2020

Department of Biochemistry and Genetics

School of Molecular Sciences
La Trobe University

1
Contents
Welcome to BCH3AAB Advanced Analytical Biochemistry 3
Assessment 5
Scientific Writing Exercises 6
Endnote Referencing Exercise 6
Using Endnote 11
Lab Notebook Exercise 13
Student-Led Tutorial Session 15
Getting the most out of this subject 16
Laboratory Rules and Safety Precautions 17
Practical 1 Advanced Pipetting Masterclass 22
Membranes and Proteins 24
Practical 2 Membranes and Proteins I 33
Practical 3 Membranes and Proteins II 38
Gene Expression 44
Practical 4 Gene Expression I 46
Practical 5. Gene Expression II 52
Practical 6. Gene Expression III 59
Student-Led Tutorial Questions  63

Bookmark
Welcome to BCH3AAB Advanced
Analytical Biochemistry
Departmental contact
Dr. Julian Pakay coordinates BCH3AAB

He is available to assist you with any difficulties you may have with your timetable,
your theory and practical work or other aspects of your studies.

Office: Room 202e, LIMS2

Phone: 9479 6568
E-mail: J.Pakay@latrobe.edu.au

To ensure your best chance to see an academic staff member it is normally advisable to contact them
well in advance by email to arrange a meeting.

All classes, including practicals, tutorials and pre-practical sessions are compulsory to attend and may
include assessment. It is important to arrive on time for all classes, particulalry practical sessions. If
you are absent from any of the classes you will need to provide a medical certificate at the next class
you attend.

3 TOC
4 TOC
Assessment

Assessment Due Date: Group A/B Mark

Scientific Writing Exercises

• Endnote 7th June
Exercise 10%

Student-Led Tutorial Session throughout semester 10%

Mitochondrial Purification Report 21st June 30%

Laboratory Reflection throughout semester 10%

Question Sheets due during the session 10%

handed out
End of Semester Exam Exam Period 30%
Total 100%

5 TOC
Scientific Writing Exercises

Endnote Referencing Exercise

The purpose of this exercise is to give you some feedback on your writing as well as familiarise you with
referencing and using Endnote to manage your references. If you are unfamiliar with Endnote it may
seem at first cumbersome and inefficient for this exercise. However once you get started, you will see
the advantages of using reference managing software and proficiency with Endnote will save you many
hours for all of your future assignments (and produce flawless citations and reference lists!).
This assignment will be marked out of 20, with 10 marks allocated to the quality and scientific validity of
your writing and 10 marks allocated to correct referencing. You are required to submit your assignment
electronically along with a copy of your endnote library. There will be assistance provided to complete
the referencing portion of this exercise during the tutorial classes.
For this exercise, you are required to write a short (500-600-word) essay on the following topic;
“Discuss how electrophoretic techniques can be used to analyse defects in mitochondrial
respiratory chain complexes.”
You will need to:

• place the word count at the top of your essay.

• cite a minimum of five (5) references and use Endnote to insert the in-text citations and create
a reference list.

• use the Harvard style for your citations and reference list (detailed below). You will need to
enter this style into the Endnote program.

• submit your assignment electronically as a PDF or word file.

• submit a copy of your endnote library (.enl file). This will be used to help the markers troubleshoot
any issues you may have had with the format of references.

6 TOC
Guide to Referencing
Whenever you produce any written document which includes ideas that are not your own, or information
from another source, it is important that you give due credit to the person(s) who produced the original
information. You acknowledge your sources through referencing throughout your document. As well
as giving credit to the source of your information, a reference list or bibliography shows how widely you
have read, enables readers to check your ideas and follow up your sources and importantly shows the
difference between your ideas and theirs.
An indication of the source of material is given in the text at the point where the information/idea is
reported. This in-text reference provides information for the reader to locate the source in the reference
list at the end of the document. In the reference list provided at the end of the document, sufficient
information needs to be provided to enable the reader to locate and read the original source material.
There are basically two styles of referencing systems, often referred to as the Vancouver (numerical)
and Harvard (author-date) systems. There are a multitude of different forms of these two systems
which vary primarily in formatting. You will use the Harvard system. The library provides
information on how to reference different resource types:

http://www.lib.latrobe.edu.au/referencing-tool/harvard

Please note the library guide has a different in-text citation style for journal articles for three
authors than one described below. Follow the guide below – that is for three or more authors
you will need the first authors surname followed by et al. and the year. You will most likely
need to modify Endnote’s output style to get have the required format
In-text Citations
You must include (in your text) references to all sources of information used for the content of your
work. To identify references, in text citations should be given as the last name of the author and the year
of publication. Page numbers can be used to direct the reader to specific information and must be used
for direct quotations, or use of specific data or figures.

7 TOC
Format of In-text citations
Your reference has..... In the text you write………
one author Authors surname and the
year
two authors Both surnames and the
year
three or more authors First authors surname
followed by et al. and
the year. * (et al. is an
abbreviation of the Latin et
alii, meaning and others)
Multiple references Chronological order with
those in the same year
alphabetically by author
surname
Multiple references – Distinguish by lower case
same author and year letters “a” “b” etc
You wish to cite a You have not seen the
reference within a original source material
reference you have but have read it in another
read (known as reference.
secondary citation)
Original authors name and
year followed by “cited in”
the source you have read
name and year
8 TOC
Example
GFP was used to study
GPCR regulation
(Milligan, 1999).
Milligan (1999), showed
that GFP ………
mGluRs have a 7 trans-
membrane spanning
structure (Pin and
Duvoisin, 1995)
BAY36-7620 acts as an
inverse agonist (Carroll
et al., 2001)
A study by Carroll et al.
(2001), showed that…….
mGluRs have a 7 trans-
membrane spanning
structure (Sladeczek et
al., 1992; Pin et al., 1994;
Pin and Duvoisin, 1995;
Pin et al., 1995; Bockaert
and Pin, 1999)
mGluRs have a 7 trans-
membrane spanning
structure (Pin et al.,
1995a; Pin et al.,1995b
mGlu1a receptors display
agonist-independent
activity (Prezeau et al.,
1996 cited in Carroll et
al., 2001)
Prezeau et al. (1996;
cited in Carroll et al.,
2001), show that mGlu1a
receptors display
agonist-independent
activity
Formatting references for your reference list
Book
• Author’s surname(s) and initials
• Year of publication
• Title of book
• edition (if applicable)
• Place of Publication
• Publisher
Nelson DL, Cox MM (2008) Lehninger Principles of Biochemistry 5th edition. New York Freeman,

Chapter/article in an edited book

• Author’s surname(s) and initials
• Year of publication
• Title of chapter
• editor* * preceding the editors name type ‘in’ to indicate that the
• Title of book chapter title is in the book. After the editors name type
• edition (if applicable) (ed) or (eds) to indicate they are the book editors)
• Place of Publication
• Publisher
• page numbers of chapter

Example…
Prezeau L, Parmentier ML, Carroll F, Pin J-P (2003) Inverse agonists to explore the mechanisms of
metabotropic glutamate receptor activity, in AP IJzerman (ed), Inverse Agonism: Proceedings of the
Esteve Foundation Symposium X, The Netherlands, Elsevier Health Sciences, pp235-244

Journal articles
• Author’s surname(s) and initials
• Year of publication
• Title of article
• Journal Title** (in italics)
• Journal volume (in bold)
• Page numbers
**You may use the full or abbreviated journal title;
however it is important to be consistent. That is, use
the full journal title every time or the abbreviated
title every time.
The full titles and official abbreviated journal titles
are easily found from the Locatorplus database,
http://locatorplus.gov

Example…
Carroll FY, Stolle A, Beart PM, Voerste A, Brabet I, Mauler F, Joly C, Antonicek H, Bockaert J, Muller T,
Pin J-P, Prezeau L (2001) BAY36-7620: a potent non-competitive mGlu1 receptor antagonist with
inverse agonist activity. Mol Pharmacol, 59, 965-73.

9 TOC
Internet References
Many of the pictures you find on the internet will be reproduced from a published source, most often text
books and journal articles. It is always better to provide the reference of the original published source
then an internet site. If you feel that the best figure for your report is only available on the internet, please
provide the author and date of publication in text (if possible; you must provide sufficient information
in-text for the complete reference to be found in your reference list) and the following information in
the reference list.
• Author’s name (if known)
• Date of publication or last revision
• Title of document
• Title of complete work (if relevant)
• URL, in angle brackets
• Date of access

Example…
[CBE] Council of Biology Editors. 1999 Oct 5. CBE home page. http://www.councilscienceeditors.org
Accessed 1999 Oct 7.

10 TOC
Using Endnote
Endnote is a software tool for publishing and managing bibliographies. La Trobe University has a site
licence, which permits all eligible staff and students of the University to use the software both at work
and at home. It can be downloaded from the following site which also provides help and training
http://www.latrobe.edu.au/library/help-and-training/using-endnote

Getting references into Endnote

Once you start Endnote you will be prompted to create a new library. From there you will want to add
references. There are essentially two ways to do this:
Type them in manually.
Or preferably,
Enter from an online search through one of the databases - I use PubMed. From Endnote go to
Tools>Online Search>New Search. Choose the database you want to search (i.e. PubMed) and search as
per normal using author names, keywords etc. You can then select those references you wish to keep
(drag and drop into group is the easiest). You will have all of the bibliographic information stored in
your library
How do I get my references into my word file?
Once you have installed endnote you should now have an Endnote tab in MS word.
1. Place the cursor in your text where you wish to insert a citation
2. Select “insert citation”.
3. Type in a keyword, words in the title or authors names and “find”.
A list of all articles in your endnote library matching the search criteria will appear.
4. Select the reference you wish to cite and double click or use one of the options from the dropdown
“insert” menu (the first option – year without author is useful if you are using an author-focussed
referencing style).

There are many alternative ways of importing references – you can also “go to Endnote” and
copy (ctrl-c) the reference and return to MS word and paste (ctrl-V) in the desired place.

11 TOC
Output styles

The output style is the style you wish endnote to use to format your references. We wish to use the
Harvard style detailed earlier.

The first time: In the edit menu select - output styles – select edit styles and enter the parameters you
desire. You can now save this output style. In addition you can select from many different preset output
styles. This is a very useful function if you need to resubmit a rejected manuscript to a different journal!
If you have “cite while you write” activated – which I think it does by default. The full references will
appear at the end of the document formatted in the style you have selected in the drop down style menu.
That should be enough to get you started. Endnote is a very useful tool and can do much more. The help
function is generally pretty good and the company offer online tutorials. The best way to learn is to play
around with it.
REMEMBER
Endnote is computer software and its output will only be as good as the data entered. If some of the
information is missing when you download it – it will be missing from your citation! It is up to you to
make sure your references are still formatted correctly and complete. Have a look at your citations
and bibliography – do they conform to the correct style?

***This is especially important if you are using Google Scholar to import references as often this
search engine does correctly incorporate the data into the various fields correctly.***

12 TOC
Lab Notebook Exercise
The practice of using a notebook to prepare protocols and record data is strongly recommended. You
should not use scraps of paper (which are easily mislaid) or the margins of the notes in the practical
manual. Both members of each pair (or all members of a project group) should record a copy of all
results for their own use - there is no excuse for losing, or not having access to, your experimental
data.
The notebook is your record of work done in the laboratory and should be recorded in the first person.
It does not require glamorous penmanship but legibility is paramount and a modicum of organization
is helpful. With experience you will begin to predict the types of data generated by various experiments
and be able to set up your record-keeping accordingly. For example, a table or chart prepared before
the data are collected, when appropriate, greatly simplifies recording, interpreting, and analysing the
results. Unfortunately, a complete and well-organized notebook comes only with experience and hard
work. Anyone going on to work in research will need to have good notebook keeping skills. Keeping an
accurate notebook is often a legal requirement and your daily entries may need to be co-signed by you
and your supervisor. Remember your notebook may be the only record of that important discovery and
might provide the legal evidence that it was in fact you that first made it!

To help improve your notebook keeping skills, there will be a formal lab notebook keeping
exercise held during practical sessions 2 and 3. You will be required to keep a formal notebook
for the duration of these practical classes and at the end of session 3 these will be collected and
assessed by the demonstrators. Follow the guidelines here.

• Reserve 1 page at the beginning of the notebook for your table of contents. You can use any
notebook/exercise book you prefer or we can provide stapled pages to use. We will return these
one week after the exercise is completed

• You will need to number each page and date your entries.

• Use only ink for recording notes. Do not white out or erase any mistakes.

• You may cross out any erroneous entries, but they must remain legible. Explain any such errors.

• You MUST enter all procedures and data directly into your notebook during the lab itself. Your
entries must be sufficiently detailed so that you or another competent student could conduct
any procedure with only the notebook as a guide. Therefore make sure that you include any
modifications of the written procedure that arise. That is, it should be a record of what you
actually do in the lab.

• Record all your raw data and observations in your notebook during the lab period

• Don’t trust your memory! Record all data directly into the notebook, never on loose paper or into
a computer.

• Keep your notebook as neat as possible under laboratory conditions. Make your notebook an
honest record of your experiments.

13 TOC
• Indicate the member of your team who actually did each procedure (first name is
sufficient); in certain settings, such as industry, supervisors must know WHO did the work
(e.g., when deciding who gets the promotion). Describe all procedures that you perform in
sufficient detail to repeat the experiment; give brief descriptions of procedures performed by
team members, and record all raw data generated by your team. Remember to describe any
problems encountered or unexpected results.

