Chemosphere 191 (2018) 954e961

Contents lists available at ScienceDirect

Chemosphere
journal homepage: www.elsevier.com/locate/chemosphere

Fluoxetine modulates the transcription of genes involved in serotonin,

dopamine and adrenergic signalling in zebrafish embryos
V. Cunha a, b, *, P. Rodrigues a, b, M.M. Santos a, d, P. Moradas-Ferreira b, c, M. Ferreira a, e
a
CIIMAR/CIMARdInterdisciplinary Centre of Marine and Environmental Research, University of Porto, Terminal de Cruzeiros do Porto de Leixo ~es, Av.
General Norton de Matos s/n, 4450-208 Matosinhos, Portugal
b
ICBAS/UPdInstitute of Biomedical Sciences Abel Salazar, University of Porto, Largo Professor Abel Salazar, 2, 4099-003 Porto, Portugal
c
I3SdInstitute for Research and Innovation in Health, University of Porto, Rua Alfredo Allen, 208, 4200-135 Porto, Portugal
d
FCUPdDept of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, 4169-007 Porto, Portugal
e
School of Marine Studies, Faculty of Science, Technology and Environment, The University of the South Pacific, Laucala Bay Road, Suva, Fiji Islands

h i g h l i g h t s

Neurotransmission system genes and sensorimotor reflexes were evaluated after FLU exposure.

FLU disrupted neurotransmission system by changing transcription patterns.

mRNA levels of neurotransmitters were disrupted at environmental relevant concentration.

FLU decreases sensorimotor reflexes of zebrafish larvae.

Disruption of neurotransmitters can ultimately disturb behaviour and biological functions in fish.

a r t i c l e i n f o a b s t r a c t

Article history: Neurotransmitters pathways in fish and mammals are phylogenetically conserved. Therefore, the envi-
Received 26 June 2017 ronmental presence of psychopharmaceuticals, such as fluoxetine (FLU), are likely to interact with fish
Received in revised form serotonergic, dopaminergic and adrenergic systems, affecting their response and associated biological
12 October 2017
functions. Hence, the present work aimed at evaluating the effects of FLU in the transcription of genes
Accepted 16 October 2017
involved in serotonin, dopamine and adrenergic transporters and receptors signalling in early stages of
Available online 27 October 2017
Danio rerio development. Embryos (1 hpf) were exposed for 80 h to different concentrations of FLU
Handling Editor: David Volz (0.0015, 0.05, 0.1, 0.5 and 0.8 mM) and mRNA levels of sert, 5-ht1a, 5-ht2c, dat, drd1b, drd2b, net, adra2a,
adra2b, adra2c, vmat and mao were evaluated. A sensorimotor reflex assay was also performed
Keywords: demonstrating a significant decrease in tail reflex at 0.1 and 0.5 mM. The transcription levels of seroto-
Psychopharmaceuticals nergic and dopaminergic transporters (sert and dat) and vmat were down-regulated at environmentally
Danio rerio embryos relevant concentration (0.0015 mM). Receptors 5-ht2c, drd2b adra2b and adra2c mRNA levels also dis-
mRNA levels played a down regulation pattern after FLU exposure. In conclusion, this study demonstrated the
Monoamine receptors and transporters
interaction of FLU with the neurotransmission system at environmentally relevant concentrations by
changing transcription patterns. Therefore, given the importance of these signalling pathways it is
possible that their disruption can ultimately disturb the escape behaviour and biological functions in fish.
Hence, evaluating the presence of this psychopharmaceutical in the aquatic environment should be
implemented in future monitoring programmes.
© 2017 Elsevier Ltd. All rights reserved.

1. Introduction

Fluoxetine (FLU) is one of the most prescribed pharmaceuticals

~o Mari-
* Corresponding author. CIIMAR e Centro Interdisciplinar de Investigaça acting as a selective serotonin reuptake inhibitor (SSRI) (Mennigen
nha e Ambiental, Coastal and Marine Environmental Toxicology Lab, Terminal de et al., 2011; Winder et al., 2012) indicated in the treatment of hu-
~es, Av. General Norton de Matos s/n, 4450-208 Mato-
Cruzeiros do Porto de Leixo
man depression, anxiety, compulsive behaviour and eating disor-
sinhos, Portugal.
E-mail address: vfpmc83@gmail.com (V. Cunha). ders (Dulawa et al., 2004). SSRIs act on the serotonergic system of

