Journal of Antimicrobial Chemotherapy (2006) 57, 24–30

doi:10.1093/jac/dki429
Advance Access publication 30 November 2005

CTX-M-15 extended-spectrum b-lactamase from Nigerian

Klebsiella pneumoniae

Olusegun O. Soge1,2, Anne Marie Queenan3, Kayode K. Ojo2, Bolanle A. Adeniyi1 and
Marilyn C. Roberts2*
1
Department of Pharmaceutical Microbiology, University of Ibadan, Ibadan, Nigeria; 2Department of Pathobiology,
School of Public Health and Community Medicine, University of Washington, Seattle, WA 98195, USA;
3

Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021

Johnson & Johnson Pharmaceutical Research and Development, L.L.C., Raritan, NJ, USA

Received 8 August 2005; returned 26 September 2005; revised 28 October 2005; accepted 1 November 2005

Objectives: In this study, extended-spectrum b-lactamases (ESBLs) were characterized from 30 selected
multidrug-resistant Klebsiella pneumoniae strains isolated from patients with community-acquired urinary
tract infections from Southwest Nigeria.
Methods: The b-lactamases were phenotypically characterized using isoelectric focusing, genotypically
characterized using PCR assays and hybridization of the PCR products. Two of the blaCTX-M genes were
completely sequenced. The location of the CTX-M-type genes was determined using transformation,
DNA–DNA hybridization, PCR assays and hybridization of the PCR products from the Escherichia coli
transformants.
Results: All 30 isolates produced at least one b-lactamase. Seventeen of the isolates were resistant to
cefotaxime, and had ‡100-fold reduction in susceptibility with cefotaxime plus clavulanic acid (4 mg/L),
indicating the presence of an ESBL. The 17 isolates were shown to have blaCTX-M genes that were associated
with large plasmids (‡58 kb), which also carried a tetracycline resistance gene, tet(A), and various
aminoglycoside resistance genes. Two CTX-M-type genes were sequenced and had amino acid sequences
indistinguishable from previously sequenced CTX-M-15 b-lactamases. The ISEcp1 element was located
upstream of blaCTX-M-15 in the same position as previously described. In addition, 23 of the isolates produced
TEM b-lactamases, 27 produced SHV b-lactamases and four produced AmpC b-lactamases.
Conclusions: Thirty K. pneumoniae produced multiple b-lactamases, with 57% producing CTX-M enzymes.
This is the first characterization of CTX-M-15-positive K. pneumoniae in Western Africa.

Keywords: K. pneumoniae, ESBLs, CTX-M enzymes

Introduction CTX-M-positive isolates have been associated with nosocomial

infections but have also been reported in clinical isolates from
The extended-spectrum b-lactamases (ESBLs) were first identified community-acquired infections.4 Since the mid-1990s, CTX-M-
shortly after the introduction of the broad-spectrum oxyimino- positive strains have been identified in most parts of the world
cephalosporins.1 While the majority of the ESBLs belong to the including Asia, Europe, North America and South America.3 How-
TEM and SHV families, in the past 10 years, 50 different CTX-M- ever, a much more limited picture of CTX-M-positive strains is
type b-lactamase enzymes have been identified from around the available in Africa. In one report, a CTX-M-12-positive Klebsiella
world.2 These enzymes have higher levels of hydrolytic activity pneumoniae was identified from Kenya,5 and in other reports,
against cefotaxime compared with ceftazidime, but lose activity CTX-M-15-positive Klebsiella spp. and Escherichia coli have
in the presence of b-lactamase inhibitors like clavulanic acid been identified in Cameroon and Tanzania.6,7
and tazobactam.1 The first CTX-M-type b-lactamases were iden- In this study, we characterized the b-lactamases from 30
tified as plasmid-encoded enzymes in clinical isolates from the multidrug-resistant K. pneumoniae strains isolated from patients
Enterobacteriaceae.3 with community-acquired urinary tract infections (UTI) in
.............................................................................................................................................................................................................................................................................................................................................................................................................................

*Corresponding author. Tel: +1-206-543-8001; Fax: +1-206-543-3873; E-mail: marilynr@u.washington.edu

.............................................................................................................................................................................................................................................................................................................................................................................................................................