• When experiments are performed concurrently (as is the case most of the time) it is impossible
to have uninterrupted pages dedicated to a specific section of the experiment. When notes for
more than one experiment are on the same page, write “continued on page ##” below the entry
for each experiment. The top of each page of a continuing investigation should read “continued
from page ##”. This notation seems redundant when the results are on consecutive pages but
it is absolutely necessary when the data are recorded after a section of another experiment.
The notebook must have some basis of organization and chronological order is the only
standard recognized.

• Remember to write down your objectives for a particular experiment – it may not be obvious
to you months or years later why you performed a particular experiment. Similarly, any
interpretation or analysis can also be written down during or after an experiment.

• Your notebooks will be collected from you at the end of the third practical session of the
membranes and proteins practical. They will be marked and returned to you the following
session.

14 TOC
Student-Led Tutorial Session
During the first week of the semester you will be assigned to a group for tutorial sessions. Each week
(beginning in week two) two students from each group will lead a tutorial session for their group.
Normally these will be held at the start of both the tutorial and practical classes. The tutorial will be
based on a set of questions relevant to the current tutorial/practical. The questions are posted on the
LMS. All of the students in the group should attempt the questions and the group should all participate in
providing answers, with the student presenting the tutorial acting as an arbiter and explaining answers
to those who do not understand.
Make sure you sign up for a session during the week 1 tutorial with your demonstrator and
record your week and whether you are presenting the student 1 or 2 questions.
• Each presenter should aim to conclude his or her tutorial within 10-15 minutes.
• You should have one power-point slide for each question answered.
• You will have access to a laptop, projector and/or screen for presenting this tutorial.
• Also it is a good idea to have your presentation backed up to your One Drive folder.

A demonstrator will be on hand to help out and record the assessment of your presentation. Marks
for the tutorials will be based on providing correct answers, clarity of your explanations, providing
full explanations and working where appropriate and providing any additional interesting/relevant
information.

When presenting you should give an opportunity to the others to answer questions so ensure that
you ask the group what they think and try to lead them to an answer rather than simply telling them.
Contributions such as question, answers and comments from the tutorial group will be noted by the
demonstrator and will go towards your lab performance mark.
(Hint – the final exam will be largely based on these weekly tutorial questions so getting
involved and challenging the information provided by the presenters will aid in your
preparation for this exam.)

15 TOC
w

Getting the most out of this subject

In third-year biochemistry the subjects are unapologetically designed to prepare you for a career in
research and to make you as “honours-ready” as possible. The goals of the practical classes are teach
fundamental techniques in modern biochemistry, molecular biology and cell biology, to reinforce
theoretical content, to provide you with a basic set of practical skills and there is a strong focus on
scientific communication. Even if at this stage you think you are sure that you do not want to have
a laboratory-based or research career, remember that the skills taught in the laboratory course are
highly transferable. Potential employers are more interested in how you performed in the practical
laboratory and with your assigned work than they are in your performance in the theory exams! In
any case we encourage you to keep your options open and successfully completing the laboratory
course will provide you with more options.

The most important way to get the most from this practical course is to adopt the right mind-set. For
most of you this will be your final undergraduate year and by this stage you should have adopted a
reflective approach to your studies. What we mean by this is, you should be asking yourself “What
do I now know and what do I need to learn or become better at?” Do not treat your practical course
simply as a hurdle that must be overcome but rather as an opportunity to learn and acquire useful
skills.

Take every opportunity to speak with your demonstrators. Mostly they are post-graduate students
completing a PhD by research and a few years ago they were in the same position that you are
currently. So by all means ask them about their research, their life in (and out of) science and advice
about successfully completing the course. While the demonstrators all understand the basics they do
have different specialities and some will have more experience with a particular technique or concept
than others. They will often answer a question from you with a question in order to coax you to the
correct conclusion.

Speaking of questions, you will find at this level sometimes the answer to a question is not obvious,
sometimes it is contentious and sometimes we actually don’t know the answer. One of your objectives
as a scientist in training is to recognise and learn to cope with uncertainty.

16 TOC
Laboratory Rules and Safety Precautions

Monica Ivanyi is the senior technician who coordinates the LIMS

senior teaching laboratory. Along with her staff she is responsible
for preparing your reagents and equipment. Please be mindful that
the laboratory is in constant use and there is limited turnaround
time between classes. You can assist by following her instructions in
matters of health and safety, correct use of reagents and equipment,
correct disposal of consumables, tidying up of the work area and
washing up.

1. Safety information
Every person in a laboratory must take responsibility for safety
in that laboratory. Safety should be accepted as part of normal
thinking and working, and not as an additional burden.

Before starting an experiment, think of safety aspects as well as

other more obvious considerations such as apparatus and chemical
requirements. Check the practical manual for any specific warnings
for use of chemicals or equipment for each practical and make sure
you have discussed these with your demonstrator before you begin
work. If you are in any doubt, seek assistance.

To maintain the condition of the laboratories and to aid in the

smooth and safe running of the classes, all students are required to
cooperate in adhering to the following safety rules.

Safety information is noted throughout this manual for each experiment. All the chemicals used
in our laboratory have been assessed for hazards usually using information supplied by the
manufacturer such as a material safety data sheet (MSDS). As you become more independent in the
laboratory you will also need to carefully assess risks for yourself in discussion with senior members
of the laboratory. MSDSs for chemicals in the student laboratory are available in the prep room as a
reference for you and staff.

17 TOC
2. General Laboratory Rules

Please follow all instructions given by your demonstrator, the prep-room staff and your subject
coordinator. Also follow the safety instructions outlined in your experimental protocol:

Students must wear LABORATORY COATS.

The minimum FOOTWEAR requirement is shoes which fully enclose the feet. Open sandals and thongs
are not permitted.

Students must wear SAFETY GLASSES unless advised otherwise.

GLOVES are required for some experimental work and are optional for others

18 TOC
• Gloves should be treated as contaminated. Don’t touch non lab items with them (such as your
phone, door handles, your face, computer keyboards).

• EATING and DRINKING are prohibited at all times in the laboratory.

• Wash your hands in the “airlock” when leaving the laboratory.
• BAGS, DRINKS and FOOD items must not be placed on the laboratory benches. All other
non-required possessions must remain in your bag.
• RUNNING and PRANK-PLAYING activities are prohibited.
• Report any ACCIDENT or INJURY to a demonstrator, the subject co-ordinator or the prep
room staff. A FIRST-AID KIT is available in the prep room, and there are first aiders to assist
you.
• In the event of FIRE, inform a demonstrator, the subject co-ordinator or the prep room staff
immediately. Follow any instructions (eg. evacuating the laboratory or the building) given by
the demonstrators, subject co-ordinator or prep room staff.
• Students are not allowed to enter the prep room without permission.
• Students are not allowed to do lab work outside the normal prac hours.

3. Performing the experiment

• Treat CHEMICALS with respect:

• Most liquid transfers are performed using a micropipette with the correct plastic tip.
• Use disposable gloves where instructed. We routinely use nitrile gloves due to increased
awareness about latex allergies, but please let your demonstrator, the subject co-ordinator
or pre-room staff know if you are allergic to nitrile so an alternative can be provided.
• Use safety glasses unless otherwise instructed.
• Use the “snorkel” exhaust fans when instructed.
• Take note of warnings on reagent bottles.
• Use flammable solvents (eg. alcohol, acetone or ether) under snorkel exhaust fans. As
certain first whether a burner is in use anywhere in the lab. A hot plate or a flame some
distance away may ignite very volatile solvents, like ether. Sparks from electrical equipment
may also ignite flammable solvents.
• Do not add water to acids (always add acids to water).
• Hazardous waste should be collected in the waste containers provided as indicated for each
practical.
• Do not touch any piece of EQUIPMENT until you have been shown how to use it. Report
any malfunction; do not try to correct it yourself.
• When using CENTRIFUGES it is CRITICAL that they are balanced and the internal lid is
clipped correctly.
• Avoid contaminating, hoarding or wasting reagents.
• Glassware should be rinsed with tap water immediately after use unless otherwise
instructed. Rinsing will help with cleaning and prevent any spillage of harmful substances.

19 TOC
• Used glass tubes are to be placed open-end downwards in the wire baskets.
• Do not place dirty or wet equipment back with clean equipment.

4. Using the laboratory

• Keep BENCHES tidy. Place equipment where it cannot roll or be knocked off the bench. Mop up
any spills immediately.
• Keep AISLES clear.
• Be sure to use the correct WASTE BINS. Pipette tips should be placed in the containers on
the bench tops. Broken glass should be placed bins provided for this purpose and not in
the general waste bins. There is a dustpan and brush for cleaning up broken glass and other
materials in the wash up areas.
• Keep SINKS clean.
• Consider the danger that a situation might hold for workers around you, and for other users of
the lab. Warn people nearby of a hazard, inform staff (eg. spilled chemicals, broken glass) and
remove the hazard as soon as possible. Signpost any potential hazard (eg. hot-plate).

General Waste Broken Glass Only

Contaminated
Sharps, tips and Waste (e.g. gloves)
microfuge tubes (no
gloves or general
waste)

20 TOC
5. Before you leave

• Ensure you bench is tidy and items are returned to where they belong (eg. tray or side bench,
correct rubbish bin).
• Clean any balances that you have used along with the area around them.
• Check that your drawer contains:

• 1 x Flipper rack
• 1 x 0.5 - 10ul pipette
• 1 x 10 - 100ul pipette
• 1 x 100-1000ul pipette
• 1 x 0.5 - 10ul tip box
• 1 x 10 - 100ul tip box
• 1 x 100-1000ul tip box

21 TOC
Practical 1 Advanced Pipetting Masterclass

Part A

Complete the Risk Assessment Exercise with your tutorial group and complete the safety induction
forms

Part B

Please watch the following videos on how to use your automatic pipettes:

General Use of Pipettes

Calibrating an Automatic Pipette

Using Your Pipette to Estimate Volumes

Pipetting Viscous Solutions

Pipetting Small Volumes

After watching the instructional videos on pipetting – have a go (individually) at:

Calibrating your pipettes gravimetrically. Do this for the 1000 µl and 100 µl pipettes. Determine the
average and coefficient of variation for each pipette at two volumes with an n = 3. Show your results to
a demonstrator.

Practice reverse pipetting with some glycerol solution.

Try your hand at using your pipette to estimate volumes. Get your lab partner to set up some
microfuge tubes containing water with volumes known only to him or her to practice estimating
volumes

Performing a protein assay in a 96-well microtitre plate.

We will use the Bio-Rad DC Protein Assay which is based on the Lowry assay to estimate the protein
concentration of unknown solution. Perform this assay in pairs – two people being the maximum!

Read through all of the points and collect the reagents that you need, including an aliquot of the
unknown. Record which unknown you have taken.

22 TOC
1. Using the 5 mg/ml stock solution of bovine serum albumin (BSA), prepare a series of standards
ranging from 0 to 1.5 mg/ml BSA. Determine the volumes you will need by filling out the table
below. These will provide your standard curve for determining protein concentration. Ensure you
mix the tubes thoroughly by vortexing. Prepare a series of dilutions of your unknown (suggested:
undiluted, 1/5, 1/10). This will ensure that you have at least one dilution within the range of your
standard curve. Dilute with H2O. Ensure you mix thoroughly by vortexing

Standard Volume of BSA

Volume H2O Total Volume
(BSA conc mg/ml) stock (5mg/ml)

0 1ml

0.2 1ml

0.5 1ml

1.0 1ml

1.5 1ml

2. Collect a 96-well plate. Each of these wells can hold a maximum of 300 µl. Note how the wells
are arranged in a grid and each row has a letter and each column a number giving each well a
unique coordinate. Place the plate on a piece of absorbent towel on your bench with A1 in the
top left hand corner.

3. Prepare your standard curve by adding 5 µl of each standard to a series of wells. Do this in
triplicate.

4. Below your standard curve add 5 µl of each unknown dilution to a series of wells. Do this in
triplicate.

5. Add 25 µl of reagent A to each well with standard or sample. Add 200 µl of reagent B to each well
with standard or sample. Mix the contents of each well by pipetting up and down. Do this gently
to avoid spilling any of the well contents or forming any bubbles. Use a fresh tip for each well.

6. If there are any bubbles they will affect the absorbance. They can be popped by touching them
with a clean, dry pipette tip.

7. Leave for 15 minutes and observe the colour development. You should see a blue colour develop
(absorbance max at 750 nm). Are your unknown dilutions within the range of your standard
curve? That is, are any of them a darker blue than the highest BSA standard? If so, you will need
to prepare another well with a dilution of that sample to get it within range of the standard curve.
Does it look right – is the standard curve getting darker with increasing protein concentration?
If it looks funny prepare to be mocked by your demonstrators and to repeat it.

8. A demonstrator will take you to the plate reader to read your plate.

9. Graph the standard curve (remember to minus off your blank reading) and use the curve to
determine the concentration of your unknown.

23 TOC
Membranes and Proteins
In this series of practicals, you will investigate
the relationship between membranes
and proteins and learn some advanced
techniques in protein analysis. You will
purify mitochondria from cauliflower
using differential centrifugation. This is a
convenient tissue as the large white
curds contain a high concentration
of mitochondria in their outer
layer and there is no problem with
contamination from chloroplasts as
you would see from green plant tissue.
They are also cheap and you do not
require ethics approval to work on them!

Once you have isolated mitochondria, you

will assay succinate dehydrogenase activity,
which is an enzyme located in the inner
mitochondrial membrane to check the level of
enrichment of your preparation. You will also be
able to differentiate peripheral and integral mitochondrial membrane
proteins and analyse these by denaturing electrophoresis.

