
of the British Museum (Natural History) Botany 12:
77–162.
FARRIS, J. S., M. KÄLLERSJÖ, A. G. KLUGE & C. BULT.
1994. Testing significance of incongruence. Cladistics
10: 315–319.
FELSENSTEIN, J. 1978. Cases in which parsimony or com-
patibility methods will be positively misleading. Sys-
tematic Zoology 27: 401–410.
. 1985. Confidence limits on phylogenies: An ap-
proach using the bootstrap. Evolution 39: 783–791.
FIFE, A. J. 1996. A synopsis of New Zealand Sphagna,
with a description of S. simplex sp. nov. New Zealand
Journal of Botany 34: 309–328.
FLATBERG, K. I. 1986. Taxonomy, morphovariation, dis-
tribution and ecology of the Sphagnum imbricatum
complex with main reference to Norway. Gunneria 54:
1–118.
GAMS, H. 1932. Quaternary distribution, pp. 297–322. In
F. Verdoorn (ed.), Manual of Bryology. Martinus Ni-
jhoh, The Hague.
GARBARY, D. J. & K. S. RENZAGLIA 1998. Bryophyte phy-
logeny and the evolution of land plants: evidence from
development and ultrastructure, pp.45–63. In J. W.
Bates, N. W. Ashton & J. G. Duckett (eds.), Bryology
for the Twenty-first Century. British Bryological So-
ciety, London.
HALSEY, L., D. H. VITT & L. D. GIGNAC. 2000. Sphagnum-
dominated peatlands in North America since the last
glacial maximium: their occurrence and extent. THE
BRYOLOGIST 103: 334–352.
HE, X.-L. & C. W. AUR. 1991. Cladistic analysis of Sphag-
num in northeast China. Acta Phytotaxonomica Sinica
29: 131–141.
HILL, M. O. 1978. Sphagnopsida, pp. 30–78. In A. J. E.
Smith (ed.), The Moss Flora of Britain and Ireland.
Cambridge University Press, Cambridge.
HOLCOMBE, J. W. 1984. Morphogenesis of branch leaves
of Sphagnum magellanicum Brid. Journal of the Hat-
tori Botanical Laboratory 57: 179–240.
HONG, L., J. F. STEVENSON, W. B. ROTH & R. B. HALLICK.
1995. Euglena gracilis chloroplast psbB, psbT, psbH
and psbN gene cluster: regulation of psbB-psbT pre-
mRNA processing. Molecular and General Genetics
247: 180–188.
ISOVIITA, P. 1966. Studies on Sphagnum L. I. Nomencla-
tural revision of the European taxa. Annales Botanici
Fennica 3: 199–264.
IWATSUKI, Z. 1986. A peculiar New Caledonian Sphagnum
with rhizoids. THE BRYOLOGIST 89: 20–22.
JORDAN, W. C., M. W. COURTNEY & J. E. NEIGEL. 1996.
Low levels of intraspecific genetic variation at a rap-
idly evolving chloroplast DNA locus in North Amer-
ican Duckweeds (Lemnaceae). American Journal of
Botany 83: 430–439.
KELCHNER, S. A. & L. G. CLARK. 1997. Molecular evo-
lution and phylogentic utility of the chloroplast rpl16
intron in Chusquea and Bambusoideae (Poaceae). Mo-
lecular Phylogenetics and Evolution 8: 385–397.
KRELLWITZ, E. C., K. V. KOWALLIK, & P. S. MANOS. 2000.
Phylogenetic study of Bryopsis (Chlorophyta) from the
western North Atlantic and Caribbean based on coding
and non-coding sequences of the chloroplast psbB op-
eron. Journal of Phycology (in press).
LIGRONE, R. & J. G. DUCKETT. 1998. Development of the
leafy shoot in Sphagnum (Bryophyta) involves the ac-
tivity of both apical and subapical meristems. New
Phytologist 140: 581–595.
, & K. S. RENZAGLIA. 1993. The gameto-
306 THE BRYOLOGIST
phyte-sporophyte junction in land plants. Advances in
Botanical Research 19: 231–317.
MAASS, W. S. G. 1967. Studies on the taxonomy and dis-
tribution of Sphagnum III. Observations on Sphagnum
macrophyllum in the Northern Part of its range. THE
BRYOLOGIST 70: 177–192.
MISHLER, B. D., P. H. THRALL, J. S. HOPPPLE, JR., E. DE
LUNA & R. VILGALYS. 1992. A molecular approach to
the phylogeny of bryophytes: cladistic analysis of
chloroplast-encoded 16S and 23S ribosomal RNA
genes. THE BRYOLOGIST 95: 172–180.
PAUL, H. 1924. Sphagnaceae (Torfmoose), pp. 105–125.
In A. Engler (ed.), Die natürlichen Pflanzenfamilien.
W. Engelmann, Leipzig.
RIESEBERG, L. H. & J. F. WENDEL. 1993. Introgression and
its consequences in plants, pp. 70–114. In R. G. Har-
rison (ed.), Hybrid Zones and the Evolutionary Pro-
cess. Oxford University Press, Oxford.
RUHLAND, W. 1924. Unterklasse Sphagnales. Allgemeine
Verhältnisse, pp.101–105. In A. Engler & K. Prantl
(eds.), Die natürlichen Pflanzenfamilien. W. Engle-
mann, Leipzig.
SCHIMPER, W. P. 1876. Synopsis Muscorum Europaeorum
Praemissa Introductione de Elementis Bryologicis
Tractante, Vol. 1. Stuttgart.
[VOL. 103
SCHOFIELD, W. B. 1985. Introduction to Bryology. Mac-
millan, NY.
SHAW W. A. J. 2000. Molecular phylogeography and sib-
ling speciation in Mielichhoferia. Molecular Ecology
(in press).
TABERLET, P., L. GIELLY, G. PAUTOU & J. BOUVET. 1991.
Universal primers for amplification of three non-cod-
ing regions of chloroplast DNA. Plant Molecular Bi-
ology 17: 1105–1109.
WARNSTORF, C. 1889. Ueber das Verhältniss zwischen
Sphagnum imbricatum (Hornsch.) Russ., Sph. porto-
ricense Hampe und Sph. herminieri Schpr. Hedwigia
28: 303–308.
. 1911. Sphagnales-Sphagnaceae (Sphagnologia
Universalis). In A. Engler (ed.), Das Pflanzenreich
(Regni Vegetabilis Conspectus), Vol. 5. Engelmann,
Leipzig.
YAMAGUCHI, T., R. D. SEPPELT, Z. IWATSUKI & A. M.
BUCHANAN. 1990. Sphagnum (sect. Buchanania) leu-
cobryoides sect. et. sp. nov. from Tasmania. Journal
of Bryology 16: 45–54.
ms. received Oct. 4, 1999; accepted Jan. 12, 2000.