24

The Author 2005. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oxfordjournals.org
 Cefotaximase enzymes from uropathogenic K. pneumoniae
Southwest Nigeria. All 30 isolates produced at least one b-lacta-
mase and 17 (57%) produced a CTX-M b-lactamase. The CTX-M
genes from two isolates were identified as the CTX-M-15 enzyme.
This is the first characterization of Klebsiella CTX-M enzymes
from West Africa.
Materials and methods
Bacterial isolates
Thirty multidrug-resistant K. pneumoniae were selected from a random
collection of 96 strains from men and women with UTI seen in the
University Teaching Hospitals, Federal Medical Centers and Specialist
Hospitals from six Southwestern States of Nigeria. The 30 isolates
were from unrelated patients and epidemiologically unlinked. The
isolates were chosen to represent the variation in the antibiotic sus-
ceptibility pattern to both b-lactams and other antibiotics found in each
of the six states. The isolates were collected from 2002 to 2003 and
verified as K. pneumoniae using standard biochemical methods.8 All
isolates were collected under approved ethical standards.
Antibiotic susceptibility
The MICs were determined using the agar dilution method according
to the CLSI (formerly known as NCCLS) guidelines.9 Two sets of
cefotaxime plates were made and one set was also supplemented with
4 mg/L of clavulanic acid at each agar dilution. The MIC of pipera-
cillin/tazobactam was determined by Etest following the manufac-
turer’s instructions (AB Biodisk, NA, Inc., USA). The non-b-lactam
resistant susceptibilities were determined by disc diffusion on
Mueller–Hinton agar (Remel, Inc., Lenexa, KS, USA) according to
the CLSI guidelines.10 E. coli ATCC 25922 was used as a control.
ESBL characterization by isoelectric focusing
Isoelectric focusing (IEF) was performed on all isolates using
Ampholine PAGplate 3.5–9.5 IEF gels (GE-Amersham Biosciences).
Gels were loaded with clarified freeze/thaw lysates11 and run at 1000 V
for 90 min. b-Lactamase bands were visualized by overlaying the gel
with 25 g/L of nitrocefin. Bands that hydrolysed cefotaxime were
identified using a bioassay performed by overlaying the IEF gel
with Luria–Bertani agar (Difco Laboratories, Division of Becton
Dickinson & Co., Sparks, MD, USA) with 1 mg/L of cefotaxime
~pI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 CTX
5.4-
6.5-
7.6-
7.8-
9.0-
+ + + − − − + + + + + − + − + + −
Strong hydrolysis of cefotaxime in bioassay
Weak hydrolysis of cefotaxime in bioassay
Figure 1. IEF profiles of Nigerian K. pneumoniae. Kpn1 to Kpn30 and CTX-M control (CTX-M-10 enzyme). +, Positive ESBL test using cefotaxime agar dilution;
–, negative ESBL test using cefotaxime agar dilution.
25
and swabbing with a sensitive indicator organism, E. coli ATCC
25922. Areas of growth over a band indicated cefotaxime hydrolysis.
Cefotaxime hydrolysis in the lysates was confirmed spectrophotomet-
rically.12 The pI standards were b-lactamases; TEM-1, pI 5.4, K1,
pI 6.5, SHV-1 pI 7.6, P99, pI 7.8 and ACT-1 pI 9.0 (Figure 1). The
AmpC enzymes were identified as b-lactamases that were inhibited
when filter paper soaked in 100 mM aztreonam was overlaid on the
IEF gel for 10 min before development with nitrocefin.
Identification of the blaCTX-M genes
All the isolates were used as templates with four PCR assays that
differentiated between CTX-M-1, -2, -8 and -9 groups of enzymes
using primers and methods previously described.13,14 The primers
are listed in Table 1. An E. coli producing a blaCTX-M-10 enzyme
belonging to CTX-M-1 group was used as a positive control. The
PCR products were hybridized with 32P-radiolabelled internal probes
for verification.
Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021
Cloning and sequencing of CTX-M enzymes
The specific PCR products from the CTX-M-1 group PCR assay were
selected from Kpn1 and Kpn19 isolates, cloned into the pCRT7/
NT-TOPO vector (Invitrogen, Carlsbad, CA, USA) and transformed
into E. coli TOP10 according to manufacturer’s instructions. For the
complete gene, the primers used were 2CTX-MIF and 2CTX-MIR
(Table 1) and both cloned and uncloned PCR products were used
for sequencing. Primers for the forward and reverse T7 were used
for sequencing the complete blaCTX-M genes at the University of
Washington, Department of Biochemistry Sequencing Facility. The
nucleotide sequences and resulting amino acid sequences were
compared with sequences from GenBank via the National Center
for Biotechnology Information Internet server.
To verify the sequences, the CTX-M plasmids from Kpn1 and
Kpn19 were digested with PstI enzyme (New England BioLabs,
Ipswich, MA, USA) and the fragment carrying the blaCTX-M gene
identified and cloned into the PstI site within the blaTEM-1 gene of
pACYC177 (New England BioLabs). The transformants were selected
on Luria–Bertani agar (Difco Laboratories) supplemented with
64 mg/L of cefotaxime. The resulting plasmids, pMRC151 and
pMRC152, were shown to carry a blaCTX-M gene by PCR. These
plasmids were used as templates for sequencing using the primers
2CTX-MII (Table 1). The nucleotide sequences were indistinguishable
from sequences obtained from the PCR templates. Linkage of blaCTX-M
− + − − − − + − + − + + + ESBL
 Soge et al.