Differential Centrifugation

Most animal and plant tissues contain a mixture of cell types and each cell type contains a number
of different membrane-bound organelles. Often an investigator wishes to study a pure population
of one type of cell or to isolate quantities of each of the major subcellular organelles to study their
structures and metabolic functions in detail.

In some cases, cells differ in some physical property that allows different cell types to be separated.
White blood cells (leukocytes) and red blood cells (erythrocytes), for instance, have very different
densities because erythrocytes have no nucleus; thus these cells can be separated on the basis of
density.

Most fractionation procedures begin with differential centrifugation which involves centrifuging a
preparation at increasingly higher speeds. This technique is sometimes called differential-velocity
centrifugation. The different sedimentation rates of various cells or cellular components make it
possible to separate them partially by centrifugation. Nuclei and viral particles can sometimes be
purified completely by such a procedure. After centrifugation at each speed for an appropriate time,
the supernatant is poured off and then centrifuged at higher speed. Each pelleted fraction can be
resuspended and further separated by equilibrium density gradient centrifugation.

24 TOC
A cell homogenate can be centrifuged at a series of
progressively higher g-forces and times to generate pellets
of partially-purified organelles. If a sample contains many
different particles with differing densities and sizes, they will
begin to separate on the basis of those parameters. The large
particles will settle to the bottom of a tube faster than the
smaller ones.

25 TOC
Introduction to Centrifuges

Centrifuges are a ubiquitous tool for biochemists/molecular biologists.

They work by spinning samples at a high speed and therefore
subjecting them to an intense force (centrifugal force) – which you
can think of as an artificial gravitational field. In fact the units for
centrifugal force are expressed as “g”.
What is the physics behind this?

When an object is in motion along a curved path, it experiences a

force and thereby an acceleration because the mass of the object
remains constant. Centrifugal acceleration is the acceleration or
change in velocity produced by the body moving in a circular
path with respect to time, which keeps the body moving in a
circular path without falling in to the centre.

Think about travelling in a car going around a curve. You are

pushed in a direction opposite to the radius of the curve. The force you feel is directly proportional
to the square of the linear speed of the car and inversely proportional to the radius of the curve. This
makes sense because you know that if you go around a tight curve too fast you can end up spinning out
of control (this is the reason curves are often banked).

How can you calculate centrifugal acceleration?

a = v2/r

where:
a = acceleration
v = velocity of rotation
r = radius

Aren’t we standing on a giant centrifuge? So, what is the centrifugal acceleration you would experience
at the equator due to the Earth’s rotation? At the equator, the speed of rotation of the Earth is 1,674.4
km/h and the radius is 6371000m.

26 TOC
Introduction to Electrophoresis

Electrophoresis, a method whereby charged molecules or colloidal particles in solution migrate

in response to an electric field, is undoubtedly one of the most frequently used techniques in
biochemistry. During electrophoresis the charged species move toward the electrode of opposite
electrical polarity. Under a given set of conditions different species will move with different velocities.
The velocity with which a particle moves is known as its electrophoretic mobility. The electrophoretic
mobility of a particle is determined by its charge and the frictional drag of its movement through
the medium. The frictional drag is determined by the size and shape of the particle as well as the
structure of the medium in which electrophoresis takes place. Therefore electrophoretic mobility is
directly proportional to the magnitude of the charge on the particle, and is inversely proportional to
the size of the particle.

Electrophoretic separation of biological macromolecules such as nucleic acids and proteins is

almost always carried out in gels. The use of a gel matrix greatly increases the resolving power of
electrophoresis. Firstly, it prevents diffusion of the sample through thermal convection which would
occur in a liquid-only medium and secondly, the dimensions of the cross-links of the gel introduce a
molecular sieving effect which aids the electrophoretic separation of molecules of different size. In
addition, the gel media may be used to support a pH gradient or a separate reagent, which assists in
the separation and characterization of macromolecules.
An electrophoresis experiment may be either analytical, in which case the objective is to measure the
magnitude of the electrophoretic mobility, or preparative, in which case the objective is to separate
various species which differ in their electrophoretic mobility under the applied experimental
conditions.

Gels can be formed in tubes or on a flat bed, but for the analysis of proteins, polyacrylamide slab gels
are most commonly used. Polyacrylamide gels are formed by the polymerization of acrylamide in
aqueous solution in the presence of small amounts of a bifunctional cross-linker. The cross-linker
is usually N,N-methylene-bisacrylamide (bisacrylamide). The copolymerization of acrylamide
with bisacrylamide produces a mesh-like network in three dimensions, consisting of acrylamide
chains with interconnections formed from the bisacrylamide. For discussions of the composition
of polyacrylamide gels, a standard nomenclature has been widely adopted. In this nomenclature, T
represents the total percentage concentration (w/v) of monomer (acrylamide plus cross-linker) in
the gel. The term C refers to the percentage of the total monomer represented by the cross-linker. For
example, an 8%, 19:1 (acrylamide/bisacrylamide) gel would have a T value of 8% and a C value of
5%. The higher the T value, the smaller the pore size. Pore sizes can also be adjusted by varying the
concentration of the bisacrylamide cross-linker.

Polyacrylamide gel polymerization is initiated by a free radical-generating system utilizing ammonium

persulfate and TEMED (tetramethylethylenediamine). TEMED accelerates the rate of formation of
free radicals from persulfate and these in turn catalyse polymerization. The persulfate free radicals
convert acrylamide monomers to free radicals which react with inactivated monomers to begin
the polymerization chain reaction. The elongating polymer chains are randomly crosslinked by
bisacylamide, resulting in a gel with a characteristic porosity which depends on the polymerization
conditions and monomer concentrations.

Denaturing electrophoresis
In their native form, proteins fold into a variety of shapes, some compact, some elongated. The rate of
migration of native proteins through a sieving medium is therefore more a reflection of their relative

27 TOC
compactness, and less an accurate measure of molecular weight. Denaturing the proteins nullifies
structural effects on mobility, allowing separation on a basis of the charge/mass ratio. It also allows
separation of subunits in multimeric proteins, allowing analysis of large, complex aggregates. The
ionic detergent sodium dodecyl sulfate (SDS) is the most commonly used denaturant. It denatures
proteins by binding to the protein chain with its hydrocarbon tail, exposing normally buried regions
and coating the protein chain with surfactant molecules. When used in combination with a reducing
agent that breaks disulphide bonds (e.g. ß-mercaptoethanol), SDS transforms all oligomeric proteins
into their completely unfolded, rod-shaped monomeric constituent polypeptides, the length of which
is determined by the number of amino acids in the polypeptide. The charged, polar head group of SDS
adds an additional benefit to the use of this denaturant. Proteins solubilized in SDS bind the detergent
uniformly along their length to a level of 1.4g SDS/g protein, corresponding to 1 molecule of SDS per
two amino acids in the polypeptide, creating a consistent charge/mass ratio between proteins. The
resulting high negative charge density means that all proteins in SDS-PAGE will migrate towards the
anode, and that theoretically the mobility of a given protein species will depend only on its MW.

Principle of denaturing protein

electrophoresis.
From Bruce Alberts, Dennis Bray,
Julian Lewis, Martin Raff, Keith
Roberts, and James D. Watson;
Molecular Biology of the Cell, 4th
ed., (New York: Garland Press,
2002).

28 TOC
Two categories of buffer systems are available for SDS-PAGE: continuous and discontinuous.
Continuous systems use the same buffer in both the gel and tank. While continuous gels are easy to
prepare and give adequate resolution for some applications, bands tend to be broader and resolution
consequently poorer in these gels. Discontinuous buffer systems employ different buffers for tank and
gel, and often two different buffers within the gel, with a third buffer in the tank.
Discontinuous systems concentrate, or “stack” the protein samples into a very narrow zone prior
to separation, which results in improved band sharpness and resolution. In the classic SDS PAGE
system, developed by Laemmli, (Nature 227, 689 (1970)), the gel is divided into an upper “stacking”
gel of low percentage (i.e. large pore size) and low pH (6.8), and a resolving gel with a pH of 8.8
with much smaller pores. Both gels contain only Cl- as the mobile anion. The tank buffer (pH 8.3)
has glycine which is a weak acid and can exist in either of two states, an uncharged zwitterion, or
a charged glycinate anion. When electrophoresis begins, glycine enters the stacking gel, where the
low pH favours the zwitterionic form with zero net charge. The glycine front moves slowly through
the stacking gel, lagging behind the strongly charged, smaller Cl- ions. As these two current carrying
species separate, a narrow zone of very low conductance is created (in other words very high
electrical resistance) in the top of the stacking gel. Because V=IR almost all of the voltage that you put
across the gel is concentrated in this small zone. The very high field strength makes the negatively
charged proteins move forward. The key, however, is that they can never outrun the chloride ions. If
they did they would find themselves in a region of high conductance and very low field strength and
would immediately slow down. The result is that all the proteins move through the stacker in a tight
band just behind the moving front of chloride ions. The effect of this moving zone of high voltage
is that all the proteins reach the separating gel at virtually the same time so that migration of the
proteins is truly a function of molecular size and not some complicated function of how carefully the
gel was loaded and when the voltage was applied. As this zone enters the separating gel, the increase
in pH deprotonates the glycine and it becomes more negatively charged. The mobility of the glycine
increases and the mobility of the proteins decrease (due to the sieving properties of the gel). The
result is that the glycine races past the protein and the proteins are no longer in a narrow zone of
very high resistance (and very high electric field). This allows the proteins to “unstack” and separate
through the small pore resolving gel.

Native PAGE

“Native” or “non-denaturing” gel electrophoresis is run in the absence of SDS. While in SDS-PAGE the
electrophoretic mobility of proteins depends primarily on their molecular mass, in native PAGE the
mobility depends on both the protein’s charge and its hydrodynamic size.
The electric charge driving the electrophoresis is governed by the intrinsic charge on the protein at
the pH of the running buffer. This charge will, of course, depend on the amino acid composition of the
protein as well as post-translational modifications.
Since the protein retains its folded conformation, its hydrodynamic size and mobility on the gel will
also vary with the nature of this conformation (higher mobility for more compact conformations,
lower for larger structures like oligomers or large protein complexes). If native PAGE is carried out
near neutral pH to avoid acid or alkaline denaturation, then it can be used to study conformation, self-
association or aggregation, and the binding of other proteins or compounds.
Thus native gels can be sensitive to any process that alters either the charge or the conformation
of a protein. This makes them excellent tools for detecting things such as; changes in charge due to
chemical degradation (e.g. deamidation), unfolded, “molten globule”, or other modified conformations,
oligomers and aggregates (both covalent and non-covalent) and binding events (protein-protein or
protein-ligand).
Another advantage of native gels is that it is possible to recover proteins in their native state after the
separation for functional analysis.

29 TOC
Visualization of Proteins

Following electrophoresis, proteins can be detected by general staining with dyes such as the
commonly used Coomassie Brilliant Blue which is able to detect 0.2 μg of protein in a single band.
Specific enzymic staining or by a “photographic” silver staining procedure is also possible and gives
enhanced sensitivity as low as 10 ng per band but is more cumbersome. General staining techniques
usually incorporate an initial washing step in an acidic solution such 7% (v/v) acetic acid) which
“fixes” (precipitates) the protein in the gel and thereby limits post-electrophoretic diffusion of the
separated proteins. It must be noted that when general staining techniques are applied to samples
representing complex mixtures such as whole cell lysates or tissue homogenates, detectable bands are
likely to represent a number of proteins. For this reason more specific analyses are often applied.

Downstream Applications
The major uses of SDS-polyacrylamide gel electrophoresis (SDS-PAGE) are for the analysis of the
purity of a given protein sample and the determination of the subunit MW of proteins. However SDS-
PAGE can also provide a convenient separation tool for more detailed analyses. A specific protein
can be identified following SDS-PAGE by transferring the separated proteins to a membrane support
and exposing all the proteins present to a specific antibody coupled to a fluorescent dye or easily
detected enzyme. This technique is called “Western blotting”. SDS-PAGE can also be coupled to mass
spectrometry. Gel sections or discrete protein bands can also be excised from stained gels and the
proteins eluted for analysis by mass spectrometry to determine the identity of proteins comprising
the band, sequence information of specific peptides or information on secondary modifications of the
proteins.

30 TOC
Marker Enzymes

In order to develop a differential centrifugation scheme to isolate a particular organelle, a marker

must be used to follow its isolation. A marker is some easily measurable aspect of the target that
is being isolated. For example, the marker can be the activity of an enzyme that is confined to that
organelle. For example, many of the enzymes of the electron transport chain are membrane bound
and confined to the inner membrane of the mitochondria. Therefore, after centrifugation to isolate
mitochondria, both the pellet and supernatant can be analysed to see which has more of the activity
associated with these enzymes. The fraction with more of the activity has more mitochondria than
fractions with less activity. It is therefore said to be “enriched” with mitochondria. Purification of the
organelle is accomplished by following its enrichment through successive steps.
The marker followed in this procedure is the enzyme succinate dehydrogenase (SDH). SDH is an inner
mitochondrial membrane protein involved in the Krebs cycle. It converts succinate to fumarate by
oxidation, passing 2 electrons from succinate to FADH2.

Succinate + FAD → fumarate + FADH2

In the mitochondrion, FADH2 passes these two high-energy electrons to the electron transport chain,
which uses them to produce 2 ATP. In our assay, azide is used to block the transfer of these electrons to
the electron transport chain. Instead, a chemical in the assay, 2,6-dichlorophenol indophenol (DCPIP),
accepts the electrons from the FADH2 and becomes reduced. This reduction produces a colour change
that can be detected spectrophotometrically. A certain concentration of DCPIP (which is dark blue) is
added at the beginning of the experiment and it is converted into a colourless chemical as the reaction
proceeds. The more SDH there is in the assay, the faster this colour disappears. By measuring the
rate of the disappearance of this colour, we measure the concentration of the enzyme in the reaction.
Enzyme rates are measured in units of activity, which is explained below. This gives the concentration
of enzyme in the solution in units/ml.

