rN ,I:BE NA%.

E oF t t LlJ{
1!{E AEr'tEErCErfI .ANA Eq,CrcUL
'105t
 EtrFECT OF EXOGENOUS APPLICATION OF ASCORSIC
ACID ON WHEAT (rutc un oestlvumL.) UNDER DROUGHT
STRESS AND QTL MAPPINC NOR DROUGIIT TOLERANCE

Ay

SrErira Trnwir
MS.loLly

A fto.L mbDittd b P.ritd flrf|h.trl ot the 4quircd.bl. lor tn€ d'gM

Botaly

Ilepartmcnt ofBotrny
Frculty of Scierc€s
UniveNity of Agriculturg Fafudabad
20tl
 I,TCI.IIRATTON

I hstby d.ch! tu tt co'tb! db E dd B&.a of .8rdt Tdftri. of

,srtb -id d viaai (?}.,,&rin usrt!$t L) udd &ough dlts od QIL E4pirg for
dtngh Llaocd & F!e.r d ny flr lt .d dd D Ft h3 t .a oopbd aE .nv
F|bltlh.d stc. (.nc?a t !e@.t, drdrd @i.d c gdi:
md.l*qrdu^t@tb!.otoodt do} I ffi..d.d& t .6b 'md.b, .o slDio.d
'btt
ft. .nd of q .r&. @d4*54. It oivat, ry & .din if ri. bftlndio
loovid.d n buld iecuti. 3t dY liaga

R.gd. No. 2005{$E0

 . t.
" lll
n lltt'
oE{f. \-.1
Facully ol sclenc*.
Uri!. eilY ol Agricultu6
The Connollcr ol Exa&in tions. F.:::;,,1.
Univenity of Agriculturc Faisakbad.

Wq the supervisory conmitt ! c€rdry rhrt uc c,ontlnts and form of

thesis submitt€-d by Samina Tanwir, have been fourd s.tisfaclory and
re.ommeod that it be proc€ss€d for evaluarion by th€ Extemal Examine s)
for thc aw,rd ofrhe degr€c.

SUPf, RI'ISORY COMMTTTEE

Chairman
_#s-_
Co-Chairman
(D!. M€nbootsq.Rrb;r)

Menbcr
(Di MulunrEd Shrlb'z

l\4embcr c,ilt
(Dr. MuhltnEdA,lt d)
to ry fuing ant *iog W**, egecrafrl
ry sweetfatfrcr, a nurce of inspiration
 Acllnowl.dg.ncnts

Moy $.nll io AUvflCmY ALt-Ag GL mn Mftiftl) d ih. Holv PrcdF1 Muhonnd

Wilh all Espai, of.r ny sincqr ltdk to nv ldnd supdisr' honodbL Dt

I hunbly
Muhmri! Ash6f. Prcfes$r of Bonnv Dd Dqn, Feultv of Scienc6' UtivtEitt of
AsricuttF, F!sl.b!n. I d ttty sEr.tul to hi; for hb ta guidtM thtugho|n tlE Esrn
eot s wll s in 9cDldio of |ni5 mlsipl l @ld aaB bv d4p Sntrodc ed
rpp@ilrio lo my @sFtis Dr' M.!t@b_u_Rthr.a Prircrp'l Sci' i4 GnP Lart'
Pl.!r Gdomica ul Moldle &Edid8 lrt., NIBGE, F.isLb6d for lti. kind lld o 6'ric
slidde in QTL Mpri'g studi6 6 rcll B fd his cicou,as.cd dd morivdo lo m* ntrd

I m .lo v.ry tunktul b rhe nemb.6 of my 3lpdisv @mi!.c D. Munond Shthbiz,

a$itdt Pofrs, D.!6tu41 of B.i.ny, Univc6it, of AgddltrE, Flielabd td Dr

Muhumd A6hrd. Itofs, bnillt. of Soil .!d Ewi|Mnl
Scidc.. Uni6rlv of
Agricuhur!, F.ieLi.n fd rten rint 8uid.tu , $lulbh su83.sid 'd mdl $ppon
lhruslrcd th. Friod ofnudY.

I 0m obliSld io NIBGEtNilioMl Innioc olBiot qhmlory od G*tio Engii..ing) Flislabid

lor Droviding funds md hboslory faoilitie for ddlcting lhe doleuld pdt of th' E!@h
wdt. I d .ho v.ry thonltut 10 Mr' FNoq rl.idor, DPL Plmt Gtnoni$ dd MoL'ulu
Btcdins lib, I.IBCE for his rind n b in DNA od!.Ni@ vort l 4 .lF lhokfll lo Mt
N.!ta A.nse. ll! sisL4 D.lamEt of Botrry fd his rjtd aisrfl* h ddding sG
*ho8! d!r. rd odd bb *qt .l li. unimiv l d $eriful lo Dv brodG A5im Tm*n rd
his rahnic! h.lp in MpurF en*& r!?licllio6 in tnc eh/sis or d'! l m vqv
'l&
$arrul b rll my friods lor rh.n pdtd .nd sood *i5h6

l*s1 but not l*! fiMt! to nv sw.d od tf4lioML piFnB for $en
I eish to ofrd my sin6E

endlc$ lov. ud lupFd. Tnn wdt suld n.vd hav. ben posiblc wilhou rh' @nliNous
.Mun3cm.nl, tupp.ir tnd pnys of hy p@lr,
 h-
CONTENTS

2.1 Erdat of dsght ftes 7

2.2 Adv*.ftcrr ofdughr 5r* d crro Sbwrn ..d 3

2.3 Efic.r of&qghr o shat sF*ii !d n! pirsiotoo, t6

l6

t7

I3

20

u
2.4 Dbugh rdeM€ mhdim !o @p€ *i1h drousht srss 22
2,4. I Mry'blosi{t rEbaihs 23
2.4-2 PtFioloei:l h*I&itu
2.4,2.I Sioabl clole sd prcderio, ofABA
2r,22 Osdjc !djr!rM.
27

27

28

2.5 lmpbving doght idtue jn ptdrs by exogdouj us of 29

horge.!dorlubchdic.trpl.Itgol1[Esut c
 2.5.2 Rol. of.!.or6io &id .g.hn .blorL 3rs in pl{rc
2.6 Aft.dinl cdp pUr! to irFow drsShr tobr6 35

2,6.1 CdHriod br*dins.pprehg

2,62 BEdfu by ru*6 eid.d sl@tioi
2.7 QTL Mrpping t9
2.?,1 Popuhioo! ft. QTL ilItlir ,9
39

2.7.l: B&locr FFihid

2J,l J Dordc hploid (DH) li6
2.7. |.4 Rdlbiut i.h.d lild (RlLt)
2.?.1JNa iboni. &E (NtrJ)
2.?2 R.!d€d gnr for ddglr !oL|d i! o.O tLrt3

27J qIL fd dbldl lobuc i! std al

3 17

3.1 Bgqinat l: As6t of du8htiololEof te! *nd

tsro(yF (Chld.l6 .t{ 65aao FM ir sil
32 ErFiMr A OFibizrlid of PEG a.dr.ri@ ro itrds
dlugbt ss ii *dd dd3
!.3 OFidLrdd of laltio &id ( !A) co4atdd
3.r,1 ErFidhr 3: Aa@dt of opd6m l4l of .erbrc &id

3.r,2 ExDsiMt 4: Aas61 of Ad6m l4l of .*o6ic &id

,.1,3 Exp..nMt 5: AsrDdl of oDtidun hwl of @rhic &id 50

 .t.l erpaimr e cooprin oraifitmrio4r-6iffifr t0

3.4,1Pl[tbioNs&M.nt 5I

5I

5t

3.4,2 Ptoidy [dic pignm! (ChlMphy t'adt "b)

'l
3.4J Ca *lrS. plruElq!
3.4.'r R.t tiE *ti6@Ld (R\vC)

3.4.t C.ll n.mbrae 3ubiliry (CMS) 5t

3..1,6 t .f@odc Ft lrirl
3,4.? Tool elubL F.t ir .rd ri. ldiny oferidi.'ri aOme 56

3.4.?.1 Sup.di& dtuur.s

3,4.7.2 C.rde (cAT) dd Foxd.& (poD)
3.4.7.3 A&!b.e Fqitr* (AlX)
3.4.8 A$sbic -id {No..@/Ean diqit nl)
1.4.9 MDA (Mltddindchtd.)

58

5E

5t
l.t ExpsiMr 7: Etrd of sorbic m'd d d@!hr ,r,6*d wh{r 59

59
3.6 E FinEt l: QrL M+dB

3.6,2 Polyno@ chlin R@rjon (pCR) 6l

6\

6l

62
 63

4.1 ExFnlot l: Als66.nr of&oud$ iold.re orn& *nq1 6t

t roqF (Ch.kwd,86 ud 5t r4{) glM in eil

4.2 ExFinat 2: @imiaid of PEG mrrlid io ind@ dflgtr

ai ebb &id (A!A) @Mnrrdon

Ortihiz3lion of

4.1.1 ExpaiMt 3: Ass. of optimm l*cl of erbic &id for

4.ll Expditrht 4: Affir of opriIM l*l of @rbio cid fo. 69

a.3J ExFi@t 5: sKnclr of oFiom lal of @rtic &id fd F.d

a.a Errai@t6:Cidt riM ofdifrqrdnod6 ofGo6icdd

!,5Ei!6i@t7:E .cofsqbicttdddo|gbtstB!.dptalplut3 9l

4.6 ExpdiEqt 8: QIr M.prins

4.6- I Phdog?ic !@ins ofF, popubti@ ld th. nrits El.t d to droudr 96

4,6,2 Cootypic @ins of th. F, popuhii@ $ing SSR turk6 97

4.6.3 Lirl4. dl:/si! rd pdldu.nd I0l

103

5 ttr
126

l!.t
lJ7
189
 LIST OF FIGURES

TIGURE IITLE PAGE

4t sh.oi-6sh-ddE I;;tl6, idlaolosldhetic tst (Pr'

ftsDinl,on ra& (E), stomalal cood@atue G!) .nd suF
sro@td Cq onenhior (C) of ts *nar 8.mivp6
rchakwl-E6 &d 654L6) st the tildilg sl!g. Gtom i! Pots)
udd w.llwalerd dd dtough @ndniotu (Dqn + S.E) in

4.2 ptnr t.iOr. tpiL" t."gtt- ot spiLlcls odbd of SIas 61

"*t*
per spikc, loo sced *tidt ard Snin icld Fr pltlt or M
qtai g.nott!6 (Chtl$tst-86 ad 651144) grcM ir pors-undq
wll qat.Ed 5nd drcudr cotrditioB (meo I sE) D

ll"r otor"y"UO" ,tr @t t*pl'nioD Ete (D sloMtal 68

@ndur.m. (&) ud sutsstoMi'l Cq @enE rion (C) or

shdt (ftrtk; aA&rz Lt s.tlinss of the cultiva l-agi
2008 ;h.tr difreMt @ladr.tios of PEG wE aPpli.d in
rurri.nt soldid ro induc drcugh strs (Ed + SE.) in

F;S;d dly bioss, net photosyntEtic rale (P'), tE$PiDiiotr 7l

d€ (t), $onat i @nduclance (s,) and sub-storutal co:
ondihalio! (C) of wh4t Crt d a€dM L.) s.cdlilgs or
$€ cdtiw t4eni-200E subjeled ro &ou€trt ste*t .!d t!,led
vithdiffcEntl*lsof!$dtic&id(0,0 J, I, 1.5lrd2EM)in
the @ting nediu (n..n + S.E.) in ExFdn4t 3

4.5 Frcsffi;@ bioma$, ncl phttsynfiaitc de (P), t anspintio' n

ralc rD, ibDaul ondutae G, dd sutssonad co]
@@nE tion (C, of whdt (I'iri@ d.rdM L r t .dlilss or
rh. culdw L;;-2008 subi4ted to dtowht st6s ed a!d.d
with diff.Ftn levcls of erbic 4id (0, 0-5, l, I -5 !r'd 2 DIO 4
(nd
a foli6 spny + S.E.) in Expdimot 4.

i-*t -a a.y tio-s, *r ptotostitb.tic rrt. rP'r' EspiEri' 75

d. rn. sroMtal 6nd@|!c G) srd $Estomtd cor

obenmriotr {C) of whdl (r'cd 4.nnu4 L ) scdlngs ot
the cultivd Lsd!2008 subj@1ed 10 dtou€lt stt s! dd t €i'd
wilh dilf.Mt l*ls of s@rbic 4id (0, 0,5, I I 5 sd 2 hM) d
'
(n@ + E.) itrExpsinc
apcevils s€ed trotlcnl S 5
a;-Niq or st@i .!d @r nsh ald drv bimls of drcugbl
stE;ed dd non-st!$€d 5 wk old pl&ts of tw eheat
s6olrT$ (Ch.[Mt-86 tnd 65'!4-6) with a$lbic rrd
@licltoo it difcnt dod6 (l@ + S E ) in Eip.riMt 6
conpuiu of net plrctosyndrclic ratc (P'), traDsli6tio! r.te
(t), sroEdd @.d@trc G!) &td $b_dod'.tal cot
.oncenbation (c) of dbudl str$sed .nd mnitrHsd 6 wck
old plmts of two whc3t gmtyp6 (chakw.l'86 dd 654rF)
wfth Mrbic add .pplicdion h difrer..l bod6 (Mn + S E)

C.rp*;f .N*pt !) ttd chlrcrcphv[ b {Cbl bl

yll (Cht
"
onLnts of dsuebl stced .nd mn'ttr*ed 6 wct old plmls
oftqo $td gFnottT.s (ChskMl-E6 dd 6541_5) {itb 8c'ibic
&id appliotion in diffmt modes (n an + S.E ) in Expdin€

(!M!/,
$lbility (cMS).
;-emblffiebbrxly
CohDeison of cell membm rd
l.,f osuuc
osolic
m;d roP, ed Fl.rive $!t€r dr.tt drcuent (Rwc) ot
irrssca ara m+msscd 6 wt old pltnte o' tro vnEt
edott!6 (ChrLMI'86 sd 6544_5r widl Ncorbic rid
ioolriirimroinrotmoa*(n@'sE,DExpdim'nt6

c..@-T n,o,6 L*t Ivtor -"* of drouglt 3t!6'ed

ald loFst6sd 6 *..k old pliots of iwo shdt g9ttotvp6
(Ch*wl-86 ed 6544-5, w$ a@fti. acid apPlication in
difG@t nodes (Ilfd + S.E ) i! Expqilmt 6

a".fi*;it".fnil;t"bG p.t ln- *l.nl lctivities of

(POD)''!d
dde (CAn
-p"."ia" ai-,1* (SOO), p.to"idsrc
el (APXt €.zFes in dsughl stt6ed
scoftd. petuxid.!.
,nd noHtrs$d 6 wetdd plds of two whe't gcloq?€s
(chrlMt-86 dtd 6544_0 qth .$dbic eiil tr'glidtion in
dilf.mt mod6 (nd + s E ) in ExperiFent 6'
ot aso6imia, elyci!. tdai$ (CS)' aid
of droueht sft$ed tdmn_slrsed
$tHr scetyF (Ch*rrl'86 aril 6544-5)
apDlietim it ditr rtrt nodo (n s + s.E.)
 EL {P'I tlcPiration
F-cbud dty bioo ss, @t pbobsldlcdcdld
i"" t4. ;r."i @idq.nq'(&) $t'tolDltd -!9i
$lt g4otvpcs
coneD;;dotr (c, of4 @k old Planls olnrc
ch'1a.1.86 ;d 65a4.6 ud€r drcudt sfts in !o'l bv
wit[bolding wtd and applyrg 0 t bM ard m u€
'glblc c Etd
*ri"" -Jiu r.a - S.e Il i'iExp.riDot 7. wtq'. dFueh:
. drot: cr= @nEol a$otbic &id. D=
DA=Drooght + Mbic acid,

r."rGt-Zrtiuut or ;i o" tars, cMs (.c[ m€mbBft

s"lilityl rWC ('.l"rir" .!lo -o!.ol), P' (nd photosvtthEis)'
t (taDspiniio! Et€) ald s,t (3rofrlll cddwt n€)' sr'dicd in It
w.ek old F, populdion of th€ clo$ bet@n $c drcudl
Esistarr qh.d cddvu, Cb!kwl'86 .!d tbe dreught $Ntv€
gdotyp. 554.{-6. Whic stms indicd. D.d valu.s of th€ hjl
in Cb,&sl'E6 vn e th. bl!.& aftv. indicd. nan vtlE ofib'

,ufty *i6
PaM-i.l 6c Pdo6 r49_2A, 5t8{8, 350-78,299-
38, 21458 .td 4E42D of Xsrrd si.s SSR Pnmis showbs
ddinor sd @nonindt ldi Pt= Ch!&wl-85' P2= 654fi,
M- DNA ladder tsaem.nt pD6lc of $c DNA hd&r E gim in

*u
Fam-swcy rbc pnm lsdltils fion knl xgm rl l'
2D, 611-6A. 4912A, WMS 169, 4d KSLIM-I 19 sho{ing
polymoDhjs. Pl= Chrkwd-86, P2= 6544'6. M= DNA laddd
(fagEcdl P'ofile of lh. DNA laddc! i! givd in olFdix u)

p--mout
sn.y wir! r:re prinm Granins tDn leffl Krd_120'
(sM-125, Xr@-l10, K5unl33, f'!w-136 ed K3ur40'
Pr= Chalwd{6, PT 65444, W DNA ladd't (frlgidsl
Doftc of$c DNA lad&t is 8im in e$.!dix n)
pmGGEirr, uppd l'ft]rvMs'
prir*r rsnnbs fros
268, \['MS-269, WMS-2?1, \lMS2?2, WMS-273' WMS_274'
wMs'2?5 (sr.ni4 ion loE left) VM92?6, VMS'282 'nd
wM$284. P l= Chatwi-E6, P2= 554+6
4.20 Populatiotr survey with pinq xe*tn 3?2_2A showitrg p'Mtr' l0l
Ch!k"d'85 (Pl) ald 654+6 (P2) rlong sth l0 hdividuals
fiom the r, poptd.lio!. M= DNA lt ld* (t glMt profilc ofth'
DNA Ldd€r ir givd i! .pFrdn Itr)

1_21 wilh p'ind xgM a9?-2A sho*ing Pqlnl! l0l

"w.y
(Pl) dd 65446 (P2) donS with l0 individuals
ChaIad-E6
iion lhe F, populttion. M= DNA ladd.t (lirglMt prcfilc 6r rhe
-Popdali@
DNA llddd is giv@ in app.ldix lll)

122 pop"trto wcy wi$ Fi@ WMS-IZ2 showitrg P@ts' t02

Ch*wl-E6 (Pl) ed 6544-6 (P2) dong sil! l0 individ!,ls

fion th. F, popddion. M= DNA laddd (tagm€d prcfile of m'
DNA laddd is girco in apFndix IID

1.21 FogrtNt-Gil!@ xg!' 49-r sbo{trr8 p.rcnts, t02

Chrk$rl-86 OD lDd 65,{.4-6 (P2) .lotg *itb l0 ildividttl!

non $G F1popdalio!. M= DNA hdd{ (6!sEE Prelilc orth'
DN.A ladd€r is 8iv.n in lppendix III)

Gd.tic @! of wh.!t cbF@soc 2A 104

QTLS for Ft pholosy!66is (PJ, c.[

(CMS) ed FlatiE *lq@& (Rwc)
 LIST OF TA"BLT,S

IABLE
MTqnsorc
ton arrtvsisorwimofih.dat for !h6ot tsh ald div
bionsi !.t pbor6yDtt lic Fle (?,), ElEpidrid tdc (O' slobdd
didwl&e 6 sd sub-stonrt l COr c.lcdtrali@ (C) of ls *lHr
scmt Tcs (Chai$21-86 atd 654'!6) !t 6c tilqiDs rt sp
udd wll-
wat @d dd dmudl @ndilio6 in ExFritMl I
Mcd sow6 ao;@;$fvarialc. of tbe .laia for plut bcighl sPiL
l@gti, rlEtd of spil bb, lmbq of 8r.i!s Fr sljr.' 100 s.€d,wiS-t
ed"s.i! yi€ld of qned gllotyPe (Cbitul-86 tld 6s4rr5)
F;$!t
udcr vdl *rftd ald dtuueh @diri6 i. E Frin nr I

MMGuar46ffinys; of va'iece of Ue daia for ner Photosvnrheric

nrc tr,l, nospiration hi. (9, 3tomt l ondudrec G!) ed.$ts
so."ri co, -i*!ari- (C) of *nd (r'it@ astw, L) sedlilss
of thc cultiw Irsdi 200E *nd diffdltt c@€tr tioB of PEG ld
@li.d in Nlii.llr rolftio! to irdr4 .ltouglt st6s ir ExPdimcd 2'
fiio d@;;;j;*"e-f th€ dara for frcsh ed dry
uioms, na phorosynrhi,tic ra& (P"), r4spitation nte (t)' ston'itl
'ou*.j"--
cdduc@. t{,, di sutsnobillt COr @6trlion (C) of whcar
tTtitiw es;d L.) dlirys of tbc cultiw t$.d-200E sbifl'd ro
;6o'ht slr6s ad ttd.d with dif.rc.t L!€ls of.scorbic s.id (0, 0 5' I'
t.5 ;d 2 !lI{) in 0E moting F.dim in Expcrimnt I
M* ,{*" fr". ""\"i-r '".i* rANOvA, of $' rbb ror 6sh
*A a.y Ui"*. itt"ay"o.ri" 6t! (P'). tdspilltior e^(O'
"aCrl *u-"t"'ut"t cq @'cnE rio! (c) of
-"a"ai* 'io
'r"*r,iC,itt* @ri; L) s.dUlss of ihe cultivd ltsi-200E
"i"n
$bicr.d ro dmuehr !fts ald oe&d with difedt lcvch ot Mrbic
eii {0, 0.5, I , L5 &d 2 ml"O d a folid spEv ir Lxperihdt 4
M;-@ fiob
-dpis"f or $< dau lor fclh ad q.-
'"mc.
bionss, cr pbordlnth.dc Er. (P'), llDlpiratior '" ,(i). Pl,l1
od*,i* ri,,t .,a .'u'to'ur"i cor @nqbltd (C' of whar
ttitum es;@ U) ..dlinss ot dc cultivu L4aD_200E sbjdred ro
(0 05 l'
Omogt rm" .ra t!*a *irraitrffir hEts of a$lbh a'id (
L5 ;d 2 ml,t) a! ! pc'sowilg s.d udnc in ExFrimflr

M@ sqws fion d.tyG of th. tlaL for shmr dd @t

t*r' -i o.y ti"t*" "i a.'gn'&t.M;a
n@-*6scd 5- ser oB
s[lsscd .d
,r"r" *; .t* g*o,rT*-(Ctsl(sl-E5 altd 654+6) wirh tscotlic
"i
;d .pplicaton in difc|tnl bodd in Expdin nl 6
M@ souds io- aldrilivsale;ifi. d'ta ror n't PIDto6F6'lic
tii, r."o+i'"ri*'or. ('), sro@',r @Id$l'!t (&) id 11
'"r.
*.iii to "i*t'- tcr or doush(Ch*wd_86 ste'!'d !d non'srFs€d 5
$e[ old llanB ot M
wbe4 EdoltFs ald 65]t461 with
a$lbic eid .pplicatjoi in di trere mode in Expcnnol6
M* .o".";fion@'ts "4"**";irhc d"r' f"' chlooptvl a (chl
.j -Jtr'r'o.plytt t icn tl @ntds of drcus'lt srtsscd "d-sc
#J?*i 6ra pr,i'" tN stlal g@ort?€ (ch'red-86 od
i!a.r-sr *:o *ti"_a"ia "f in dilr€ml modca in Exponm€nt
"pplic.tion

M6;u.GE; d.tF! of d1. t!'r' for @ll ndb@'

",t.@t
srabil y (cMs), laf osmtic por.dti.l (oP) 9d rclaET
w.rr!: @Idl
fnwci"i tlr""Or 'E"tt d -d on_slss.d 6 wcr oUe'd Plds of $t
"r'"r,
e.notyFitch*""t'80 -a 654a5 | wih Mrbic sPplictnon
ir dilldni nod6 in Expdim.nt 6-
r"r-i- to. un tni. ot uti*r or ue dala lor of HOr ed laf
sts'"a tud non's!6r'd 6 @t old Plant or
,* --tq-te.
r"roa cinros ot om,gir
.td 6544_t {ith Lr6'bic @id
e*.,'T"r-tCh*"tl'86
"rtJ in dif€€nt hodes
lDlicdion in ExF.rim. 6

l6f b@l eluble

t"tanro- 6om asrvsis of "siocc ot ur ou tor(SOD)
ddviti6 ot snFoxid. disd4
pbteir; eor ud--urcs PtrBdr$
iroOt, ..ra* (cAn ad Mrbar. pcmnds$ (APn 6zld6 b
tmn noFrE6s.d 6 @k{ld Plml3 of tm *bol
-a
(Chat{.1.S6 dd 6544{) qi$ aglbic acid lPplication in
'faga
seno-types
diffar.nt no.les ir Exp.rim.nl 6

V6- ---squc
rrc- anatysis ot wigrr of rlre e f-1 *fdi: *id:
dy.; i"t i* rce;, dl p.lioe orc or ldG of drousht srr*e'd
i,iJi"".***o o ** oi pt-" ortso g6o9?Gs (chakql'86
$lsr
uno is*lr.i,r' Morbic &id iPPhctlDn d ditr'E
nod6 in

id'lpiBtior r!l' (t)'

r-ha d.y bt"',"., 'rdFl@" .t" (P'),6!antr&ti!n
o"."rrr *"h*r,.- C,l i'a *i-'to*rrt cq (c,) or a
*J olo pr*o or n^-.L"t e"oott?€s chd(wl-E6 !d 65a+6 ddd
doucrrl sires in $il bv srhnoEhg sltr md lPPlvinS 05 nM
M;bic rid itr d€ oorins ftdim in ExD.rimelr 7'
F6troii-troic
oraatio rnore uc rrlu p' tlcr dptoqDrtai!) E
(lrdei;- d"), at (ttoddl 6.dlE18el Rwc (Glatirc
vatc! drcnt lril CMS (ell irdbr.'. stdilitv) sMied
in 6
qEt old F, Fpuldion of t!. c'* bct$t t lht enat curirw'
chaksl-86 dxl ita g.notYpc 6544{.

adpltfaffi@CGffi nploy.d i. ssR alllvsis orutar

g@otrtes Ch*wel-85 dd 6544_6.