https://doi.org/10.1016/j.chemosphere.2017.10.100
0045-6535/© 2017 Elsevier Ltd. All rights reserved.
 V. Cunha et al. / Chemosphere 191 (2018) 954e961
the central nervous system (CNS) inhibiting the reuptake of sero-
tonin (monoamine serotonin, 5-hydroxytryptamine, 5-HT) by se-
rotonin transporter (SERT, 5-HTT) in the presynaptic membrane
(Kreke and Dietrich, 2008; Valenti et al., 2012). This inhibition leads
to the accumulation of serotonin in the synaptic clefts, increasing
the serotonergic neurotransmission through postsynaptic seroto-
nin receptors (Raap and Van der Kar 1999; Bisesi et al., 2014). In the
absence of inhibitors, serotonin is recycled and stored in a vesicular
monoamine transporter (VMAT), a non-specific monoamine
transporter, or degraded by monoamine oxidase (MAO) enzymes
located in the outer mitochondrial membrane (Hoffman et al.,
1998; Maximino, 2012). FLU has been detected in the environ-
ment in concentrations ranging from 3.5  105 to 0.0027 mM
(Metcalfe et al., 2003, 2010; Santos et al., 2010; Styrishave et al.,
2011; Silva et al., 2012). The presence of FLU in aquatic environ-
ment increases the risk of negative effects in aquatic organisms,
namely in fish, as the neurotransmitter pathways are phylogenet-
ically conserved with mammals (Kreke and Dietrich, 2008; Valenti
et al., 2012). In line with this assumption are the results from
previous studies on aquatic organisms (Santos et al., 2010; Schultz
et al., 2011; Lacaze et al., 2015) showing alterations of several bio-
logical functions and behavioural changes upon exposure to FLU
and to other psychopharmaceuticals, with direct impacts on fitness
and general population dynamics (Monpelat et al., 2009; Lister
et al., 2009; Santos et al., 2010; Schultz et al., 2011). In aquatic in-
vertebrates FLU exposure resulted in genotoxicity and cytotoxicity
as well as effects in the locomotion and burrowing movements,
although at higher concentrations than those found in the envi-
ronment (Lacaze et al., 2015; Fong et al., 2015; Hazelton et al., 2014).
In fish FLU seems to compromise the antipredator behaviour
(Martin et al., 2017; Saaristo et al., 2017) making individuals less
reactive and also inhibited egg production (Lister et al., 2009). Fish
embryos, due to their vulnerable condition, could be more sensitive
to SSRIs exposure since serotonin is known to play an important
role in vertebrate embryonic development (Buznikov et al., 2001;
Levin, 2006). In previous studies it was shown that zebrafish em-
bryo development is impacted by FLU, at concentrations reported
in aquatic environments (Ribeiro et al., 2015; Cunha et al., 2016).
Nevertheless, and despite some previous studies there is still a lack
of knowledge regarding the interaction of FLU with the neuro-
transmitter system. Hence, the main aim of this study was to assess
the effects of FLU on mRNA transcription of serotonin, dopamine
and adrenergic transporters and receptors in early stages of
development of zebrafish embryos.
2. Material and methods
2.1. Parental animals
Adult wild-type zebrafish, obtained from local suppliers, were
used as breeding stocks. The stock was kept at a water temperature
of 27 ± 1  C and in a photoperiod of 12:12 h (light:dark), in 60 L
aquaria with dechlorinated and aerated freshwater in a recircula-
tion system with both mechanical and biological filters. The fish
were fed ad libitum twice a day with a commercial fish diet Tet-
ramin (Tetra, Melle, Germany), and supplemented once a day with
live brine shrimp (Artemia spp.).
2.2. Rearing conditions and exposures
Reproduction and embryos exposure was performed according
to Cunha et al. (2016). Briefly, females and males (ratio 1:2) were
transferred to a spawning tank, and submitted to acclimatization
for 12 h in a tank with a net bottom covered with glass marbles
within a 30 L aquarium. After egg-laying, in the following day, the
955
breeders were removed after the beginning of the light period.
After spawning, the embryos (1 hpf) were cleaned, counted and
transferred to a 24 well plate (10 embryos per well for gene
expression assay and 5 embryos per well for behavioural assay) and
exposed until 80 hpf to different concentrations of FLU (0.0015,
0.05, 0.1, 0.5 and 0.8 mM) (Alsop and Wood, 2013) (diluted in DMSO,
0.004%). Experimental controls used in all the assays were water
controls and solvent controls (DMSO 0.004%). Prior to embryo ex-
posures, the test solutions were placed into the plates for 24 h so
that the chemicals could adsorb to the plastic, and the solutions
renewed after preadsorption. The lowest concentration
(0.0015 mM) is in the environmentally relevant range (Silva et al.,
2012). The test solutions were renewed daily, for the duration of
the experiment. Each plate had three replicates for exposure and
each assay was replicated at least six times with different batches.
After the 80 h of exposure the 30 embryos per treatment were
collected and preserved in RNALater for gene expression analysis.
2.3. RNA isolation and cDNA synthesis
Total RNA was isolated from embryos preserved in RNALater
according to Costa et al. (2012). Briefly, total RNA was isolated using
Illustra RNAspin Mini RNA Isolation kit (GE Healthcare), according
to the manufacturer's protocol. RNA quality was verified by elec-
trophoresis in agarose gel and by the measurement of the ratio of
optical density at l260/l280 nm. RNA was quantified using Quant-
IT RiboGreen RNA Reagent and Assay Kit (Invitrogen) using a Flu-
oroskan Ascent, Labsystems. One microgram of total RNA was
subjected to digestion of genomic DNA using Deoxyribonuclease I,
Amplification Grade (Invitrogen) and 1 mg of cDNA was synthesised
using Iscript cDNA Synthesis (Biorad).
2.4. Quantitative real-time PCR (qRT-PCR)
Gene expression of serotinergic (sert, 5-ht1a, 5-ht2c), dopami-
nergic (dat, drd1b, drd2b) and adrenergic (net, adra2a, adra2b,
adra2c) systems, vmat and mao was assessed by means of quanti-
tative real time PCR (qRT-PCR) and performed according to Cunha
et al. (2016). Primer pairs for each target gene were designed
with Primer 3 software available in http://www.ncbi.nlm.nih.gov/,
based in available sequences in GeneBank. Primer sequences,
amplicon lengths, efficiencies and Genbank accession numbers of
target sequences are given in Table 1. To determine the efficiency of
the PCR reactions, standard curves were made, with 6 serial di-
lutions of the template (concentration range from 0.05 to 50 ng/ml),
and the slopes and regression curves were calculated. Gene
expression was quantified by normalization with multiple refer-
ence gene (elongation factor 1 (ef1) and actin b1 (Actb1) using
Normfinder algorithm (Urbaztka et al., 2013), and the relative
expression ratio was calculated with efficiencies using the Pfaffl
mathematical model (Pfaffl, 2001). Data is presented as mean of
mRNA expression in relation to the reference genes.
2.5. Behavioural assay: sensorimotor reflexes
Sensorimotor reflexes was evaluated according to Pinho et al.
(2016). Briefly, after 80 hpf each exposed larvae was gently
touched with a micropipette tip, in the head and in the tail, to
register either positive (immediate swimming) or negative re-
sponses (no movement upon touch). This procedure was repeated
10-times for each larvae (alternating head and tail touches, and
allowing 30s rest per larvae between each individual touch) to
calculate the proportion of positive responses.
956 V. Cunha et al. / Chemosphere 191 (2018) 954e961