Succinate dehydrogenase is an enzyme of the tricarboxylic acid cycle and is found in mitochondria.
Because it is quite stable and found at high concentration only in the mitochondrion of eukaryotes,
succinate dehydrogenase is useful as a marker enzyme for mitochondria. As long as the mitochondria
remain intact, the presence of SDH means that mitochondria are there. One complication is that if
the tissue is not fresh and the mitochondria have decomposed, then the SDH enzyme will be in small
vesicles called microsomes and will stay in solution.

To study the effects of a competitive inhibitor on the activity of succinate dehydrogenase, you will
add malonate to the reaction mixture. Malonate is a classic example of a competitive inhibitor; it
has a molecular structure that is similar to succinate, so it will bind to the active site of succinate
dehyrogenase. However, malonate is sufficiently different from succinate that it cannot be
dehydrogenated.

Specific Activity

Enrichment of the organelle in question is determined with respect to its specific activity. Specific
activity is expressed in units of enzyme per milligram protein (units/mg). During the differential
centrifugation, proteins are separated. Some go into the pellet and some stay in the supernatant.
Therefore, if the enzyme stays in the supernatant and many other proteins pellet out, the enzyme
will represent a higher percentage of the protein in the supernatant than before it was centrifuged.
However, if the enzyme activity is measured in units per ml of supernatant (unit/ml), the activity
would stay the same, since the volume of the supernatant that enzyme is suspended in has not

31 TOC
changed. Similarly, if the enzyme went to the pellet, its activity expressed in units/ml would be
dependent on the volume that the pellet is resuspended in before doing the assay, and not on any
enrichment created by the centrifugation. For this reason, both the enzyme activity in a fraction and its
protein concentration are measured and then the specific activity of enzyme is calculated by dividing
by the concentration of protein in that fraction to give units/mg protein.

32 TOC
Practical 2 Membranes and Proteins I
(complete this practical in groups of 4)

A. Homogenisation of Cauliflower Tissue

1. Weigh out 5 g of sand into the mortar and pestle and keep chilled in an esky of ice.

2. Use the razor blade to shave off the outer 2-3 mm of the inflorescence meristem (the white curd).
Avoid including any of the green tissue. Keep going until you collect 20 g of this tissue. Use a large
weigh tray to weigh the tissue. Once you have collected your tissue, ensure that you tidy up - so
sweep up any cauliflower debris and place it in the bin!

3. Add the tissue to the mortar and pestle and add 2 ml of homogenisation buffer to every gram of
tissue.

4. Grind the tissue (on ice) into a fine slurry. You should keep going until you have a smooth
homogenate free of chunks of tissue.

5. Place a funnel into a 50 ml Sorvall centrifuge tube on ice and line it with cheesecloth folded double.

6. Carefully pour you homogenate into the tube through the cheesecloth. Gently squeeze the
remaining fluid from the cheesecloth into the tube.

B. Differential Centrifugation of Cauliflower Mitochondria

1. Centrifuge the homogenate at 1000 g for 5 minutes. As this is a short centrifugation, this can be
done using a bench-top centrifuge at room temperature.

2. After centrifugation, carefully pour off the supernatant into a new 50 ml Sorvall centrifuge tube on
ice. Take care not to disturb the pellet.

3. Remove a 2.5 ml aliquot of the supernatant to a capped 10 ml tube. Label this tube post-nuclear
supernatant.

4. Centrifuge the post-nuclear supernatant at 10,000 g for 30 minutes at 4⁰C. You will need to use a
more powerful centrifuge with cooling for this step. The demonstrators will help you with this, as
some of the tubes will need to be centrifuged on machines in the research facility.

5. After centrifugation, very carefully pour off the supernatant into a capped 50 ml tube. Take care
not to disturb the pellet. Label the tube “post-mitochondrial supernatant” and keep on ice.

6. Examine the pellet – what colour is it? Why do you think it has this colour?

7. Resuspend the pellet in 15 ml of assay buffer. Label this as “resuspended mitochondria” Pipette
the solution up and down repeatedly to ensure the pellet is completely resuspended and free from
clumps. Keep on ice.

33 TOC
8. Go on to parts C and D. These can be done simultaneously and dividing up the labour within
the group is fine. Just ensure that you understand what each other is doing as you will need
to pool the data to complete your worksheets and remember this work could be the basis for
questions in your practical exam.

C. Determining Protein Content of Mitochondrial Fractions

1. Remove 1ml of the resuspended mitochondria to a microfuge tube and centrifuge at 10,000 g for
15 minutes. Since these mitochondria will only be used for protein estimation, there is no need to
perform these steps at 4⁰C or on ice. In fact, do not put solutions containing SDS on ice as the SDS
will precipitate.

2. Remove the supernatant (as much as you can with a pipette). Resuspend the pellet in 250
µl of 0.5% SDS (you will first need to dilute the 10% (w/v) SDS stock solution). Vortex the
mitochondria well to solubilise. (You are concentrating (4x) the mitochondria here - you will
need to take this into account later!)

3. Centrifuge the solubilised mitochondria at 10,000 g for 5 minutes.

4. Remove the supernatant to a fresh tube.

5. Remove 450 µl of both post-nuclear supernatant and post-mitochondrial supernatant to fresh

microfuge tubes. Add 50 µl of 10% SDS to each of them to make a 0.5% solution. Vortex well to
mix. (You will need to take this dilution into account later!)

6. You are now ready to determine the protein concentration of your mitochondria, your post nuclear
supernatant and your post-mitochondrial supernatant. Read through points 7-11. Draw up a
protocol for determining the protein concentration of your samples and ask a demonstrator to
check it before you begin. We will use the Bio-Rad DC Protein Assay which is based on the Lowry
assay and is specially formulated to work in the presence of detergents.

7. Using the 5 mg/ml stock solution of bovine serum albumin (BSA), prepare a series of 5 standards
ranging from 0 to 1.5 mg/ml BSA. These will provide your standard curve for determining protein
concentration. It is always more accurate to make up a larger volume than you need. I suggest
prepare a volume of 1 ml each of 0, 0.2, 0.5, 0.75, 1 and 1.5 mg/ml BSA. For example the 0.2 mg/ml
sample would have 40 µl of 5 mg/ml stock BSA plus 960 µl of water

8. Collect a 96-well plate. Each of these wells can hold a maximum of 300 µl. Note how the wells are
arranged in a grid and each row has a letter and each column a number giving each well a unique
coordinate. Place the plate on a piece of absorbent towel on your bench with A1 in the top left
hand corner.

9. Prepare your standard curve by adding 5 µl of each standard to a well. Do this in triplicate. It is
easier to place the triplicates directly below one another. For example, the 0 mg/ml “blank” would
be in A1, B1 and C1 the 0.2 mg/ml “standard” in A2, B2 and C2.

10. Below your standard curve add 5 µl of each sample to a well. Do this in triplicate.

34 TOC
11. Add 25 µl of reagent A’ to each well with standard or sample.

12. Add 200 µl of reagent B to each well with standard or sample. Mix the contents of each well by
pipetting up and down. Do this gently to avoid spilling any of the well contents or forming any
bubbles. Use a fresh tip for each well. You should remember the Beer-Lambert law from 2nd year.
Every well needs the same volume as absorbance depends on path-length.

13. If there are any bubbles they will affect the absorbance. They can be popped by touching them with
a clean, dry pipette tip.

14. Leave for 15 minutes and observe the colour development. You should see a blue colour
develop (absorbance max at 750 nm). You should see a clear increase in intensity of blue colour
corresponding to the BSA concentration of your standards. Does it appear to make sense? Are your
samples within the range of your standard curve? That is, are any of them a darker blue than the
highest BSA standard? If so, you will need to prepare another well with a dilution of that sample to
get it within range of the standard curve. The colour is stable for several hours.

15. A demonstrator will help you at the plate reader to read your plate.

16. Graph the standard curve (remember to minus off your blank reading) and use the curve to
determine the concentration of your samples.

D. SDH Activity in Mitochondrial Fractions

Please make sure that you read and understand the notes regarding this assay in the section
preceding the protocol. Read the entire protocol before you begin! Keep all of your reagents at room
temperature apart from the mitochondrial fractions/supernatants that need to be on ice.

This assay is difficult for two reasons:

• The samples you are assaying are turbid and you can expect some settling of the tube contents
over the course of the assay. To control for this, you will need to blank with a tube that contains
everything apart from the substrate DCPIP. You will need to do this at each time point.

• Ideally, we would perform this assay with a minimal amount of DCPIP present. The problem is that
DCPIP can re-oxidise in the presence of atmospheric oxygen. To minimise this effect, which would
compromise your rate determination, we will use a starting concentration of 50 µM DCPIP but you
must also avoid inverting, vortexing or otherwise mixing the tubes once the reaction has started.

1. Initially you will need to set up a DCPIP standard curve. Using the 500 µM stock DCPIP and
assay buffer to dilute it, prepare a series of standards in the glass spectrophotometer assay tubes
provided. Each tube should contain 5ml and you will need tubes containing 0, 10, 20, 30, 40 and
50 µM DCPIP.

2. Cover the tubes with parafilm and mix well by inversion.

3. Using the 0 µM tube as a blank, read the absorbance of your tubes at 600 nm. Important -
since we are looking at the difference in absorbance over time -don’t zero (blank) the

35 TOC
 spectrophotometer between measurements - we will take into account the blanks at the
end!

4. Make sure you use the tube holder (NOT the cuvette holder). The tube holder will keep the tube
held tight as it is adjustable. Check with a demonstrator if you are not sure.

5. Graph the DCPIP standard curve.

6. Set up the following tubes and keep them at room temperature. Do not add the PNS, PMS or
mitochondrial suspension until you are ready to start measuring.
Tube Assay Sodium DCPIP Malonate Succinate PNS* PMS* Mitos*
# Buffer Azide (0.2M)
(40 mM) (500 µM) (0.2 M)
1 3.0 ml 0.5 ml 0.5 ml - 0.5 ml 0.5 ml - -

2 3.5 ml 0.5 ml - - 0.5 ml 0.5 ml - -

3 3.0 ml 0.5 ml 0.5 ml - 0.5 ml - 0.5 ml -

4 3.5 ml 0.5 ml - - 0.5 ml - 0.5 ml -

5 3.0 ml 0.5 ml 0.5 ml - 0.5 ml - - 0.5 ml

6 3.5 ml 0.5 ml - - 0.5 ml - - 0.5 ml

7 2.5 ml 0.5 ml 0.5 ml 0.5 ml 0.5 ml - - 0.5 ml

8 3.0 ml 0.5 ml 0.5 ml 0.5 ml - - 0.5 ml

9 3.5 ml 0.5 ml 0.5 ml - 0.5 ml - - -

*Do not add these components until just before you start measuring.

7. Please note that tube 2 is the blank for tube 1, tube 4 is the blank for tune 3, tube 6 is the blank for
tube 5 and tube 8 is the blank for tube 7. Do you know the purpose of tube 9?

8. Important - since we are looking at the difference in absorbance over time -don’t zero
(blank) the spectrophotometer between measurements - we will take into account the
blanks at the end!

Tube 1 Tube 3 Tube 5 Tube 7

9. Before you begin measuring try and predict which tubes will have highest succinatedehydrogenase
rate. Rank the tubes from lowest to highest.

10. Turn on the spectrophotometer andwait 5 minutes for it to warm up. Adjust the wavelength to
36 TOC
 600 nm. Start your reactions by adding the appropriate extract (PNS, PMS or Mitos) but you will
need to stagger the additions so you can run these reactions at overlapping times. I would suggest
staggering the addition of extract at least 1 minute.

11. Keep track of how much of the resuspended mitochondria you use for the assay – it is important
for the calculations later.

Tube 1 Tube 2 Tube 3 Tube 4 Tube 5 Tube 6 Tube 7 Tube 8 Tube 9

10

15

20

25

30

35

E. Preparation of Mitochondria for Week 3

1. Use the data from your protein assay to determine the concentration of your resuspended
mitochondria. Remember to work out the concentration of the original suspended mitochondria
- so you need to take into account any dilution factors in the assay and the 4x concentration
step from C2. If you are unsure about how to do this calculation, you will need to ask your
demonstrator. Keep the mitochondria on ice.

2. Label six 1.5 ml microfuge tubes with your initials. Make sure you will recognise these in the next
practical.

3. Aliquot enough of your resuspended mitochondria to provide 0.5mg of protein into each of the
tubes. Centrifuge at 15,000 g for 15 minutes at 4⁰C.

4. Remove the supernatant from each tube taking care not to disturb the pellets – use a pipette to
remove all of the supernatant.

5. Place the tubes into the class esky. A demonstrator will place these at -20C for storage until next
week.

37 TOC
Practical 3 Membranes and Proteins II
(complete this practical in pairs)

A. Collection of mitochondria

1. Collect your pelleted mitochondria from week 1 and keep the microfuge tubes on ice.

2. Label two of the tubes A, B. You should also have two spare tubes (from your group of 4 last week).

3. You will use the tubes for the following:

Tube Extraction Analysis
A 1 mM CAPS pH 11 extraction SDS-PAGE
B 2% Sodium Dodecyl Sulfate (SDS) SDS-PAGE
extraction

B. Extraction of Peripheral and Integral Membrane Proteins

1. Add 80 µl of 1 mM CAPS, pH 11 to tube A. Ensure the pellet is completely resuspended by pipetting
the solution up and down. Store on ice for 45 minutes and every 5-10 minutes mix the solution by
pipetting up and down. While you are waiting for tube A you can complete the other extractions.