OLs d.r.cted-bftEi8'stlrctic nt tP"), ell mmb|@

sralility (cMs), slomlol corducloce (&) tld reltiire {aL'
fnwo dtrough single narkct atdvsk tom th€ l,
sDuldion of ! Nss ber\|H thc drough @lcnnt cultive'
"oot"oi
blut"ot+e -a Ot" O.ogttt *nsitiv. genottTc, 65446

aT L" d.Gct d fd id PhordFth.lic Bte (P"r' eU lMbim

stability (CMs), stomltd @lduct E (d ud Gladve Mter
@ dt (Rwc) tbough inldval tnllPilg ilm tt F, PopuLrion of
a cN b€i*d lh. dmlglt tolerrd csltivd' Chttwl-E6 tnd
fte
sitirc g.mrtTE, 6t44-6
drcught

0-1r,d*l"d f- "d pbd"ttttt"ti" oohtu

tea. (P'),611
sr$iliiy (CMS), sroDlal coid!.iuc! G) rnd Ghdrc rda
@.ld (RVC) rhtu!8l coinpdii. Elppiry Aon lht Fl
popDlrlid of t ffi bctlE d th. dFug}! told&l cdnw'
'!t!rvtl
Cb,ksl-86 ard the drcught s.tuitirc ga,ot P.,6544'6.
 rJsro?rxtrarc

@tsoedoGft.&.!b,l9z).
Ut of Fi@t!|cd i!l$. d4.

$tpD{ Ird&G!rd)'
lmtplr{A t ddic.d).
 List of Abbr.vistions

IndoL aaic rcid (Auin)

AIX IM

MAS Mdk6 alsiltcd *l.ction

T,{DA

CAT Mtr
cj OP

cbl Chloophyn PECr0o

ctM

cMs POD
st.!!il'tY

cor QTL

DHLs ROS

E RWC

s.E.

CB SMA

I, soD

H:O ssR

l{o!
 AbstItct

which l$ds to
D.oughr stress affects n v{iety of n i.bolic proceses in Plants'
..nqi;duc losre, .rcp vield Relctilt oxygm sP€ci4 ptoduced udsordtoughl planls
."i" *-J"*' .-". 'n damasc !o chlorcplasdc membnn€s
";aarik and sroy'h As'-oftic acid comnodv rtrom
i;lie i" .a'..4 pl't*v',l6is 'r
r;r.-i'n c o, p,ir."riuf -doxid t" which rcuualizes rhc hMntul efTds of
drcushr sgess ln
*i.ii"" e." lp*i.' -.r' a H,or Prcduc€d in pleLs under
..0"1 rn "no,ii-r"l o" ievcl or ascorbic acid application ro $hear
iianl *ti"*Ji. '*,
a."O, "redivc its vsryins concmt-adons ecre aPplied in
thr€e

ii"a*, t'i.i "'*'s

rolia*pdv or in the Poti's nedium usins a snsr'
*i'r*-1"d-ioog i'.
"i '..a lcvel found in each mode rl mi ror

il;;;il;;i;"p.v wble 0 5 t'M ror rootbg mcdim) wd appried to

'osr;r€.dvc
.i*i e*"il*. a."ri .let! cultvar' chakml-86 and s dmughr s€nsirive
;;;.'6544-; sown " in trvoropooc cLrttua rhe cultivs chals'l-86 Proled
;ft;il;;ff;;i;dmd !o the smoq?e 6544'6 in ..trn. or ner
&cid rMr€d and non-reared $hed
"i".*irr'*". .o*rft anO tield Ascorbic evsruar'd ror rious
ffi;'Jil;";"",n;;
I'ft''* .r"ti".-.ur.i 'itieoea
o o'motrc sm's
""re
ell manbrane subilitv chloroPhvll@ ents ner
\

'mmpiratio
-r-i,
iloiiil;' mte sromaral cdduct'lca o6moric potentiar'
iDA H,olud as'odicrcid @tc as werr d thc
!;ffi;;; vanous;" .,srymanc anuox'@6 tr-' POD CAT 6nd APX)
activni€s of
iiil,ii iiri-"ir'";,il ;"iorarcd rhe adverre €ffccis or drousht bv
stabilirv'
*i;,"". dmase and h'nc€ imprevinc c€ll membdnes'1|
"i-i*i"*e
.i[.pirrrt"""o. ner ph;osvnth€sis osoric .adjsrm'nt :d :loI
n*ii ir-s "otp"..a ro rhe non-uEatcd oo's Amons $' tF mcres
rhrough thc rNtins.m'dium was r'larivelv
mor'
**,tii
-n" *ia
"ppliedor as'orbic acid in.alleviarins thc harmful efle't
"ooi,*i*,
.6i*F". p."'i'i"g.ri*ts
;;;;;;" *ere arso obscrved shm added to the soir' rhe rr
-.'*..;n"r-ar-86
iiii"F- "i'i. ";*' qta mapPin8 x 6544-6 srom n hldroponic sorution under
one QTL for net Phorosfnrhesrs h{o
i'i"tr" *.".* "*a
t-
warer conkm w're de$Ied on rhe
i". *ii..i;-" ""uiri v -ir on€ f;r Rhrive
.'r'-r".i.i ie n. "''io 'fconelatimacidstudies usins dars or the F': Popularion
mv ab; b€ prcse oo the 2A
;il; il;. QrLs ror as'odic
i'ii-i''"." r;r*.at tl. OTtx tor ncr Photosldhesis' ceu mcmbrue sLlbilirv
dd relative wdc' conrenl.
 CIIAPTER-I
INTRODUCTION

\l'lrcar is . l.ading @p Mong wol4 bcitg the uid

sll lhe imporrdi c.Gd crops of ihc
nosl prcdE d @Eal di.r Miz! dd iie. It is eid€ly .d.d!d to diflcMt $il dd
ctimtic onditioN s is rroM in 6lnosr !I Flls of de mdd @vaing @ud 18 or
0,6

rhe rot l crcp @. lslblrn k mong tn wbat-pDdu.ing @eLi6 of the *o d

th. top
with m mud ptudEtior of ovs 24.2 nllion todles (Anoqhou& 2010) The
iDpofid@ of wh@t drl.s b&f to PFhitLtric tind It is us€d b Mling bcad
oreuehourlhc M d.It is t uiq@ tuod gti! beje n @ .i!s g]!l!a a subsi.le lLat
helts in iking ofbr€ld. Psta, PdLy ed s.noliM prcdlcis I also made ftom wbml- ld
lndi. &d P.krtLn, p6pL w st!e5 flour for d4i!s cbsPln $tch is $c n6t @mon
od Nnfal souG of did iE lb,s Egid.

Vhat g63 fmily Pd@ prcviosly t€mcd a Grmine{c Cvdshrev et

b.longs &' the
al, 2006). Thb fmily i! ltE b4.5t noog th€ nol)@l plets md .odpri$s
lppoxinaLly 600 gElm !d $€[ ow 5000 sp6ci*. WL.t is a @nroon t d fq
nemb6 of thc g@N fttic@ ?'i.lic!, tpei.s aE pLc.d in ihE grouF '@ding lo
ihet chftno$re tMbd s, diploid (AA/BB/DDj 2n=2x=14)' tlsaploid (AAEB;
2.=aF2E) &d hqaploid (AAaBDD; 2!= 6x= 42) ivFs. Hcnplaid TritiM @tiw
is tbe nosr wid.ly gltM *lEl spei6 in ih. *orld

Hqodoid whol wolv€d doud 8000 io 9,000 v.6.ao, msl pobablv in lii€ pr46t
dly L!! (Fddmn, 2OOl). A@rdjlg ro aftt *e Am t eh@logictl tt'onl. il5
@nire of ongi! 16 thc F.ttit cr6c. cgion ofth. Nd E sl It w 6rsl
gbM in
soulh*i€m plis of Tukcy, Syn!" h.&1, ,td lhe Nil€ d.ll.! of Egvpl (Ld'Yadu 'r
dl (2000) dd lho irs cultiv.litn be8& to sPlad b Euope ed othd cgioN of ilc
stld. This cbp is osidqld s t Mjor fstor i! 6e tumldon of citv-hos'd wieli6 d
fic ailt of civiliutioD bc6@ n M orc of fie fits cbPs thst oud be
'6ilv
culti\€ted

on a leg. !cd. ed lhc hs61 could b. sloEd N tood for long p'riods Th' €alv
E$/ptid vw .tcvclopes ofbEsl sld invdtilg rhe orcq d.rclopcd boti.8 into oac of
th. fiFt l.rssFil. f@d production bdusties (CNrdN, 2003)

Wh6t is a $splc food for .bout 40 % of tlE wdd Popuhdol In odcr to tulfll th'
inMirg ho<t d.tuld of ih. gosi.g poPdldd ne.d! bv 2050' sbat prcducior nsi
bctle ar e mual Et€ of 2% (Gill a ol., 2004) PiPid climdic chsg6 dong ailh
bioric ard lbionc s.ses @ thc Min hl)rd!6 lo its bigh prodEtion Amry |h*
f..to6, noistln! sitBvdFughl k a Mjor sbioiic slrs lhlt .flds *te!t Ptodulid |o a

g.ar exlent (shao rr 4a, 2009) Dbusht or w.lq d€ficn is .lefned 6 lhe abs4' of
ad@u& mbtuF I).6$v for nomsl gto*l! dd conpLtton of lifc cvcL of a ddr
(MeivalrM .r d1., 200S). Pldlls $trd drough *n€n qda epplv to thc tuts is vcrf
low dLie to l6s soil noistle or wh€n hespintion 6t is v.!v hjgh Th'e te onditiotu

uuauy dcw togclhd ud.r and or mi-siddi@r6 (Rddv,t dl' 2004) About 60elo
of $c land d of lh. wdd k eithi! l!. did a.d si-did Fd@ (Hong-Bo e' 4r'
2006a) {hce sder is ilF dajd linitirg f&lor b plad prcdwtivitv F@duc'd
prcipitadon .!d high evlpote$intion h Uce {.&s clws s*r sd Polonged
*rtd sts (EllMn\ 1999). Kils er zr' (1992) t4on d tlrl vield Ed'lcrion in slt.tr
o.cs wo in lh. US pt iis, cilic! @ w of lbe oost hvoEd dinfed faidjng Na! of
th. erld- Howver, tle prblen ofdrclghl is &ut in ih. ddeloping patt oftn' world
whcrc lh@ @ a fd oPpoiuidd for .dopting d@dl woidle sttdeg* seh
a

R.dlc€d qatq supply advNlv aff..t3 msrlv dl phvsiolosrcd ed bioch€mical

proc.s in plmts Bulting i! lqlE€d PLlt grevll Ev6 a ldpon'y drolgl @
cls hug. lcs i! ctup vi.ld (&bnf .nd Ma[nood, 1990; PinlEio tt 4l' 2005)'
Drcugh siress r.d@s d Cq dsinilatioD ntc (lhoiosvnoetic tatc) d@ to rcduc'd
stomtal condel&@ (Rcddy 3l aL, 20Ol) Th. chlorephyll @nteDi ed tb'
&iivitv of

tubis oz'r. cbo .tedasc de to w&l d.ficir (Anin dr 41 2009) @XiDg in ductd
pholosFLhdis sd bmss of plmls Dnught Esulls in Edu@d oxvg'o supplv ro thc
@ts linitirs nutiiot k upt &d 6?i6tion (Pom, 1990) Undr wter delicit'
mdbmd dry up, b4onc PoroB dd lo$ th'n Ptopd nudionilg (Lvit! 1980)'
 tlmbtu$ als Larb b los of @tluld.onpaftn nidiztio! art disruprs
Stcas eithin
dnzym. srivit, rh@by.lbrilg n€llboljsm of the pl6d (Mahrje ed Tu.ja,2005,
Alhni 2009). Walq dcficir de ca|s oxi.lniE srr6s ald rrigg4 lhc fomltion of
@tirc oxye6 spei6 (ROs) sEt 6 suFoxi& ndic.t.d Hrq N&tmao.t at_.
1994). h is EFn.d thlr l% of rhe O! ed by pta s is Edkcd b a.tivai.d o*yso
(Aladr md Tatalashi, 198?). nE acrivarcd oxyed spdi.s rcacr witl p@r.irs, lipids,
DNA Dd cell m€DblaE lodile ro im.@ ellut' daMsc (AlhEi 2009).

thc dt nr of stB toLue vdi6 to6 ip.ci6 ro sp@i6. pt.nB udd sr6s uddgo
n.ry physiologicd.nd noQhologicat che86 to &cli@dz. th€elvd to unfavonbte
mviromd (SalMoro ed MMi4 2002), Fo. thb pu!!os, th€y adarn c..rain
mdhqisB 1o !ol@i. dmughr sds such s e!!€ (@mplcrin8 tif. cycle stq wlro is
av.ilau.), .void@ (arcidi.s d\.trdi,riotr by min;nirns wt r los &d minl.inirg
hjgh w.tcr poi..lial in ti5.B), &d tolmc by wios physiotogicd neheis s!.h

6 omotic adjwrrot (chlves sr ol. 2003; Ali &d ahaf, 2o[). Il&ugh oftotic
adjuslDai, pl6t c.lls @uul,r€ high coMtralioi, of @oparibte slui.s or
osmoFoi*t4rs. TI@ @ Nr-ronq, .teiii.llly n4traj, srl siad nolertB i!,i
adh.c io prci.i! @!t nr of c€I lmbdss th@bn ld€rirg llm Aon bcing
dcmiutcd (YaMy r/ al., 1982). compaliblc aold.s bcbS n urral sub3raes .lo @i
int .&re wnh e uld tusiioN .@ stto prcht sr nish .oncanratios (Sd.j &rd
sinchn,2002). A@Mulsrion ofIL* $lu$ h.lF Mi ri! tuEor PIs@ wnnin elts
d'dby Drobdi.g cdlubr coDFrln..& tm iiurr @!.d by d.hrdrariotr (Setob .,
al.,1992J.

Maay bio.heDic.t adlpiltiotu ale @cu i! ptdts to tot@t wlt€r deficir (Reddy ., dl,
2004). C!ri.i! str sehdrced lmi.in! prcduccd by sr* GpoBrvc goes e tn
boleul{ adlptatioB pl.nB *prs stE $bje&d !o d,rughr slr*s (Cuittu &d
Bohndl, 2000r Zlq 2002). pter! als pbduG abebic eid (ABA) udd dreugni
conditioN, $,lich plays a bl€ in tot.fue io dchydftdon by ctosing no@la (Wilti$on
ad Dlvies, 2002). ?leb h.ve rhe abilit 10 nqirati&t@riqle th€ ROS pbduc.d
unda sr* by pbdeilg ditrcMr lyFs oferjoxiddrs (Mirda, 2OO2: Ali ..d ArhEf,
201 HovlF,
l). !.va! lloughl cddifoB ii b.cons di6cul fd odird pldll ro
'Ddd
Dor-r tt@r.lv6 tod &fydrni6 dd di&lilc de.8e.

ft.! r. tlro lolnioor io .olE lD. FDhl@ ofdowhg frcly, by codlr.rio8 d'B Ed
&rclopiig inir/iod 6.ililiB d sdly, th. &ttloF.or of wilri6 sith b.dcr
g6!ri. cir.ec lo noirnn dE rd @imd.n& ttt io 6cir lii! @4 PiFicd
.pp.o!.td for iDFovidg ra.i qDly lo @P3 t! dor fdiu. !d vEy diftdlt lo
&li4 Fnicxlily i! &vclopilg cordic! llxt a Ptlir.! dlt io lh.ir ii8[ co6t
'Ihsrbn, 6!di!g ilF &d n o! lo 8.oa!E .biotic !!B iolcE cdlivlB b lb
bcB ofphd !ci.oc. c.arcs rh* &F G{d*o .!d TuLj., 2005).

Gddc inDrollmt fd yi.ld ulda dtuuglr coodili@ i! F$iblc .td ba he! odc to
looc .xr.ot ir t@y d$qslr lti.IE rr!.r of iD. eorld by lhc .xPlordi@ of
norpboloSiol @rooic.l d ccologicd !d.Fri@ ofpbd. io drcWb @vtoiro.ob
(C\tld r, d., 197). Hollw,lt. 66iFrliiod of PbFioloSicd .Lrd.it nry Forc
t rld fd br!.di!s Fog nn.3 .iDi!8 { ioFovi.S dougb| toLllE lEil3 i! @!6
(C.!ioi8|!y .!d rr!rh.4 l9'9). Dc?iL dry d...da of t!5.rltl, dro!8hl L dil t
ci.llcogc !o phot b!!.d.'3.'Di! i! dr io lt uecdicbblo.@plcx !ftof 6it tt4
dolg *it[ wili otLr .biotic dstc! (Ctc.rEIi, 1996) A!
iB int r.ctioo
'!d.ilE!di!8
of tt t rdic !.d plFioloSiol tr& of dMalr loltr@ erct d l4d lo ioptovcd yicld
0loughbr. dilg dd b.tr.t..!p n n g.6d.leh!iqq.

Drought dt.! iolcru.. h phb nly b. bFovd llroot! 8!a DeiFrliid

(Dubo{r.r., dl, 2003i Ad6f, 2{()9) or by e of grosil rlguldoB (S@rd!., al,
2fiIt) ,ad dg8ic $lut .s wI a dfialr .!d vihtnir|!. V&iN 4oS.eudy 4pli.d
dtugbl sttss aElior.dv! n ar hrv. b..d ucd i! pbtu. Accordio8 ro 3om dliq
3tudi.!, aog.oou qplierid of s.oftic rcid (vit di! C) ta. tiglifi.ld cr.d d
pl6t3 stjc.rd b 3.li!ity dd &owh d!.s (46.. ,r ,I, 2qB: Doh.b.dirn ., d,
2010). Astbic *id i! @ of t!. Do.t iEDorhl m@tDrtic ldidi&ltt (Arigpdi

od D. Iiilio, 20@). I dl'r. tbioric r!4 roLdncc in pblt3 by i@irg

phDbar!6.tic pigncnB dd h.nc. goerr of phl3 (ADin .r ar, 2mr' B.i!8 u
 diioxiddt, n coisid€tlbly alLvialB oxidaliv. damdge cau.d by st .s. Aslbic &id
&15 a a suhatlG for eftate F!xid.s., *nich srcDg6 HrOr.

Plet si3i.rce tu &hievd by producing gdot|6 with a

bE€din8 for .lrcughi
@mbiEdd of ad,prirc chaldd nl!.. 6!tr . silsL .da'rirc chuEid (Ktucr,
1980). This hs ben pncriad in the pali ituough.bpincd ble ding by $Lcting rlmis
@ lhcblsn offi.irp[qF !6, DNA Est6Nin d st@rio! is mw beitrg qLlsiv.ty
ebploy.d h bEeding crop pleB for a nuldhrde of q@tir.riv. iraiis (H. et al,1992;
Mobe .t d/., l99l; P.ie ald Totus, t95; ll@!@lj'i .r al., 2000: C:d.\dn et d..
2008). PIet t aiis s@h es height, iel4 drcu8ht rcrist M e1c, cxnjbir qwrit tirc
v&i.rio! @ntoll€d by !46l mjq ed DiM gaB, rh.r.foF, Efcrcd 10 s potrsaic

Qwtjtatile tr.tu e
difficdl to trEipulate in @lv.diord bE dilg progms
@mp@d 10 Mcnd.lie tlits, drclght Esirrane b.i!g a 6mpl€x qwritalive rail h
.M m@ dificult Thc ldi $,lt@ gcD.3 for suct rrsirs & p|tgr o! cbrcmo$r* aE
call€d QIk (Q@tii.tivc Tait Loci). With th€ adv6r of DNA mtcl iehDlos/, il is

rcw posibL ro l@r aid idatifr l[. Fsirion of eTb @ cbrcoo$de.. Earily
dete.l$L DNA tudkqVQTLs crn bcE& th€ efrci@cy of bEeding Foellmes for
dDuShr Gisir@. PLn $i.orisa havc it nii6.d err.in q@rilaliv. trzits &rr @ bc
ustd 45. otm lo ae$ drcWht Gilr6c. in plants sh s wh€ar, Thee inctud. lci
pholosy h6is (Ritchi. al, | 990),ldfeata Fcrri.l (eurd. ald Jon q 1979j Mrti,
dr

a ar, 1989; HcEb8Etini ?r al.,2000, yb-\i^E et at., 2@8), osnoiic adjNrlhl

(toh@n dt ar., I984j Moryo snd 'ttt" t9g6:, Zttua et at., 2@t t Robin .r al, 2003:
Ki&i .r at, 200ft) ad rctative slrer @rrc (Madn sr,t. 1989; Counois .r aa, 2000:
Ihull@ ., al., 2001j T.tdrl er dl, 20Oj) !rc.