Table 1. List of oligonucleotide primers used in this study 100 mg/L of ampicillin. Multiple transformants were selected and their
plasmids isolated and visualized on 0.8% agarose gels stained with
ethidium bromide. Transformants that carried a single large plasmid
Primer Sequence 50 –30 Reference
and hybridized with 32P-labelled blaCTX-M probe were selected for
further study as previously described.16,17 The probes used in the
blaCTX-M universal study are listed in Table 1.
CTX-MU1 ATG TGC AGY ACC AGT AAR GT 13
CTX-MU2 TGG GTR AAR TAR GTS ACC AGA 13
blaCTX-M-1 group Genotyping of tetracycline and aminoglycoside resistance
CTX-M1GF CGC TTT GCG ATG TGC AG 14 genes in transformants
CTX-M1GR ACC GCG ATA TCG TTG GT 14 The other antibiotic resistance genes carried by the E. coli trans-
2CTX-MIF ATG GTT AAA AAA TCA CTG CG this study formants were determined using DNA–DNA hybridization with
32
2CTX-MIR TTA CAA ACC GTY GGT GAC G this study P-labelled probes and PCR assays as previously described.16,18
2CTX-MII TGA TAC CAC TTC ACC this study The following genes were screened: tetracycline resistance genes
TCG GGC AAT tet(A) tet(B), tet(C) and tet(D); and aminoglycoside resistance
blaCTX-M-2 group genes aac(3)-II and aac(60 )-Ib. Probes and primers are listed in Table 1.
CTX-M2GF TTA ATG ACT CAG AGC ATT C 14

Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021

CTX-M2GR GAT ACC TCG CTC CAT TTA TTG 14
blaCTX-M-8 group Results
CTX-M8GF TGA ATA CTT CAG CCA CAC G 14
Susceptibilities to b-lactam antibiotics
CTX-M8GR TAG AAT TAA TAA CCG TCG GT 14
blaCTX-M-9 group The MICs of the b-lactam antibiotics are listed in Table 2. Based
CTX-M9GF ATG GTG ACA AAG AGA GTG CA this study on the cefotaxime MICs, the isolates could be divided into two
CTX-M9GR TTA CAG CCC TTC GGC GAT GA this study groups. The first group included 17 isolates that had cefotaxime
ISEcp1 link MICs from 256 to >512 mg/L and the second group of 13 isolates
PROM+ TGC TCT GTG GAT AAC TTG C 15 had cefotaxime MICs of £4 mg/L (Table 2). Within the first group,
preCTX-M-3B CCG TTT CCG CTA TTA CAA AC 15 cefotaxime MICs were reduced ‡100-fold in the presence of
blaSHV 4 mg/L of clavulanic acid, whereas in the second group, cefotaxime
SHV INT ATT TAT CTG CGG GAT ACC CC this study MICs were reduced £10-fold in the presence of 4 mg/L of clavu-
blaTEM lanic acid. In the first group, organisms were uniformly resistant to
TEM INT AGC CCT CCC GTA TCG TAG TT this study seven of the other b-lactam antibiotics tested and variable for
tet(A) cefotetan and imipenem, whereas in the second group, isolates
A1 CGA GCC ATT CGC GAG AGC 16 were susceptible and/or variable for the other b-lactam antibiotics
A2 CGA ABC AAG CAG GAC CAT G 16 tested (Table 2).
A3 GCC TCC TGC GCG ATC TGG 16
aac(3)-II Identification of b-lactamases
AAC 3F CAA TAA CGG AGG CAA TTC G 18
AAC 3R GAT TAT CAT TGT CGA CGG 18 IEF identified multiple b-lactamases with pI values ranging
aac(60 )-Ib between 5.4 and 9 and all isolates producing between one and
AAC (6) ID CAT GAC TGA GCA TGA CCT T 18 five enzymes with different pI values within this range (Table 2
AAC (6) IU GAA GGG TTA GGC ATC ACT 18 and Figure 1). All 17 cefotaxime-resistant isolates expressed a pI 9
b-lactamase that hydrolysed cefotaxime in the bioassay. In addi-
tion, four isolates with identical IEF profiles expressed an AmpC b-
with the mobile insertion sequence ISEcp1 was investigated with pri- lactamase (Figure 1), which was identified because these enzymes
mers PROM+ and PRECTX-M-3B as previously described.15 The were inhibited in the presence of 100 mM of aztreonam (data not
blaCTX-M-15 sequence has been assigned GenBank accession no. shown). To verify the presence of the CTX-M-type enzyme, a PCR
AY995205, and the second blaCTX-M-15 assigned GenBank accession assay using universal CTX-M primers was used and the 17 cefo-
no. AY995206. taxime-resistant isolates gave PCR products of the correct size that
hybridized with an internal probe. In contrast, the cefotaxime-sus-
Detection of the blaTEM and blaSHV genes ceptible isolates were negative in this PCR assay.
The presence of blaTEM-like and blaSHV-like genes was identified The presence of the other SHV-like or TEM-like b-lactamases
using DNA–DNA hybridization of whole plasmid and chromosomal was determined by DNA–DNA hybridization of group-specific
DNA dot blots with the appropriate 32P-labelled probes as previously probes. Twenty-seven (90%) of the isolates were positive for
described.16 The probes were internal primers designed from the cod- the blaSHV-like and 23 (77%) were positive for the blaTEM-like b-
ing sequences of blaTEM and blaSHV genes (Table 1). lactamases (Table 2). All cefotaxime-resistant isolates produced at
least two b-lactamases and included four with blaCTX-M-like, bla-
E. coli transformation TEM-like, blaSHV-like and blaAmpC; 10 with blaCTX-M-like, blaTEM-like
Plasmid DNA was isolated from the K. pneumoniae isolates using the and blaSHV-like; two with blaCTX-M-like and blaTEM-like (these two
alkaline lysis method.17 Transformation of K. pneumoniae plasmids strains, Kpn8 and Kpn10, also produced a pI 6.5 b-lactamase with
was done using the heat shock method into CaCl2-treated competent cefotaxime hydrolysis in the bioassay); and one with blaCTX-M-like
E. coli DH5a cells. Transformants were selected on Luria–Bertani agar and blaSHV-like genes. Among the 13 cefotaxime-susceptible
(Difco Laboratories) supplemented with 20 mg/L of tetracycline and isolates, six were positive for blaTEM-like and blaSHV-like, six