2. Add 80 µl of 2% SDS to tube B. Ensure the pellet is completely resuspended by pipetting the
solution up and down. Mix by vortexing. Store room temperature.

3. Centrifuge tubes A and B at 10,000 g for 15 minutes at room temperature.

4. Remove the supernatant from A to a fresh microfuge tube labelled “P”.

5. Remove the supernatant from B to a fresh microfuge tube labelled “T”.

6. Discard tube B containing the pellet.

7. To the pellet in tube A, add 80 µl of 2% SDS. Ensure the pellet is completely resuspended by
pipetting the solution up and down. Mix by vortexing. Store at room temperature.

8. Centrifuge tube A at 10,000 g for 15 minutes at room temperature.

9. Remove the supernatant to a fresh tube labelled “I”.

10. Discard tube A - containing the pellet.

11. Add 20 µl of 5x SDS-PAGE loading buffer to tubes P, T and I.

38 TOC
12. Mix by vortexing and now keep these tubes at room temperature.

13. Fix a coloured cap lock to the lid of each tube using a needle and heat denture these proteins by
incubating at 95⁰C for 5 minutes.

14. Centrifuge these tubes at 10,000 g for 5 minutes at room temperature.

15. The samples are now ready to load on the SDS-PAGE gel (Bio-Rad apparatus).

C. SDS-PAGE Electrophoresis of Integral and Peripheral

Mitochondrial Proteins
1. Take a pre-cast gel cassette. Position both thumbs on the ridge of the comb. Remove the comb by
pushing upward in one smooth continuous motion.

2. Pull on the tape gently to remove it from the bottom of the cassette (see next page).

***Don’t forget this step or your gel will not run!!***

3. Assemble the cassette into the gel tank apparatus. Ask a demonstrator for help when you are

doing this. Add running buffer to the inner chambers – check for leaks. Add running buffer to the
outer chamber. Ensure there is enough buffer – the level in the inner chamber should be above the
tops of the wells and the outer buffer as indicated for the number of gels you are running.

39 TOC
4. Use a pipette to carefully rinse the wells with running buffer. Flush each well twice with running
buffer.

5. You can now load your samples. Use the special gel-loading tips providedEnsure you leave at least
one lane free for markers. Do not load the gels so they are symmetrical/reversible or you will have
trouble working which were your samples.

Volumes to load:

5 µl of sample Molecular Weight Markers (See a Demonstrator – 1 lane per gel only)
5 µl of sample T
5 µl of sample I
20 µl of sample P

***Write down the order you loaded the samples in your own lab manual!***
6. Have a demonstrator load the molecular weight markers (important!).
7. Run the gel at 200 V until the dye front reaches the reference line (approximately 30 minutes –
butmoniter the gel!). At completion of the run turn off the power pack and disconnect at the mains

8. Remove the cassette and use the opening lever to open the plates. To do this align the arrow on the
opening lever with the arrows marked on the cassette. Insert the lever between the cassette plates
at all four locations and apply downward pressure to break the seal. Gently pull apart the two plates
beginning from the top of the cassette.
9. Wearing gloves gently remove the gel and place in a clean tupperware box containing stain.
10. Label the box using tape, including the names of all group members with samples loaded on the gel.
11. Place the gel on the rocking platform for overnight staining.
12. Ensure you view the demonstration of the hanging drop method of protein crystalization

40 TOC
E. CRYSTALLIZATION OF LYSOZYME BY THE HANGING-DROP
METHOD

X-ray crystallography is a technique used to determine the structure of proteins. It is based on the fact
that an array of repeating objects scatter (diffract) X-rays in a regular fashion. In the case of protein
crystallography, the objects (‘unit cells’) in the array are molecules of the protein of interest, and it is
the electrons around the individual atoms of these protein molecules that cause the diffraction. X-rays
with a wavelength of between 0.5 to 2.5 Angstroms (Å, a non-SI unit equivalent to 10-10m or 0.1nm)
are suitable for X-ray diffraction experiments. The diffracted X-rays can be recorded as a series of
spots (a ‘diffraction pattern’), several features of which can be used, with the help of some complex
calculations, to build up a model of the protein molecule. For example, the distance between the
spots on the diffraction pattern is directly related to the dimension of the repeating unit cell, while the
intensity of each spot is indicative of the electron density of a particular part of the protein molecule.
This information can be used to determine the positions of each atom in the protein molecule,
resulting in a meaningful structural image.

Growing protein crystals provides the regular ordered array of protein molecules essential
for successful X-ray diffraction experiments. A crystal needs to have a regular 3-dimensional
arrangement of atoms made up of a repeating unit (the ‘unit cell’ referred to above) which is the
smallest region within the crystal that is representative of the crystal as a whole (i.e. the entire
crystal can be made up of multiple unit cells, shifted by translation only). It may contain one or more
molecules of the protein (if more than one, they are related to each other through axes of symmetry).
The regular arrangement of the unit cells forms a 3-dimensional crystal lattice’, and a high degree of
order within the crystal is essential for X-ray diffraction experiments to be successful.

The physical properties of a solute (eg. a protein) can be represented in a phase diagram
showing regions representing super-saturation and under-saturation of solute.

41 TOC
Phase diagram for protein crystallisation

Precipitation occurs when the protein concentration is too high and the protein molecules
aggregate. Nucleation is the spontaneous aggregation of nuclei, but no further growth occurs. The
metastable state is when growth of existing nuclei and crystals occurs, but no new nucleation takes
place. The undersaturated state means that the protein molecules remain in solution.

By reducing the concentration of solute, a supersaturated solution can enter a metastable state
of lower energy, either by aggregation or crystallization. In the case of crystallization, three stages
are involved: nucleation, crystal growth and cessation of growth. The saturated region of the phase
diagram can be divided into three additional areas: metastable, nucleation and precipitation. When
the protein concentration reaches the nucleation region, nuclei (foci) are formed. As this occurs, the
protein concentration decreases and a metastable phase is reached in which it is likely that crystals
will grow from nuclei, and that protein crystals already formed will continue to grow, but no new
nucleation takes place. Crystal growth is thought o stop when the protein molecules reach exchange
equilibrium between the solution and crystal phases, and/or when the protein concentration is
depleted to such an extent that the undersaturated region is reached.

One of the most commonly employed protein crystallization methods is vapour-diffusion,

which can be accomplished by hanging-drops, sitting drops or sandwich drops. The hanging-drop
method is most commonly used, as it is technically straightforward, reasonably fast, and economical
in terms of protein usage. To grow protein crystals by this method, the protein solution is placed
on a siliconised glass cover slip. An aqueous buffered solution of precipitant (known as the
‘crystallisation solution’, ‘precipitant solution’ or ‘reservoir solution’) is mixed with the protein drop
at a concentration just below that necessary to precipitate the protein. Usually the protein solution
and reservoir solution are mixed in a 1:1 ratio so that their concentrations in the resulting drop are
half of their original concentrations. The cover slip is then inverted over a reservoir containing the
reservoir solution (typically a volume of between 100µl-1000µl) and sealed. Because the reagents in
the reservoir solution are now present at double the concentrations present in the protein-containing
drop, water evaporates from the drop gradually. When the supersaturated state (the precipitating
condition) is reached, crystals of the protein may form.

Schematic of the hanging drop vapour-diffusion

method of protein crystallisation

42 TOC
A number of precipitants such as ammonium sulphate and polyethylene glycol (PEG) are commonly
used to facilitate crystallisation. In order to reach the ideal crystallisation conditions for a particular
protein, a range of variables need to be tested in crystallization ‘screens’ or ‘trials’. The variables
tested may include protein concentration, alternative precipitants, presence and concentrations of
salts, drop size, pH, temperature, and of course the general crystallization method employed. Other
additives may be required to slow down the rate of protein precipitation in an attempt to produce
large, perfect crystals.

The optimization of crystallisation conditions for a newly isolated protein may take from several
weeks to many years. In the case of lysozyme, the optimal conditions for crystallization have already
been determined, and lysozyme is in fact the best characterized protein in terms of its crystallization
behaviour. Have a look at the lysozyme crystallization demonstration. Examine the droplets on the
coverslips under the microscope and pay particular attention to the set-up of the crystallization trial.

You will need to be able to answer the following questions at the next tutorial:

• Explain the principle of the hanging drop method of crystallization.

• Draw a side view of one covered well from the crystallization experiment. Label the hanging drop,
the reservoir solution, where lysozyme is and indicate the expected net movement of water.

• How could you tell if the crystals are lysozyme and not just salt crystals?

• Briefly describe the results in the crystallization experiment. What appears to be the optimum
NaCl concentration?

43 TOC
Gene Expression
Aims

To examine of expression of two typical house-keeping genes, Actin and GAPDH in Hela cells (a human
epithelial cancer cell line). In this practical, you will use qualitative RT-PCR and western blotting to
look at gene expression.

Learning Objectives

• To learn the principles of purifying nucleic acids and protein from mammalian cells using
guanidium thiocyanate phenol-chloroform extraction.

• To learn techniques in RNA handling and how to determine the concentration, purity and integrity
of an RNA sample.

• To understand how reverse transcription coupled to PCR can be used to either clone specific
transcripts or to quantitate their level of expression.

• To learn the basic principles of western blotting.

• To understand the dynamics of PCR amplification and how this can applied to real-time
quantitative techniques

RNA purification

Obtaining high quality, intact RNA is the first and often the most critical step in performing many
fundamental molecular biology experiments, including Northern analysis, nuclease protection assays, RT-
PCR, RNA mapping, in vitro translation and cDNA library construction. The main challenge to purify RNA
is to isolate it away from proteins and DNA which will affect or inhibit downstream applications and to
prevent the RNA from degrading (see below). The method you will use is a commercial version of the
guanidium thiocyanate phenol-chloroform extraction procedure developed by Chomczynski and Sacchi
(1987). This method relies on centrifugal phase separation of a mix of aqueous and organic solvents.
A solution containing water-saturated phenol, chloroform and a chaotropic denaturing solution
(guanidium thiocyanate) is used to lyse the cells. Guanidium thiocyanate and phenol denature the
proteins, including RNases, and separates rRNA from ribosomes. In the presence of chloroform or
the case of this practical, BCP (bromochloropropane) the aqueous and organic components can be
separated by centrifugation into two distinct phases. Acidic phenol is used to selectively remove
genomic DNA away from RNA. Genomic DNA is more basic than RNA, because it lacks an oxygen
molecule which makes RNA more polar than DNA. Hence, DNA is easier to protonate, neutralizing
the charge on the phosphate group and allowing it to partition into the phenol phase (coloured pink/
red in this practical). Following centrifugation nearly all of the RNA is present in the aqueous phase,
while DNA and protein partition in the interphase and organic phase, respectively. In a last step, RNA
is recovered from the aqueous phase by precipitation with 2-propanol.

44 TOC
RNA quality control

There are three quality controls that are performed on isolated RNA. One is to
determine the quantity of RNA that has been isolated, the second is the purity of RNA that has been
isolated and the third is the integrity of the RNA that has been isolated. Nucleic acids can be quantified
by measuring their UV absorption using a spectrophotometer. The absorbance is measured at 260
and 280 nm. The concentration of nucleic acid can be determined using the Beer-Lambert law, which
predicts a linear change in absorbance with concentration. An absorbance reading at 260 nm of 1.0 is
equivalent to about 40 µg/ml of RNA.

RNA has its absorption maximum at 260 nm while proteins have a peak at 280 nm. Therefore the
ratio of the absorbance at 260 and 280 nm is used to assess the RNA purity of an RNA preparation.
Pure RNA has an A260/A280 value of 1.8-2.0.

The integrity of the RNA is also an important consideration. Total RNA run on a denaturing agarose
gel shows two distinct ribosomal peaks corresponding to either 18S or28S for eukaryotic RNA. The
major rRNA species (18S and 28S) are synthesised by cleavage from a common 13 kb transcription
unit which is part of a 40 kb tandemly repeated genomic unit. The fact that the 18S and 28S rRNA
species are derived from the same precursor molecule means that there are exactly the same number
of copies of both molecules in the cell. Traditionally, the intensity of these rRNA bands on denaturing
agarose gels have been used to calculate a ratio that served as an indication of RNA integrity. A
28S/18S ratio of two is considered to be good quality RNA.

Traditional separation of total RNA on denaturing agarose

gel electrophoresis followed by ethidium bromide staining.
The 28S/18S rRNA bands in this figure have an intensity
ratio around 2 and would be considered good to very good
quality RNA.

45 TOC
Practical 4 Gene Expression I
(Complete this practical in pairs)

A. Handling RNA
1. During the RNA handling stages of this practical you will need to minimise RNase contamination of
your sample. Some of the precautionary steps below will already have been done for you, but most
you will need to observe. And any apparatus or consumables provided to you RNase free will need
to be kept that way.

2. The most common sources of RNase contamination are your hands (skin) and bacteria or mould
that may be present on airborne dust particles or laboratory glassware. To prevent contamination
from these sources, wear gloves at all times and use sterile technique when handling the reagents
used for RNA isolation or analysis.

3. Whenever possible, use sterile, disposable plasticware for handling RNA. These materials are
generally RNase-free and do not require pre-treatment to inactivate RNase.