Exjs&Ie of r QTL in ! chmtIr@b,l resioD indieles a polymqlhi. t(s Bpo.siblc

for thc sFcitc riir wialiotr (Sr.B zl, 2007). eTrr hrv. be! idoar6.d fd m.
"r
€om.rci.lry imporr4t raits in cF! plets (Saliba4olonbei .t ot.,211rt u et 4t.
2004 Cudd.r z/. 2006; v.rcd et ar.,2OO7, Kui et at..2W7q NnDri a d.,2010;
Veg a al., 2011). Howvd, very few cfofl! lave b.6 made o! locatinc eTll for
dretgbi Bi3t{M i! Bbeal. ft. F6.d dudy 6 dsiSld lo .xardn drclsbt
iolllllle of Lroploid trad $tt d (I|MM attw L) uing phyliologicd ud
bidLiic.l .pplorch6 s w[ ,! DoL.uLt upliry of l6il! @of6!iD8 dreqbt
tolqe|cc. Thc irfmrli@ g@nt d rodd h.lP to iDpn* &ooght rolcrbcc of *nai
T!. objdtivB of tb. ssldy gft to:

. ses whdher the dog@u! apPlication of sdbic rcid could dldid. thc

adtsr. .traB ofdreughl h whet

. 6nd opli6@ l@l of lsnic eid lb.l could h.h etar pldr3 lo tol.6te

. .fDiF th. cftd! on veiou! plysiologicrl iocb.Dical phmdu i! d.ougbt

3it!$d phdts ruppli€d wilh @orbio lctd

. find oui th. ctr ctilws of difcr.nt mo&s of .slbi. &id appliclli@ o! pldt
gro*1h urdd drcugbl

. idotit god tup QTII rd d@Shl lokt @ i! ri.d

 CHAPTER.2

R,EVIEW OF LITERATIJR.O

PbDts barc ro code sh* dviroMdl! bel@ r[.y @ ua!|e to Dov. or

lbe add

chorp th€n habiral. A@!di!g to . prej.ctio4 trcBrd icld of l[ mjor .griculiEl

cFp pldts k rEd@d de to €xposlr! !o dv* 6vi!1m@ts (B!j et al., 1999, Btty
^j
e, dl, 2000). Dtuugh slr6s is oft of th. main orwmdial fa.l6 ihat
"fre.l
{orldrid€ asricdnnal podudion (Bny a al, 2000i M6iva!)ro,t u/., 2008) becau.
weler is the most inpondt f&toi for plot grcqll| ed d€v€lopmcnt. Pl&tr idy
€xpdi€M drcudt undd condition! tuch 3 low rainfall, hid salinily h $il or high
t@FEtw in the smudinss (Zh!, 2002). Dreu8lt c.ss saia deficit in Plets
*h'ch nltinrt€ly 6dts in a dc.rle in r.Lrirc wat r mnlent ofliss to a I@l *b€t
pbdrs sufrd d6ic.ali@ (tado,2010). How6, wld Equi@tut v&i6 nom cop to

Np- A few &)E *irbout dinfdlos s@ dmusbr siBs fo. a c€rrab cop
DAy
$te@, a dlt sF[ of nG f@ ! ek Dy mr crl5,c droue]t foruelher Np.
Goe6Uy, dmught is. @ndilion b qtich svrilobL soil ooi$'e i5 r.du.€d ro a poirt
ptft pldr erewtb i5 s@ly.f..r.d (Os@i., ar, !9E7).

2.1 E(et of drcughr ltiar

De lo oBidenbL chdse in lh. wrld climt€ ed Bitfal Pan€d caed by .gssive

firl bmine dd global Bmilg (Coy.l, 2004; Kim ed Byua 2009), ih.1o1al did ea
of th€ world is ilclgidg spidly. ftis E@nt dobd chtugc in cljlale and incEding
utq ehonlge e Lading to huge Gootnio 10$6 in creP Fduciion ieludi4 tbd of
qlsr (zhu,2002i Wmg e/ al., 2003i Hong-Bo ./ at, 2005; Enc..t al,201A) Moft
rh6 50% ofebbol @
in u.l* wh..l cutirttron is afic.t d by dtuughl slrcss
(tujar.o,2001: Ashsf, 2010). I! b$ is vdy dc%ilting 3 eh€41is a slrple food rot
oG ihitd of6. wrld popialion,
P*&ia! ba d eid mi{id climL (Alonymou, 2000). of lh. btal ?9.6 nilion h.
ro

of the coury, only 9dlo 6eiB nor iha 508 m 6i! !q eM. M()mEr, thh
Binfall i5 Fediccd to cd@ turther i. tutur Kopt!., dl, 2004r Hone-Bo er 4l,
2006b; Kin ard BtlA 2009). Mor d& 70 % of thc 6i!&I i! P*istar M oily
dwirc lhe @!s! Eortbs of I!., July ed Augun. Allho[gh $pdddd ini8alio.
by 6d Mlcr t .Eilablc foi Me ad., howr, it is mt Gooud ro frilfill th. reds or

crops. This l€ads ro low !@nomic yi.ld ofdiftcdr cop6 including wh.d,

Atve4 .fl..a, of dNlgbt rtra o! crcp lmwtb dd prod!.livily

2.2.

h ha b.a qidcly sMicd thr. hcobnn ellility, chloophyll pigndtr oilotic

adjuhqt, wr.r r.l.lioEr rnd @t phordynrh.tic ot ofpl@rs gmeing undd dmughr
condinc @ badly.tr€cted sNiDs r dccr.e h sowt! sld icld (B!se ad Tud,
19?6; B@j@i! dd Niclsrl 20{6; PEb. s, al, 2009). Drought str.$ l*ds to difreht

det$olic cheg€s in plet tissB (A.hrif.nd O'L.dy. 1996; Lwlor ard Cotuiq 2002i
Deniml@ ./ 41. 2010). Ih* my b. ir the f@ h srivity of c.d!i!
of vuiarion
dchlolit s 6d crzym6, ladirg 10 inLibi|d e[ dp.nsion ard r.duc.d gN*lh (AbEf
., 4r, 1995) or diltub@s in ga qch|.€! (Cohjc, 1994; NalE sd L.wlor, 2005) &d
Fodudio! of hmtul @1ir oxygen sF.i.s (P.lra. er al, 2002) whjch afeci plmt
nebholisn in diflqut wys dd cNse celhl& dmage (Rddy er 4t, 2004; Mal@j&
md Tuicja, 2005). In sho4 dnD8hi sr6! c.Es ch&ees in trny all pbess vitat for
gro*th md &v.lopDclt ofplets (Ctsv6 dr a,, 2003; Farwq r, al., 2010).

Dblght .ffects plsc ar all ere*tl slsg$ of rh.n ff. cyclc (Atmrd .r dl, 2oo9),
holffi, 61ain $.g.s skh a g@iDtioa sNdlbg establishmor dd llowring e€ ih!
non diticd pcnods (Arhftf dd Md4oo4 1990; Betoii .r 4a l999illti.s et a1.,20021
KhtrE€zh.d €r al, 2010). Ihe .dv!e .llel3 of dsuelt on s6d g@inrlio! ed
s..dling srcw$ hrr! ben tboblgbly i!v61isrr!d in !@y cbp 3pei6 (s.desbie rd
YN[i2Mi t,!]ii'& et al..2lt]9\. In r rccar stlldy, osoric arss in miz. sis fi@rty
dcEaed gemiroion pdafaee, ldgth of ndicsl ed plMul. dong wirh bionss
affiulalion of lecdlinss (Klayahezhad €r al, 2010). Hoycv.r, when $bFd€d b
 dewlt rl bLr sLg6 of plrd delrlop|M! pL.ts &tidy GF%m ilcn g@,rb by
moddating both ceu divisior ed .ell dpuion (Sknycz &d ri?e, 2Ol0) in order ro
n6,.i! .xdpl., Kla .r dt (200t) Fporrcd lha,r pl&t b.ishr, leaf @
@ll tugor. For
ed st m dbseld of rnaie pler d..@ed signjfic&rty ufttcr dbughr 3tres. The
d6liE iD pler lEigh of s@OoE bls b@r .tEibded Mirly io r<turi@ ir c.tt
cdegcn.nr (Mdiv@tu sr ar, 200?a) dd @n nMbd (Ski.ycz et at.,2OtO\. Th.
dcci.{s. i! ell flrDbq k eirh6 du. b Foldgcd duatiu of c.I divis'd d ndsc{t
division de, Ii M Eported &!r rtrollghl atr€r.d lhe q to S phae tr.rsirior in
AEbidoFis dd 3!dow (cdlid &<l Tldiqr l9r; stirye ?, al, 20t 0).

FBh rnd dry bioll4 of pldrs sufails ton elt . srr33 i, cGidehlly d.d*.d
(ArhEf aod O'l.ary, 196). Ewn a stighr dare in sGr @nr.n! m, lod to
idibition of phat gbert (Taiz &d zci8d, 2006). Ku$t! .r 4l (2005) Fpon d !
consi&nble d.cl!* i! fr€sh widt of Fdt nil.r $bjetcd to dtoudt slr6s. war.r
d.ficit dera!6 srcirt
i.sfictins c.U dp€sion GDa, l9E5) l@dilg 10 i.duc.d
by
b,oms productior (ahraf ard Matn@d, 1990). rn maize, tlroughi srE$ led to
subsLdrrl iDp.imenr io biofri, s..muljrtio4 rbe E<tetion E lTyo ai si[ing i.gc,
34% ar gain 6llin8 stas. ed 2 | % at maiuiry (Kmd er at, 2003).

DnuCl-rclstcd Edudion of pbd gF*t! ed ietd ii @uscd bv dcc6c in

photosyrlh$is. PhorosyDrh*is @nrefts ligbl dFey inro
cbcDicat tug)| &d
syiiL6i2.s ory.nic cdpo@d! fo! pLtrB (tawlor, I995aj Triz ed z.igd, 2ooo.
Ir G
cxtr.tuly $Biriv. to.lrowbl srr.s be€!I. v.ala is cfuid for rhc nbctionirg of rhis
r[1)l* 0rwlor, 195.} Phorosyrthcab pdiriv.ly @fttatls with ptdt productiviv
(Cifford ed Evs, l98ti tj*tor, 1995.). A <Lctle h pbororlrbGis
dE 10 dreughr
stEs my b. sfuiburql b srombt clore whi.h i.d|6 $ohatat condErarcc rcomic.
2000) Ladias to a d.qo!. ia rlEpir.tio. ald u}tarc of
CO, (Cohic, 194: t99:
Molnd !/ dt, 2002; PooFIi €r ul, 20t 0).

Plorotrindb tuy d$ d.c@ d@ to @-nooarat f&1ol' (Ftcxs.r ol, 2004),

wlt D
rctltrc wrer contol <trcps bclow ?Oyq rh. rcd@{o! in phorosynrheis is g.n Elly
 atuibut d io loMtomid .ffdt (Kd*r, l9E7; Ennrfli .nd Eel, 2005). ntc eliviry of
rubis .nzr@ &c@s urd.r Ml€r dcficn (Anin e, 41, 2009; DmiFvsta er 4a,
2010)*tlich cdu6 ncl pborosynthBis. Mosi of thc Gvide@ d dsudr,indk€d
chdg.r ind,eG th.t rhc dour 6d &nviv of dbi$o @ftol photosyndaic ..rbor
Binilalion Cq sinit.tio! ol! (lhorosrlrhetic 6te) of b.e
(Reddy .r ai., 2004). Na
pldrs d.cEed dtuiGuy undd dreuchi (ZLtev dd Yordtuv, 2004). Lswtor (1995b)
Eport d r 16 i! photcynileti. !4rivity udo dsugh d@ to rhc d€crtas ir i.Grirl
Cq pc$w od lca in lbility of d€sophyU c.lls to photoslhthesize. Ir is pid.ly
eporI.d tb,l rct photoaynt!.tic sc (PJ, ranspinriotr E& (E) ald nomLt oDdElsee
G, of diflq€ni mp sliccics d6rcr6ed uDdd drcudt slr.ss ondilioN (Pekovic a al,
199; Yousf er dl, 20r 0; Ali dd Ash.af, 201 I). G.|mJy declin€ iI ss .xchag. (p-
E, g,),oliliEly @relat\* silh rhe inten$ity of deuehi shcs (Cimi@ et at., t992).
Ho@d, rhe cffer of dreushr @ ditr.Mr pb +oci6 vdi6. soBhm @utd
photosynth*ize ar a Frc up to 25% oflAim@ ai s leafwar€r poretrtial of -t .2 Mta, At
lhc @c !o&.ri.l, om lave silr.d lrd stow<l D pboroByntheis (BadL .r at,
1973). Me$@m6t of photoslnthesis hs b.m rcported u!.nrt in seniu plmis for
doughl6istsrc. b6ae it E0ers rhc ovlBtl bchlvid ofa pt&r sbj.crcd to wt r
dL$cn (S.bpi& aad plmhon, 1984; F.hina ed plmhoa 1994).

Chlobphyll pign.nts &. viiat io hwest lidl for photoslhthBi!. Both chlobphylt ..a,,
dd "b' e pbe ro dchrdnrio! 3rs (F.&oq dr dl., 2009)_ ,'@di4 b Chd6 ., a/.
(2001) thc cblorcphyll conient of plmt d.q€66 ttraslic.lly under drcuejr srcss (Kwd.
et at., t990. R.ttuW et al.2005t Adjr .r zt, 2009). This drc i, cl oopnyu
conlent l.ads to disryeizarion of rhyLkoidl)@blecs (L!dj.l e/ dl, 2000) th4by,
Gsult.g in l()M!e1ptoidynlh.iic 6la C 6pny[ |actinpl6nr g6e6ly de|las
or r soDe c€g rcmiB bchaScd ude drcu€h sr6s dcFndins on lh. duration ed
s.qity of dreudt (Kr?yo&isir ., dl, 1995; A{g ard KilrrM, 1995). for exmplq
d@ueht stB cssld ! substaitrl de.ile
in cht@phyU a cblorcphyll b md iolal
chlobphyll @nt. i! sudflo$E pl&t (Mdivat|m s, zr, 200?a). wttE6, a{B md
Kirkbd (1996)ob6d.d tu cfl6t oD 6c cnbbphyll @ror! of sulnowq Dl6ir
subjot d to dDught stes nay b. d@ io nild drcught, On rh€ orhd had, Arhrf &tl
K'rin (l9l) EF Ld s ilcr. !. in c[ooPhyU i! 3om. cltlim of bb.t 8m lnilc
dc.rtls in olh6, 'nEy cofftl|d.d tld lbi. ditrawc ban@ diffqal cultild ott
d@ to wiiio! in @yG iMlv.d i! t tytlh6i! of cblorePiyll af.cli!8 dtouSit
rolcrldcc .blity of tbc g.ootypca, TL chlotlllyn conLnts of dt@ght l.siriet
g.ooryF of sta!.dl e.,4 ew hiSba @DF !d lo {E .aitill SpnoDF utrds
d$lgbr st* (Pntdi &d T&pi 199, 193). SiDiltly,lh. cbldqhyll6ntds of
dNogbr rlsiltot culiils of b.d!y tadcd ro b. hi8!d ttd lhd of &ouglt s.orilit
o|g (Rdg-Hu r, 4r, 2()6l Stly rra .bility E fould to b. .!.sid.d *il!
in'tllrd icld lDd trBpindon cfrcict y udcr d$uSht fBi i! sorghim (BotEll .r
al20O0i H.Bt!4.r.l,2mD.nd *h.d (B.abclt.nd Pt'n!co, l9E).

R.brivc sLr od.or, laf e.Lr &d oloolic Po!.oti.b G lb. orin cobloFls of
plst $ld GLlioo! (Anjun,, ar., 201l). tt f*.Lr Potalid !!d oootic Po!6tirl of
Erir. (^li!!d A$!.f,20lD et .r (Adjci ed K*b!', l9E0) rnd tbnow (Ad!d
ed O'L.{y, 1996) .p.ei6 Fdu.d sisific&tly 'Edcr douSbl 3t* (Rodti .r ar'
2007). Cdrivc wilh bishd ndrctio! in lofooolic poi6li.l e coi.id.r.d Gid.lt to
douglt 3lF$. I !$ ba Fqo5.d thd l..f sbc (dlnotic) Polalirl n vbc u$d a
drought tlrin m. clcclio! dicriod (Sojt!.r dr., l9El i Crtr.r &d Prll.r3oi' | 9E5) Soil
v!r.. poEltilt d.ct!.sd undd wlt r dcfcn cotdilids, 30 plrd! b&t to tlducc 6cir
ltd Eridrh nlsor. ni. k elidrcd ttlmogh
osrolic poiaiid in ddd to rb€orb e/sa
tlE e@ul.tio6 of . vei.g of iloalnic &d oa.nic otaotkt ittcludiig @bFliblc
$ld6 nl.h s fmli& ed dyci!. ttLilc GL.!d it llfar.d lo.3 ocnolic ldjuslt!.dt
Gl!g, l9?9i Kcyvla 2010). Piolin i! lb non 3tudicd conpdiblc $lul! strch i5
lrDotud ro ircra. npidly uda ddgh (Anju ., ar., 201 l). fttu oldoic ldiNE cnt
6 *lil! lowrils of clll o6doic por.did urd.. dreugh h.lF i! pl&t gmelb &d
dcvdopn@l by prolidirg Bid!@ to srd.r &ficit (Ludlow rdd Mubow' 1990;
Pd.!tli, 199) by DdDat,lN of Ei plolotvltblic nL !!d hiSh 3tod.lal
@ducbF (DoMlo!, l98ili OUF! dd BclowiE, l9E4

PGl.ti!. vd6 6 cot nvq of k f tieaE i! dvc$.lv !ft.td bv dsahl s!3e

(Ddit!$16 ., ,r., 2010: Ali .rd A!h6f. 201 l). RtldiE $rt6 cdiat of wll hvdlrlxl
tissB is !$ally b.t@ E5'95o,6 (P!rdo, 2010) Bnich wi6 ia difcMr sp.ci6 Pbnt
cclls loF thcn nlgor sdq dreu8ht Guftr, l98O w[.n th€ Elatirc ster 6nidr of
Lav6 declees. D!. ro wd. lds of *at r. .eU nenb@6 dIy up, bc.ome poios md
be thcn pbla fiDctioaiDg (L.vit! l9E0). It h obs..v.d thrl rhe s!6i6 ldap.td to dry
dvionlrMl! minllin bigha RWC dp.r.d to th. ollcrs. A@tding ro m. studi.s,
$drM suff.6 s smrllq d4rce in RWC p.t uil ch48e ir l4f w1c. Fot€nd.l {M
@don dd miz *ha subjd.d ro &o!dI stB (Actm dd Kri& 1977i kvitt,
l9E0). In a d6r s:rudy Yocf .r ar e0l0) EFn d thc cf€rs of urd rtEs @ *r&r

r.latio6 oftvo Tuisie alfdfr (n&dic4g rdt'rd) populltios ftom did ard mi{id
E8ioB. Tn y foud $ar wlGr deficil signi6@0y rcdE d rbc Fldiv. v.r.r @!tdt of
both populrtioa tuiftd, how6, rh. d..@ *!l lolq in t!. dreudl lol.rdt
populatior Maintcme of hid RwC ud€r linitcd waier b @Nidded a $islant
neheisn 1o drougbl s1!.6s ,trd is lw.sLld 3 a *l@lion qit don for drou€h
rolctle @ayd, 1980; Marin .r 41, l9E9; Riichic .r 41, l99q Gdt dd K.yomio,
t992).

A@rdi'g ro Foyr &d N6ror (2000), dreuebt sr* €lB d inb,tse h lidr
eptlring dd ib utilizalio. duing phol$yntlBir. Tht .xca a.r$/ is hmtul for
phoios'slen II b.c6w of o@rcducdon of the rcaction @nr€ (D.mj4 Adms ad
Adm, 199), Pbor.syst o ll (PS tr) !.iiviry is doM-Fgulsr.d Bultle in chag6 ir
qwtm icld, Excs clccrton Lir.g. @cN (ccen d 41, 1994; Asbhf,2009)
lodins ro disipation of fre iadicals of tdked oxygctr in the cl o.oplNrs (Sminof,
1993). IR t!! Fdtqb e ..--o"ry cdlcd s '!*d!e oxygcn !p.ci6, (ROS) or

'4tirc oxrs@ !p6i€s' (AOS). Th.s ROS inludc sin8l.r oxygen, erFrcxid. sion
ndi.al, hydrcxy Fdicals, alkoxy n<l,cals and hydrcgo Fbxid€ (Ashrd 2009; Csrelli
e, dr, 2010)- Th. inj'ry caut d by rhe Ros sh .! hydrc8@ Foride (rrrot is
knoM 6 oxidatiE str* ard is @ of thc Mjor drn S.lo pt nr.xp6ed to stEs
such6 drclghl (Tartoua 2010). Mous od Abdel-Aziz (2008) Eponcd e incE6e in
HrO, @Loi in tuize uldq drclght strs. Horwd, thcy obs€d lha1th. uowr of
t!O2 Prrdrc.d in <lioughr rot@t cdrivG *6 ls onF&d ro thc drougbr eNidv€
oDB. Sinild clulB wr€ Eloned by H. a at (20t l) in what.
12
 Although ROS @ .le piodald in pblts gDsirg dd€. ,orn l coqtrtioB Oone
2001), then Fodu.iiod is pDmor€d udd sa€s @ndiliois. Drought st€s es6 e
i!.!!e ir pDdEdoa of @.tivc oxtt@ speics (IrFire, l99t; Ashnf ed F@tad,
2007) stich !q@ly ttamage ihc lipid contat of menbrc teading b th€n
damage
ard di$4rio! (Mirdq,2002; A!hsl20o9). MDA (hatoldilkt tyd.) b.i4 !
bypr.ducl
ofihh m@btu dao.8c r.!.rion 0ipid p@nddion) @ b. N.d d ! n .sW ro de$
rhc mout of rhngc o!*.t ro eI @bturs (ZIdg er dr, 2007.,
Ftoog et ol.,
20t0).

Ardond,ni! e prcduc.d i! r+oc. ro rh. ROS (A!bd,2009) ar v&ioB t@rioB ir

trE e[
wh@vd Erc1ive oxyg€n spe'.s e podeed. Ihe @io ROS swnsins
drjoxidats e tuFtonde disutas (SOB), a fdity of berattczloB ,!icb
c{tartz€ rh. dilDutarioa of slperoxid. adical lo HrO, (Bowlq e/ at
, t'{r'l wws .t al.,
200t; AsbEf,2009). SuFuidc disiie. @4D. Equis corpd (cu),
zinc (ZD) or
oalgh* (Mn) a @f&ros. fte
crrod@ic i$fom equic oprE, rhe
Ejtocho!&ial o@ Equic brng&€$ qhile tle dra.ellule one rcquir.s Crrzn
(Diplelq l9a; M{Uud t99O). SOD,ciiviiy c& te dcrmined
on th€ b€lis of
inlibilion o{ a }€Uop @mpoud niDbl@ ctraaliu. cata.l.g (CAT3)
ud
F@xi&€ (POD9 fou'd itr Frcxis@6 @ h@c pbreid l|!r cslllr% th. mov,l of
H1O, by 64v.nidg ir ini! m1f (Asd4 1992; Dipt6t, 1994j
Wilhrcw e, ot , r!{/1j.
Thd e svcrd fo@ of p@xi&* CsldM cxisr in &c ba! iefo@: CATI.
cAI2, ed CAT3 (Will€tds €r st, 199?).

othd dzrraric elioxideis, !$Ibai!