2.6. Statistical analysis
Differences in mRNA expression and behavioural responses
were evaluated by means of a one-way ANOVA, followed by a
multiple comparison test (Tukey's test for mRNA expression and
Dunnet's for behavioural responses) at a 5% significant level. Data
from mRNA expression were log transformed in order to fit ANOVA
assumptions. All tests were performed using software Statistica 7
(Statsoft, Inc). Hierarchical cluster analysis (HCA) was also applied
to further depict relationships among genes assayed. HCA was
based on the Pearson correlation coefficient with average linkage,
using Morpheus software available at the Broad Institute (http://
www.broadinstitute.org). Gene expression was plotted into a
heatmap according to HCA results, using Morpheus.
3. Results
were observed for net. mRNA levels of adra2a were significantly
increased in embryos exposed to 0.8 mM of FLU (p < 0.05). adra2b
and adra2c also displayed a down regulation pattern, observed
mainly at higher concentrations of FLU (p < 0.05). The main trends
observed in gene expression are summarized in Fig. 2 in the form of
a heatmap. The heatmap is colour-coded according to the per-
centage of variation. The heatmap shows the clear tendency for a
down-regulation of gene expression identified previously, as indi-
cated by the prevalence of colder colours (blue). Hierarchical
cluster analysis identified two groups of concentrations sharing
some similarity in gene expression and correlation between con-
centration and the evaluated genes. The first group aligned
together concentrations of 0.0015 and 0.1 mM of FLU. The second
group aligned together the other concentrations (0.05, 0.5 and
0.8 mM) confirming that most of the down regulation genes were
recorded at these higher concentrations.