26
 Cefotaximase enzymes from uropathogenic K. pneumoniae

Table 2. Antimicrobial susceptibilities and b-lactamase determinants of K. pneumoniae isolates

bla MIC (mg/L)

CTX-M-1 SHV- TEM-

ID Statea pI group like like AmpC CTX CTX+ AMP CFZ CAZ CRO ATM FEP PIP TZP CTT IPM

1 F 5.4, 7.4, 7.6, 8.5, 9 +b + + + 256 £0.25 >512 >256 64 >256 64 32 >512 8 0.5 0.25
2 A 5.4, 7.4, 7.6, 8.5, 9 + + + + 512 £0.25 >512 >256 64 >256 64 32 >512 8 0.5 0.5
24 C 5.4, 7.4, 7.6, 8.5, 9 + + + + 256 £0.25 >512 >256 32 >256 32 32 >512 4 0.25 2
3 D 5.4, 7.4, 7.6, 9 + + + – 512 £0.25 >512 >256 64 >256 64 64 >512 16 1 0.25
7 E 5.4, 7.4, 7.6, 9 + + + – 512 £0.25 >512 >256 64 >256 32 >64 >512 16 1 0.25
13 C 5.4, 7.4, 7.6, 9 + + + – >512 £0.25 >512 >256 64 >256 64 >64 >512 32 1 0.5
30 A 5.4, 7.4, 7.6, 9 + + + – 512 £0.25 >512 >256 32 >256 32 64 >512 32 0.5 0.5
8 B 5.4, 6.5, 7.4, 7.6, 9 + – + – 512 £0.25 >512 >256 128 >256 128 64 >512 16 2 £0.06
10 C 5.4, 6.5, 7.4, 7.6, 9 + – + – 512 £0.25 >512 >256 128 >256 128 64 >512 32 2 0.25

Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021

11 B 5.4, 7.6, 9 + + + – >512 £0.25 >512 >256 128 >256 128 >64 >512 4 2 £0.06
16 A 5.4, 7.6, 9 + + + – >512 0.5 >512 >256 128 >256 64 >64 >512 8 2 2
15 B 5.4, 7, 7.6, 9 + + + – 512 0.5 >512 >256 64 >256 64 >64 >512 4 1 0.25
28 D 5.4, 7.4, 7.6, 9 + + + – 512 £0.25 >512 >256 32 >256 64 64 >512 32 1 0.125
29 E 5.4, 7.4, 7.6, 8.5, 9 + + + + 512 £0.25 >512 >256 128 >256 64 64 >512 32 0.5 0.5
9 A 7.4, 7.6, 9 + + – – 512 £0.25 >512 >256 32 >256 32 32 >512 16 0.5 0.25
19 B 5.4, 7.4, 7.6, 9 +b + + – 512 £0.25 >512 >256 64 >256 64 32 >512 32 1 1
26 A 5.4, 7.4, 7.6, 9 + + + – 512 £0.25 >512 >256 128 >256 128 >64 >512 16 4 0.25
18 C 7.6 – + – – £4 £0.25 >512 32 £0.5 £0.5 £0.5 £0.5 >512 4 £0.125 0.25
12 F 7.6 – + – – £4 £0.25 >512 8 £0.5 £0.5 £0.5 £0.5 512 4 £0.125 0.25
25 D 7.6 – + – – £4 £0.25 >512 8 £0.5 £0.5 £0.5 £0.5 >512 4 £0.125 1
27 D 7.6 – + – – £4 £0.25 >512 8 32 £0.5 £0.5 £0.5 256 2 1 0.125
14 A 7.6 – + – – £4 £0.25 64 2 £0.5 £0.5 £0.5 2 16 4 £0.125 0.25
21 D 7.6 – + – – £4 £0.25 64 4 £0.5 £0.5 £0.5 £0.5 16 2 £0.125 1
4 F 5.4, 7.6 – + + – £4 £0.25 512 2 £0.5 £0.5 £0.5 £0.5 256 2 £0.125 1
5 B 5.4, 7.6 – + + – £4 £0.25 512 2 £0.5 £0.5 £0.5 £0.5 512 2 £0.125 0.5
17 D 5.4, 7.6 – + + – £4 £0.25 256 2 £0.5 £0.5 £0.5 £0.5 256 2 £0.125 1
20 C 5.4, 7.6 – + + – £4 £0.25 256 4 £0.5 £0.5 £0.5 £0.5 16 1 £0.125 1
22 E 5.4, 7.6 – + + – £4 £0.25 >512 4 £0.5 £0.5 £0.5 £0.5 512 2 £0.125 2
23 F 5.4, 7.6 – + + – £4 £0.25 >512 32 £0.5 £0.5 £0.5 £0.5 >512 4 £0.125 1
6 C 5.4, 7 – – + – £4 £0.25 >512 32 £0.5 £0.5 £0.5 £0.5 512 2 £0.125 0.25

CTX, cefotaxime; CTX+, cefotaxime plus clavulanic acid (4 mg/L); AMP, ampicillin; CFZ, cefazolin; CAZ, ceftazidime; CRO, ceftriaxone; ATM, aztreonam; FEP,
cefepime; PIP, piperacillin; TZP, piperacillin/tazobactam; CTT, cefotetan; IPM, imipenem.
MICs were determined by the agar dilution method (apart from that of TZP, which was determined by Etest).
a
Nigerian States: A, Oyo; B, Osun; C, Ogun; D, Lagos; E, Ekiti; F, Ondo.
b
Completely sequenced and indistinguishable from blaCTX-M-15.

TCATTGCAGCAAAGATGAAATCAATGATTTATCAAAAATGATTGAAAGGTGGTTGTAAATAATGTTACAATGTGTGAGAA
-35 -10

GCAGTCTAAATTCTTCGTGAAATAGTGATTTTTGAAGCTAATAAAAAACACACGTGGAATTTAGGGACTATTCATGTTGT
<----IRR---------->

TGTTATTTCGTATCTTCCAGAATAAGGAATCCCATGGTTAAAAAATCACTGCGCCAGTTCACGCTGATGGCGACGGCAAC
----> blaCTX-M-15

Figure 2. Nucleotide sequence of the 30 end of the ISEcp1 and the start region of pMRC151 and pMRC152 blaCTX-M-15 gene. The promoter sequences are underlined.
IRR is the right inverted repeat. ATG is the start codon for the blaCTX-M-15 gene.
were positive for blaSHV-like and one was positive for blaTEM-like with the internal probe. In contrast, no PCR products were found
genes (Table 2). with the other three PCR assays. This suggested that these isolates
carried blaCTX-M-1-group, which includes blaCTX-M-1, blaCTX-M-3,
Characterization of the CTX-M enzymes blaCTX-M-10, blaCTX-M-12, blaCTX-M-15, blaCTX-M-22, blaCTX-M-23
Four PCR assays specific for blaCTX-M-1, blaCTX-M-2, blaCTX-M-8 or and blaCTX-M-28 enzymes.3
blaCTX-M-9 groups, respectively, were used. For the blaCTX-M-1 To identify which CTX-M gene was present, we completely
group PCR assay, PCR products of the correct size were hybridized sequenced the blaCTX-M-1-group genes from Kpn1 and Kpn19.