Fmxidd (ApD, Stulattion Edera& (cR)
dd &ly&@rbare rcdrctas (DHAR) e invotv.d ir tbc s.ornatcglllrrion
cycte
(Aod!, I94). Asolb.r. p.rexidrs @ pe*d i! cbrorcpllst jroiA
rhyLkoi&.
microbodi*, crlosl, pcmxieDes ed
niiochontrti& Tt€y lcrrliz€ thc e$aprng HrO,
duiag pbotosynth6is lad pholoEspialioL Atrhough cdre ed
ApX both Edw
HlO, !o E o, rlE affniry of ApX for rLO, is doE rh@ thai of
@tatdc (SDirnof ed
vhcld, 2000). Ia addition ro rh.* crrrbaric iondats, rhft
, c art i! @n_
dzyn lic otioxidots slh a $colbic aci4 .amLmid!, 0.@dds, lo@pltuk rld
glulathione (N@lor ed Foyd, 1998; schdd.t at,2002; Ashnf,2009). All lh*

tuytudc dd rcn- .MF.tic drioxidel3 prctccr pldts aSrinst oxiddiv€ dahage

ca@d by ln. ROS (Niki cr 4t, 1994). ft. erivity of sdond,nt3 g*r.lly isltls
udcr !tr6s @ndilioE (lrrrine et al-, try4iP$ttd et dl..2!A0} ftc .l.vat!d Lv.l ed
hieh &tivit of &doxiddB povid.3 6id!M to plrlts assDll sts (Ca!@ ., dL,
2001). For cxmple, MoBs dd AbdelAziz (2008) obsflctl a subslgntial imte in
lhe &rivitiq of SOD, POD 6d CAT in dia pLtrts subjer.d b dbuglt ct .d qiilt
rEG eoly€thyl.ne glycol). How.r, a &w rcMchc6 biv. Eponld a &cEde ii ilE
&rivity of $m etioxidat Glzynd uda {ress. Fo. .}Mpl€, Hong-Bo .r ul (2005)
epdr.d a d66e in N6bic &id h miz. lnd eh.!t pldtr subj..ted lo *al€r d.ncn.
'Iris nly b. du. 10 th. Mbic &id bciag ucd up by ih. APX wtte
Ma.oiut iats ruh s N, P, K !d Ca c Mtidly
r.quiFd by Pld$ for ptoF
gro{! dd Mintena@. Dcfici@y of €v.i t si.elc lutri€nt mv l.!d 10 d.ith of pldt
MircEl Nti.nl upt*e fiom eit aDd thc rcsFclive lran lcdion wirhi! pbtis is

$v.rtly aff4ied by d&wht 3li6 vtic! lads to imP.itunl in phtrlgoleth (Taiz Dd

z€isd, 2006). Ac@ding to Powe. (1990), dtought Fsults in r€du@d oxvgen $Pplv to
lhe @q lna.by, lihiting .ulrie upLle ltd llspinlid W.l4 lnd nindal t9ltlc bv

DldE se clos.ly rclatcd besute *al€t it Mdsary for lhe ratuleation of nutri€nis inlo
&d wirhin thc Dldt, nE av&labilily &d wtd.e of .ulri4ts g4nllv de.Ms undd
wald d.ficit d@ to subst nti.l de.rt4 in trnspintio! rarc .nd inp.ircd a.tivc odpoa
(lrv'r! Poslr, 1990) TlF plant @t svstqi noduLt s iisclf uda drcuglt
1980;
qhich Nl'idt
@nditioE by loBilg its p.deabiliry ald ardvit (Alab, 194) dft to
uprake is nutilaLd, A ddlirc b sil moistG hs h€cn rpdlcd io be posiliv€lv
assid..l *ith dqle in flow of Ntrids nom eil io mt (Mis .ttd Tvlq' 2000)

Pota$i@ G) pq.nl withi! pLnrs pl!,s e ibpdblt oL in the t sulllid of o$bric

poLdlial of ilE ens by aclivating edyG involved in spinlion and ll
photosvnlh6is

.ls ceulalG sloMtsl oFniig, pboidtnlh.sis ald ldlPindon A@ding b enlin

teports, a declede in Kr uptlic ws ob$lved ud.r dreugh slres (Baquc t' al 2C46)
'
A d€cr.se in K' lwel of {h.at Dldis is hmftl for Pl6ts d may c.w stomatd
't

CalciM kale!vit l nuti.rt i! plrli deittolis ltpLy3.6E lrelcilPL 90*l!

&d c.U dit6'on (Taiz anl zei8d, 2006) c.[ cl@s.don 6 sfered bv Ct7' ion
6rentr.tion. C.lciM is ds iovolv.d in cotollirg @[ 6db6n Fdcibili9
(giFhi, 2004). B€ins t onPone of ll6btag, it @ntdbuca to iI!. 64n&lD@ of
fieir structe ud tunctid by L.eping lipids &d preteis bonded toe.th€r' Mo@v.r,
CAr' bcirg a s.cond t|r.sgger, pl.ys .
sig!i6@t relc in aiiioxid&t .Mvnc sigMl
ta$ddio! (Hitrhi. 200a. As!fl.l ?t.1.. 2005) A rcdkton i! Ca" densaLion
Mder wrer sir.s hs b€r Epon d in *'trtl plsts (Khe .t al. t994; Ashdf tr 4r'
1998).

NitroSd is an Mlirl @npoMt of adim &i&.nd lu.leic &ids rl w[ s I@v

otls bio-nol..d* iFluding €izvnc& Nitrosen s.!w!v inlibits plmt
dcfciencv
gbstb. Siish ed Ush! @003) FFll.d a d6.d i! pldt N 6nr'nt undcr *dd strd'
Oihq cs€dh.B rcPoncd siDil& tsulis .3rli€r (T&gunig et at' 198?) Pho'3Phoru'
motnd mjor cl€odl involvc<t in ptdt grc*th aId aSdation, is ltso afrctcd bv
drclght sitts. lttosphoN b.irg a pst of AT? Plary3 a k'v ole in elular Espiatid
lt
a pln of Ncl.ic eidr e.l t@v 64fet
(Iaiz ed Ztig€r, 2006) Dcficidcv or P
c.es ! s@
's dirtttt@@ in o.t lolis of pblts Phosph@u u/ake h$ ben
g.lently Fpon d ro decr* und.t wt{ d.nc $F!s in d'lTftnl Pld( sFcies
including Mize (Pffia.b4d6 4 d, 190)
qtcd (Khtt t' 41, 199) dd FpFr
ff@.l,1985)

Vcgdrdrc gowrh ed treld u!d.t d.oleht f.@lly h't ! redivc dlthrioq

beaw
gnin vield uda
incFr!.d vegctrtive gro*'th uder good noistut€ condiions suppsss
dreusltr(Hutd, 1976) Gain b ! @nPld ttit bdle ofh'ils ihc @bbiraion of
vield
s.v€sl pldl gre*tl @bFn d' W.ld 3t!.s t!d@s @p
yi'ld tcgddless of th€
$8961 $at
gre*lh stas. !t $'hi.h ii o@utr (J€M! ad Mogds'l! 1984) some s1udi6
higb tilldiig crpocity @v b. h.ffrci.l if dtought sLtu and
dtrcsis (Austia 1987;

15
Im€s and Qwiq l9E7). Ibis My be du. io th€ €nobiliztior of .lr@dv emdat d
pbotoctnrblte Bdd i! the stqD ro th. d.v.loping gnjn (A98.!wal dd Sin!!, 1984)

which nay @niributc up to 22% of edin rcirht ud* drcudt ste$ @nditions (Gqt,
1995). Howa, HBd (1971) st 16 dal a br8h dldilg ability tuy be & u9ut d
luuy in dry !16 bcew it i5 q6&tu1 ofsoil noistur, $dich my bc n cd.d lal€r on
i! noe critical slagca of d@lopE .L Po6t-dnesis drcughr stt!33 M Gport d lo b.
hdtul to sFin yi.ld ofb..lct tgddl* of lh. sr*s ld.l 4pli.d. satuj lrd WdtsaL
(2000) epon€d tEt mdimm d.c@ ii yield @culcd std crcps we'e €xpoed io

drcusht sEes ar tu nowitrg $49.. Drou€trt s.s inP.iB floE produdion ad tawr
gnis e prcduc€d (Anjm e, al, 20ll). Reduction in elah nllnb€r pd sPike udd
drcueh also trds beaue s.cd sel D qnc.t is ensitirc io wrld str€s al or IF lo
Dorrd d.iosis (Saini .!d AspDdl, 1981; l9E2). A@ding lo Fatooq et dl. \2009) wn r
d.ncit subquntiaily r.du@s idd thirs by dktutbins Llf gs dchsge psm.tca etich
mt only dkturbs rhc ph@n|@ of phlo@ lo{dine atd Niniht t!!61@tro4 bul ale
@ftlltion betw@ photosynilrcsis dd
distupts th. dty datrq pdidoninS, A signi6@t
yield ws ob3d€d ir whotlldh udq dreudt (&ul, 1974). Accoding lo Nicol4 end

Tu@ (1993), lal photosyntlGis datlls ryidly afie! rndcis itr s in 6P3
subjecr€d to dou8lft. DE to this, pldtr hiv. io tly on veg€htiv. r€€ryca leadiog 10

low g6in pldu.tion. 'Irtu, dreush sEes els d.lcidioN.ll4ts on.oF rbrcu8h

phrsiologicd modificltioB ir dl pler oryd d€ntudlv l.rding b dea..d sdin vicld

(c@hdd cl dl. 2002r Dolarabadid .t al., 2010).

rbqa 8tuwrh dd i6 Pblblo5f

23 Efrat of dtu!8nl o!
23.1G$vlh rld bloDN
&dindion is a v.ry critical ph* of qh.!t lif. cyclc s it is thc @3i .ftcitd bv

douelt (Davidsotr 4d Chav.lia, l9s7; Jajmi, 2009) Th. exftmal osodc poi€nlisl of
$il b.ilg highd th& lbtt ofth. !€d pF6ts n AoF inbibins wl.r O,luillcAbldor
€, aI,2002) $ s..d sm it hoisnE ltlss€d eil faes ibP.jr.d uLr.b$!lioo
lcading to poof or no gemimtiotr al atl. Poor e€mimtio./sdling erotrth Mv le'd to

@p 6itN wb6 th. sedlinss e nor PloFlv 6t!btish.<l (SolaDi dr 21,2006)

Th.EIor, siies lolcrde.t gcmi@lron dd $e{Iing st g. is inPottalr for lhc wival

of *n !t plan (Adjci ed KirUE! l9E0). Ashnf ed Nrqli O95) ob@.d lh,r wt r
imbib'lioA Smimtion rnd sdlilg Croslh in she.t wF sev€ely !fr4t d by <LouSltt

sh.s. Lald on, Iljldi (2009) @ndwt.d s similu snldy on 7 $t€al g.dot'?€s wd.r
drough stslnd foud ild thc gEmiddonp.Md.€F 8ltDtvpe B 78%,
oftold!
Btrile th.r of si$vc oes re 360r. Tttc snrdy tlso dealcd thsl gmidiion
!d.dt ge ed s*dlilg grosdt d..@s.d wid inci4i4 int€srty of dreught

d*loFndt ud6 dDugh! grev.i! d4@ de to de.1!e ir

Ai I.t4 stag6 of pl.rt
photosynthetic ni. dd @ll divisio! (Isuji .l 4r, 2003) Water d.ficit str€$ caucd

signifi@i rdkrion b sh@t lelgth ofwh.ll (Arhnfer dl, 1996) Bhln ald Ra (2C$5)
GFnld thal &di& i! dd hciSh dt bc a{libuted io tlductio! i, ell dld$mcnt
ord.xpNio! due 10 low tusor ulder d!ou8!t Sill]re tr el, (193) g@ 5 dffi
$,ltdt 8etutt?6 in @ltsting soil moisG &d found th8t dtouglt str.ss @used loqlr
dry E,|!er @mulati@. viucgs ?t ul @00l) slso studicd lb. pllt m of biomrs
ecmdalion in dltlm whcli SdoR!6. 'ftcy foud lhat dty wight rq plad EdE.d
by 42 % t q dtuught ondili6. Mey oth€r studies Epoit lhat wat€r d€fi.it
$&lr!ti,lly Eds.d dry biotrN of rieal (A$4f 4 al, 199; SiDgb .nd Usha, 2003)
Iltis r.dElion h bioltB ofsi.ll i. de io Edued *l phobsv n sis (Bhan ad Re'
2005).

d..i€es dsidmbly uader both d.ought dd hal stles

Nct pholoslath$is of wir.5r
(Shd ald Pruls.4 2003). A .Lc1!e in Elativ. *ter @nt@t undd drcueld c.'M
dosw of slo@i! wnich in lM rdlB ner Pboiottlthcric Ele (R.ddy e, al, 2004;
Aljm.t dr,20tl). H n fid d dl (198) sfidi.d ihe.ftci ofdsud on sFilg s'lcai
culti@ ard foud lhat nct CO, simiLlrior 6t t snd stomral @ndei.nc'
$bt ld,lly ilducld dE io dtoughr stB. Th.v @@hdd thll d dlv d@{* in
phoiosrathlris w dE to hid stonatal Fsiet ne whil. contidEd wltq d€fcit l.d to
rtduction in m€sophyu netlholism wlich d.crcased phoiosvndsis Ac.ording 10 Steven

?t al. 0990), hiSltd *tdl tEt pholo6Fth6is ud6 d.olght mv b. u!.d d. s€lation

cddon fd &ought tsistan4. I ba b..n obw€d thit dou€hl Giso goot?.s or

*t !r [ave @dpendrcly bighd ftt phobsrrtl6is (O@i 6d Otui, 1983;

G6t aod ycyomto, 199). ILe nsultr of Ritchi. er zt (190) aDd Manin s, al. (194)
sho{ ihat ihe bioch.hical facloB @ntolling intenal CO, Bsinilarion.pptu 10 b€ l€ss

6istd1 vdi.li* th& iD sl|eplibl. on6. A nuba of

afecl€d by str€ss in dsught
studja EFn aistee of wilbili9 i! @phylls for pholostrthAis ir EpoM to
drolght fi* (Joh@E ., aa, 1987; CaJldguy .d Ma*nr4 | 992; S.wda ald Sugai,
194).

Allen sd On, (2001) rcDorled thal tltought st $s adv€Ety.lLds photosynih6h by

closing stonai4 disturbing the thyl.loid .leEon Ftulporr chlin ed inhibiting $e
c&bod ied@tion cyclc. M.junda €r 41, (l99l) 3ndi€d lh. a.livity of Rubis ozrn
unda dmughl sl!* &d found lt R$is m dpidy lc! lading ro a
t ilE etivity of
d.ce* ia n t photortath.sis. It ir widcly FIDnd in liidtw rhrt th€ min @.-
slonaial caBe for dc.re or iihibitior of pholosynth.sis k thc reduction or los of
activ'1i.sof @bon cycl€ .nzymcs; ihc hosr imporral o@ b.in8 dbulos t,t
bisphcphlte wboxybs./oxys@ (t wlor !d CoDic,2o0Z R.ddy .t .t.,2W, Mt
el a|'2ln{j Anin.t d!..2Cn9;84@.t d-,2010)-

2.3J Ctlorcpbyu o.tdl!

CNorcphyll pigm.nis &d thcn a@iat d proteia e fodd in chlor@lst nmblms
(Iaiz md z€i8q, 2005)- chlorcphyll bcing e itporla mmpondt ofchloepldts hs a
posilire Elaliochip *ith mtpholosy !.si!. Los of cblorcD[yll @r.nis of *tEr uldd
doughr stt* (M6hi, 20ll) lads b d4@ in Er phot6ylrhcsis (Anjm €r al.,
20ll). Hdcq plats with higha chloophyll cont€nls would show b.t&r Fi. of
photosynihsis. nF deudl-induc€d d@r.e in th€ toial chlorophyll €ort nr of wh€ar
o4E E!'dly wh6 inlensily of deughr sh* ill.ffi (krrys, 2010). fte .lecM* in
udd eEta d€fcil
cblomlhyn @D&nt st s rat6 pl@ du 10 ils phoio{ndrdoa ald
decFdri@ ( njM ., ar, 20ll). Majdmd! ar 091) sMi.d rhe a.tiviis of
€r

chloophylla* &d p.oxidse uder drcu8hl slrlss ed fould that thc degnddioD ral€ of
chlorcphyu wa flstcr $m iE synth6h. Lat€r on Mihiilovic er al (1997) also obwcd
t3
s inw.5. in lLe cblobphyla. &rivit in thc lec of *dqr Dl4ts srbjcLd !o
d$u8h1. Thi! slFs ihrn dsu€h 3a6s dcsF<Ls lhe chlobphyl @nlcnl of plea|5.

Howvcr, dsughr Gistart g@tyFs of whcr! n.rntain ihcir chlorcphyll conLntt undd
drousht shc$ (Pdtod .nd Tdppi, I993).

Thcvdiou fo@s iavolv.d i! sil-pldt{d)06ph.rc @ntinlm ed lpLtc .nd los of

wld @lllituic rb. uG. lElatioN. wlra soil elrd po&ltitl deq.3s, Pldt olmonc
(ehnc) Ftcldd ad h ru lafwra pot nii.l tl$ dq:|!e (Bl'rd, 19?4i Aslnfdr 4i ,

l92i MdE ./ da, 2002). ExFs@ io sEs lelds to ! s6ttl d.c@

dld tEid dcficn
in lcaf osiriotic od w.r.r Fte id of ditrqtot ehcd g@oi}!6 qtilc higl* trdd
dcficii l@ds to sv@ Fdutim in sLr Fl.t on pMct s (K!@a-chop6 &d S.loL,
2007). A3h6f e, ar, 0994) EFrt d vaiation h l€al Dl€l dd osnoiic Po&ntial in
difr.Eot wh.at g.notlT.s $bj4t d to drought. Lvitt (1980) qpLjned th.t l.tf water
Flnli.l b. !s.d 4 a elfttid qicrion to sEd gdoBFs ag.itst drcugnt !tr$
Thc osmlic !ot@li.l of sndt uldq &ou8trl b loeqtd dE lo higtr @uulrdon or
conpdjbt. elul6 i! th. c€ll by Oe pbenon.M crU.d ocmiic djullD.nl (Asbnf &d
F@b4 2007). nre tuin (Moiie or obFliblc solu16 4 tot l elubL .!ge, Pslie,
slyc'ft bctaire &d inorg&ic ioc swh s K' (RobiMn od Jor6, l98q Sakamoto ed
MMi4 2002i Sabados ed s.vow, 2009; Silva er 31., 2010). Thes @nplliblc solut s
help in Minlainug tle tugor potential of@lb. lt is ePoded t r whe.t Pl&tr rlalively

show a lowr dmuLtion of th€e coftDltibL slutes dda drcudt (Navvar ed

Walis, 2O0l), [ow.r &cuul lid of prclift hB b.€! Flornd 6 ihc fist EspoN or
*h.d pbnis rubjcr.d to Mrd defcn (Aljun ., a/., 20ll) Hong-Do dt al (2006b)
.x@iEd $c !!Ao@ of ter wnel SdtF 10 $il sl!. d€6cit in ! Poi qF.ind!
Thcy Fponql tb!. K* ed poliE @cdtltion incB.d @der dtuoebt sss.

P\etltiv. mLt @nl€!t (RvC) is co$id.tld $ n.6sN of pldt wldof lafstdtus

th!u. (Anjm er 44,2011).nd is adwly aifcctd in $tted uder dreugh (Saird er

,1,. 1998), llet Mler r€l6iio6 e impoirnt foi th. a.tivlrion of the mlioxiddl dcf6@
sysren undd dtoudr sEes (Mencod ,/ 41, l95i Kh,@ {hop6 and scloi.' 2007).
 TIF RWC of *t|err plels wsi dorlscd by 43 % (tm 88 10 a5 %) @dd dmughr
(Siddique a dl. 2001). Mliit n&e ofh'gh Rwc ud* wt
@Bid€d as a
tiDited r js
E$siei hcchdis agaisr deught s.ss (St @., dt, t99o) be€@ n is obsry.d
$rt &olghr Gi!|.d c' ivs of*tEt minrlined bighs Ft.tire h&. @nldr i! lof
iises @dpaEd lo lle su@pribte oc (tuhrzf dd K.lD4 1990; Et Hafid ?r 4t, 198).
Lo$ ofell tugor dE to low RWC u.del dDuglt srrss @ulis in e uto dehydr.rion
whicb e's lN of idcgri9 ild mi-p..@Uc Ere of ttmbtu6 tedi4lo ih.ir
ruphft dd btaldoM (Tlipaiht 2000). A 3ignfi@t d.c@ in CMS (@lt tI@btue
stabilily) of wh€at under dbughr stres ha b.e! rcpotud (KhM-ChoDF dnl Setor..
2007; M@v6i 20lt). IhcFfoG, @ odb,e dabiliy Eflets a
lh'siotogicd s
indiqtor of dmught Gitsmc of a enlin pLnr g@type (Lvin, 1980; Btm &d
Eb€M& t98l; Prrchedn ald ShiD|rtr 198?; psna.hedn ? | at., t992 "ftbat\y,
2000). Hidd rh. e[ b@ttrd slabiliry Edc. dewhl !!s, th. higha wodd b. thc
dto!8ht Eiste@. CMS of wbet hs ben exploir.d !s ! srss lor@ indiqlor
(Ashraf?r 4t, 1992; saim €/ dl, 2005).