3.1. Flu interaction with neurotransmitters pathways 3.2. Flu reduces zebrafish sensorimotor reflexes

mRNA levels of neurotransmission transporters and receptors
(sert, 5-ht1a, 5-ht2c, dat, drd1b, drd2b, net, adra2a, adra2b, adra2c),
vmat and mao in embryos exposed to different doses of FLU are
presented in Fig. 1. For most of the analyzed genes, the results show
a non-monotonic response to the treatments and a dose-response
was only observed for 5-ht2c, drd2b, adra2b and adra2c. The vmat
gene was significantly down regulated in embryos exposed to
0.0015 and 0.1 mM concentrations (p < 0.05), while no changes
were observed for mao (Fig. 1A). In the serotonergic system
(Fig. 1B), the transcription level of sert was significantly down
regulated at 0.5 mM as well as at the lowest concentration
(0.0015 mM). mRNA levels of 5-ht1a were significantly increased in
embryos exposed to 0.8 mM of FLU (p < 0.05) and a down regulation
pattern was observed for 5-ht2c for all concentration with excep-
tion of 0.1 mM. In dopaminergic system (Fig. 1C) dat was down
regulated at 0.1 and 0.0015 mM concentrations of FLU (p < 0.05). The
transcription levels of drd1b were also decreased at 0.05, 0.5 and
0.8 mM (p < 0.05) and drd2b also displayed a down regulation
pattern. In the adrenergic system (Fig. 1D) no significant changes
To assess the effects of Flu in larvae behaviour a sensorimotor
reflex assay was performed (Fig. 3). In exposed larvae, the results
showed a tendency to a decrease in the positive reflexes when
larvae were touched in the head, though differences did not reach
significance in comparison with control (Fig. 3a). When the touch
was performed in the tail a decrease in the sensory reflexes was
observed in exposed larvae, being statistically significant at 0.1 and
0.5 mM) (Fig. 3b).
4. Discussion
Neurotransmitters pathways within vertebrates, including fish,
are well conserved (Kreke and Dietrich, 2008; Valenti et al., 2012).
Therefore psycopharmaceuticals that are design to act on these
pathways in mammals, will possibly interact with the same path-
ways in aquatic organism and affect the neurotransmission sys-
tems. Moreover, our previous study also demonstrated that FLU, at
the same concentrations tested in the present study, impacts the
development of zebrafish embryos (Cunha et al., 2016). Hence,

Table 1
Gene list Genbank accession numbers Primer sequences and concentrations, amplicon lengths, efficiency of reaction for serotonin transporters (sert), serotonin receptors (5-
ht1aa, 5-ht2c), dopamine transporter (dat) dopamine receptors (drd1b, drb2b), norepinephrine transporter (net), adrenergic receptors (adra2a, adra2c, adra2b), vmat, mao gene
expression quantification by qRT-PCR in zebrafish.

Gene Accession number Primers Sequence (50 /30 ) Final Conc. (nM) Amplicon length (bp)

serta NM_001039972.1 F: CATCTATGCTGAGGCTATTG 300 73

R: AAGAATATGATGGCGAAGA
5-ht1aa NM_001123321.1 F: ATGAGGATGAGCGGGATGTAG 300 80
R: CAATCAGCCAGGACCACG
5-ht2c NM_001129893.1 F: GCGCTCTCTGTCCTATTTGG 10 89
R: GTAGCGGTCGAGAGAAATGG
dat NM_131755.1 F:ACGTCAATTCTCTTTGGAGT 150 86
R:TCCTCGATATCATCACTGAA
drd1b NM_001135976.2 F: CTGCGACTCCAGCCTTAATC 600 98
R: AGATGCGGGTGTAAGTGACC
drd2b NM_197936.1 F: ACGCCGAATATCAGTCCAAC 300 96
R: GCAGTGCCTGAGTTTCAACA
Net XM_689046.5 F: AGTCCAGCGTTCTTGCTGTT 300 92
R: TCTGCCCAGTATGGGAAAAC
adra2a NM_207637.2 F: AGCGTTTTGTGACTGCTGTG 300 86
R: TAATGGGATTGAGGGAGCTG
adra2b NM_207638.1 F: GTCTGCCTGGCCACACTAAT 10 80
R: GTACGGGGCGAGTTTTATCA
adra2c NM_207639.1 F: CTATTCTCCGGCCACCATTA 10 80
R: CCAGCACATTCCCCACTATT
vmat2 NM_001256225.2 F: CTAAAAAGCTCCGCATCCAG 150 231
R: TGTCCAAGAGCAAAGCAATG
mao NM_212827.2 F: ACCAACTCAAAACCGCATTC 300 151
R: GTAGGCAAAAGGGTTCCACA
 V. Cunha et al. / Chemosphere 191 (2018) 954e961 957