4. Treat non-disposable glassware and plasticware before use to ensure that it is RNase-free. Bake
glassware at 250°C overnight. Thoroughly rinse plasticware with 0.1 M NaOH/1 mM EDTA and
then with diethyl pyrocarbonate (DEPC)-treated water.

5. While most sources of fresh, deionised water are free of contaminating RNases, deionised water
can be a contributor of RNase activity. If degradation of the target or probe RNA occurs, it may be
necessary to test the water source for RNase activity by incubating an RNA sample with the water
and checking for degradation by gel electrophoresis.

6. Chemicals for use in RNA isolation and analysis should be reserved for RNA applications and kept
separate from chemicals for other uses. Wear gloves when handling the chemicals, and use only
baked spatulas and untouched weigh boats or weighing paper.

7. Autoclaving alone is not sufficient to inactivate RNases. Solutions prepared in the lab should be
treated by adding DEPC to 0.05% and incubating overnight at room temperature. The treated
solutions should be autoclaved for 30 minutes to remove any trace of DEPC. Also, Tris-based
buffers cannot be used with DEPC; the DEPC reacts with the free amino group and Tris loses its
buffering ability. Purchase Tris that is tested RNase-free and use DEPC-treated or Nuclease-Free
Water to make your Tris-buffered solutions.

8. Some labs have found it useful to set up an “RNA Work Only” area that has dedicated labware,
pipettes, ice buckets, apparatus, etc.

46 TOC
B. Purification of RNA

1. Collect a Hela cell pellet (frozen in dry ice) and keep on ice but ensure that you process the cells
quickly.

2. The cells were grown in suspension then counted and collected by centrifugation. Each pellet
represents about 1 x 106 cells.

3. Add 1 ml of the Tri-Reagent to the cell pellet.

Note: TRI Reagent contains a poison (phenol) and an irritant (guanidine thiocyanate). It can cause
burns. When working with TRI Reagent use gloves and eye protection. Do not get on skin or clothing.
Avoid breathing vapour.

4. Lyse the cells by pipetting up and down several times. There should be no clumps present.

5. Store the homogenate for 5 minutes at room temperature to permit the complete dissociation of
nucleoprotein complexes.

6. Add 0.1 ml of BCP (1-bromo-3-chloropropane) to lysed cells. Ensure that the tube is capped tightly
and shake vigorously for 15 seconds.

7. Store the resulting mixture at room temperature for 10 minutes then centrifuge at 12,000 g for
15 minutes at 4°C. It is important to perform centrifugation to separate aqueous and organic
phases in the cold (4-10°C ). If performed at elevated temperature, a residual amount of DNA may
sequester in the aqueous phase. In this case, the RNA will not be suitable for PCR.

8. Following centrifugation, the mixture separates into a lower red phenol-chloroform phase,
interphase and the colourless upper aqueous phase. RNA remains exclusively in the aqueous phase
whereas DNA and proteins are in the interphase and organic phase. The volume of the aqueous
phase is about 60% of the volume of TRI Reagent used for homogenisation.

9. Transfer the aqueous phase to a fresh tube and save the interphase and organic phase at 4°C for
subsequent isolation of proteins.

10. Precipitate RNA from the aqueous phase by adding 0.5ml of isopropanol, mix by vortexing.

11. Store samples at room temperature for 10 minutes and centrifuge at 12,000 g for 8 minutes at 4°C.
The RNA precipitate (often invisible before centrifugation) forms a gel-like or white pellet on the
side and bottom of the tube.

12. Remove the supernatant and add 1 ml of 75% ethanol to the RNA pellet. Wash the pellet by
vortexing and centrifuge at 7,500g for 5 minutes at 4°C.

13. If the RNA pellet accumulates on the side of the tube and has a tendency to float, re-sediment the
pellet at 12,000g.

14. Remove the ethanol wash and briefly air-dry the RNA pellet for 10 minutes. It is important to
remove all of the wash but ensure that you do not completely dry the RNA pellet as this will greatly
decrease its solubility.

15. Dissolve the RNA pellet in 50 µl of RNase free water. Keep on ice.
47 TOC
C. Quantification of RNA

(The instructions below are for using the nanodrop spectrophotometer – an alternative technique
is to use a conventional UV spectrophotometer, which works by the same principle but uses a larger
volume)

1. You will use the nanodrop spectrophotometer to determine the yield and purity of the RNA. This
work must be undertaken only with a demonstrator present.

2. Take your RNA sample on ice to the nanodrop – in the rear prep-room

3. Ensure that the nanodrop has been previously blanked using deionised water

4. Lift the pedestal and add 1µl of your RNA sample directly to the centre. You should be able to see a
tiny hole, which your droplet should cover.

5. Record the concentration of your RNA in ng/ µl. Also record the 260/280 ratio.

6. For RNA, the peak should be at 260 nm, and as a general rule, the 260/280 ratio should be
between 1.8 and 2.0.

7. Calculate the volume of your RNA solution you will require for running on the denaturing gel.
Remove an appropriate aliquot for the formaldehyde gel (remember to still keep your purified
RNA free from RNase contamination and on ice) and place the remainder at -20°C in the rack
provided.

D. Purification of Protein

1. Take your tube containing the red phenol-chloroform phase from the initial RNA extraction.
Remove any remaining aqueous phase overlying the interphase. Precipitate DNA from the
interphase and organic phase with ethanol. Add 0.3 ml of 100% ethanol and mix samples by
inversion. Next, store the samples at room temperature for 2-3 minutes and sediment DNA by
centrifugation at 2,000 g for 5 minutes at 4°C.

2. Aliquot a 0.3 ml portion of the phenol-ethanol supernatant into a microfuge tube. Precipitate
proteins by adding 3 volumes of acetone. Mix by inversion for 10-15 sec to obtain a homogeneous
solution. For most you this will be 3 x 0.3 ml (0.9 ml) but adjust if your volume is different

3. Store samples for 10 min at room temperature and sediment the protein precipitate at 12,000 g
for 10 min at 4°C.

4. Decant the phenol-ethanol supernatant and disperse the protein pellet in 0.5 ml of 0.3 M
guanidine hydrochloride in 95% ethanol + 2.5 % glycerol (v/v). Disperse the pellet using a pipet
tip.

5. After dispersing the pellet, add another 0.5 ml aliquot of the guanidine hydrochloride/ethanol/
glycerol wash solution to the sample and store for 10 min at room temperature. Sediment the
protein at 8,000 g for 5 min.

48 TOC
6. Decant the wash solution and perform two more washes in 1 ml each of the guanidine/ethanol/
glycerol wash solution. Disperse the pellet by vortexing after each wash to efficiently remove
residual phenol.

7. Perform the final wash in 1 ml of ethanol containing 2.5 % glycerol (v/v). At the end of the 10 min
ethanol wash sediment the protein at 8,000 g for 5 minutes. Decant the alcohol, invert the tube and
dry the pellet for 7-10 min at room temperature.

8. Add 0.1 ml of solubilisation solution (1%(w/v) SDS). Gently disperse and solubilise the pellet for
15 minutes by “flicking” the tube or pipetting up and down as required. It is normal to find that
some of the protein does not go back into solution.

9. Transfer the solubilised protein to a new, labelled tube and store the solubilised proteins in the
rack provided. They will be transferred to -20°C for you.

E. Gel Preparation

1 gel can be shared between 4 pairs of students.

1. Tape the ends of a gel mold and make sure some of the tape wraps around the bottom of the mold
by 1-2 mm. Ask a demonstrator for help

2. Add 0.5 g of agarose to 45 ml of deionised H2O in a conical flask. Dissolve the agarose in the
microwave – place on high for 40 seconds.

3. Keep an eye on your solution to avoid over-boiling. Stop the microwave immediately if your
solution froths or boils vigorously.

4. Visually check to see that all the agarose has melted. Unmelted agarose looks like tiny refractive
lenses floating around. If not completely melted, nuke it a little longer. Try 20 seconds.

5. Allow the gel to cool to approximately 60⁰C (where you can just stand to hold it with gloved hands)
you may hasten this by running cold water over it but do NOT let it cool too much.

6. Add 5 ml of 10 X Gel Buffer Solution (Do not confuse this with the gel running buffer). Mix well by
swirling

7. Cast the gel by pouring the gel solution into the mold and add the comb. Avoid introducing air
bubbles to the gel.

8. Allow the gel to set for at least 40 minutes at room temperature, (it turns slightly opaque). While
the gel is setting you can begin to prepare your samples.

9. Once set, remove the tape and place the gel into the gel tank. Cover the gel with the 1 x Gel Running
Buffer until the level of the buffer is 2-3 mm above the gel. You can now remove the comb.

49 TOC
F. RNA Sample Preparation and Gel Running

1. In a new microfuge tube, prepare 8 µg of RNA in 10 µl of MilliQ water. If you have too low a
concentration of RNA use the maximum volume of your RNA solution.

2. Add 10 µl of 2x RNA loading buffer (it already contains a fluorescent intercalating dye) and mix
well. Collect the solution at the bottom of the tube with a brief spin.

3. Denature the RNA samples by heating to 65°C for 10 minutes on a heating block then place on ice.

4. Load 10 µl of your sample (4 µg of RNA) to a well of the gel. Ensure that you record the gel number
and the lane where you have loaded your sample. A demonstrator will apply a positive control to
one empty lane for you.

5. Electrophorese the gel at a 120 V.

6. Run the gel until the bromophenol blue has run approximately halfway.

G. Photographing Gels

1. Ensure that you switch off the power supply.

2. With a demonstrator carefully carry your gel to the gel doc station to view it using the UV-
transilluminator and photograph the gel.

H. cDNA 1st strand synthesis

1. Thaw the template RNA, 5x RT buffer, dNTPs and Oligo(dT) primer on ice. Mix thei ndividual
solutions to assure homogeneity and centrifuge briefly before pipetting.

2. Combine the following in a 1.5ml microfuge tube

Component Volume
RNA (1µg) X µl
Oligo(dT) primer 1 µl
Nuclease-Free Water X µl
Final Volume 5 µl

3. Close your RNA tube tightly and incubate at 65°C for 5 minutes to pre-denature the RNA.

4. Centrifuge briefly (10 seconds) to collect the contents to the bottom of the tube and store on ice
until it is added to the reverse transcription mix.

50 TOC
5. Combine the following components in a 0.2 ml reaction (PCR) tube:

Component Volume
5X Reaction Buffer 4 µl
MgCl2 1.5 µl
dNTPs 1 µl
Nuclease-Free Water 7 µl
Reverse Transcriptase 1 µl
RNAse Inhibitor 0.5 µl
Final Volume 15 µl

6. Add the 5 µl of the RNA and primer mix to the 15 µl of reverse transcription mix in the 0.2 ml
reaction (PCR) tube

7. Mix gently and centrifuge briefly to collect the reaction mix to the bottom of the tube if needed.

8. Label the tube clearly with your initals and place on the thermocycler.

9. The thermocycler is programmed to Anneal (25°C for 5 minutes), Extend (42°C for 60 minutes)
and Inactivate the reverse transcriptase (70°C for 15 minutes).

10. The reactions will be collected and stored at -20°C for you.

51 TOC
Practical 5. Gene Expression II
A. PCR amplification of target genes

1. Prepare a serial dilution of your cDNA using sterile water so you have tubes containing a 1/10,
1/100, 1/1000, 1/10,000 dilution. A minimum amount for each dilution would be 2 µl of cDNA
solution and 18 µl of water. Remember to mix between each serial dilution. If you are unsure how
to do a serial dilution – check with a demonstrater.

2. Each pair will set up 7 reactions – one for each of your cDNA dilutions and also one negative
control containing sterile water instead of cDNA.

3. You will analyse your PCRs on a gel with another pair. Find your pair now and have one pair
choose GAPDH primers and the other use Actin primers for their reactions. This means you will
have a “complete experiment” on each gel. Record which set of primers you are using.

4. Label 7 PCR tubes with your initials and number them to identify them later (write only on the
tops of the lids, not the sides). Note that these PCR tubes are not the same as microfuge tubes –
they’re much smaller, and thin-walled so relatively fragile and easily cracked.

5. Assemble your PCR reactions. Wear gloves and work systematically. We will be using MangoMix™
which as stated by the manufacturer “is a convenient, ready-to-go, 2x Reaction Mix containing
MangoTaq™ DNA Polymerase, MgCl2 and ultra-pure dNTPs manufactured by Bioline. The Mix is
optimized and ready-to-use and requires only the addition of water, template and primers.”

Reagent Final conc in Volume of each

reaction reagent to be
added (µl)

cDNA template -
dilution
2

2x MangoMix 1x
Primer 1 5µM 0.5 µM
each

Primer 2 5µM 0.5 µM

each

milliQ water -
Total reaction volume
50

52 TOC
6. Place your PCR tubes in the PCR machines as instructed. Record the positions of your samples on
the template provided next to the machine so you can retrieve your samples readily at the end of
the run.

7. The PCR machine will be programmed and set to run for 40 cycles by demonstrators, as follows:

initial for 40 cycles final

extension
95°C 95°C 56°C 72°C 72°C 4°C
5 min 30 sec 30 sec 40 sec 5min hold

Gene Primer 1 Forward (5’-3’) Primer 2 Reverse (5’-3’)

GAPDH ctttggtatcgtggaaggact gtctacatggcaactgtgagga

Actin ctgtctggcggcaccaccat gcaactaagtcatagtccgc

B. Agarose electrophoresis of PCR products

(Do this in groups of four – two pairs)

You will prepare a 1% agarose gel in 1X TBE (remember that a 1% w/v gel is 1 g agarose in 100
ml buffer). However, our gel molds only hold a volume of 60 ml. Please look at the following video
providing instruction on how to pour and run an agarose gel if you are unsure: https://www.youtube.
com/watch?v=59aIHlUoNQs.