23J M.ttbou McrioB

Photored.ution ofo in rh. chloroptajrs unda drcugh conditios lezle to pmdurion &d
ecuulation ofihe Eerivc oxygen sFcie& supetuxid€ ard H?O2 (Robin$n od Bbc.,
2000). 'ftc lhyh&oid neEbE6 ofdloioplr,rs @npdliDg &e @aion @rB pSI
&d
PSn eir\. Mjd sir6 of FodEiion of ROS (It3ctive oxygd spei6). .nris
Pncnonoon of chdges in pholo6yst€D eliviti6 LadinS b prcduciion of H:O, by
pholoEdultion of oxyg€r E di6@ved by Mehl{, l!@forc, ir is crlcd the M€hld
E&iiotr ( $d4 199). TL doM,Egutalion of PSII ous.s a eft Bttiitr on l[c hr.
of.l*lron !r..s*d l6v6 todins to fEc ,atticnl prcduclion. nse ie
flow id drcught
Edicals or r.acriv. oxygd spei* e prcdo.ed i! cNodpt cts,
FDnm6 lrd
diioclon&ia of pl&t e s (A$n4 2009). siE 0E RoS bave e cxft,up.ircd
.l@tro4 thcir configuaiion is not stablc. Thcy i€nd !o m.ke th€m*lv6 sLbt by
@ting wirh othd @leutcs ad !rod@in8 hoF fE n<rj.{b. h rhis wy, a cbain of
@IioB is initiat d (Min|6, 2002). Hydrsen Frcndc is pbdued film lh.
disur.lion of su!.rcnd. or Ptotonqintioo (N.w .r aL, 2010) &d is !..@'nal€d in
lh. m€sptyu @lls (Foy.t, 2001). Hrq h.i!s e itrhibitor of Cdvin cvclq is a v€ry
ddgeos &d @ b. lcth.i for plmts (tunf, 2009) Ros ddtrp ldlv aI
ROS

nj.@mlaules (Apcl at'd Hin,2004) and w@ly distutb nctabolic rcadio6 of @lls
(AshFf, 2oO9} ft.y .ae svft oxi.lalivc drnag. lo biolosical nol€cules! DNA,

Fotein dd ligid! (Aeda, 1999; Mitder, 2002; Jhonsn 3r ul . 2003) Kh'lm-chopd dd

Seloh (200?) r€poned . siSnitiol incl€ale inth. Hrq edent in wheal pL g
subjecled b dnudl stess. MDA @nlcnt in qh.at pLnts also incltes ud{ dtoudt

str€s du€ io oxidltivc damg. of ndbrssc! (Hong-Bo €r 41, 2005)-

ROS produdioD ed udulalion is conEollcd by th. .ffici€nt etioxidart sysren of

pldrs Gnlm-clopa dd ScloL, 2007) @mFiring of lhc en2:ttatic md rcn'
€nzyn'ric diioxid4rs. I! a<lditio! i! soD, PoD &d cAT, AlA (.slbic @id), GsH
(Glutahi@) dd aPx is . pdr of thc rs6d. glulrlhioe cycl. (Mold, 2001). They
pDvide pbl.ctid agaiNl ccUulu ald $b-ellubr dd!9. by d\etoxirying ln. Ros.
Sderalsldi6 FDo.Ld @he!d 3ltB tolctu* doc b ovs Fodrclioo of SOD &d
cAT in thc sirdt chlobplsrs (Foy.r,2002; LuD., ai.,20Ot). Drcuslt 6indt
g@t!€ ofeiar showd hish.! a.tiviti6 of SOD, !OD, CAT 4d APX ud€r dsught
srr6s @o9aEd io lbar of rh. (B (Kb@4hop6.nd selote,2004.'I!e
s4irirc
a.4@ularior of &Or 6 [ighd in dmuSh sitirc g@tyFs of l!.d showing dEt
rb€ ROS sdvcnging systcm of lhcs plor3 w Elariv.ly inefrcidti padiculdly tb€

CAT and AIX €nzr@ etivity w lowd in thcF plots. H@s-Bo .t ,1. (2005)
obsen€d lb€ p€rfomdcc of i.n wh..t SmtnB ud.r drourh srcs ll mt@tion ed
foud thal lhe drcusht rcsislad grcup dhibilld hid aclivitiA ofPOD. SOD, CAT md in

tum low€r MDA conlert. Thir sho\rs that lhe m.mbm. damas€ due to lipid
Frexidsrior of wh4t plant! with €fiicient ws lowd. Anong ihe
eiioxidel syst m

nonaztmtic mtioxiddts, .$$ic &id b v.ry impone!. wil[ rhe help of d@$aL
Fmnd!* (APX) enzlm., a@ibic eid play! 6 min p6.t ir odondlrl defde stsld
of plads (Ioyd ud Ha$i6o!, 1994; Noctor.nd rotq, 1998; Smimoff rnd vheld,
2000). Ii tu rloded thai APX i@s6 in wh.al pldts subjec&d to dreugh str.ss

23.5 Gni. Yield

Drelgit st!c! *pciauy th. |mitlt onPoMc in
drelgh Edu4 vi.ld lid yicld

wh.aI (kluaf, l99s). ROS hN. ,n td\&r cfect or a vdi.tv of biolosical

@rcnolcul6 lcltlins lo s@ cdus dtn gc, bhibition in pholostnth€is tnd
hd. r.dsrion in yteld. Kld !r a/. (1990) nudi.d th€ apo@ ofnirc $lst cultivd
&Id rpoi.d thai gttu yield of all vh€a1cultiv.6 de.rsed utd{ droudt condirioG'
vlt !r ynl(t Edues $b6l&ti!Iy eid e
$bj@t d ro [igh l@ls of deught
ptatu
stEs (Keyvsq 2010). Sire 80 v. yicld of*leat b dsivd &om photGrrth'sk du g
mlurilioq thus dc.i*c in photosynihdi! educcs ield (shth dd Paulen, 2003) ll
ha bc.n rcpott d lh!,t Laf pho$tnthBis d &lh.si! d.cEs o'r&'dlv b wlar udc
drcught n6 (AusM a al lg82l Dougbl d EpmdstiE sge caM abonion ol

kmcls du. to d.ctte in supplv of cebobvd!.tcs (Saini ald w€stgai', 2000) Nicols
ad Tulq (193) tlcsi@rLd *bst pLdi usins h.g!di@ cblorate ar lb€ gtain fining
e,se lo inhibit phoGynthesis odd esd deuglt tol'lee of lh' 9@00T6
Thev

$g8d.d rhat drcught ioL6 stFlt Sdot!6 @uld b' el'cled bv llis ndhod a
iedEli@ in pholxlntb6's .t 8nh 6uing ttlge ld b $b'st"tial los in eoin
si4 tnd

liercl widlt of drcurt ssitiE gs9p6. Th. &-r'!s in phdros,trh6is Lads 10

disorbe@ h othct bioohmicd od Phvsiolosictl Prccssd a! wll lelding lo d6c0s
i! rloulh dd y,cld ofthc wlFlc ddt (cbiid!4 20{3)'

2.4Dblsil toldnce oehinilDt to oD. wtrh dtuorll rlla

Dtuuehi lalinadon is . mdbilation of.htneEs in linrcis'
goeib' Gtulic potdiial

dd anboxith.r defeue! ol Planrs (Dw ?r 4r' 200?' Mosdv pluts 6dopt t\o eenedl
sEai.giq drcugltt avoidd@ dd &ou8hl tot'@@ rtouglt lvoid'ne is
i!'
ph.@n@! by whicn pblte miltai! hiSh sal4 poi'ltisl i' th'ir lqve ud'r
'Lou$t
&hi.v'd $rcueh moDholoeical chegcs su'h d
colditioN (Blm, 1988). h is usuallv
dtrc.d sloD,ral @d@ta!e, rd@lion i! laf I.!, dqelopEdt of dEdsile
Nl
sy$.ms ard imEa* in Mlshool t lio (Kuftl|m, 1980i l'vitl' 1980) Drcu€ltl

22
tol.|r@ is rlE ability ofapla to @intrjn md.l net holic tmrioning ad alld
wter pot riiafs (Dw et aL,20o7), DF sbiliry to roL@c dreug)rr 8tr.$ @y b.
obwd in dl plaaq howd, ils cxi.ni v&is tom sFci6 to speies dd d€t
b.tw@ cultivs of lhe tu€ sIei.s (Hong-Bo er al-, 2006; Yildiz-A}tss er al., 2009).
DrcuCt tol@ of a phlt depcn& oD t!. gorilh srage 6 wll a dudj@ rnd sdity
of tbe &oughr 3aB (D.niffL! .t al., 2@, I,l^ns hrE .volvld rol@@
nchdis againn stns dvircl'|mis offcn.r th. cosl of ih.ir Frfollrrc.
Plel rspoNs io droughl e vcry @npl€x. Edly rslons.s help plmts swive
sr.s
for e@ tinc whilc drcught tol@ nebois @ ldg tdn pbtc.liv€ MU6 ro
egulde pler frsrjoE @dd dtuu8lr srs (Pirh.N er 4I, 2001). Pl&Is Espond !o
*Era d.ficir @nditioa l!reD8h a wi.ty of Doipbologicd srd physiologic5l
b4h&is includins Eol6uld t3ponlcs or chaled i! e.!. dpEsion. A gEdl d€.I
of infodli@ on how plart! rcsFld to drcugh ar tlE mol@uld, physiological,
@tomi€l ad nophological lcrcl h3! ben gath€rcd in thc past il@u8! exrBivc
m@! on drcudt rolefue n@hois of plotr (Hutst tld .r ,r, 2004. ft.
ovire'milal ..rt ooleulA Fspotg i! pl&ts &d h.tp
cucs Eiggq phtsiologi.d
lh6 adjusl th.m*lv.s @qdingly (P.rdo .r ul, 2010)- nE ditr nqphologicil and
phrsiologic.l drcudt tol€tue nabdis ir Dlmts e:
211.1 MorpbololL.l n*nnis@
y6 ago, rhey
Ev( si@ ih. pl.nt6 lcn wa&r ard colo.iad rh. lard euad 400 millioi
ble b6 copirs siil dress corditis Cftoc, l99D by adlpdng ! vuicty of
borphologicd adapLtioG to @ntilE lh.ir Sres1h ad swivsl, On of th. wly
dsushr dvoid.ne !d.pr{io6 in pLais b clEnsc in oovsboot nrio (Tmd, 1979). Liu
hd Slut4l (2004) rcponed a Edw.d shoot lrd mt gtuv1! ude. drcudt howvd, the
m1 sn*,lh ws l.s df*&4 Avi@ er al. 099?) obsed ihal lcSrbes lilc alfalfa slorc
C ard N llld.i in Mts sticl [.lp ir cgros{t of plrlt! an r dcfoliatior u d
drouSht sli6s, Alothd nDdm.ntal pldt nlrF.tion -eh""is is gowing dc.Fr @rs
by in@io8 Mt ttickns ad ldsrb willl in@ine drcudr in odd b expbn
avsiLbl€ wGr &d ituE.ie absoDtion cfi.i.ncy (Hur4 1976i Weg e, 4i, 2003). Si@
th€ uppcr laycrs of d.fcil looi gosrh bccom.s mE
eil uurlly dry f$t l)I.Lr walo
dt6siv. u!dc. sreh @ditio6 (Bolq, 196) $ lhal plalt Lp t!@ *d.r .!d bilMls
Gob ihc loM l.'6 of.oil,

So@ pldr3 sh a alfalfa rdd pd4hr!.long qLciv. @ts *dich r.!.h lI€ qald
taue e tt y @6 dFd.ne ft8aiv. qitd pot ials. Sl|ch pldts e cdlcd w&r
sFrdel' (S.lisbury &d Ro$, 2007). T!.y ltid drcught ed lmfici.ndy s the
lvoilabL soil wter. The D6.rt @hderale escale dreoSltt by rDainiry domdn dll
*Bt4 bc@n i svlilable dd thd cmpLt th.i! lif€ cycL in the short sl posible tim
(P.rdo., al,2010). D6ic..li@ lol@t plslts @ I@Er Eom b.lot 10./. RII/C
(Ona.t et a1.,20cot vi.. et al., 2004). Succuldl pldts sucb .3 @li dd othd CAM
(crNd@e r'fid Meilbolis) pleis clos. th€ir stoo.ta duing the day &d @ wate.
sarm b...N tbey 6 st@ wcr ir tleir lbick s@d.rl tissB. sore s!ei6 6
sil.h AoD CAM ro Cr *l*n *d.r b4.lB avalablc (Sdbbury md Ps, 2007)
Vdd sv$ ed wtlr sD.ndes d€ ef.ftd io d "D€sicdtiotr postponeB'(Taiz dd
28i86,2005).

PBdion of elt r los fiob the swf... of da!. i5 .tlotbd drought lsid,G
i4heisn in pldis- TtFy 6nnol w!l.r loss thrdgh trdsPiFtior by ddc6ing ldf
dpsion sd leEf .m udd dreught @ndilioq th€Eby s.ving ihcrelva tun
dcbydr.ri@ (Ricl'dr, 1983i MdeliE .r c/., l98i Liu ttrd St_utzel 2@2i ttlel et al ,
200?). R.dlction in ldf a8 i! .ddilio! io pEv@ling *d.r los fton plsl surf@ de

helps pler in mainlaining hisk! !.t photdynthcsis udcl .lroucrtl Gao9p€s havine
sGls l6vd show high.r L.f *l photoeyrihdsis pd uit led .M (Condo! ed
tuchads, | 993) *nicn @y bc de io sntlla ell siz. It n g.n nilv oberv.d thar pLnt
vilh smdl.r c.tls tuy b. @mprativ.ly dmudl iolcet conp.Ed to lho$ h.ving ldgq
@lls b€cause srniller elh ce mai .ffici.dily (Gupta ed Bdkowila
ain tugor morc

198?). Culing ad wiltirg ofd$ e

lav6 is @ly 6Po@ of plants to derghl slrss
by \riic.h th.y @ ninihir tt qF€ut of ldd lo dir*l sudrgbr (Lehcr, 1995)
thftby lvoidins dcsi@tion. Inc6e in @idcdis ihictnds (Ashtm ald Bqlt!, 1994),
thick$ ad $a,iy cuiicl€, hiiry lav.s @hling.r, 1980), sunko slomata (Ta'? dd Zeig4'
2000, l.lf.bFisio! ed xylm d.nsly (P!!sioE4 1983; scl lnd Holb@lq 2006) e
ale aFn d to b. plet drcughl adrltire Bpo66. fte t:aits my be ruipua|d to
improvc .ltought tolc@ of crcp pl&ts,

2.41 Pbrtiolo?iol Dahrbd

Uidnsilrdine of ihc biochdjcd ed physioloSrcat spou* of pLlts to .lroudt stres
e inporir for dr dqelolc of sf*bl.r. Eicri6 (Reddr et at.,20{,4).W&
ph)siological rcspoE.s ofrldt .gainn dsudrt @ bn.ny d6crib.d a followingl

2.4e1 $our.l .16!E dd pr.d!.tid ot r.B

An inde6. in lesf-.i vapou pFsff difrd.rce is im.diately *Ecd by pldt lav6
which Epidly closc lhen stomr[ dd if @ts dill have sutrrcicnt ahilablc wtd
(Asfu, ai.,2000). CiDrd @lk of siodt lo<{&d in th€.!id.djr of larcs, qidly
lN trrgor whjch l€d! 10 sloMtal d(xN (T.,2 dd zciger, 2006). This $omiAl cloM
@t be ABA (Ab$isic aid) d.F d&t or ABA-'ld@dddl (YokoL., al,2006).It h6
.ow b..n cxi€sively studied thlr a @r-to.lcd sigEl is Muc.d by tlrouShr which is
ErdaLd by trdpnand stre. \r4!cn loil *!rd is dcplet d ad roots sr'n drying,
the

thc sign l is !6si!.d to tbc ldv6 *tich dpidly doe lhcir 3toDrra Thjs chcnic.l
sign l G knoM Io b. ihe hodo@'ABA' (Reddy ./ al, 2004). S@id er ar 099?)
Elon d . dilet FLtion ben€n a!6ci3ic &id aDd don r.l @.d!.lae, ABA is
syDt'6i4d & rdo tom xanihophyls edd drcu€lt stEss ed plays a main pdd i! the
dtuught rol@ drpoN of pl&rs (Shilozki lnd Y@gtrchi-Shin@Ii, 1999)
0Nugt rcgulalid of stornd ondElmc. (wilki$n dd Dwi6, 2004 Sch&htne
ed Goods.r,2008). Stoller at (2000) repod.d rhal & incrcae in xyld sp-A3A ed
Laf ABA po6itirely coftld.d eilh a Edlxliotr in sroo!$l @ndEr!re. Lry siomlrl
@nducld@ or hid stomatal Esist tre has ba Fpott d a o drol'd adaptitr
pal2ftt . (Alla er 4t, l9?O b€aw it d.cFir€s th. dt of tr6pi6tion.It is eponed
$at dought Bislant g@ltF hlE loe bospirarion nr! @np.r.d to rle su..ptible
0!6 (Blm, 1982). In@ed pDduclion of ABA udq drought slrc$ incMes stomatal
Esislae to pw6t stc.los ed rcgah Nso. (Himn ad Wd8hl l9R). The goc
.trcodi4 lbccisc atdchyde oxids& w foed to b. cxprcscd i! s!8d c€lls of
d(t{/dllr'L.d ItaI@ lc!6 (Koiwi .. ar', 200a) AEA e@uhl6 in lb.
'lratrMrs
o.soDhyl s $@ ar plrlt b dlt]drdd (I!iz .td ZiB.r, 2006). HiC ABA utdd
&.rgh ha Dccn r.Eo.Ld to @id.i! bid t r Phoiottilt€i3 by t!&.ing laf 3izc &d
luDb.t of 3t@.16 p.r lc|t (Qlttic (l9l) ABA i! .l& t!9od.d to Fgnbl. lh.
dpBioo of tclttl drcugh idu.cd oRN !.!dFoait (Kin8.rdl,192).

.dlllhat
2,all Ot.odc
TBior didde i! plrnt! ulda ddght tt t ttry iDlonor ro csry ost norDtl
b
n talolis rId SroelL PLlts Dd .i! nrip. u!d.r &orth d.s |bol{l lh FqB
of oootic ldjudn rt (Blu r, ar., 1983i McC\, ed Hanlo4 1990; ltolnb.rg &d
Bulow, 1998). fti! tu & dqlivc o.ctoi3D of dl Pltlt3.g.i8t dtorgh ir* (Molte
., ai., 2oo2i MrLjD .!d Tuqi., .!d A!b.f, 20lD Phbtt .rnthaiz. aqt
2005i Ali
u@ul& vsiour @DFtiblc elutc.; lbiro ai& $d .! Foli!., 3uga3, polv.DiB
.!d ldrhry ononium coDPoud! ruh l' g!4iE bdri!. ctc i! tlsPoos lo (!u$l
d..r $.h !5 K', Ni' !d Cr tlolg trith $cio!., $gu rlcohol3
SsEd imrgrnic iods

.ttd digeaddid- @ .bo iEltd.d lnoog lh. @o!.liblc $lutB (I@E! ., ar,
2003). ft.y @ .l$ cdlcd oooliq, odoltlB d oooDroLcnds, t{4i.h PLY o
idporlllt Fl. i! in!i!. iriig lusor by is!.!iig *dd tpt l(., ptor.ciii€ cdb bv
MtiE8 ROS (f.hod6 rld &db4 l99l; l(.utit.!il Bbl! 2003i TlDm., at,
2003; Pi.h.ro .r dr., 2005) dd ntbiliri!8 Mklo€ s s[ 3 ullitri'n g Flt i!
@forD.liotr @d.r dlo||th tn3i n orStDic elu.t c!.dtl, cb.ticdly lcur.l.!d
codp.libl. si6 cclubr FEB (Y@r ., ol, l9t2) 'Dty &cuduld. lo high l!v.b
in cllomp|s! .!d clrdol @d.r dftugh clodilioB (R.ddy d ar, 2C'@. r}cv d! mi'
toric crto d mbr ccto'jio6 (Alodo ., 4r., 2ml). Tb.n cdc.ddi@ cs Ercb up
to 200 DM i! Dhn! c.l| (Rlod6 rld ser$, 1994). Hosq, ib.d.6l of lh.i!
r.cedrtid vdi6 b.tw rp.ci.. !d b.aH diftal cddla of tL 5e 3p.ci.3
(Pbh.to.r dr, 2005). Oootic.dj!tu@t i! rlFi.d lo bc ulcd n . !.ldtid qil4i@
fd (bouglt |! i.l@ (i/o4rD, l9E4). A lin!| EbtiodhiP bauetn ocboli. ldjusto€o!
ud d.hydrdid *s! ioldrG b! b.t! tu@d (Irllow ,l 41, l9E3) h.ca!s. it
udt .ia nlsor (Mor.A |98a).rd hisl Rwc (noE.d LudLo*, 1986)

26
2,4.2.2J Preli!.
Pblift is hdsic€Iy s ditu &id llodE d ir pl.ni.' 6nd pllts ! oajor ble osodc
'n
ldj\dmnt d ! @patbl. elute !id6 dreleir stBl l! @l|@t!lion dpidlt
incE4d to a gsr dt nt udd Mr.r d.ficit @ndirioc in n6y pla sp@ics (L@h.r,
2001; MoDt-Guadly e? d,2001: Choudh.ry., at,2005; Kavisr aI,2005; Ashr.f ed
rool&1,2007j M.niraM er dr..2008; Anju r/ dl.20ll). Prolift al$ @1s a a

noledd cbr!€mrc to For..t stistlB aid crl'M &tiviti6 of ccnlin

pmr.in
.nzy@s. b dditior io its olc in Motic r.tjNtle (Ashnf ud F@lad ?007), polile
eis a d siFaring nol.cul. i! ceuLling mito.hon<tial rcactioN, ellpolif€ration dd
r.n expl€sion whjch h ne€$aty for Mov€ry nom stEs (Sabodc od Savow,
2009). Pblie is @nsidcEd ! poi.nlid pldt netalolitc wiih prctectir nDdiotu
(sabados ad savoN, 2009). It !.rs d!l a ioxidr (P€ddy dr a./.,2004) by EdEing
th. ,l.nigiig ellels of silSLl oxyCd rd hydrlryl radi..is on phorosys&d n (Ali. lad
Moh&ry (197}bufiB ellulai r.dox po&rr,al ed nriDiB pholciilibilion of thc
Ir
thyhkoid ndbme of chlooplasis by fte ndicd qwnching sd d.c@i!8 ROS
ptodu.tion (AslEf ed Foola4 2007). HorS .r dr e000) obldld rhar preli@ iDctEs.d
sv.nging of ROS prodt*.d by oxiddirc sir6s. Pblic biosl n6is ii a.tivdd wnib
ils dcgtuLtion is i@tivat d udd sr!$ conditi@ (Morer-cu.dry e, a1., 200D_
Sabddos dd Savoe, (2009) argu€ ihil pr.lin€ bidyrhesis rarhq tha prelioe iielf
my be invotved i! stEs adaptaliliry,

2.1-2rl Cly.irc b.a.i!.

clyci'. b€l!i@ (GB) i! a N-n€rbyl sutEtirut d dlTivarirc of th. ditu @id gtycin
(Rlrcd6 ed Hmon, o@ntdion in plalts comiddably ircE46 uder
1993). Irs

droqhr ard sarility stE$ (N.Ltuu et al'200l.1tata.t al-,200),Iokot^ et zl., m06,

Muivllll@ ., dl, 2008) .!d h.lF lotct ell l)mbd6, Folcis dd .r4rd by
mainbining wt . baltue ben'M eI &d dvimmal. It is e .lcldcally rcun l
nol.cul. ed Eadily disolv* in wt q th.cby 4ily inlqading wiih both hydrcphilic
ard hydbrhobic .lonaiN of pDreiN (Srkdoro ed Muhr4 2002). It is sFihBiad
tom cholin€ witb tbc h.lp ofe d4!e choliE ooF oxys@ (lsbitad d, al., 1995).
Il is foud in hiSh coicdtalioN in rh. chlNpLst ed in ldditio! to o6@ric
adjutrd! n d$ hclp, ir st liliz.tion of PSII uldq ondatiE (Pala€eorsiou ed
'lr.$

2.423 Andorid.ll ryrL6

T[c ird&tid of oi.lt iE s!6 itr plots u!d.. s?I.r d.fcit b$ bccD w[ r€lond
(Plddy €r al., 2000i Mr!o, 2002). HiSh l*l of ROS (@riv. oxygc! spd4)
pmductior uDdq oxidadv. Blr.s is hladoa ard toxic to pleis (Arada, l99q BoMi
.r dl, 2001). They d.mlge cell tlmbtucs rad cas prcteb oxidllon. nrdfoE, &
cfficidt ddondrnt d€ftns srstm (c.npririig d4tudc ed mndzyn tic
eiioxi.lanrs) is ..iivaLd in pl4rs i! fts4ons. lo oxiddirc dGs (Rlddy cr al., 2004;
Ashnf, 2009). Tluough lbb syst@ pb!t! h@g. tunrl I*1.
ro tep tho. ROS ar a

Patori er 4t, (2000) Epollld th.t drcurh sr.$ qws e increlse in bbl foli&
eliond@ir of lqvd. A@.dj!s to Mm (200?) . seq@ of ddb 1!les plee in
pldls edd wt r .!.ficit sires. Fi$t tb. .nhft.d lrodeti@ of ROS lrd tb€D th€
cxpBio! of g€i.s ilvolEd ir prodsri@ of etioxidets l€ding 10 highd lelds of
sliqid, i ed ha|cc drolgb. rol@ b !.bid€d be.@ of ih. .6ci.d elivily of

Anju .r 4r (201l) Epon! lbll rh. &osdt td.fue abilit of plerr d.p€lds or th.n
dlioxiddr c!p&ity, Th@ e tlo SrorF of &rioxidlrts i! pldtsi 64ra1ic and !o&
dzyEric. Tbc @ir a4D.ric otionddE @ sou PoD, cAT, GR &d Alx (Reddy

Itu mnarlrric pldt erididlntr @ clNifcd fili!.r ilro $o sreqs;

.r ai., 2004).
Ashc &id lit s€v.!sa, dd th. pistMtt tuch 6 c@t rcft|s, taveoF ed
dth@rdiG (Conklin, 2001; MmeBosh ed Alege, 2002; Trbsi .t aL,2002i Apel
and Hi4 2004; AshFl, 2009).

28
2.4.3 Moleubr r6potrr.l
Mey biochdic.l ard @l.cdd adlpr.iios se .xprss.d in pldts 3ubj4&d ro wtcr
dcficit (R.ddy.r dr, 2004). Dbugh r€poBivc |Mbatis d th. mlQula rnd 8.n.
.xprsid l{.l e try @npLx and blvc mr ben nnlv wd.'sldd tet (aq 2002i
Chaitlrva er ot. 2003i Chav6 ?t al., 2003) A .ubd of gdes e
qpe.icd to b.

bvolved in adapt lion of plants against dreudt lness. Tlt v cd@d. ptor€iN 6shr.d
with F.Eb|e t@sFn $.h Mtd cha@l piotcils ecb s aquporiN
!s AT?ts6 ttrd
(M.ggio ard Joly, I95). Dehldris dd ddicelid sts pdt iB p.oduc.d bv sts
Esporuivc gd6 e th. n6i @mon nd4uls adlltltios pluts apG3 whcn
subj@t tl to drcught etrE s (cuhn& &d Bohtcn, 2000; Tai €/ dl ' 2000; zhu. 2002)
Prot ins sh s d.hydriB (drcusht indu.d Fotetu) e v.ry impoiant ir c.uult
ttmblle pmi6lio! nd stalilizatio of c.rt in a4t6 uda droughl sts (Cloe'
l97i SchwE./ dl,200|; Chowy et d,2cf1iLisg.t a|,2003:''l.iz a ztigd,
2006).