Fig. 1. Relative mRNA expression of vmat and mao (a), genes belonging to the serotonin system (sert, 5ht1a, 5hth2) (b), the dopaminergic system (dat, drd1b, drd2b) (c) and the
adrenergic system (net, adra2a, adra2b, adra2c) (d) in D. rerio embryos exposed to FLU (0.0015, 0.05, 0.1, 0.5 and 0.8 mM) for 80 h. Bars with different letters are significantly different
from each other (p < 0.05). Results are given as mean ± SE, n ¼ 6.
958 V. Cunha et al. / Chemosphere 191 (2018) 954e961
Fig. 2. Heatmap of gene expression variation in zebrafish embryos exposed to different
concentrations of FLU. The colour scale reflects the direction and magnitude of
variation.
given the reported mode of action of FLU in vertebrates, this study
aimed at evaluating the impact of FLU in monoamine receptors and
transporters at the transcription level. Serotonin (sert, 5-ht1a, 5-
ht2c), as well as dopamine (dat, drd1b, drd2b) and adrenergic (net,
adra2a, adra2b, adra2c) transporters and receptors and vmat and
mao in early stages of zebrafish embryos were analyzed. In
mammalian model species, FLU leads to a down regulation of Sert,
5-Ht1a and 5-Ht2c and this decrease has been attributed to the
increase of serotonin accumulation in the synaptic clefts by
repeated SERT inhibition by FLU (Oliva et al., 2005; Gomez et al.,
2015; Lesemann et al., 2012; Barbon et al., 2011; Messripour and
Clark, 1985) that promotes behavioural and emotional changes by
serotonergic system modulation. In this study a down regulation
was observed for sert and 5-ht2c, at the lowest and environmentally
relevant concentration. Hence, FLU seems to affect the serotonergic
neurotransmission system in zebrafish embryos in a similar
manner as in mammals, leading to a clear down regulation of se-
rotonin transporters and receptors transcription. This decrease in
mRNA can possibly affect the neurotransmission and provoke
behavioural changes as described by previous studies (Santos et al.,
2010; Pelli and Connaughton, 2015). In this study behavioural
changes associated with FLU exposure were also evaluated. A sig-
nificant decrease in the sensorimotor reflexes, mainly in tail re-
flexes, was observed. Signals from head and tail touches are
conveyed to hindbrain Mauthner neurons stimulating escape re-
sponses (Pinho et al., 2016). In vertebrates, Mauthner cell signalling
is hormone responsive and requires coordination of multiple neural
signalling systems (Iwata et al., 2000; Faber et al., 1991). Therefore,
exposure to toxics that can modulate neurotransmitters or block
postsynaptic receptors, can results in impairment of the neuro-
transmission (Little and Brewer, 2001). This can disrupt the
communication between sensory receptors and efferent motor
systems that results in reduce behavioural responses (Little and
Brewer, 2001) as the ones observed in this study.
Serotonin and the serotonergic system play a role in vertebrate
embryo development (Buznikov et al., 2001; Levin, 2006), hence a
down regulation of genes involved in this system can also affect fish
embryo development. This hypothesis is further supported by the
results of a previous study performed in our laboratory reporting
that FLU affects zebrafish embryos development (Cunha et al.,
2016). Given that the changes in transcription levels were
observed at environmentally relevant concentration, it will be
important to perform additional studies, such as pathways
silencing to better address FLU interaction with the serotonergic
system. This work also evaluated the effects of FLU in the tran-
scription of receptors and transporters of dopaminergic and
adrenergic pathways, since previous studies suggest an interaction
between these systems and the serotonergic (Kreke and Dietrich,
2008; Boulay et al., 2011; Lesemann et al., 2012). Similarly to the
serotonergic systems a tendency for mRNA down regulation was
also observed for dopamine transporter (dat) and receptors (drd1b,
drd2b) and adrenergic receptors (adra2b, adra2c) in embryos
exposed mainly at higher concentrations of FLU. In agreement with
our results, FLU has been reported to decrease dopaminergic D2
receptor transcription in mammals (Dziedzicka-Wasylewska et al.,
2002; Lesemann et al., 2012). The decrease of mRNA levels of
dopamine receptors and transporter may have a negative impact in
key functions, known to be controlled by this system, such as
cognition, locomotor activity, motivation and reward, mood,
attention and learning (Beaulieu and Gainetdinov, 2011). In fish,
dopamine inhibits basal and GnRH-stimulated gonadotropin
release by binding to the Dopamine 2 receptors (DR2) on gonado-
tropes, and by decreasing pituitary GnRH receptor expression
which can impair gonadal growth and spawning (Chang et al.,
2000; Dufour et al., 2005; Crago and Schlenk, 2015). In another
study, Sebastiscus marmoratus was exposed to Tributyltin (TBT) and
the results revealed a decrease in the transcription levels of dopa-
mine receptors affecting the predatory activities of the fish (Yu
et al., 2013). Therefore, the down regulation of dopamine trans-
porter and receptors by FLU may negatively influence the repro-
duction and the behaviour of fish. Adrenoceptors are present in fish
melanophores, modulating the pigmentation, as reported in pre-
vious studies with other pharmaceutical classes (Fujii, 2000; Xu
and Xie, 2011). In agreement, zebrafish embryos that were
exposed to the same FLU concentrations showed a high percentage
of pigmentation anomalies, mainly at the highest concentration
(0.8 mM) (Cunha et al., 2016). The storage process of monoamines is
performed by VMAT that is released at the synapse following
neuronal membrane depolarization. When monoamines are not
stored in presynaptic vesicles by VMAT, they are degraded by MAO
enzyme (Maximino, 2012). Transcription levels of vmat were
diminished in the presence of FLU, while no changes were observed
for mao. In contrast to our results, a previous study with rats re-
ported an increased the transcription levels of Vmat following FLU
exposure (Rehavi et al., 2002). Our results demonstrated a down
regulation tendency upon exposure to FLU. However, an up regu-
lation was observed for some genes. This seems to point to non-
monotonic responses to FLU exposure which should be study in
future studies.
 V. Cunha et al. / Chemosphere 191 (2018) 954e961 959