1. Tape the ends of a gel mold and make sure some of the tape wraps around the bottom of the mold
by 1 - 2 mm. Ask a demonstrator for help.

2. Weigh out an appropriate amount of agarose to make 60 ml of the gel mixture in a 250 ml flask,
add 60 ml of 1 X TBE, cover it with Saran, and microwave for 1 minute and 20 seconds on high
power (a good starting time). Keep an eye on your solution to avoid over-boiling. Stop the
microwave immediately if your solution froths or boils vigorously.

3. Visually check to see that all the agarose has melted. Unmelted agarose looks like tiny refractive
lenses floating around. If not completely melted, nuke it a little longer. Try 20 seconds.

4. Allow the gel to cool to approximately 60⁰C (where you can just stand to hold it with gloved hands)
you may hasten this by running cold water over it but do NOT let it cool too much. Don’t be startled
(and drop the flask) by the popping sound of the cling film as the flask cools.

53 TOC
5. Add 6 µl of SYBR-safe to the 60 ml of molten gel. Then pour the gel into the mold and add two
8-well combs – one at the front and one halfway. Avoid introducing air bubbles to the gel.

SYBR-SAFE IS AN INTERCALATING DYE AND IS A POTENTIAL MUTAGEN. EXERCISE CAUTION WHILE

USING IT. WEAR GLOVES, DISPOSE OF STAIN IN THE APPROPRIATE CONTAINERS AND CLEAN UP
ANY SPILLS IMMEDIATELY

6. Allow the gel to set (it turns slightly white). The gel is ready to run, as soon as you pull off the tape,
remove the comb, and submerge it in 1X TBE. Unless you are told otherwise, our gel boxes hold
450 ml of buffer. USE GLOVES.

C. Protein Assay

1. Read through points 2-11. By now you should be an expert at performing this protein assay! It
is okay for up to three pairs to use the same standard curve. Draw up a protocol for determining
the protein concentration of your samples and ask a demonstrator to check it before you begin.
We will use the Bio-Rad DC Protein Assay which is based on the Lowry assay and is specifically
formulated to work in the presence of detergents.

2. Using the 5 mg/ml stock solution of bovine serum albumin (BSA), prepare a series of 5 standards
ranging from 0 to 1.5 mg/ml BSA. These will provide your standard curve for determining protein
concentration.

3. Collect a 96-well plate. Each of these wells can hold a maximum of 300 µl. Note how the wells are
arranged in a grid and each row has a letter and each column a number giving each well a unique
coordinate. Place the plate on a piece of absorbent towel on your bench with A1 in the top left
hand corner.

4. Prepare your standard curve by adding 5 µl of each standard to a well. Do this in duplicate.

5. Below your standard curve add 5 µl of each sample to a well. Do this in duplicate.

6. Add 25 µl of reagent A to each well with standard or sample.

7. Add 200 µl of reagent B to each well with standard or sample. Mix the contents of each well by
pipetting up and down. Do this gently to avoid spilling any of the well contents or forming any
bubbles. Use a fresh tip for each well.

8. If there are any bubbles they will affect the absorbance. They can be popped by touching them
with a clean, dry pipette tip.

9. Leave for 15 minutes and observe the colour development. You should see a blue colour develop
(absorbance max at 750 nm). Are your samples within the range of your standard curve? That
is, are any of them a darker blue than the highest BSA standard? If so, you will need to prepare
another well with a dilution of that sample to get it within range of the standard curve.

10. A demonstrator will take you to the plate reader to read your plate.

11. Graph the standard curve (remember to minus off your blank reading) and use the curve to
determine the concentration of your samples.

54 TOC
D. Sample Preparation and SDS-PAGE

1. You will be provided with 10 % (w/v) SDS-PAGE gels ready for use. This will be sufficient for 2
pairs of students.

2. You will need to load at least 10 µg per lane. More (up to 30 µg) is better but make sure that you
have the same amount of protein per lane for the experiment. You will be able to load in total
about 15 µl. Again ensure that you have a complete experiment per gel.

3. Close the microfuge lid and place a coloured lid clamp over the tube then place samples in a
heating block at 80⁰C for 10 min.

4. After allowing the samples to cool a little, centrifuge them for 1 min. This sediments any insoluble
material which may be present. This insoluble material can clog the gel loading tip used to apply
your samples to the gel, and it can distort the protein bands on the gel.

5. Load the samples across adjacent wells on one of the 10 % SDS-PAGE gels provided. You should
apply 15 µl of the sample. Before you apply your samples, take careful note of the lanes you use
and complete the sample description sheet accompanying the electrophoresis apparatus on the
side bench.

6. Demonstrators will apply a 5 µl aliquot of pre-stained protein molecular weight markers,

containing about 3 µg of each protein to help you determine the size of the protein bands on the
NCF after probing next week.

7. Under demonstrator supervision, connect the power leads and check the polarity before turning
on the power. Electrophorese the samples through the stacking gel at 100 V, then through the
separating gel at 120 - 150 V until the bromophenol blue dye front is about 1 cm from the bottom
of the gel. This will take about 75 min.

8. Under demonstrator supervision, turn off the power and disconnect the leads from the power
supply before removing the lid from the apparatus.

9. Carefully remove the gel from the plate sandwich as demonstrated and place it on a glass plate
saturated with Western transfer buffer. Remove the entire stacking gel, then cut away a
small part of the lower left corner of the separating gel (about 5 mm from each edge) so its
orientation is known later.

10. Immediately transfer the gel to the Western transfer apparatus as described below.

55 TOC
E. Western Transfer
WARNING:
The transfer buffer contains methanol which is toxic and flammable.
Wear gloves for all steps of the Western transfer procedure.
The NCF is fragile. Handle it gently with forceps and by the edges only.
Do not touch the NCF with your fingers or scuff its surface.

The following Western transfer procedure will be demonstrated to the class once all SDS-PAGE gels
are running.

You should begin setting up your own gel/NCF sandwich as soon as your own gel becomes available.
To save time and to avoid congestion around the Western transfer apparatus, the 3 pairs of students
associated with each gel should set up their gel/NCF sandwich on a glass plate at their own benches as
described below. A kit containing all required materials will be provided for each gel.

To stop the gel from drying out and to reduce the risk of trapping air bubbles between the various
layers, keep all blotters, the NCF and the SDS-PAGE gel saturated with transfer buffer at all times.
Excess fluid can be removed later.

1. Equilibrate the gel in Towbin transfer buffer (25 mM Tris, 192 mM glycine pH 8.3, 20% MeOH) for
10 min

2. Add about 20 ml of transfer buffer to a square lunch box, then soak two pieces of extra-thick (2.4
mm) filter paper in transfer buffer. Six pieces of thick (0.8 mm) filter paper can be used if extra-
thick paper is not available.

3. While the gel is equilibrating, prepare a transfer membrane. Cut away a small part of one corner
of the NCF (about 5 mm along each edge). This will be aligned later with the lower left corner of
the SDS-PAGE gel (which should also have its corner cut off), so the orientation of the NCF will be
known. Then carefully add the NCF to the transfer buffer and allow it to soak for a few minutes.

4. Assemble the transfer sandwich on the glass plate by placing one piece of wet extra-thick or 3
pieces of thick filter paper on the bottom, then the membrane, the gel, and finally, the remainder of
the wet filter paper on top. Use the blot roller to remove air from between the assembled layers.

5. Once the stacks are positioned in the cassette base, place the cassette lid on the base. The lid is
reversible, but ensure that the electrical contacts fit closely into the slots in the base. Press the lid
down firmly and turn the dial clockwise to engage the lid pins into the locking slots.

6. Slide the cassette (with the dial facing up) into the bay until it makes contact with the magnetic
interlock and you hear a click. Cassettes can be inserted into the bays in any order, with or without
power to the system.

7. The demonstrator will initiate the run which should take about 10 minutes.

8. When the transfer finishes - in a suitable work area, peel away and discard the upper blotters to
expose the gel on the NCF. Using a ball-point pen (not a pencil or other type of marker), gently
mark the borders of the gel and the position of its lower left corner on the NCF.

9. Very carefully peel the gel away from the NCF and place it in a square plastic lunch box containing
some transfer buffer to keep it moist. Do not discard the gel at this stage in case the transfer of

56 TOC
 proteins from it has failed and has to be repeated.

10. Check that the pre-stained MW markers have transferred correctly. If necessary, mark their
positions clearly with a ball-point pen.

11. Avoid damaging the filter by supporting it on a glass plate or on filter paper while you do this.
Using a ball-point pen:

• Label the number of each lane across the top of the NCF.

• Write your initials at the top of your portion of the NCF.

12. With the NCF still supported on a glass plate or filter paper, use a scalpel blade to slice the NCF
into 2 sections (one for each pair of students). Try to use a single, continuous straight cut – jagged
edges and nicks make the NCF very prone to tearing during the subsequent probing steps.

13. Transfer your portion of the NCF to a small rectangular plastic lunch box labelled with your names
and prac group (write on the adhesive tape provided, not directly on the box).

14. Rinse your piece of the filter briefly 2 or 3 times with about 10 ml of PBS.

15. Dry the filter by placing it on a sheet of tissue paper (do not “wipe” it dry - this may damage its
surface and scuff marks can show up as false positive staining later). Dry the inside of the lunch
box before returning the NCF to it.

16. Place your lunch box on the tray provided in the 4°C cold-room. It will be stored there until the
probing phase next week.

F. Loading and running the agarose gel.

1. At the end of the PCR run, collect your PCR samples.

2. If required, briefly centrifuge your samples to bring the fluid to the base of the tube.

3. Load 20 µl of each sample into individual wells on one of the agarose gels provided. The MangoMix
already contains a loading dye.

4. Demonstrators will load DNA size markers to selected lane(s) on each gel. These will enable you
to estimate the size of your PCR product later.

5. Demonstrators will run the gels for approximately 30 minutes at 100 volts.

6. The gels will then be viewed on the gel documentation system under UV light to visualize the DNA
bands and photographed.

57 TOC
G. Analysing Gels Using ImageJ

1. You will be provided with digital photographs of your gels on the LMS. They will be either TIFF or
JPEG files.

2. You can open these with a program called ImageJ. This useful freeware from NIH is installed on all
the terminals in the LIMS computer lab however you can also download it from:

http://imagej.nih.gov/ij/

3. From the ImageJ file menu open your gel picture. You may need to rotate your image in another
program first if the bands are not level. Since the bands are light on a dark background you will
also need to invert the image. Choose invert from the Edit menu in ImageJ.

4. Now select the rectangle tool and draw a rectangle around the band but include some of the gel
both above and below the band.

5. Once you have done that press Ctrl 1 or (Analyze>Gels> Select First Lane) to select this as the first
lane.

6. You can now move the box onto a second band press Ctrl 2 or (Analyze>Gels> Select Second Lane).
Repeat this step for as many bands that you need to analyse.

7. Now press press Ctrl 3 or (Analyze>Gels> Plot Lanes).

8. A new window will open containing a plot profile of each band. You should see that the height of
the peak correlates with the intensity of the band. In fact, the area under these peaks represents
the density of the band.

9. Use the line tool to close off each peak by drawing a line connecting either end of the base of the
curve. Ensure that each peak is completely closed off

10. Now you can select the magic wand tool and click inside each of the peaks in turn. This will give
you a measure of the area under each peak.

11. You can copy these numbers into another program or spreadsheet like Excel and plot them against
the dilution of cDNA that you used. What do you notice? Is there a correlation between dilution
and band intensity? What is the relationship? Do you think this PCR reaction has plateaued at the
low dilutions?

58 TOC
Practical 6. Gene Expression III

A. Setting up PCR reactions

1. You will prepare four PCR reactions this week that you will each run at different cycle times.
Choose one of your cDNA dilutions, which has not reached the “plateau stage”. You will need to
refer to your ImageJ data.

2. Label 4 PCR tubes with your initials and number them to identify them later (write only on the
tops of the lids, not the sides).

3. This time to ensure the PCRs are as similar as possible you will prepare a master mix. The master
mix will contain enough for five reactions but by preparing a bit more than you need prevents the
final PCR tube from having less then the others. Ensure you use the same primers as last time.
Make this up in a 1.5 ml microfuge tube and mix well by gentle inversion. Wear gloves and work
systematically.

Reagent Final conc in Volume of

reaction each reagent
to be added
(µl)

cDNA template -
dilution 10

2x MangoMix 1x
Primer 1 5µM 0.5 µM
each

Primer 2 5µM 0.5 µM

each

milliQ water -
Total reaction
volume 250

4. Aliquot 50 µl of the master mix into each of the four PCR tubes.

5. Place one tube into each of the 4 thermocyclers set up for 28, 29, 30 and 31 cycles. Record the positions
of your samples on the template provided next to the machine so you can retrieve your samples readily
at the end of the run

59 TOC
B. Agarose electrophoresis of PCR products
(Do this in groups of four – two pairs)

You will prepare gels that have been made in “1x” TBE buffer and our stock solution of TBE is “5X”.
You will prepare a 1% agarose gel in 1X TBE (remember that a 1% w/v gel is 1 g agarose in 100
ml buffer). However, our gel molds only hold a volume of 60 ml. Please look at the following video
providing instruction on how to pour and run an agarose gel if you are unsure: https://www.youtube.
com/watch?v=59aIHlUoNQs.

1. Tape the ends of a gel mold and make sure some of the tape wraps around the bottom of the mold
by 1 - 2 mm. Ask a demonstrator for help.