2.5 lupbvirs drc{tla ,oLtuc i! phntt hv .togdou !r. of il.rguic

'!d
or8di. .boiciL/Phll gn& regoLton
n. .rog@ or$d. $hG! eDh 6 bNiNlidt6, salicvlic &id,
alpli.Elion of
tduloF, Slycine b.tsin , Pmline ed agDic &id hav€ ben Fporred ro inFove
drou8lrt tol@c. i! nMy plmt sFci€s $ch s whea! n!i4' blrl€v, sunllow.r and oka

.!c. (It lf dd BiIglM, 193; Att€.4 l996i s@ear.a.r 4l' 2000i sif{A.1 al '20oli
Af-H.timi ord s.rrd.. 20oli Khd .r al., 2006; Ali et al., 2m8; Dola^belrfu' .I at.,
zOtO: Aaditu et ot.,2orr', Ni dd Ashr.f, 20l l) ft* doscloc solutd @v be
applhd io Dl&re s a tqtrlmvs€d prining (WeeD a at 2006;
prc.$wins sating
Bashirld.b ed Hajrch@b"d|€ai), $ a folid spav (gusi! €r al 200E;
Dolat lodid ., aL 2010; Khlu ., ai. 2ol0) d lhDush rh. @t D.diM (siten er al.
2OOl), All Eod6 of apPlicdi6 hae b@ fould etr*liv. i! @ut@tilg th. drce

eftels of stes, howaet .pplicaiion duoud ih. rcoling m.diu hd been foud
rlativcly norc efectirc (Atb& sr al., 2009) du. to continuou supplv of $hte b.ins
2.5.I Alcorbi. .cld
vi,roi! C (L*cotic @id) is a ubiquitiou tuoledc in eutlr}!l6. It is . sDdl *.1d-
solubL vitdin 3!ga. It ws fi6i islat d by Szed- Gyorgyi in 1928, Hc c{I.d
like C6
i! t.'@iic &id. It M llld @!.d a$lbic &id by Harcrtb ald Sat- Gy6q/i ir
1932. It is fouod abudddy in all @ll compo&nls leh !s.po!la!ts, chlorcpl0sts,
cltosol, va@l€, nn@hold.ia dd D6nffi OinC@ ., al, 198). Gffilr laf
@lls @nLin 2.5 nM Mrbic @id; howvd ils @'c€nt6don reach ovd 20 DM in
'nay
cbl@plsti (Smi@tr, 2000). Sonc dics on bi6ydhe& dd nD.rid of @rbic
eid hw. bd publish.d $l'ich ddcdbe thc @nplelc bi6rath.li. paihwy of @rbic
eid (Soimtred wtcdq,2000).Ino.di.t p6uer of @rb,c tuid is Lsal.ct\tm-
l+la.bn€, *trich is fom.d froD DSluse6P via Dbarnos l-P .nd CDP-D-

A$orbic &id pbys e import&t Fl€ ir c.llular Foes6- ft involvq in c.ll

'My
divisid ald ell s"ll .xFEim (PicMlccni ud Fotq, 2003) lh6lby rcguldi4
grc*dr dd .t vclopbent of plels. Apopladic s@rbale is . ofetor for Pblyl
hrdtuxyle acliv.l6 hy&oxy FotG glycoFoicin iquitld for eU divisi@.nd
which
expdsion (Snimotr, 1996). FEUmoE, Asrbic aoid lcts s a @substa& of Fd
diortgc@ rhi.h has s rcL i! !o$ tultktiotd @difieliotr of ell *![ prc&iN
(Anigoli,194).

Asrbic &id h.i4 a lo$qful &lioxid&r sbg6 .!d c@Eols tbe @m.!t!ti@ of
Irlor in pldts (s.im a al, 1998) with lhe hclp of 4 enzyme a@date
Frcxid!&(APX). 'ftis .nzye tmlfd .L.toB fi@ Mritr. to ll1q OvdbSd
peoxidc) Fodrc'ng dehydoMrbltc dd st t s podu.ls (Rlvel! 2000).

A$.!!ot + Hydogcn pdxidc - Dchyd$a*o6d. + wds

C6ll.O6 + Hrq + Cdl5oi + 2It O

Asrbll. hs . turge of APX iso@ztt6 thd calallu the r.ducdon of Hro! to E o

ed MDth 'moN<l€hydro46rbd.' (Asada 199). Thce APX dzld6 w dcoliale
d a substa& rnd oxidi4 n b d.bdMs.o$aL lhrcush tc H.Iiwll-A$da p.tlMv
l0
via Dorcd.hy&odcdbai!. 'fte dehydroascoftalc is rhd r€duld ba.k to N!.orbale. Ilris
@ion @c6 in thc viciriry of PSI. In thb wy, ROS (@1i!e oxyg.n sFci6) d€
diBdy scav.ng.d (Forq od N@lor, 2000).

Its inpod!@ for h[m

6a b€! l@M siF ili dievay s . vilsui!. Ir5 duny
|ptrl. b co6i&Fd r o6pu!$ry pan of hllD di€t fd preF h6lth Mid.I|a@
(Noctor and Foy.i, l99E; MulFBo*h 3!d Alg@,2003) b.cr& I camr b.
stdhdizcd in th. hl)lM body ad hE b be t!}d Aotu en€tuI $!Ms.

A@ding !0 BtH. (2006), e.bic &id (A&{) @nrent in vaiou pler! is e @tler:

ArA (i! n!/r009)

l l0

6 Malgo 20

7 Spi@h 30

t0 46

l0 53

l0 80

*te!t s€.dlings, !$6i. @id cdrdr is uslslly foud b.i@ 2.6

ft is Epon d thlt in
io 3 b8/100 8 wl$b n b 15.3 DE/100 I in !d8!m Its ddlr.tion incia56 wirh
gdell (M.ion ., al, 2010). Aeording to ToIlKi .r ar. (200D r*ds of too
gtmospcm &d &giorFms e godally d.void of th. r.duc.d eorb!i., @nrajnjng
only a linlc moDt of dehydrDs@6.&. Howd€r, or imbibitioo of wt r 6co$ic a.id
ldel sldtt inct,sing npidly {ith Semiiltion of sed prcb6bly duc to r..tirztior of its
sFth6is od6 !o coF wilh lh. brmtul ROS. 'ft. stnlhBis and etivity of ihe APX
'n
crzyE .swi.r.d wilh erbic &id .l$ gnduly $.ns i@€rin8 ei} sedli.g

31
t,52 RoL ofl*orbi. |cid .€|iul rbiod. rtE i! pltult
Rol. of Mrbic acid (@rb.te ion) in d.lioErirg oxidliilc stF$ ir plarts sreM
urdd adv.sc dviloffndts ba beer rcpon.d by FvEnl rs.Nh.u (Gillhm fld
Dodge, r98?; Pstod sd Trippi, 1992i Bsisak ?r al., 1994i KbN et oL,2006t Atdt et
4t, 2009). Aelbic eid b.'!g & .liioxidrat (MigEl d, ,r, 2006) $ld di.d
dogmuslt io plsl! SroM ir salirjty or drcuglt slrs, pdl&ls PreLiE and liPidr
rs'i.d on.htiE dmlgc G@bBi ., dl, 2000; shdala dd N.tfu, 200 | ) by &1i'8
6 a substni. for $.orbdle pddd.le which s.3vdges Hrq. M.nconi €, al (1995)
foud ihat prep.r tunclioning of ricoft6i./8lutlthione clde Mintained Ros ai ile
cod.ol lev€l in {hcd pletr subjwt d to sltcr d.ftcit ExogFno$ sPPlic.lio! oferbic
&id inprcB roEl l4f de, pboLstnthdic Pigi.dls a.d gto*rn of plds Ed.t
dsughr str* (Khs\ 2006: AsiD .t a1,20(4i Dolatu,iia .t al ,2010)- Astbic &id
is ale rpon€d b rynth6i2! prelile which s.t 6 6 osoFsnlator udcr st6s (Sind
et d|..2001).

lr!8 aso, Xrist@yyr and Mluty (1979) Epon d $at .$lbic eid imned thc i.ld of
de frp $bjet d tt st r d.ficit Ads $d Kiilhe (1996) gt * lutAoM s€edling3
in .uttiat $luion @Linirs loly.lbyLnc 8ly@l (PEG) to ind@ osotic $6r It v
Epon d th't dog.nouly lpplied !$$ic &id i.hrbiLd nenbrane donage @!s.d bv

Sind ., ar (2001) s:tudi.d ihc ctrd of alcorbic eid otr cd/. pl&b subjed.d ro
-ft.y aid.d a$lbic lqd b $. $il !t ih. nL of l-7ng/kg a
dtuught slr6s in soil.
fou.d llat M$ic &id bad u ilsailg .fr@1 o! RrvC, ct ooDhvll @tenG.
Dhotosrrtieti. 6& ed poline &cedition in thc plants $bjei.d to drougln irss
&d N.unan (2001) ercw lonaro plots b hydrcponic culfut€ and added salt
Shalala
INaCD 10 the nuticnt ncdiM io indkc sdt srEs ir oft sel dnd PEC it th€ n'tri.nt
m.diu ro ind@ osotic sEs ir ooibd et 'Ilcv obscd rhtt addition of Mibic
&id (0.5 bM) lo lh. nutrie ncdia iftelcd 3..dlitg swi\El.d A!.b siSht d wll
r.s ttcccs.d MDA conLnts, This pDv.d thc lbility of Mbic eil to rcd@ oxid.tit

doEage udd drcught ond sI str6s,

32
Itre etrer or 6 h sdkins *beat gniu i! 0.6 DM eqlic &id elurion Fior 10 ewing
h saline sh$cd soil sli obw.d by Al.H.lini dd Hd!d! (200t). I ws foud rhai
wheal rldls grcM iom sEds pdbcd eiih sorbic eid solution slDwd hicld
@Ido$, sl@t ud $luble s!g& @lrcar @mp{!d to th. M-tr.aild ons und.r slt
slrs. Kbe.7 al (2006) stdi€d lb. .f@1 of.xog.noB alpli@lion of Mrnic eid or
$ttat sdli!$ subj6r.d io NaCl stB in hydtuFdc culrft. Th.y lppticd 0, 50 dd
100 lptn Mrbi. &id a a folid sp6y which ircMed ct[obphyll "." colcoB of rh€

steal plads. Anin ,r al. (2009) foud thrt eo$ic eid in@d frcah ed d.y wi8ltl,
l.dan4 polilc @nten( &d d@s.d lipid p@lidltid od ion lcabSe in ok6 plsrs
subjdtcd to waicr d.ficit 1!.i. 6ult3 &d @lid Eports BeLd rhlr scooic &id ir a
powin edqiddt (Anigoni ed Dc Tullio, (2002) elich oijidarbly allwidB
onddiv. da@gc eu.d by {irought stB,
Ath& e, al (2009) rcpoded th€ etrdr of eorhic &id in implovitrs sdl tol€me of
BtEat pldis. They g.w rwo cullilgts, S-24 (a stl
dd MH-97 (a modent€ly
tol€@1)
slt tol@i) i! s.liniz.d bydroFnic cdtE .rd appli€d @.bic &id at lnc ra& of too
eg/L in Mling b.dju, s a foli& stny &d.F+ewirg s..d tr6tn nr As.bic &id
dndE d golvth, gls qcheg. ch&a.r.ri$i6, Idf a$rbic tuid @r.nt dd etioxidat
aliviti.s of SOD, POD dd CAT. Th.y concludcd th.l appli@rion of eo$ic &id in
etins Eedim wa th! mosr etrdtive modc ofapptication. Dolarabadjan d dl. i2OO9a)
sludied th€ etrcct of Mrbic &id on Miz. pl&rs udd drcudr strls, They dpplied
@rbic &id 6 a folilr A6y ed fould th.r il irco*d tLe &rivirics of SOD, mD dd
CAT, tLdt6y, FdEilg rt MDA orcrt in taE. Dotarabrdie .r al (2009b) rt$
rpplied a$ftic lcid sp6y ro @ob plet! $bjelcd to s.tr srr.$. Th.y apon€d th.t th.
applation of eorbic &id Edeed MDA co!&nt by cfl4riv.ty couraa.tiog thc
adveae effect of oxidalive sires. Anf! e, ar @009) ,Mied lor8hw udo salin€ stress.
Awbic eid w6 .ppli.d G a $6ti!s/pF-$wing s€d haon nr .lon. d @nbincd
*i$ folid a?plicllion- Then 6dts dqld rbd aglbic eid !.lp.d pls s minr.in
llen laf ult! stlehr .d ami.ation urdd sfs @ndiric,

33
Hassan€in er al (2009) rcpon€d that ,9 io eid aPplied 4 a prc-sowing ed rratudt
.nd folid sp6y to mize pla s under ltlitr€ strcs enhoc.d gto*th palntrlers,
ilr@.d th. IAA, c.4r. chlorcphyll piemcnt! .!d d..@ed ABA ld.l. SOD dd PoD
&lirity ders.d vrhilc incar.d, SiEi|fly Dolab!.di.n and Joucebai,
tt l of cAT
(2009) stutlicd th. .fr@t of aslbic &id or @@on b@ greh urdd sll sEss tlEv

add€d aMlbic sid (0,25, 50 .d l0o PPD) 10 Holgled3 nurri.nl elltio! u$d ir
saline culie. A!@ibic &id inc@s.d thc chloDphyll pigndB aad Educed ABA
conienl of Dlsrs.

Dolalabadis .r zl folE applidtion of .elbic eid (50'

(2010) @nducted a $udy on

l0O, 150 bg/L) d c@ ptdls $bjeLd !0.!rcugln s[s ar th. vcg.tni* &d
EpDdudiw stg.3. BiotN &d gnh yi.ld of @m pb s sr v.setative ad
GFodudirc phs6 wG obw€d. Irlcy itPodld that Mbic acid imrca$d E6h dd
dry v€ight of lten &d l.af s wll s grajn w.ighr pe planls lt was foud thal 150 mgll

of dorii. eid s E folid spny ws tlF iost cff4dve in dlarcing gnin vield ofthe
ddig r!i[moc, 100 Ds& of 8oftic eid solulion B.frdtivc in iftMing n@
tBh aod dry sighr5 al lbc rcgEt tir *tilc 50 68/L at dE ltprbdrclivc allgc

Khn 4 a/. @0lO) lrplicd a$rbr eid I0. 50. 100 ds,4-) 4 t pcowing sed !E tuor
in A/drica md obs.ded ihe Crosil of sc..liigs Eon pdn d e€ds undq ell str€s.
They eponcd thal a$$ic @id dl6c€d gre\tfi, in@d shooi/ root ftsh wigln &d

ctdorephyll cont s of satt st!€ss€d plaotr. Thcy foud lhat 100 mgr- asao6ic &'d w!
th. non ctrctivc Lkl in @lioElirg tlE adEts. €fcts of s.lt str.s Kl'lil d al
(20i0) alpliql difrdl l@ls of !5.orbic eid (q 100, 150, 200 PPo) $ . folid anv 10
dNught slts.d bsil (o.tD@ ,6t/dn) alv.gcilrile ard loMing stage ltouehi
sienifi@tly d.cas.d th€ so*th of pl4t! howv4, aswhc &id chloophvn
'tcMs.d
a ed b @naits, RWC and Sros,lh of plet! ft.v foud 100 ed 150 pPm ofscorbic

eid 10 b€ ldel. R6!nrly, Anin ed Hajmh@mdt.@i (201 I ) have

lhe mosr cff@tive

obwed tF .ffdt of ae|bic &id on oba pl4i5 groM in nurridt $lutior udet
osolrc sfts ildu.cd by PEG.'nEy t!9ticd sscoibic eid s a led eddng lah€nt
pdor ro wirg. ft.y rcpod.d a sub{rntidlv ircm!.d ediMriotr m'! sh@i lmglh
 ed biobrss of tm r,\e s€ed! prim.d wirh a$!bi. eid. Az.nirltr .t al.
se.dlings
(2011) sbdi€d dudu qi..l eedlilgr in sslr sEs &d EFned ibrt dog6o!,
opplicjri@ of Mrbic &id (O? mM) in sil ibFoitd @ie s s wtl
cblomphyll .s
.nhdcing goslh ar<l prolir. @ror trtril. dcccNing H1O! @!tor'

2.6 Breedilg crcp pldb to iDpmy. drou8hr toten!.e

PL tol@ ofcrep ptdts. LneEtu.
$icnf6$ bsvc b.cD stiivilg to ioprevc drotghr
cPoris tnai dreught 1d-a@ in 6oF i! rt min f(s of ffit rserch (Matnje.nd
200t de ro dininihins wLr t3olrc€s aEitrbt. to coF. D€Etoptunr of
Tut ja,
dFldt st6s tol€m1 cullivEB cd bc &hicvcd thDugh d.ploying rEditional/mpinc.j
breding s wll a gen Miputation by Dol@old brrdirg (Drbnva et ot.,2l1r,
MU6 .r ar., 2003: Tatd. ,, ot , 2004; Alhni 2010).

h thG pasi, fdn6 hrrc b6 bE ding mps *irtrcur toowLdg. of ea.tics by selecring
b.itq pleB Aom the popularior Yi.td potcnri.t ofcdlivs inprcv.d 10 a ldge cxrenl
by utirg knowl€dg€ of g.ncti.s sFb s th. godic Fi@iplca di*ov€Ed by Mcndcl. n.
.tron to c@biE dc.ihblc planl trails ![!gr ir ditrffit g@typ6 itrto rhe sam ptdt
by cNilg bcg.4 With rlr. dir@vdy of Walson &d cricl's Dodct of DNA i! l9Jt,
g.ndic codc in 1960r Btricrior .nzyE r h 1970r dd rhe d€v.topmor of@onbimr
DNA l4hnoloey in 1980 hs nad€ posibl. lo inirod@ a dcrnabb cde froE @y

?J,l Convotio!.t bh.dllt .pp|@r6

Irnproving yield of croF to e!)lw food s.cuity udd varyins ovirom@B for rh€
leSc \reodd population hrs b€m ftc majn concm ofplanr brccds. Duing the
Dsr
50 y.rF, cNiderable gmaic ioprov€incnr hs bd
road. Birg conveotidst or
taditiorEl brEeding rehniqu€s to d.vetop hiSh lelding cullivd wil|l dcsiEbtc
combhalid of !"jrs i. diff.@t dop sFciB Aslnf (2010) condlct€d e srflsive
rcview oD vdious &oudl iolcmr cultivan4in.s prcdE.d in diff€Ml dops through
Brclding for drclghl r.sistdc. in the p6st *"s minlv do.c thrcugh emPirical

bEdilg by !.l4ting plstts brscd on thcir phdotlTes. TFditional brceding to

improve d$ught r€sisllt@ in vh.d !d olhd croPs l8 bcen Micd dn ainS

eenctic rc$urces iom sses*d cnviromcnt (Skovnand er ol ' 2001). Selftlion for
bigh ield porcrnial udd drcughl ddilions ha lcd !o ibgovcndts in s1|n vicld
of{h€at ed barley (tuau et dl, 2002). Cenetic variatio is imporlsd for ddirabl€
t?it in thc populalid. Gsetic v.ri.tiotr wifiin sP.cis gocrallv qists, howver if
vsiation in the poputan@ ofsotnc spdns .bB not cxist' thm wild rclalivd ce b€
.xploiled a3 a sule of vdi.rin. Widc do$in8 hB b.en dPloired lo iltlode
sEBs Fisrant 8FD.s tom wild rclati\ts (Valko!4 2001) PlaDr gprctic 6o'@s
hav. ben cxplored for drcught Bist nt laiis ed thev hav€ been incoaoratcd
ilrouglr cft3ring and Y&i€ti.i4in6 fd &ought ttrds €nviment! hlve b€'n
d€vcloped (Quicl al. 2001; xinglai er at 2006; Tdruo 3r al, 2010) Howevei,
"t
und.sird c.n6 @ aho h@fdEd P lc qDssng two p6mts !o @obim d€siFblc
haits. For ddDle- hliaL has bcm d€vclop€d bv crossing wltdt ed ryc sP@i$ It
qualirv
i3 Eldtivelr drcught r$ist@t hoBEver; iB graio do€s trot contlin ddirable

Si.cc, drcudt lolenncc ir a complex t int'tution of envircmcnl

sl and involves

*ith dulllplc ga.s so 8.retic inprevdd! in crop pla s for drought tole@4 ha

2.6.2 Brcdin! by Mrld Asitt .l Seletlon

tn crop pbnts. plant bEeders rced to n.DPulate q@titaliv' tals coniloll'd by a

nunbd of g.G, Th.s. qMliLlirt d polvgdic tlits e dfrcult to Mipultte

in t
h.ding pbStu conPNd to ihc M€ndclim taits d@ th'ir ltiScnic mnN antl
b
hisb dviioM€ x g.@ irtem.iior Bv idddrying DNA ndtd link'd to th* l!!rrs'

th.y@ h. .4sily ruipulated ed ilcdPotlt d into conn'Eitl culiir"6 Zhao t' dl'
(2008) ba d.$tib.d thc ptoc.dw for !)dk{ dsist d slslion odAS) in brc'ding;

nsdy physiolos€l dtlysG of fF cop is studi€4 thd selation of g'rcnc @l'@

(ohr&t vs lB@pliblc Smplaln), enlblhhrcrn of a s@nins cdEna, disdtion of
g6aic vdiarion based on Spmdic Lclslogi6 (DNA @kedQTL ddvsit' fidilg
thc rsposible g€n€s ed fbally uling lh. i omatior in lailoring deught GislrDl
cultiw thhu8b bedine or s.netic .ngirenng

DNA ea*6 deret poltsoahj$ vsi.tion in DNA s€qMe (5gndg. md

b!s.d d
Ch.il|m, 2OO4). DNA odt6 h.y bG dctFt d by Non'PCR sEh 6 RFLP (Esfiction
tuglMt ldgth polbdPbis) or by PCR betc{t techniqB sth 6 SSR (SiEplc
s.qu.G EFats). In 1980s! RFLP E thc 6on @tunlv us.d teh.iq@ in pldts ed
eibals ro iddd-ry mlk6 fq tnidyinS dirttsity and @nsr.Etid of c.ndic naPs
(Gdd e| dt. l9l; Mccouch a ai., 2OO2; UU@ ed Mediih., 2000; Kotu.t.''
2ool; Pdlbq.r a/..2001r. In RFLP, S.nomic DNA is @l bv rsriclro.Mtd.s inlo
shstl tagsdts of dif.Hl sift. Thce cln th.n b€ sepdted ihrcu8! el€cirophoFsir'
Radiolabeled ereb€s @ hybddi4d with restict€d DNA dd lhen visualiad bv
.utodd'ognphy, The 6N ensiv. go{ic Mpr Ning RFLP w olBrucd in

toMlo (Bdalzky ard Te}sley, 1986) !d niia (H€l@tdis., at, 1986). Howvcr'
RFLP inrclB n<Lo!.tivity, is idbni.ltly ditrcul to u!. dd vi€lds low PolvnoipbisD.