Fig. 3. Effect of FLU on zebrafish head (a) and tail (b) reflexes. Differences in positive reflexes were evaluated by means of a one-way ANOVA, followed by a multiple comparison test
(Dunnet's test) at a 5% significance level. Results are provided as mean ± SE, n ¼ 3.
960 V. Cunha et al. / Chemosphere 191 (2018) 954e961
5. Conclusions
In conclusion, FLU decreases the transcription of important
neurotransmitters transporters and receptors, at concentrations
found in the environment. Our results show that FLU may regulate
different monoamine pathways involved in important physiologic
functions and behaviour responses. Hence, future studies should
address the ecological relevance of the findings reported herein.
Moreover, our results point to non-monotonic responses to FLU,
showing that lower concentrations can damage the neurotrans-
mission system and therefore should be consider in future toxico-
logical and risk assessment studies. The fact that environmentally
relevant concentrations can disturb the neurotransmitters systems
supports the importance of monitoring the presence of this psy-
chopharmaceuticals in the aquatic environment.
Acknowledgments
The authors are thankful to Hugo Santos, Olga Martinez and
Ricardo Lacerda for the technical assistance provided in the main-
tenance of the aquaria. This work was supported by national funds,
through FCT and co-funded by the European Regional Development
Fund (ERDF) through the COMPETE e Operational Competitiveness
Programme, under the project PSYCHOBASS (PTDC/AAG MAA/
2405/2012 and FCOMP 01 0124 FEDER 027808) and UID/Multi/
04423/2013. Virgínia Cunha was supported by FCT with a PhD grant
(SFRH/BD/77931/2011).
References
Alsop, D., Wood, C.M., 2013. Metal and pharmaceutical mixtures: is ion loss the
mechanism underlying acute toxicity and widespread additive toxicity in
zebrafish? Aquat. Toxicol. 15 (140e141), 257e267.
Barbon, A., Orlandi, C., La Via, L., Caracciolo, L., Tardito, D., Musazzi, L., Mallei, A.,
Gennarelli, M., Racagni, G., Popoli, M., Barlati, S., 2011. Antidepressant treat-
ments change 5-HT2C receptor mRNA expression in rat prefrontal/frontal cor-
tex and hippocampus. Neuropsychobiology. 63 (3), 160e168.
Beaulieu, J.M., Gainetdinov, R.R., 2011. The physiology, signaling, and pharmacology
of dopamine receptors. Pharmacol. Rev. 63, 182e217.
Bisesi, J.H., Bridges, W., Klaine, S.J., 2014. Reprint of: effects of the antidepressant
venlafaxine on fish brain serotonin and predation behavior. Aquat. Toxicol. 151,
88e96.
Boulay, D., Depoortere, R., Louis, C., Lacave, M., Lucas, M.T., Griebel, G., 2011.
SSR181507, a dopamine D2 receptor and 5-HT1a receptor ligand: evidence for
mixed anxiolytic- and antidepressant-like activities. Pharmacol. Biochem.
Behav. 97 (39), 428e435.
Buznikov, G.A., Lambert, H.W., Lauder, J.M., 2001. Serotonin and serotonin-like
substances as regulators of early embryogenesis and morphogenesis. Cell Tis-
sue Res. 305, 177.
Chang, J.P., Johnson, J.D., Van Goor, F., Wong, C.J., Yunker, W.K., Uretsky, A.D.,
Taylor, D., Jobin, R.M., Wong, A.O., Goldberg, J.I., 2000. Signal transduction
mechanisms mediating secretion in goldfish gonadotropes and somatotropes.
Biochem. Cell Biol. 78, 139e153.
Costa, J., Reis-Henriques, M.A., Castro, L.F.C., Ferreira, M., 2012. Gene expression
analysis of ABC efflux transporters, CYP1A and GSTa in Nile tilapia after
exposure to benzo(a)pyrene. Comp. Biochem. Physiol., Part C: Toxicol. Phar-
macol. 155, 469e482.
Cunha, V., Rodrigues, P., Santos, M.M., Moradas-Ferreira, P., Ferreira, M., 2016. Danio
rerio embryos on Prozac - effects on the detoxification mechanism and embryo
development. Aquat. Toxicol. 178, 182e189.
Crago, J., Schlenk, D., 2015. The effect of bifenthrin on the dopaminergic pathway in
juvenile rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 162, 66e72.
Dufour, S., Weltzien, F.A., Sebert, M.E., Le Belle, N., Vidal, B., Vernier, P., Pasqualini, C.,
2005. Dopaminergic inhibition of reproduction in teleost fishes: ecophysio-
logical and evolutionary implications. Ann. N. Y. Acad. Sci. 1040, 9e21.