2. Weigh out an appropriate amount of agarose to make 60 ml of the gel mixture in a 250 ml flask,
add 60 ml of 1 X TBE, cover it with Saran, and microwave for 1 minute and 20 seconds on high
power (a good starting time). Keep an eye on your solution to avoid over-boiling. Stop the
microwave immediately if your solution froths or boils vigorously.

3. Visually check to see that all the agarose has melted. Unmelted agarose looks like tiny refractive
lenses floating around. If not completely melted, nuke it a little longer. Try 20 seconds.

4. Allow the gel to cool to approximately 60⁰C (where you can just stand to hold it with gloved hands)
you may hasten this by running cold water over it but do NOT let it cool too much. Don’t be startled
(and drop the flask) by the popping sound of the saran wrap as the flask cools.

5. Add 6 µl of SYBR-safe to the 60 ml of molten gel. Then pour the gel into the mold and add two
8-well combs – one at the front and one halfway. Avoid introducing air bubbles to the gel.

SYBR-SAFE IS AN INTERCALATING DYE AND IS A POTENTIAL MUTAGEN. EXERCISE CAUTION WHILE

USING IT. WEAR GLOVES, DISPOSE OF WASTE IN THE APPROPRIATE CONTAINERS AND CLEAN UP
ANY SPILLS IMMEDIATELY

6. Allow the gel to set (it turns slightly white). The gel is ready to run, as soon as you pull off the tape,
remove the comb, and submerge it in 1X TBE. Unless you are told otherwise, our gel boxes hold
450 ml of buffer. USE GLOVES

60 TOC
C. Loading and running the gel.

You will run your PCR products on this gel to check their purity and size.

1. At the end of the PCR run, collect your PCR samples.

2. If required, briefly centrifuge your samples to bring the fluid to the base of the tube.

3. Load 20 µl of each sample into individual wells on one of the agarose gels provided. The MangoMix
already contains a loading dye.

4. Demonstrators will load DNA size markers to selected lane(s) on each gel. These will enable you
to estimate the size of your PCR product later.

5. Demonstrators will run the gels for approximately 30 minutes at 100 volts.

D. Western Blotting
The incubation and washing steps described below will be more efficient if the NCF is gently agitated
on the mixing apparatus provided in the lab.

All of the following steps should be performed at room temperature.

Keep the lid on the box containing your NCF tightly sealed during all incubations to reduce the risk of
spillage, contamination and drying out of the NCF if your box is accidentally knocked over.

Blocking

Before probing your NCF with antibody, you must quench excess protein binding sites on its surface.

1. Collect your NCF which has been stored at 4°C since the last session.

2. Add about 10 ml of “Blotto” (defatted milk powder in TBS/T) to the lunch box and leave it on a
rocking shaker for 1 hr.

Probing With Primary Antibody

1. Discard the quenching solution and wash the NCF 3 times in about 10 ml of PBS/T (5 min each
time).

2. Discard the final washing solution and add 3 ml of diluted primary antibody.

3. Incubate the NCF for 1 hr with gentle rocking.

4. Discard the primary antibody and wash the NCF 3 times in about 10 ml of PBS/T (5 min each
time).

61 TOC
Detection of Primary antibody with secondary conjugate

1. Incubate the NCF for 1 hr with 3 ml of the appropriate secondary antibody-enzyme conjugate.

2. Discard the secondary antibody-enzyme conjugate and wash the NCF three times in about 10 ml of
TBS/T (5 min each time).

Developing the Western Blot with an AP-based detection system

1. Remove as much of the rinsing water from the lunch box as possible, taking care not to damage the
NCF.

2. Add 3 ml of NBT/BCIP substrate mixture to the NCF in the box and incubate with gentle mixing.

3. Areas on the NCF containing your protein of interest should appear as blue / purple bands within
a few minutes.

4. Continue incubating the filter in the staining solution until the bands become sufficiently dark to
be photographed. Do not allow the level of background staining to become too high.

5. Once the protein bands are sufficiently intense, rinse the NCF twice with a few ml of distilled
water.

6. After 2 rinses, gently blot the NCF dry on a piece if tissue paper, then let it air-dry for about 10 min.

7. Take your membrane to the gel-doc to record your data.

62 TOC
Student-Led Tutorial Questions

Week 1

Student 1

1. Explain how an automatic pipette (like the one pictured) below works. Briefly explain how to
use it.

2. How can you accurately aliquot a highly viscous solution using an automatic pipette?

3. What does the term “specific gravity” mean? What is the specific gravity of a 50% (v/v)
ethanol (in water) solution?

Student 2

1. What is the difference between accuracy and precision? What is the difference between system
atic and random error?

2. What is the coefficient of variation? Why is it useful in pipette calibration?

3. Why should you always select the SMALLEST size pipet that will handle the volume you
wish to aliquot to achieve the greatest accuracy?

4. Explain how you can “gravimetrically” calibrate a pipette.

63 TOC
Week 2

Student 1

1. Use the Beer-Lambert law to explain how a colorimetric assay works in the
spectrophotometer. In your answer, define the following terms; chromophore, extinction
coefficient, absorbance, transmission and reagent blank.

2. Most of the spectrophotometers in the teaching lab emit light of wavelengths between
400-700nm. However some spectrophotometers also emit light between 200-400nm.
Why is this extended range useful? Provide a specific example.

3. How can you use a spectrophotometer to perform a qualitative analysis of a substance?

Student 2

1. Explain the principle of differential centrifugation and its applications. What is the
difference between differential centrifugation and rate-zonal centrifugation?

2. When we quote centrifugation conditions in a protocol, what information do we

need to provide? Why is it better to quote relative centrifugal force rather than speed
(revolutions per minute) when writing a centrifugation protocol?

3. The two eukaryotic ribosomal subunits are referred to as the 40S and the 60S ribosomal
subunits. Yet the intact ribosome is referred to as the 80S ribosome. Explain why this is
so and explain what the “S” means.

64 TOC
Week 3

Student 1

1. What type of tissue is the “white curd” of cauliflower? Why do we harvest only the outer
2-3mm of this tissue?

2. Explain how we will use centrifugation to isolate mitochondria from this tissue.

3. How will we determine the protein content of our mitochondrial fraction? Briefly explain
the principle behind the assay.

Student 2

1. Explain how succinate dehydrogenase activity is assayed in this practical. In your answer
explain the purpose of:

a) Measuring succinate dehydrogenase activity in the different fractions.

b) The DCPIP standard curve.

c) Not inverting, vortexing or otherwise mixing the tubes once the reaction has started

d) Sodium azide.

e) Tubes 2, 4, 6 and 8 which do not contain DCPIP.

f) The addition of malonate to tubes 7 and 8.

g) Tube 9.

65 TOC
Week 4

Student 1

1. Explain the concept of an organelle marker protein or enzyme.

2. How can a marker enzyme/protein aid in isolating and enriching a preparation for an
organelle?

3. A student prepares mitochondria from a cauliflower which has been stored at 4C for three
weeks and finds the SDH specific activity of their PMS is about the same as their
mitochondrial fraction. The same protocol used on fresh cauliflowers showed a 10-
fold higher specific activity in the mitochondrial fraction compared to the PMS. Can
you think of a plausible explanation?

Student 2

1. Carefully explain how to complete the table below to determine the SDH specific activity in
the post nuclear supernatant using the data supplied. Assume the same volumes were
used as in the practical and tubes 7 and 9 had a negligible change in DCPIP concentration
over 30 minutes.

66 TOC


Week 5

Student 1

1. What are peripheral and integral membrane proteins?

2. How could you experimentally determine whether a protein is either cytosolic, peripheral or
an integral membrane protein?

3. What is CAPS? How does it affect membrane proteins at high pH?

4. What is the purpose of the reagents SDS and dithiothreitol (DTT) in denaturing PAGE?

67 TOC
Student 2

1. On an SDS-PAGE gel what is the relationship between size and relative mobility?

2. Do you think that all of the proteins of the mitochondrial membrane are visible on your
Coomassie-stained SDS-PAGE gel? Can you suggest alternative methods that could be used
to potentially resolve and visualize more proteins?

3. Explain the principle of the hanging drop method of crystallization. Refer to the figure below
and explain the changes to protein concentration during crystallization. What is happening to
the water in the drop during this process?

Week 7

Student 1

1. What is Trizol or Tri-reagent? Explain how RNA is purified by guanidinium thiocyanate-phe

nol-chloroform extraction. Why is pH so critical?

2. What is RNAse? How does RNase complicate the extraction of RNA?

3. What is diethyl pyrocarbonate (DEPC) and how does it work?

Student 2

1. Discuss some other ways to limit RNase activity.

2. How can we determine the concentration and purity of RNA by spectrophotometric analysis?

3. How can we determine the integrity of our purified RNA?

68 TOC
Week 8

Student 1

1. What percentage of total RNA is poly-A-RNA in eukaryotes?

2. In rapidly dividing cells ribosomal RNA accounts for 80% (by weight) of the total RNA. Yet
RNA polymerase II accounts for over 80% of total the transcriptional activity (rNTPS polym
erized per hour) in the cell. How can you account for this?

3. We used trizol to purify RNA in the practical class which employs the guanidinium
thiocyanate-phenol-chloroform method. Another common method to purify nucleic acid is by
the use of silica-membrane filters. How do these work?

Student 2

1. What is cDNA? Why do you need to make cDNA from RNA? (Why can’t we just use RNA
directly for PCR?)

2. How is the first strand cDNA transcribed from RNA?

3. What is an oligo-dT primer and what are Random Hexamers? Discuss why it might be
advantageous in certain circumstances to use either an oligo-dT primer or random hexamers
in cDNA synthesis.

4. Why would you need to optimize the concentration of random hexamers for reverse
transcription but not oligo-dT?

69 TOC
Week 9

Student 1

1. Explain how to cast an agarose gel to analyse your PCR reactions.

2. Briefly describe the factors which you need to take into account when designing PCR primers.

3. What is in MangoMix™? Would you this to amplify a gene for the purpose of cloning and then
expressing a functional gene products? Explain your answer.

Student 2

1. Explain what is happening at the different phases of PCR – denaturing, annealing and extension.

2. Why does the exponential amplification during PCR eventually attenuate and the reaction reach a
plateau phase?

3. You purify plasmid from E.coli and obtain 100µl of DNA at 0.75mg/ml. You want to amplify the
insert contained in the plasmid by PCR. You need to add 50pg of plasmid DNA to your
PCR reaction.

How much of the original solution do you need to add?

Is this practical given the minimum volume you can accurately pipette is 1µl? Draw up a
dilution scheme using 1ml tubes that is.

Your PCR reaction volume is 25µl and we want to keep the template 10% or below the total volume.

70 TOC
Week 10

Student 1

1. What is meant by a “house-keeping” gene? Why is performing PCR on these an important

control in qPCR?

2. Will the relative transcript levels of a gene always be the same as corresponding protein levels?
Discuss why or why not.

3. What is meant by real-time PCR? In your answer, explain the terms cycle threshold and SYBR
green.

Student 2

1. Why are non-specific PCR products a problem for real-time PCR? How can we determine if we
have non-specific PCR products?

2. Explain the statement below:

“If a PCR is 100% efficient, the Ct difference between two successive concentrations in
a 2-fold dilution is 1.”

3. Why is it preferable to do “real-time” PCR to be quantitative rather than determining the

amount of product after a set number of cycles?

71 TOC
Week 11

Student 1

1. Give a general overview of how Western blotting works.

2. Explain the purpose of incubating the nitrocellulose filter (NCF) in 3% (w/v) de-fatted
milk powder in PBS/Tween before applying the primary antibody. Could you use an alter
native to the milk powder?

3. You wish to probe a western blot to detect endogenous Fra-1 in HeLa cell extracts. You
have the following antibodies at your disposal:

goat anti-human-Fos-1

rabbit anti-human-Fra-1

goat anti-human-Fra-1

rabbit anti-mouse-Fra-1

rabbit anti-human IgG – alkaline phosphatase linked

goat anti-rabbit IgG – alkaline phosphatase linked

goat anti-rabbit IgG

Which combination of primary and secondary antibodies would you use and why?

4. Can Western blotting be used as a quantitative technique? How could we use Western
analysis to determine the relative change in a protein’s expression levels between two
treatments? What would we need to be able to determine the absolute level of a protein (i.e.
ng/mg of total protein)?

72 TOC
Student 2

1. What is Digital PCR? Describe the principle behind it.

2. How has microfluidics made Digital PCR accessible for researchers?

3. What advantages does Digital PCR have over real-time PCR?

Back-up Questions if Oversubscribed

Student 1

1. The fusion protein GST-IKKβ Kinase has a theoretical molecular weight of 87kDa but on
SDS-PAGE it has an apparent molecular weight of 120kDa (even after boiling in sample
buffer containing SDS and β-mercaptoethanol). Can you provide a possible reason for this
anomaly? In your answer explain what is meant by “apparent” molecular weight.

2. Explain how blue-native PAGE works?

3. How could we identify a specific mitochondrial complex on a blue-native PAGE gel? You should
be able to come up with two ways.

Student 2

1. What is densitometry? Explain how you can use SDS-PAGE and densitometry to determine the
relative levels of a protein. Further to densitometric analysis - would it be accurate to say that a
two-fold difference in density represents a two-fold difference in protein mass when:

Comparing the same MW band across two lanes?

Comparing two different MW bands in the same lane?

Explain your reasoning.

2. What is two-dimensional gel electrophoresis? Typically what properties of proteins are used to
separate them in this method?

3. In simple terms, describe the principle of protein identification by peptide mass fingerprinting.

73 TOC