'nF dilevdy of poltDc@ cbi! rali@ (PCR) bv M![is ad f.]@u (1987)

dobnodzed DNA Mltd tecbmlogy nol oldy in cre! b&.diDg but ale in oth.r 6clds
such s [M DNA fig.rFinting h fot8ic atud€, dlv dcletid of d*.g .g
hcpatiris ald prlhity dis?utcs ci., Thc PCR is 4 @plitr rdid ofa sp@ific Egion of
DNA thil @ dplified Bing a slEd pdmct ltc PCRbed n thods nDv eithd ue
h€

dbitry, sii-ebit.fy d gme sp.cific ptih6 The L.hlologis iNolving sinSlc

aftirsry pine$ N tudom uplili.d Poltmahrc DNA (BAIDi wilids tr at'
1990), dbitrsly pimed w.hh md Mccl€lland, 1990) and DNA
PCR (AP-PCR
mplificdiod 6ngdprinti4 @Ar; C@bno ADol€s., al, l9l). Ir'€e t chniqo* rc
simpl.,6y to ue ard do not irvolvc ndj@tivily eiich hd Mde th€n v€ry poprld
for mappilg .nd gd.dc dimity !tudie, RAPD ald DAF both e svnlh€tjc
oligolucl@tid€s to idgEt s!6ifi. bln u.kmm ddom sire of gmnq DAI us v€ry
shon pri!6 uu.Iy 5J ffi. ft. 6plif.d p@dats e lglitd d lolt$ler-b.ct d
poly!4rylani.le sel ad d.l-Ld by 3ilvd sLinite @ass@ ed B.trtl€y, 195) RAPD
(RlDdoD rEplifi€d polrdoipbic DNA) i! lhc tinPlcd rcR bss€d tebniq@. L Fquil.
lnrl l9l) ad involv$ short EndoE IGE
quntity of DNA (Mic[clnoE ./ a1.,
dlitiry Fil!6 to dptry rh. DNA. RAID uplficdiod 6 b. $FnLd d aeaee
sel (Dmiklt .r ol, l9a). RAPDS @ .tomiDtnt tur!.c dd h€letuzvlpB ildrviduds
c{@l bc difreMtiated Aom homozygos o@s R-APD cchniqws hav. b.co widelv
(Bodkova.r zt, t95; Stubd, l95i [(rtl@ r,.L,2004; Thda d 4r,2006)
ls€d
HMvd, QTL adlysis ltd oappitg e t ldivcly not e slc6snn wih R-A.PD ort6
du. to th.ir non-Eltoduciblc .nd domiml Btun

'n!e n.tho& !.ni{bie&y PriEd e eplfi€d A.smdt ldgi!

'nwlving
polForpbis (AILP; vos ., al-, 195), Eic|wLlil6 tq.d'pdm.d DNA (M]_rcq
Sh,m .t al, 1995). s.lcciivc dplifidion of nicl@lellitc Poltooryhic l@i (SAM?L;
Mo4et sod vogel, 1994) @d @domly @plifi€d micmstellit€ polvnorlhis
(RAM!; wu rr dl, 194) .L. AILPS c b!.d on RFLP3 but slich{v d,frdt ln lhi5
te.b.iquc, rdapt 6 @ li8!t d to.!d! of Gtictior nagDGnB !d lhd uplificd with
pdn€6. Anplification EeulB e E$lv.d or .lenaturing poll€crvlvnide gel. Th'e
ML.6 !rc domiMt io Datw ard ths yid.l pd au.lic info@tiol Oth.t PCR bas'd
labliques iftlude SSR (sibple s€q@c. rc!€l/dicos&[il6)' CAPS (clevcd
@pli6cd polroorp[ic equ.!B), SCAR (scqEa chleLrit d uplificd eeio$)
dd sN? Gingle nu.l6tid. polldorphirn) (VarslEv e, .r, 2006)

SSR (mic.6d.llil6) e 2-E neleotid. E!.alr FF&d in tttdd up ro huldrEds of

rincs. ubiquirou in otlroca o2sellfue., ar, 1993) SsPs e sid.lv distribnted

ou th. g.none on €&h chroncotu (Lin aid Lutv, 1989). Di!@letid€ rp.{r tuotifs

s1rch 6 AG/CT e mc filqMlpL!!i twh d Bt*t (Motsste ., dl' 2002) SSRS

in

hde bccom rcry Fpulu beae of $cir cxrasirc g.mtu @v@sc (Ctpta and
veslney, 2004)- ftey @ higlly polFotPhic, rcpodEiblc in 6ulrs, .nd b.ing locs
spdifi., arc v.ry infom.liv. od rotc.
SsR nst6 h.ing @{oEiun in Dlu. @ dif.cnfDte lonozvgotes Aon
hehzygoGs. Th€e MkGR cd be Hdily arobdld (Shdiflou .t al ' 2003) ed ts'd in
divdsity studi4 s w.ll 4 nappirg of idPoda gen€s, Msjn soNd of gencotion of

33
whqt micGat€llires N John Idcs cent oIC) Norwich LK (StcPh4son 41. I98),
"
tPK (C'aleBlcbd ald G€tudy (Ro<kr, l99E), wbst Ficlwt lliL oMni@ (vMC;
v6hn y ., al. 20OO) 6d u,tFd SSR club (Ni6t .t at ' 2003)

SSR tEhrqE involve foNsd ald dc Find ro dplifv tb' t3lgtr s'qu4c
Ih6. Fib.6 @ d6'8ned fot nsrins csioN of itF Equired FqUE@ (Beka atd
H.ua 195). Ga€nlly, Flyldvleilc g.l is wd to visralize Mplified DNA bv sSR

edtlm, howvd. asflose @ al$ be Led SSRS e considcr'd lh' nct id'd oatcrs
for D4ping stul,es (VNh!.y./ dl,2006) Thev !!vc b@ *id'lv ued in ruv
crcP

sD6id b iddti& Q'ttr dd @Btst s€ldic b46 (Mccosb et al,2@2iLjntt a!

2005; Z6g et a1.,2005; Tddd! et dL.2(nf; sornlin.t zl-' 2008; N'linj
al,2010;
'r
veg .t .1., 201 1: Li a o/., 201 I )

2.? QILM.ppirg
Algaji (2009) defn d QTL 6!pDi!s 6 "tlE D,itd-hcilirstcd g€detic dissetion or
vsiaiion of @Fdd Ph@lyFs ilbueh spPbpdat dF ibdttl ddign md statisical
dul)s€s of segeeding mildals" It b t!. oo.r efrcidt tppm&h for sMving
poly8dic nars 3Eh $ dmughl loto"M *eFeltid
D.aeloPf,€nt of a tb!Ppi!8 or

populalion from eencticdly ed pimtt?icsllv div€$e pdenls is ihe lEt siep fft QTL

{Dlysis Th. .bili9 !o tteid QIrl is hi8!.r in F1 or Frndivd poPdatioN 4d

c.onbind inbr<t lircs, howvcr, oth€i nsPping Populalis such d backdo$, doubl'
bDloid .&l lar isos@ic lic @ .ls 8cd.

2.?J Popul.lioN lor QTL dPPbg

Two @ntrdtilg pdnG @ q!6!.d to d.vcloP e rr hvbnd ehich is *lf'fcrtrliz€d to 8cl

e F, pregdy. Ite i! ecMrllv N€d in sded€ mPping sM''s (Mccouch

F, popdarion

Dd Dor8., 1995; H.tund.z .r al , 2oo2i fnsga .t 41 2o04i sofali$ €l al ' 2008;

.t ai. 2Ol0) b4!s il is 6v !o d.rclop in a shon'r Fiod ot lim' MoF*r' il
NaliN

naridiz3 the domarioi of co{oniMr ma*s Thc Gdonimt n!*s sSre$c

39
sI:2:!d ctb.dooin b!*6 *gFS!r. s 3:l- Mljor drastdlk of[, poptdion i3

fiat a.! individud is a @iqu. 8tug!€ $ .pplication ofo dFdtnot l d6isn md

Gplicario! is not pcaible.

2.7.1.2 Bak Mr poloLlio!

Backctus populatior is dev€lop.d by @stin8 tPo contBling Pdelrts to gel e Fr which
qnich b u*d itr
is frfilF @$.d eilh @ of rbe pd.nl3 lo gd a tacrrc pregdy

mppbs (Bo@a 2001; coPl!, 2002) It is jusl like th. F, lnd hd sinile advottgca

ed diedvdages. The only difrftnce h tlat donimt lnd ccdooindt narkes bo{t
sgcgalcs ll in ba.kN Prc8dY.

2,7.13 DoubL brplold (DH) lhd

Doublc b4loid liB qe dd.lop.d by g.lmtirg hlPlo'd pdots fton hlploid cclls
(Flld or c8s ells) followd tt cls@3om doublin& Doublc btPloid liG e
ompt.&ly honozygoE dl l@i. TLy htlc b€n u!.d fo. i.lenti66iion drd nt4'ping
at

of QTLS in wh.at (Qwie ./ dr,ls,4i\.@ et al ' 200q dtn veou oihd oop6
(Irip.lhy .t .1., 2000: Jing et al , 2{}04; chlouFt .t ut' 2006i KuM t' dl' 200?; Dtslii
., al 200n. Thc ody drsdwlag. of dolbL h4loid tiN is that 0!c1e 6{v 10

2.?.r.4 R@dbiNt bbl.d li!6 {Rlt!)

'IrFy e d€v.loped 0mush 0|cs.lf-fttliliadon oflbe F bdividuds fd nve or
tFli.d
moe g*nliotu. RtLs h.v. bcn usd exl.roivdv in QTLS n'pping stqdiA (HeN€ t/
at, 20ol; Yu d/ aL, 2005i Veg ct d , 2@7i clSN a 61. 2009; Wt!! 4r 4i 20l l)
how€, R[r n €d lons tDe 1o ttevdop and sonciiM tbe PoPularios 3ho*
erllgadon disiortion (S.ns s/ ,l, 2006).

2.t,15 Nd lt r.!i. lin6 (NUi)

N.s i$seDic lirca bde de b.c! used for sdctic @!Pin8 (JaEkongIw al , 2004)
"
Th.y ditrq i. presme ot !h6.ne of a sp..ific t{g€t s.ne How€v'r, d'v'lopMt of
NIL! litc tenbi.a inbtld liB is iiG @sMils b..tr lrc @ltatng pe s

(vith Fspd io a ert in !!io e cosscd sad ihd the pbgelv h boclc$ed for 6
40
goer.tions. Si@ the NlLs will hav. th. s. gtr1ic backSroud exc.pt fo! a
diffeE@ D t si4l. sdc lo@ d loci of @e chrcno$ne, oy pollboryhs
d.tectcd throud DNA oelG tuy bc.o id.nd 6 fintcd *ithlhal p.nicule g@.

A egrcgaing mkd tclls .bour th€ allclic aianis of erch individual of ih€ *ge84io8
populadon, Th* p!fl.@ 6 be s.dd non gcl pictc lner Ming tb€ PCR
udnEdioB @ g.l cl6topho6ir. A gatic lirlog. E p @ th@ bc cdsmei.d with
the h.lp ofgcnoit?ic tlar It pbvid.s informdion or thc gd€ric di$dc€ b.r@r each

Mkd oo ihe b6is ofthet rccombb.tion fr.quocy (Kor'y dd Psny, 1996). ft. uit
or disr.!@ is tak6 d cM (clnri Molge). A disrare of I cM ir cquiwt.d ro l%
Fcombi@tion. A ga.ric nup speifid tlE ordd of es*d ed thc iner,ndk r

KeBy &d P@oy (1996) hlE deeib€d Eioc sieFr fo. corsirudio! of gdcric n ps:
6Bdy, ph.m9ping of tb. popuLlior for rlE quaffibriv! rtri! iho wnid8 of pam6
rorpolporyhim, eenoq?ing @h of thc popuhdotr with th! polrroahic
markds, sorilg of th. allclic 'ndividual
of .$h irdividu.l of rh€ populstion aad flslly'
'l.rB
ddmirlliotr oford* of8.n dc Er*.B sithin rle fnlrg. gm!p.

Ato $oiing rh. data of altclic $ans of.ach individud fion gel ptoto8nphs. rh€ data h
su.lly lubjet d io silri3ricil $ftwe 10 tu&e a g4ric Da! ed dctccr eILs.
MAPMAKER/EXP i5 g@6lly red for thi5 pupo*. Ir consEsrs a g@cric Dap of ihc
nark€a t$ted ba$d o. EcodbiMrio 6!qu€ncy. Ir us.s a nap tumtion rratdaE or
Kosbi lo tr&slate dist n@ inb cM toh l@mbiMiion Ii€qllmy. An atgorirhn is
us.d to o.dcr lei or ! Dlp b€$d m tOD (los of ihc odd!) atio. t-oD ffi is loc of
odds of one hnotbBis (c.g linLge) v€s d .lrderiv. or ndl h,"orlEis (m Dnk!g.}
'fto pregm h u!.d ro dei.ci QTLS on rhe gderic Mp. Q II" C.nogaph€r
a sbtistical

is the n$t populd $iwar.. Bsi@Iy .ll 6e sft,es id.ntify QII,s by f+sgEsation

b<rv6 lle !l|16 .r Eria lai ad rhe all.l6 ar 6€ QTL (8rem4 20ol).
".alrsis
'Ite tuin s1a&1ical n rhods u$d @ sinSle mlq ealtsis, inrdat mppil8 ed
omposit€ iotcwd mppin&
singlc D!*a ealFis (SMA) neilod E IiBr inllodEld by Sd 0923) who dctect d
th. first QTL fo. sad sia !d s€ed pigodtation in bc8. Ir iJ siDpl. .rd doe mt

cquitc 8.n ordd. h ws ANOVA app@h ed is sonetim cau.d lnd*et

rcgE$ion" at oe bi*.r l6i (SoId, 1976). The nuppils popu/.rion is gcnorr?ed wirh
oE blrtd ed is cbsi6.d into te g6up! brs€d d l[.i! gootyrB. Tbc popddion is
ph.en?icdly mqd ald @npoDd for. cqlli! q@rirllirc lair rrlc difctlc is
iadsticdly 3ignjftcdr, th. Mkq h sid to b€ finred b a QTL fo. rhal i6ir. Th€ SMA
delelion mdbd is loq in pow of Bolurion bed$ whd tuk6 @ widcty sD6..d,
QTL @y bc fe fiob th. dart6. S.puG 6tnatio. of QTL efer5 is nor posiblc
6rcu8h tht method ed iadividuals stN g@lyFs e mi$ing st a Da*d have to be

t5d6 etd Eots&in (1989) itrrodE d rhc Intemt Erppi!8 (n{) ndbod. Ir is noE
.d@tag6!s rhe rhc SMA tuihod (Clpta 20()2). ft. IM appM.h ttquiB ! gdctic
ba! md podre8 a cwc dd is ba$d on joint tlquaciB of a pair of ddj&cnt @tds
ad a pubtiv. QI! flek d by ihe rwo ffi.k ts which nak s ir rusibl. ro prodM
nd.ladai 6dD,r.r of ldlrio ald cfccr of eTL ft is llE mosr Dopuls, nethod ro
detd QTrr. Elch l@tion of gmre i! co iil@d o@.1. titu s lo.dio. of purariE
QTL. LOD $oF is calcul.t d ar @h incrdnot (lalking sr€p) ofrhe inr.rual tho fo.
th€ whol. gbup. LOD sE In46 ile sr.ngth ofth. d'den@ of!@s.M of a eTL

Allhough, IM is th. ndr comoily u.d mcthodolory in eTL mlping. Howcvd. i1

wa dsiglcd lo map a 3in8le QTL &d do.r cosida othd linr€d or ulinlcd eTrr
nor
a.treting th. tr.i! *nich dc@s i[. pok &d @lurion of lhis ncrhod. So,
conposi| i!&rv.l tutping (CIM) B irrodwed 3 o@ of iB e(ensiod. Additionat
aankin8 Ddk6 s @-vdiar.s Edu.e onfouding etr cis of l:eby eTl_s (Zou od
zag,2008). ft is lh. molt infom.tive sppr@h. Aly nmb$ of eTk @ bc mlped
adr.€ly th'ough a cue It rEdlB thc .r$'c of d.tarbg gh.st eTb M.jor
&istqck of lM ard CIM n thods is rhlr thcy EquiF a nddad staiisticd pbstu
speilly d6ign d for DalpiDg QTL' *hL SMA mly be @i.d out vith &y sinple
sratisiical eft{a.c using corelation teclriqE.

2.t.2 R.poned QTL' lor dnlgll toLn.c. h ctup pLol!

T@.ndoN $c.g hs bcn n de i! n4piDg tuy agricuhElly inpondt g.m wirh
DNA b'lc6 in crep ptots. QTIr fo! th. tiliG sE! 6 osotic adjrBtlr@l ir sufoE
(ltq\. .t al., 2oor', r,isi .t al., 20Oi!), wUE in ,9/oszn r.r r.4r'4 (Ihm ., dr,
2001), d€€p $il wd.r qploFtion in Ln!@ (Johren .r al. 2000), bot-ABA (Giulimi ,,
41., 2004), leaf gtoMh aod anlh6is{ilkiiS inLryal in tuire (W.l*$ et at 2007J,

chl@phyll '!" .nd "t', oootio poldtidmd icLd in @lton (S.m8! .t al. 2004), t*.
o.*t laf sqlc*.M
of ir etghm @orcll a ar' 2000), floMing tim i. botLv €n e,
2r.,2005), s.d yicld rld dreush su!flibility iDdq in etbd (Du., ar 2009), ell
beDbtue stabiliry (Triplthy .t dt. 2oo0), Mt Lngth (St€L dr ar, 2006) @1 ih,ctGs
(Zhare er ot, 2001), ooi F@ttaiion (kicc .r 41, 2000) ad osnotic adju$ndt in n@
( 88 et 41., 201r', I\obin et el" 2003) bw. h.€! Epon€d. Although QTL mappine

$did for drcught iolc@@ h!v. bdn @nducted in IMy @p3; how.r lh@ re
ooE rEpons on rie (Coqroi* et al,200A: Z}@g .t d!-,2001. Krno6hita ,t ul, 2002;

Babtr et al, 2003; Robi! dttrftt! tr al, 2004; KllM et al ,2@'li B.tuq .l
al, 2003;
a/., 2008; Yd Ying .' at, 2008), wl4t b rh. l4t shrdied cmP in lhb FsD4t

2.73 QTk for druuCt tol.r.oe ln wb.rt

Qwi. ., al. chonosm. subdtitutio! lifts &d populttroN d.riwd lion the
1994 us.d

c@ bet*ra a hiSrt-ABA ptodwi.s *tEt cultirli Ci@ 67 ald . IoFABA ptodEins

Chilw SpdnS wicty to dder QTrr for ABA emuLli@ trdLr drcught slrcss ABA
Gumlldon ud6 dtuugLl slBs lad! !o tionalal clore, *hich p@.nts Mtct 16
fton pL $rcugh ttll3pin id. AMrdiDg to thek rcs ts, th€ g.@ eocoding ABA
prduction h prcs.nt on the chremosm. 5A. Morge and Td (1996) u!.d @ombimr
ilbrEd lin6 ir wh.al dd EporLd ihit th. 8ft for osNgrlaliod wd l@&d o.
chsm$N ?A. Thcy u$d l[. RFLP lehliqE .nd dplov.d linhge aElFis for
.Ltection of QTL. Th.t apodcd iit leslioi on lh. short m of 7A clftn@@' 13 cM

1owlrds th. c.nnomrc &@ tbe RFLP tocu Xprtl 19.

vdma rr al (2004) adoiad Ds linca dqivcd fton the cb$ of tm EwPce Wint'r
wnols for QTL sntlttit of a.g |af scsme ed sdin vield Thcv us.d AFLP
technieue dd detaled d QI! fd flag lcdf sd€edc. und€r drcugnt stre$ on
chsEoem 28. Jisg.t ai. EaFd Q'Es for spft. bngt! u&t drougbt st6
(2004)

onclmm$n s IA,2D,3D, 5A, 58ed?A,tunmb€tof spfteblson lA'4B'5,A'6A

&d 68, fd tml nMbq pd s?it &d l00O gnin wi8h on 2D, 5A 68 !d 78- Thev
cpoiied thst th€ chronosm.s 2D, 54' 68 ed 78 pltved e inpoisl rcle in c&ryilg
g6cs for inpond lgtumnic !!its i! *tcal.

QTtr for Ed@liou in dqs to hedilg, 8nl! fl dralior ed ie@sd dl. of

gten

filliog in a rtuobimi inbtd ltred populalion udq drcodl stcst k@ ide ified bv
Knigwi et al. (2fi14) uilg SSR b,rtd Th. Eicr@tllit -fvm,a otr chremoen' 4.\
was foud ro be s@iaLd with a i\.duction in dlF to h€.dirs; in$*sed san nUine
raG &d low dreurli ss..ptibility itrd.x.

a popdnid of 96 <toubled tqloid li6 tod a cos b.l*a Chit@ s!fi!8 ard SQ I

wd wd for QTL ddlyst by Dlshti €r dl (200?). '[tev suggesled fiat mdt agremm'c

rraits inLritcd diffdarlv in lrfitl ed st* @!dilio6, So, QTL aldvsis is lav
t.iis. TlFv deieted 6 QTk fof
cfici€di in ud€stllding th. geielic.ont$l of th.s.
l0OO grainwis!! | fdp.d@Llengt!,I forSllinvicldond5 forNntdof sEi$Pa

ed. n!.y d.t6t€d 3 QTLS for str* sleflibilitv hdd on chrcffiom.s 7A' 4B dd 68
dd 2 QTLS for si.!$s lol€tlM ind.x on ih. chbdose 5.4 ald 58 Diab d ar @008)
id6ti6ed 63 QIr-s for @opy t mpesne, 43 for chtorcphvll coni'n! l2 for
rd$ointion Fte, 3 for clatik mld co cnt &d 7 for osoiic adjusbndt i! a
eoDbi@t ilbrEd popul'tio! of dtu *h.5 @&. drcugli std

QTL d.lysb h€bs pldt bltedeB to t ilot pDdwtiv€ and ueftl as'iculrud c'ndvs
uing dlrtd 6sisn:d $l@tion (MAS). 't!c w of DNA bdt6 liltcd 10 desinble

ll,ggcc in MAS adds F@ision i! $l*tio! of pldts *ith d.sinble of

Q 'onbiittion
gdca. QTL! for soN com@ially iFporttlt Fdits i! cop Plmrs h!v' b€n iddlift'd
and qploi.d in na*d dbr.d bt! ding pDgrds (Cldvelli .' a/ 2008)
Th identift'd
QTLS will Dovidc sein iofmdon n) Plst noleuld biolosists for clonins 8cn6
udalying tlcs. tr.iis ed thcn @ipuhli@ in cl)ffiial cultim thtugh
biot chmlosy/gmelic oSinding.