Dulawa, S.C., Holick, K.A., Gundersen, B., Hen, R., 2004. Effects of chronic fluoxetine
in animal models of anxiety and depression. Neuropsychopharmacology 29 (7),
1321e1330.
Dziedzicka-Wasylewska, M., Rogoz, Z., Skuza, G., Dlaboga, D., Maj, J., 2002. Effect of
repeated treatment with tianeptine and fluoxetine on central dopamine D(2)/
D(3) receptors. Behav. Pharmacol. 13 (2), 127e138.
Faber, D.S., Korn, H., Lin, J.W., 1991. Role of medullary networks and postsynaptic
membrane properties in regulating Mauthner cell responsiveness to sensory
excitation. Brain Behav. Evol. 37, 286e297.
Fong, P.P., Bury, T.B., Dworkin-Brodsky, A.D., Jasion, C.M., Kell, R.C., 2015. The
antidepressants venlafaxine ("Effexor") and fluoxetine ("Prozac") produce
different effects on locomotion in two species of marine snail, the oyster drill
(Urosalpinx cinerea) and the starsnail (Lithopoma americanum). Mar. Environ.
Res. 103, 89e94.
Fujii, R., 2000. The regulation of motile activity in fish chromatophores. Pigment.
Cell Res. 13, 300e319.
Gomez, F., Venero, C., Viveros, M., García, F., 2015. Short-term fluoxetine treatment
induces neuroendocrine and behavioral anxiogenic-like responses in adoles-
cent male rats. Exp. Brain Res. 233, 983e995.
Hazelton, P.D., Du, B., Haddad, S.P., Fritts, A.K., Chambliss, C.K., Brooks, B.W.,
Bringolf, R.B., 2014. Chronic fluoxetine exposure alters movement and bur-
rowing in adult freshwater mussels. Aquat. Toxicol. 151, 27e35.
Hoffman, B.J., Hansson, S.R., Mezey, E., Palkovits, M., 1998. Localization and dynamic
regulation of biogenic amine transporters in the mammalian central nervous
system. Front. Neuroendocrinol. 19, 187.
Iwata, T., Toyoda, F., Yamamoto, K., Kikuyama, S., 2000. Hormonal control of urodele
reproductive behavior. Comp. Biochem. Physiol. Biochem. Mol. Biol. 126,
221e229.
Kreke, N., Dietrich, D.R., 2008. Physiological endpoints for potential SSRI in-
teractions in fish. Crit. Rev. Toxicol. 38, 215e247.
Lacaze, E., Pe delucq, J., Fortier, M., Brousseau, P., Auffret, M., Budzinski, H.,
Fournier, M., 2015. Genotoxic and immunotoxic potential effects of selected
psychotropic drugs and antibiotics on blue mussel (Mytilus edulis) hemocytes.
Environ. Pollut. 202, 177e186.
Lesemann, A., Reinel, C., Hühnchen, P., Pilhatsch, M., Hellweg, R., Klaissle, P.,
Winter, C., Steiner, B., 2012. MPTP-induced hippocampal effects on serotonin,
dopamine, neurotrophins, adult neurogenesis and depression-like behavior are
partially influenced by fluoxetine in adult mice. Brain Res. 1457, 51e69.
Levin, M., 2006. Is the early left-right axis like a plant, a kidney, or a neuron? The
integration of physiological signals in embryonic asymmetry. Birth Defects Res.
C Embryo Today 78, 191.
Little, E.E., Brewer, S.K., 2001. Neurobehavioral toxicity in fish. In: Schlenk, D.,
Benson, W.H. (Eds.), Target Organ Toxicity in Marine and Freshwater Teleosts,
vol. 2. Taylor & Francis, London, UK, pp. 139e174.
Lister, A., Regan, C., Van Zwol, J., Van Der Kraak, G., 2009. Inhibition of egg pro-
duction in zebrafish by fluoxetine and municipal effluents: a mechanistic
evaluation. Aquat. Toxicol. 95 (4), 320e329.
Martin, J.M., Saaristo, M., Bertram, M.G., Lewis, P.J., Coggan, T.L., Clarke, B.O.,
Wong, B.B., 2017. The psychoactive pollutant fluoxetine compromises anti-
predator behaviour in fish. Environ. Pollut. 222, 592e599.
Maximino, C., 2012. Serotonin and Anxiety. Springer, New York, ISBN 978-1-4614-
4048-2, pp. 15e37.
Mennigen, J.A., Stroud, P., Zamora, J.M., Moon, T.W., Trudeau, V.L., 2011. Pharma-
ceuticals as neuroendocrine disruptors: lessons learned from fish on Prozac.
J. Toxicol. Environ. Health B Crit. Rev. 14 (5e7), 387e412.
Metcalfe, C.D., Chu, S., Judt, C., Li, H., Oakes, K.D., Servos, M.R., et al., 2010. Anti-
depressants and their metabolites in municipal wastewater, and downstream
exposure in an urban watershed. Environ. Toxicol. Chem. 29 (1), 79e89.
Metcalfe, C.D., Miao, X.-S., Koenig, B.G., Struger, J., 2003. Distribution of acidic and
neutral drugs in surface waters near sewage treatment plants in the lower
Great Lakes, Canada. Environ. Toxicol. Chem. 22 (12), 2881e2889.
