DNA Replication Practice Directions: Below are the 3 steps in DNA replication, Follow the directions for each step and then answer the questions below. 1. Color the DNA molecule red. -What does the diagram to the right show happening to the DNA molecule? (Explain the first step in DNA replication) Fancation of DNA Gale 4 Strand Helicase beeakina hydcagen babs) -Color the new DNA nucleotides in the diagram to the right blue. Color the original DNA strands red. -What happens to the DNA molecule during the second step of DNA replication? Caos C ce Added io the Correct a fro O now strand -Color the new DNA strands blue and color the other DNA strands red. -What happens during the third step of DNA replication? Jew hosPhati/sugac backbone secured" tinother 5 Droof-ceadia -Which color, red or blue, represents the original template? “cedHow DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? ce paced with dhe cucreet pacts Hey Act Dot ieatioed 5. What is DNA replication?_(py.n0 DA\A Jo 7 2 id, ul Molecules 6. Using your notes and this assignment place the steps of DNA replication in the correct order. _2— a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. __L__b. The DNA double helix breaks or unzips down the middle between the base pairs. —= c. Acomplementary strand is created for each of the two strands of the original double helix. 4_ d. Two new identical DNA molecules have been produced. 7. (True’or False) The process of DNA replication results in a copy of the original DNA molecule. 8. (True or Falsé) Sugars and phosphates break off from the DNA nucleotide to provide energy for DNA replication. 9. (True or False) DNA does not have to break apart to be copied 10.(True of Falsé) After DNA replication is complete, there are two new DNA molecules; one molecule has both of the original strands and one molecule has two new strands of DNA. 11.Where does DNA replication happen?_[n the oucleus 12.When does DNA replication happen? Mhase of intecphese 13.Below are DNA strands. Make the complementary DNA strand: Original Strand: Complementary Strand: TGCAAATTGCTCACCGGGGATCAGCACCGG A CATT RACQAGT GALE C€ TAGT CQTGECE Original Strand: AG GGGATCAGCACCGGATTTCATGAGCCCTA Complementary Strand: (C6 CC TA GTC GT GGCC TAAAG TAC TOGGGAT 14,Make a DNA Timeline. This timeline must include: 1. Color. 2. Awritten description of the three steps of DNA replication, = ->————_—— 3. A picture of each of the three steps of DNA replication. Ros of PNA Example timeline: DNA Replication Timeline Tow OS OG Fenn the three steps Spi wpe 7; of Replication