27
 Table 3. Transformants compared with their parental K. pneumoniae

Transformants associated
Non-b-lactam Transformants MICs (mg/L)b Non-b-lactam resistance genes
Strain resistance markers Transformants resistance markers
IDa (parental K. pneumoniae) pIs CTX CTX+ CAZ CRO ATM PIP CFZ (transformants) tet(A) aac(3)-II aac(60 )-Ib

1 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 256 £0.25 32 256 64 512 >256 TET, KAN, GEN, TOB + + +
2 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 256 32 512 >256 TET, KAN, GEN, TOB + + +
24 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 256 £0.25 32 256 64 512 >256 TET, KAN, GEN, TOB + + +
3 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 256 32 512 >256 TET, KAN, GEN, TOB + + +
7 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 128 32 512 >256 TET, KAN, GEN, TOB, + + +
CHL
13 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 128 32 512 >256 TET, KAN, GEN, TOB + + +
30 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 128 32 512 >256 TET, KAN, GEN, TOB + + +

28
8 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 256 £0.25 32 256 32 512 >256 TET, KAN, GEN, TOB + + +
10 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 256 £0.25 16 256 16 512 >256 TET, KAN, GEN, TOB + + +
Soge et al.

11 TET, KAN, GEN, CHL, SXT, CIP 5.4, 9 32 £0.25 16 32 16 256 >256 TET, KAN, GEN, CHL + – –
16 TET, KAN, GEN, CHL, SXT, CIP 5.4, 9 64 £0.25 16 32 16 256 >256 TET, KAN, GEN, CHL + – –
15 TET, KAN, GEN, CHL, SXT, CIP 5.4, 9 128 £0.25 16 256 16 512 >256 TET, KAN, GEN, CHL + – –
29 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 256 £0.25 32 256 32 >512 >256 TET, KAN, GEN, TOB + + +
19 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 128 32 512 >256 TET, KAN, GEN, TOB + + +
26 TET, KAN, GEN, TOB, CHL, SXT, CIP 5.4, 7.4, 9 128 £0.25 32 128 32 512 >256 TET, KAN, GEN, TOB + + +

TET, tetracycline; KAN, kanamycin, GEN, gentamicin; TOB, tobramycin; CHL, chloramphenicol; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; CTX, cefotaxime; CTX+, cefotaxime plus clavulanic
acid (4 mg/L); CAZ, ceftazidime; CRO, ceftriaxone; ATM, aztreonam; PIP, piperacillin; CFZ, cefazolin.
Non-b-lactam resistance phenotypes determined by disc diffusion and Vitek.
All transformants positive for blaCTX-M-1 group and blaTEM-like genes.
a
Parental K. pneumoniae ID same as the transformants ID.
b
MICs determined by agar dilutions.

Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021

 Cefotaximase enzymes from uropathogenic K. pneumoniae
Both enzymes were indistinguishable at the nucleotide and amino
acid sequence level from blaCTX-M-15 and are found in GenBank
accession nos AY995205 and AY995206. The –35 and –10
promoter regions necessary for expression of the blaCTX-M-15
was located at the end of the ISEcp1-like element upstream of
its inverted repeat, which was 48 bp from the start codon as pre-
viously described for blaCTX-M-15 from India.19 The 193 bp
upstream and 212 bp downstream in both plasmids pMRC151
and pMRC152 as blaCTX-M-15 genes were indistinguishable from
that previously sequenced from an Indian E. coli (AY458016)
(Figure 2).
Location of the CTX-M enzymes
The blaCTX-M genes are usually located on plasmids and the 30
K. pneumoniae strains carried a variety of plasmids that differed
in size. Among the 17 cefotaxime-resistant isolates, we detected
between one and five plasmids on an agarose gel (data not shown),
with all carrying a large plasmid (‡58 kb). This large plasmid
appeared to carry the blaCTX-M genes and a tet(A) gene, coding
for tetracycline resistance. To verify this, we transformed the K.
pneumoniae plasmid DNA into E. coli and selected for ampicillin
and tetracycline resistance. All transformants carried the ‡58 kb
plasmid; a single isolate per transformation, carrying only one
plasmid, was selected for further studies (Table 3). All were res-
istant to cefotaxime, hybridized with the blaCTX-M-1 group, blaTEM-
like and tet(A) probes, and had reduced MICs in the presence of 4
mg/L of clavulanic acid, suggesting that the transformants carried
at least two b-lactamases. This was confirmed by IEF (Table 3).
Fourteen of the E. coli transformants were also resistant to kana-
mycin, gentamicin and tobramycin and carried aac(3)-II and
aac(60 )-Ib aminoglycoside resistance genes, whereas the three
tobramycin-susceptible transformants did not carry either of
these aminoglycoside genes (Table 3).
Discussion
The CTX-M family of ESBLs has been increasingly detected
worldwide.3 In this study, we characterized 30 K. pneumoniae
isolates from community-acquired UTI patients in Nigeria. The
isolates produced 1–5 b-lactamases, with 17 isolates positive
for the blaCTX-M-1-group gene and 80% producing at least two
b-lactamases. Two blaCTX-M-1-group genes were sequenced and
were identified as blaCTX-M-15. A blaCTX-M-15-positive K. pneumo-
niae was first identified in India in 1999,19 and more recently in
Portugal,20 Korea21 and one isolate each from Cameroon and
Tanzania.6,7 The ISEcp1 element was found to be located upstream
of the 30 end of blaCTX-M-15 in the same position as reported
previously in CTX-M-15-producing isolates from India and
Turkey.19,22
Clinical isolates expressing CTX-M b-lactamases often display
much higher resistance to cefotaxime versus ceftazidime. In this
collection of isolates, all of the cefotaxime-resistant K. pneumoniae
and their E. coli transformants were also resistant to ceftazidime.
CTX-M-15 belongs to a small group of the CTX-M b-lactamases
with measurable ceftazidime hydrolysis that results in higher
ceftazidime MIC values.15 The blaCTX-M genes were associated
with large plasmids that also carried the tet(A) gene. In addition,
fourteen plasmids carried previously characterized aminoglycoside
resistance genes, aac(3)-II and aac(60 )-Ib, whereas three plasmids
carried other aminoglycoside resistance genes. However, some of
29
the antibiotic resistance genes usually associated with mobile ele-
ments were not associated with these K. pneumoniae plasmids.
These results are similar to reports from other studies.18,23 The
multiple antibiotic resistance genes on these plasmids may
allow the maintenance and spread of CTX-M b-lactamases in
pathogen bacterial populations, even if patients are not treated
with extended-spectrum cephalosporins, especially in Nigeria
and other developing countries where antibiotics are unregulated.24
From the study of these 30 K. pneumoniae clinical isolates it
is clear that the CTX-M b-lactamases are expanding throughout
Africa. To define the extent of this spread, the characterization of
antibiotic-resistant bacteria needs to be done in each geographical
area, especially in areas where resources are limited and antibiotics
can be obtained without prescriptions.
Acknowledgements
Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021
Prof. H. A. Odelola was part of this work until his death. We thank
Rafael Cantón for the E. coli/CTX-M-10 strain, Ellyn Wira for
preliminary VITEK MICs and Karen Bush for helpful suggestions.
Some of the data in this study were presented at the 105th Annual
General Meeting of the American Society for Microbiology,
Atlanta, GA, 2005.
Transparency declarations