Messripour, M., Clark, J.B., 1985. The control of dopamine and serotonin synthesis in
rat brain synaptosomes. Neurochem. Int. 7 (5), 811e818.
Monpelat, S., Le Bot, B., Thomas, O., 2009. Occurrence and fate of pharmaceutical
products and byproducts, from resource to drinking water. Environ. Int. 35 (5),
803e814.
Oliva, J.M., Urigüen, L., Pe rez-Rial, S., Manzanares, J., 2005. Time course of opioid
and cannabinoid gene transcription alterations induced by repeated adminis-
tration with fluoxetine in the rat brain. Neuropharmacology 49, 618e626.
Pelli, M., Connaughton, V.P., 2015. Chronic exposure to environmentally-relevant
concentrations of fluoxetine (Prozac) decreases survival, increases abnormal
behaviors, and delays predator escape responses in guppies. Chemosphere 139,
202e209.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-
time RT-PCR.0. Nucl. Acids Res. 1 (29), e45.
Pinho, B.R., Reis, S.D., Guedes-Dias, P., Leit~ ao-Rocha, A., Quintas, C., Valent~ ao, P.,
Andrade, P.B., Santos, M.M., Oliveira, J.M., 2016. Pharmacological modulation of
HDAC1 and HDAC6 in vivo in a zebrafish model: therapeutic implications for
Parkinson's disease. Pharmacol. Res. 103, 328e339.
Raap, D.K., Van de Kar, L.D., 1999. Selective serotonin reuptake inhibitors and
neuroendocrine function. Life Sci. 65 (12), 1217e1235.
Rehavi, M., Roz, N., Weizman, A., 2002. Chronic clozapine, but not haloperidol,
treatment affects rat brain vesicular monoamine transporter 2. Eur. Neuro-
psychopharmacol. 12, 261e268.
Ribeiro, S., Torres, T., Martins, R., Santos, M.M., 2015. Toxicity screening of diclofe-
nac, propranolol, sertraline and simvastatin using Danio rerio and Paracentrotus
lividus embryo bioassays. Ecotoxicol. Environ. Saf. 114, 67e74.
Saaristo, M., McLennan, A., Johnstone, C.P., Clarke, B.O., Wong, B.B., 2017. Impacts of
the antidepressant fluoxetine on the anti-predator behaviours of wild guppies
(Poecilia reticulata). Aquat. Toxicol. 183, 38e45.
Santos, L.H.M.L.M., Araújo, N., Fachini, A., Pena, A., Delerue-Matos, C.,
Montenegro, M.C.B.S.M., 2010. Ecotoxicological aspects related to the presence
of pharmaceuticals in the aquatic environment. J. Hazard Mater 175 (1e3),
45e95.
Schultz, M.M., Painter, M.M., Bartell, S.E., Logue, A., Furlong, E.T., Werner, S.L., et al.,
 V. Cunha et al. / Chemosphere 191 (2018) 954e961
2011. Selective uptake and biological consequences of environmentally relevant
antidepressant pharmaceutical exposures on male fathead minnows. Aquat.
Toxicol. 104 (1e2), 38e47.
Silva, L.J., Lino, C.M., Meisel, L.M., Pena, A., 2012. Selective serotonin re-uptake in-
hibitors (SSRIs) in the aquatic environment: an ecopharmacovigilance
approach. Sci. Total Environ. 437, 185e195.
Styrishave, B., Halling-Sørensen, B., Ingerslev, F., 2011. Environmental risk assess-
ment of three selective serotonin reuptake inhibitors in the aquatic environ-
ment: a case study including a cocktail scenario. Environ. Toxicol. Chem. 30 (1),
254e261.
Valenti, T.W., Gould, G.G., Berninger, J.P., Connors, K., Keele, N.B., Prosser, K.N.,
Brooks, B.W., 2012. Human therapeutic plasma levels of the selective serotonin
reuptake inhibitor (SSRI) sertraline decrease serotonin reuptake transporter
binding and shelter-seeking behavior in adult male fathead minnows. Environ.
961
Sci. Technol. 46, 2427e2435.
Urbaztka, R., Galante-Oliveira, S., Rocha, E., Castro, L., Cunha, I., 2013. Nornalization
strategies for gene expression studies by real-time PCR in marine fish species,
Scophthalmus maximus. Mar. Genom 10, 17e25.
Winder, V.L., Pennington, P.L., Hurd, M.W., Wirth, E.F., 2012. Fluoxetine effects on
sheepshead minnow (Cyprinodon variegatus) locomotor activity. J. Environ. Sci.
Health B 47 (1), 51e58.
Xu, J., Xie, F.K., 2011. a- and b-adrenoceptors of zebrafish in melanosome move-
ment: a comparative study between embryo and adult melanophores. Biochem.
Biophys. Res. Commun. 405 (2), 250e255.
Yu, A., Wang, X., Zuo, Z., Cai, J., Wang, C., 2013. Tributyltin exposure influences
predatory behavior, neurotransmitter content and receptor expression in
Sebastiscus marmoratus. Aquat. Toxicol. 128e129, 158e162.