None to declare.
References
1. Bradford PA. Extended-spectrum b-lactamases in the 21st century:
characterization, epidemiology, and detection of this important resistance
threat. Clin Microbiol Rev 2001; 14: 933–51.
2. Jacoby GA, Bush K. Amino acid sequences for TEM, SHV and OXA
extended-spectrum and inhibitor resistant b-lactamases. http://www.
lahey.org.studies/webt.htm (27 September 2005, date last accessed).
3. Bonnet R. Growing group of extended-spectrum b-lactamases: the
CTX-M enzymes. Antimicrob Agents Chemother 2004; 48: 1–14.
4. Woodford N, Ward ME, Kaufmann ME et al. Community and hospital
spread of Escherichia coli producing CTX-M extended-spectrum
b-lactamases in the UK. J Antimicrob Chemother 2004; 54: 735–43.
5. Kariuki S, Corkill JE, Revathi G et al. Molecular characterization
of a novel plasmid-encoded cefotaximase (CTX-M-12) found in clinical
Klebsiella pneumoniae isolates from Kenya. Antimicrob Agents
Chemother 2001; 45: 2141–3.
6. Gangoue-Pieboji J, Miriagou V, Vourli S et al. Emergence of CTX-
M-15-producing enterobacteria in Cameroon and characterization of a
blaCTX-M-15-carrying element. Antimicrob Agents Chemother 2005;
49: 441–3.
7. Blomberg B, Jureen R, Manji KP et al. High rate of fatal cases of
pediatric septicemia caused by gram-negative bacteria with extended-
spectrum b-lactamases in Dar es Salaam, Tanzania. J Clin Microbiol
2005; 43: 745–9.
8. Murray PR, Baron EJ, Jorgensen JH et al. Manual of Clinical
Microbiology. Washington, DC: ASM Press, 2003.
9. National Committee for Clinical Laboratory Standards. Methods for
Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow
Aerobically—Sixth Edition: Approved Standard M7-A6. NCCLS,
Wayne, PA, USA, 2003.
10. National Committee for Clinical Laboratory Standards. Performance
Standards for Antimicrobial Disk Susceptibility Tests—Eighth Edition:
Approved Standard M2-A8. NCCLS, Wayne, PA, USA, 2003.
 Soge et al.
11. Bush K, Singer SB. Effective cooling allows sonication to be used for
liberation of b-lactamases from gram negative bacteria. J Antimicrob
Chemother 1989; 24: 82–4.
12. Sykes RB, Bonner DP, Bush K et al. Azthreonam (SQ 26,776), a
synthetic monobactam specifically active against aerobic gram-negative
bacteria. Antimicrob Agents Chemother 1982; 21: 85–92.
13. Pagani L, Dell’Amico E, Migliavacca R et al. Multiple CTX-M-type
extended-spectrum b-lactamases in nosocomial isolates of
Enterobacteriaceae from a hospital in northern Italy. J Clin Microbiol
2003; 41: 4264–9.
14. Villegas MV, Correa A, Perez F et al. CTX-M-12 b-lactamase in a
Klebsiella pneumoniae clinical isolate in Colombia. Antimicrob Agents
Chemother 2004; 48: 629–31.
15. Poirel L, Gniadkowski M, Nordmann P. Biochemical analysis of
the ceftazidime-hydrolysing extended-spectrum b-lactamase CTX-M-15
and of its structurally related b-lactamase CTX-M-3. J Antimicrob
Chemother 2002; 50:1031–4.
16. Miranda CD, Kehrenberg C, Ulep C et al. Diversity of tetracycline
resistance genes in bacteria from Chilean salmon farms. Antimicrob
Agents Chemother 2003; 47: 883–8.
17. Sambrook J, Russel DW. Extraction and purification of plasmid;
screening of bacterial colonies by hybridization. In: Molecular Cloning:
A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press,
2001; 1.31–8, 1.126–32.
30
18. Leflon-Guibout V, Jurand C, Bonacorsi S et al. Emergence and
spread of three clonally related virulent isolates of CTX-M-15-producing
Escherichia coli with variable resistance to aminoglycosides and
tetracycline in a French geriatric hospital. Antimicrob Agents Chemother
2004; 48: 3736–42.
19. Karim A, Poirel L, Nagarajan S et al. Plasmid-mediated extended-
spectrum b-lactamase (CTX-M-3 like) from India and gene association
with insertion sequence ISEcp1. FEMS Microbiol Lett 2001; 201: 237–41.
20. Conceicao T, Brizio A, Duarte A et al. First description of CTX-M-
15-producing Klebsiella pneumoniae in Portugal. Antimicrob Agents
Chemother 2005; 49: 477–8.
21. Kim J, Lim YM, Jeong YS et al. Occurrence of CTX-M-3, CTX-M-15,
CTX-M-14, and CTX-M-9 extended-spectrum b-lactamases in Enterobac-
teriaceae clinical isolates in Korea. Antimicrob Agents Chemother
2005; 49: 1572–5.
22. Lartigue MF, Poirel L, Heritier C et al. First description of CTX-M-15-
producing Klebsiella pneumoniae in Turkey. J Antimicrob Chemother
2003; 52: 315–6.
Downloaded from https://academic.oup.com/jac/article/57/1/24/915126 by guest on 30 January 2021
23. Eckert C, Gautier V, Saladin-Allard M et al. Dissemination of CTX-M-
type b-lactamases among clinical isolates of Enterobacteriaceae in Paris,
France. Antimicrob Agents Chemother 2004; 48:1249–55.
24. Okeke IN, Lamikanra A, Edelman R. Socioeconomic and behavioral
factors leading to acquired bacterial resistance to antibiotics in developing
countries. Emerg Infect Dis 1999; 5:18–27.