2.8 C.!dn Elrilertug

ctsicat bre.ding nethods involw ctusi.g of !6@t! Mth dsinble Lsitt Howdd, in
thsc .!Fo&l|s, pLli bc.dd ts to @Dptonisc for lhe inttodlclion of ud6idbL
traib lirlcd lo th. dcsiEd o!.s, Thc dtat iniroduction of Equircd 946 iluough Scnelic
dsindiie b e .mci. wy to ilEod@ ddiBblc ch68! (Cuhnll ed Bohn 4
2OO0). somc e.neiic DdipuLtions ftr drcu*lt lol@cc have b.d und.nak{
(Csniv€lti er ai. 200E; Asbnf, 2010; Iipdm tld Buiitr, 2010) For qdple
inE duciid of g.@ for biosldhcsis of osnropretec-r{is (Bohn.rr and shcvelda, l98j
E E .r dl., l99E; Mc@il ., al,2c,r',vu',j^et dl 2005i Z}no 4 41,2009: Ashtaq
2010). srcngcs of Elive oxyga acics (Noclot ald foyer, 1998) ad stt s
induc.d ptuleic (ftomssbow, 1999i cnena et 41. 2002l' D6laI et zl 2009) Howcr,
g.ldic iryrelclMl for dDughl asi$Ee in Pnet ltd oD4 6Dps hs not ben vdv
$cc6sntl by 8.ndic €ngiftding, Dowht Fsisld@ in *b@t and oth€r @P plels nav
mr b. lchidcd by inlrodurim of g@.s fd a single d!it, A lrrg. gtow of gcG
@t sys16t, hid$ Flauv. w.1er
contolling a codbi@tion of tdits lik€ .xt€Nive
@nrdr Educ.d v,l.r los, Sood omnc adjuthe4 cll ndb|le $.bililv'
Mulalim of &lioxidell in hidt anoul .ic udd dsuSlt wuld Ed b be

inboduc€d for inprcving Bisrse in 6p pbtrts

A! eeliq studica €pon ihat .xog€lou lpPli@tod of tutio{idots inplovs

'lrought
bl.t!@ of c|op pldl! irclditr8 *nc4 lgdic &id $ d dtioFd,nt 9m to hrE a
good polertial in m.lionring ihc adv@.tr cls of oxidliiv. stress on cDp Pldis but

tuind r€*eb on bi@h.Dicd lnd phtliologcsl bL of elbic &id in pldts

$bier.d to drcuslt t!!s is FquiFd. MGI of lh qo* t lon d f@us€d on salt
tol@c€ of pldt! rbrougi dogooN applic{tion of edbic acid Motov'r in
qdlid
sndi.s |tschcE sdc6lly 4pli.d d En&n d* of @tbic eid wirlour Pdor
opiniation of its nost .f€cdve doe, High conc4tr.tion of a solute mlv be bxic lo
platrt whle a loM ld.l @y b. nEfrdlivc so' th. .!sssi@t of oPtiDN ldcl of
dcorbic &id ltplicliion @ droodt stEs!.d planB should bc died ou MoFE
uifom dtourh to.ll lbc dpdiodltl popuLtid Mv b. 4llicd in hvdoponic
sri6s
cultw by sins PEG (lolrdtyl@ 8ly@l) ii! contitst io eil cult@. L4.Nqfr et al.
(1961) rpod.d th.r rEC @old be Ecd to nodify the molic pot nlial of nuiri4l
elurio! snd ind@ drcuCt stlsr ir t.oftllLd ll|lrw Ir 1970's ald E0'3 the e of
PEG of high (4000-8000) noleulat wiCt b€ec vdy PoPub .! hiShd ool.c'nd
wigh PEG @fit Penct!& into plad lisc. Arnong th. dtoughl iodrcing olnoli€
cmFurdlj PEG i! pEf.nEd oE thc ot!.s (Irga*ff .t d' l lr Slloa 'r 4''
200?). B€ing no&ioxic to planis it is widely ed to indw dloughl 3it s (Ch4n ed
NMua I9'4; zhes ed KirklaD 1996 gaElru d/ .i , 2010). slFh,b ./ al (2010)
ls€d 5, l0 .!d 15 % IEC ir nuticnt elulion for $dy i! ii.c viiL HrEltu t' 4'
i2010) u*.t 8 ald 16 % PEC to ilduce dild and sv@ dtuuelt sLc$s 6p4!vdv for
syb.!! pldts. PEG pollmd ltodued i! a msc of tul@uld
is a Dn-iolic
"d.r
wistu. Thc cdibdtion cw. lle$od .€aiNr tb€ noled! wigbl ad @nc'ntialio! oI
lEG M danonstal€d by Mon v (19E9) As PEG of ditr@1 mol@uh w'i8hls hd a
dif.Flr omtic pollntial Pncd in $llni@ fm, thccf@' (!s'tml of tE optinM
Lv.l (do!8 vErying colc€ftr.tioB of PEC) for indebg dough '3tl's @nsidsinS the

osolic pot rtial is ale vcry trnportdn,

Thu, the trt$t projdl w deigncd 1o .v.lutic thc nost cflddw l€rcI of
crog@uslt spplicd .sftic sil d st6t PttDB ud.. o6mtic str4 @r'd bv PEc
io s. how it dl€viates the advee .ff@ts of &ought Funlcnot, identifi'adon of
QTb fd dm!8!t tol.ru€ in ih. pc.rt Ptoj.ct rculd prcvidc t b6is
ro initir&

war.b @ cloiing of g.tEs dd theii @iPulation for hjghd 'ldogclou Mbic &id
 CHAPTER-3

MATERIALS AND METIIODS

Thc dpqinenlr wft @i.d ort in lh. wiFhous. of th. D.Frtncnt of Botalv'
univqetyof Agricuhu.Faislnb.ddunnSth!wi .r2009-10.td201&201I- S4dof
(he culiiva$/g.notypes ad rhe Ir popdaiion of thc ws Chdwal-86 x 6s'!+6 re

obtain.d !m G€ftlic! Utri@ity of Aericulntr€

th. Deputrcnt of Pltd Bt!.ding and

faisal.bad. All qFrim.nts w* on<lelcd un td hydrcpoiic cult'@ dclPt th. l' ,nd
lh. 6d which vltc perforncd in $il. Scds s@ sminat d on m'e€'cd liller papq in
Pmi plar.s in . Slowl[ oon. Ior $c hy&oPonic dpdihot ,a wk ai.r gmindioll
heelihy sadlings w€E irupldt d on sttrcf@ sh6t! loatinS on Hdglsdt nuiri@t
slulid (E46t!ir! l9?2), AD cl€fic prp s us.d io &a!e rh! dlfidr sluton FGI
M rcpla..d ddv wc.k. Dought str€$ in hvdroDonjc
Hoogbrd\ nuid.nl slt|tion
exFd|Mts s d*lop.d a ck !fte! nttsPlaltatinS lhe 3..dlin€F bv uilg rEC@
rutriot s.lutiot F€diun. In lhe soil €lpednqt'
(Porycthyl€nc glycol) diselv€d in lre

stas s6 dcvcloFd by eilbholditg v.lq A @npLt lv E doDiz€d d6ig! with de

Eplic.i6 wd .hploy€d in all th. qFdn nts.

3.r E4..iD.il t: Algrdl ol drcl8hl toLnne of |to tlol g.notypd

(Ch.l0tr86 tld 65446) grcv. In !o
Ttu s@otF3 of s!in8 *iat (I'i,i@ @3tm L) wilh ltuu doughl_Bi3t M (a
dbusht bledt cdlivd, Chakwd-86 dd a drcught sosniv. cEnotle 6544'6) w
subj.d€d io dreu8h slt* dEinS lbe groMh p.riod eob tilcrilg slgc iill mrndtv lo
Ns ih drought 1ol€me in a eil qFrin@t. ThE wrc 12 plsiic pots (6 fot @h

stutypc) @nt ining ?.5 l(g anni.d sidy lod $il Ta s€.& ofa s.ootvp. *'E $u
in @h po! and .t the m..gde of sdnd lcd, 5 h.dthv *.dlines w.F bn in Por'
'&!
At th. rire of liUitg lh. pols, ibc @ple of th€ eil sw l.16 ar dnd@ 10
'Lt'mi!e
lhc hoisnft @nteft on ov.n dtv blsis (.1 7trC)- IlE moistercl€ase cNc of loil sple

@ d.{.mircd Bitrg thc filta P.!ci detbo<l (Fawn ard Couiec@igc' 1967) $ a ro
follo{ E noistw @nte offie soil in ihc po$. Olinm inig.tion w suppli.d to the

sedlilrs ulil th€ dlqirg 3tage.

At tllc tildiog n!gc,3 loll ofe.! g@tyt vft c.dirD$ly lt9pli.d wih oPliDE
mobtw dd nunitiot while I mi aincd at _10 MPa dordl sit6s Ov *idlDlding
{d4} sil ir lh. pots vs notitoFd bv weiding lhc pot!
Th. noistc coni.at of
.vcrydly dd kFpilg th. misE uifotn vitli! li. 3.t of po!3. Dd. fd tsvdry
biotlB ald sa dcbe8. s,r, E odld tnq ftec aEts of 0pPlidli@ of dro!8hL'Il!e
dbught slres {s @tinu.d in ihe me My ,nd 3 Pldts !.r pot wcF alo*€d lo Srow lill

m.turity, [,!.n planri bc.dc ruly natun, dlt fd Plad heid! spike ldeth' nMbd of

spitclcls, tMba of s!i$ F spikc, 100 sc.d wislt .nd gdn vicld Fr pl6t (totd 8ran
wiglt pd plad) vre cou@t d.

3.2 Etp.rtndt 2| Optldlrdlo! of PEG sonc. t don to hdrc. dbugh !tis.! io

rbqa plrnl!
'ftc oDtnu @elEitid of PEG ar *iicb shat plmts 3howd a si8!ficari stlss

s i&ndtred uins t si!81. vdiety. S.!dlin85 of a *ed cdtivd' trsi 2008 {cF
tmplari.<t into 12 plaslic tubs with 20 sdlirgs in €eh pla$ic tub @nt.ining 4L of

Hoagl&d's lutiol stutioa CotuentiliN of 5, 10, 20 dd 30 % PEGI@ wt tslcd

ftc ocmlrlig of thd difrffit me ralroB w.le mq8!r.d Bilg e (Mob'rd'
Th. opidM str6s ldcl ,ffe.tilc pl6E *rs eEluiod on th. btsis of vbutt
ob!.flation dd in ims of t€du.rion in leaf Srost ed l.nf net pholosldh6t of
rr*s.d plers @npdld to @ntFl pbtrts lndtuo @ks ofrpPlietior ofrEc T*ntv
% PEC (4-6 MPa) M foud N oflinM cot.ntltiotr Et {bich pLlts suffdd lts
bur did rct show Frnrn wilting Fulhd dFinmts u!. @ndu.Ld
Bi4lhb lcvcl
3J OpllDizrdor of s@.blcrdd (,,4).o.c.nlhlto!

scpcL Eirls w@ @ndud.d for the difr.mt DodB of .pDlic.rid of Mrnic &id
(in mtiDg Eedtu , s t folid sFy.nd sccd piimits) ro oFioiz.lh. @ration of
Mrbic eid ine.h modq of 4plic.tion. ntc *'ltcrr cultiw' tlr&i 2008 m ucd in
dF trials. Thde $€e l8 dD.rim€dal nus, .!.h cotaining 5 $.dlings in 750 dl of
soasldd'e dutiimt soludon. Dbwhr str $ I ryPli.d aftq ore Gk or
ti&splsl|:olion. PEG@ 6 disel*d in lhc E dim i! ttte cqu,l d(s wil! tr
intdvat of oft.!.y udl 6c finalon@tntion of 20%. tiv.lev.ls of aglbic &id (0'
0,5. L l.5 dd 2 nM w.G u.d in €eh no<t! It@ vft it@ plastic nugs for
'a'h
b!!mn!, Dats for gB .xchdgE \@ recoftt d otr fullv qP&&d ld leat h$h/d4
biollN of th. plrlrs 6 ale @rdcd Th.l4l of .s6ic !'id al qlich platg
shoe!.!Elxinw erc*th dd na pbotody hdic E& uada dsuglt s @Nidatd tlc

33,1 ErD.riD@i 3: A$dDdt of optlDnD lw€l of ucorbic eid for mdng

D.dlm
A qek anq tllsplrdlinS 3.cdlin8s in qo|glitd's soldion, of th' tolal l8 nws' 3 wE
in
1atd as @ntol eith Hoagllnd's nutri.nl elution onlv, in fic other 3, PEG disolved
E@gldnd's nuhi4t elution, ed 0 5 bM eotbic rcid' 3 vith PEG 4d I
3 with PEG

dM eorbic &i4 3 *ith PEG ud l.5sM @rbic &id ard 3 wirh PEG sd 2nM
qcboge ed Pldt
aglbic &id dislv.d in H@slaltd3 lutti.t solulior Dd! fo! ga
biomars (n!sh dd dry *lights of sh@rs &d Mts) wE F@dcd tm
@ks ancr in'
ftaltnent. Arung the 4 lev.ls,0 5 mM lsdic &id $ludon {s the nct effcctivc in

m.lioEtilg rhe deug)u .frcd .nd ws u.d in th. ExpsimcDt 6'

33J Etpdid.ll 4: Ax4oot olopliDud Lv'l oI .@rbh lor fobr !Pr.'

'cid
Folis tptly 6 dislvnS the rcquiEd mc"i$tion of dubic eid in
pEPsed by
distjlLd *!ter *ith th. addili@ of o.l '/o t@n 20 (as ! surfe&ll)
to incEsse
aboit€!.e of tbe eluion i.ro ln. 16!6 A e€€k anq ltadedng sadling5
in

Holgldxl's Ntti.d ebno!, out of lE nug3 I 9G tsl@ s ontDl

with Hoggled's
49
nuii@t ehtion only, 3 with PEG dislrcd in Hdgland! rwi6t elulio! dd
qith 0'5mM
s.€.tlinss spray.d wilh dieilLd mi.r, I with PEC ad *.dlirys tr4&d
$.odic @id fotid sFay, 3 wilh Pm dxt s.dlilgs spnv.d wilh ln $@6ic &i4l
qif! lEG &d s.tdlings sp6yed wid 1.5 lDM asrbic &id @d I qith PEc ald
$cdnlss sFiycd with 2 dM eo$ic acid. w6 applied
&ual volM. of folid sprav

rwie (wirh d inGdsl of orc w.k) !o a4h s.t of Fcdlings tr:b for 8rs d'h&ge ed
Dldt bioEns qw t@iled rvo re€ks.iq thc tGh. . AmoDg tbc 4 l*b lDM
4co$ic acid $lulion M th. rust efr4tivc in d.lio6ting ih. dmudt 'fl41dld wa
w.d th€ Expedmnt 6.

3J3 Elpqiddl 5t Asd.d.!l of opdDrD kv.l oI .@rtlc tol priDi!8

"id "d
l, I 5 and 2 bM eolbic rcid
Fifty se.ds wcrc $ok d for l0 h in @h of tbe o, 0 5,
$luli@ b plsti. b.elr€6 S..{Lt p.tud wib dinil.d wt . (0 eo$ic eid) wrc
t'ld s @rrol. Thc eald sc.d! w6 plr..d i! P€rd Plda for g'mitrlid Ana oc
wk of irrtslleli!8 s€dlin$ i! EGgldd's iri6l s.lotio& o$ of lEm!8s,3w'rc
t kd s contol with H@glandk nuiriat s.llnioD onlv, 3 witb ?EC diselved in
H@gtrnd\ Nt i.d sl|nio! .nd sc€dlings Fin d *ith ml4, 3 silh PEC 4d s'Gdlings
Iion *.d Dlidctt viih O-5 nM Mbrc rcid, I wilh PEG ed sedlings non Fd
plined *ith I DM eoftic !4id, 3 Nith PEC old *edlings fion s4d piim'd wirh l 5
n as.orbic .cid .td 3 wilh PEO aDd ,..dli!st nod ed PriEed {ilh 2hM Mbic
eid. Dd! tor g6 qchtlg. &d pla bioEls rw teodtd le! wceb anq th'
ft.tnot. AFong O€ 4 ldck u$4 t nM Mbic a'id ellnid 3 s'ed pdning
M[rcd G mt e$dtiv. in tulDru'n8 the drcugh! efr4l nd @ u$d D

!.,1EIp.riD.!!6: CoEp.rlro! of difredl Dodd of.!otbi' t'id tppllotio!

Gqnitil d r..ditss oft drclsh roLtut cultivd, Chd'val-E6 dd a drcuslt sitivc

gcnotyF, 6544{ 9d toEfqtd inlo Plsnic tubs @h contlinilg 4 litd of Hoaglardt
nulddt solution. The oDtimi4d lev.ls of ts.o6ic acid for elch modc of lpplication
(@dD8 ocdiu, folis spav ald Fiming !.!tn4o &bn th' Esulls of
'ldmincd
Etviou qFimats (ExFiddt 2, 3 atd 4) r@ applicd Out of lh! 24 0$€ (@b
50
hlving 20 pldts, l0 or.!4h gaoq?e), {cE wiih Hoagldd'! n{ric elutior onlv, l
3

wilh rEC diselv.d in Hdglald'r out i.nt slutio!, 3 wiur 0.5 oM edbic 4id
dislvcd i! Holslod\ nuEiem elurion, 3 sith PEG dd 05 bM Mbic &id
dislv.d h Ho!8lddt lui.idt slutio!,3 wiih I mM .$dic &id applied a. rolid
spdy ro $. se.dlings! I with PEC .rd I DM astbic aid apPli.d a t foli& spsy to ihe
$edlbgs, 3 with e.dlings &.n !..d Fid.d vii.t lmM eo$ic &i4 3 wilh PEC &d
s€dlinss non s.cd pio.d with I mM r,ierbic sid S!.ds \r@ pnbe{vsoar€d in
Mbic eid solution 6 plwioB .xpdinent. Fd loltu spot cqua.l vduc sas applied

t{i@ (wirh e intcnd ofoE w4k) io ad s.t ofs.!dli4s.'Ilt followils pltuei.b

wre rcod.d fiv. w@ts lid trdpldtadon:

3.4.1 Phnt DioDur .rFltn bl

PleB lre
hN.sled dd s€shed wiih dbliU€d wtci, blottcd dry .nd spda('d into
sh@ls &d mis. Tb. sh@led Nt ffi biotlN * lh@ E.rd€d

And t4i.g n$h weish! ihc spl.s wre ovadried !t 55"C for 72 h ed thcn dry

3.4.2 rhobrrnth.tic pigD.nb (Cnbmplyu "r'ud "b")

'nE ndthod of Ahon (1949) vu u!€d fd th€ .td.mimrion of chlooDltll a ed b

@nicnr5. I-4f spl6 (0.25d q*

.$ ald len ovmight at 4oC iD s ttl of Eel. aclone'
The next doding the qtra.rs q@ 6ltifu8pd at 10,000 rpm for 5 nin 4d thc
$F@t d's d6o$6!@ M eord.d al 645 dd 663 M Ning a sFcnoPbotoD't'r
(Hir!chi-U2001, Tokyo, Jap&).

The folowiDg c$!li@ qw uFd io d.Gmi!. lhe cNomphvU @renE:

Cl oephyll 0.2? (OD 663) - 2 69 (OD 645) x v/1000 x
a= w
ChloFphy[ b= [22.9 (oD 645) - 4 68 (oD663) x v/1000 x v
v= volme ofthc cxtr'.t (nl)
w= wiehr ofthe tEsh l.afti$e G)
3,aJ Gn .!cb.rge Drru.acn

Gas erchsgc pardct B $ttich included n t photosvnthetic ot€ (P'), lrdEPiration latc
(S), s1oD.Ll c.ndwl@ (g') .nd $b-sto,t'drl or $b-lionattl cq ct)lMFatiod (Cr)
lr@ madc on thc 3d lcaf of ca.h pla Nitrg d oF! svstem potublc infrlEd 8r'
an lla(Arslt'tic.l Dd.lopmot CoEP.!y, Hoddcet! Frstdd) nF n6uffi.nts
qF cfiied oul dtrb8lh. middl. hos of i!. dly to gcr uifom ligh &d idFnt'E
@nditiotu for all th€ pldis nqsued in eeh cxpeinent The light intetsitv wied fton
l20cl40o Dr t'. Th. laf chuhd ws cldP.d ovd th. c'dltl Potti@ or l!'
'lml
lc.f, adaial $de up. Duins nan|Mqn the lea{ bcing m*utd rc s_shlded bv
othcB art tia chmb.r w4 h.ld it! ! FositDn to altow th. Ld tdinu lidt

Ti. laf cldbd of IRGA Fovid.d ho@8mN 6viF!|Mt 1o nininize lcEFrElle'

Cq drt wtlr tapou ga<licnl! s th.t CO, sidLtion tal6 @utd b' {tddnincd in !
kmM niqoclirrte. Th. ef.de air *€r &i.d bv Plsilg it ihous! two colutu of
silio gel. A solll tu visMly niflld 6. .ir ro ellse . hiSi n& of !n E(llddl
mund th€ l.af ths, inc@ing 0E boundarv b)€r .ondwblc' b hegt ard gsou
r$fd In ordd to @ndl laf &oFduq U. uplq wildo{ of dt chtnbq B dtdc
of s h€t rcfl4titrg gls which nininia! th@al ddittion @ching thc l4t Duing

m6um.nt thc t..f chmhd ${l h€ld in su! a *.v lhal th' l'a{ vls
'xPos'd
to

ruinu light Ore a lcd E ilst d itto lhe laf cbdb€r, rcl phoro6rnthdic nL'
dspidjoq stomabl @ndutlee ed sub'ttomltd CO, ws ndwd ir drc
diffdrdiat no<tc of rlF IRG,A. A! sn s . dedv r.ding v$ ot64v'd
(Mally
bcwen 30-60 e@n&), it w.! r€srded. The IRC'{ als n6Nd rhe flow or air
tbblgh lhc chebq .!d t@dcd lb. difrcr.@ i! lh. nob nlttio! of Cq bdwd ltt'
chubtr dt'M snd thc onrld, Dlalirc hmiditv Gq%), lir t'EpedtN CC) in tte
.h@ber ard pbobsynlhdicstly edvc adi.ri@ (PAR) D,rnol D: s' in a sdgl'
Brdioe. Using tbe d.asl|'!@!t!, l6f sd dtd pmp flo* nLr t dtra
bggd

@mdted to lle IRGA cdcubt d gs *chrnge pa..n'i'B b6std on th' follo{ing

fomub. 0.6os .nd tlrlsE , 1987).

P, i, crlculd.d by lhc eqution:

E boLuLt .l by t!. cquli@

t=(t). t0,-x"!0 -r,I

& is 6ldb&d by tL .qudim

s"=Et6,Trr')
Cis cdcubt d ry tt. .qudid:

c'-c!-l(P.x l.6Y orl

Ac=Cprdifttdli.ltt'!trdt E e* !d.!dtrn!.ir d6E (Dol mf)

&= Molc t .iid of\rdd vspoE.t lc.f c.hb.roulct (nol ml'')

t,= sattlrlt d!4ourp(t s@(dd nor')

q = MoL tElio! of COt in ould .ir nlo hf ch.Dba gir bv (c! ' AD) fid
r)
Ffad. ud dif.rcnt l EslBots (f@lcs nol
l-5 = Rrio ofdifrlility ofclCr dd tdd i! d
Slord witli! th€ loggd aft s numbd ofc.dti&ts 3on ofstdcb hld lo b' d'c@ined
dFiD.lldly, Th.t s@:
l) BoudN lrE Big3re l[)

This ws dctcmincd by alosins both sudac€s of ! 2 cD'@. of damp filLr plPd

witbh tb. Pd*iM. l6f cbaDbd !d 6.'siog .qdlibrim r|,|lirc hMidit and
culfttc sir tlbpedt@, It ws Fsiblc b n d ofr4in nt t mol' fiom a ltlP.rcd ghph
of boundlry layd &sisr3ne .glinsl ela{v€ hmidity $ppli.d wiih ihe .qlipbat

a!@!r
This is th. Bpon$ of t!. IRGA ro infnii. r'nt r @IM!'.rroN This @ ddmined bv

p$i!g CO, - fia 6ir ttlough ilE rcf€de inl€t on thc erlya wiih lhc aulld set to
€fcl!@ ald tdditg 0E ssrirc dcfl.ction oo lh. @dtn COt- Ae an of boh
wai.r wpou @nleit ws rb4 p!!sd thud! llte an lla tud tl,e ftw + ot - @dbg
B reord.d. fte difraen@ b.tEn thc two MiinSt g|v. t[c ilsltu'@fs 6po@ lo
bomeltd $!ou co c.r Tbis M @NetLd lo Ena,( bv rcfdilg to a F P.rcdlable
suppli€d with th€ equiPm.nl.

3) Atbo$hdic P65@

'ftis *s oblained wit! s buobcid pla..d in lh. ClNhoe wbcF n@em@ls vd

4) Ilov R,ll

ftis ir lh. rcld€ flow nt! ofdry lii into ihe.uvefr. in th€ IRGA ton volMelric ai'
slpply uit. It w6 s.l ct 400 ol pd nhut in .ll ib. dFdtMts

i Laf AEa lcn'zl

Ttjr *s, d.imi!.d filn leiSlh trd sidth a ds.dih.d rboE.

Tn dah tom th. dll! logg{ su dom-loatt€d dir6llv 10 d conputer for an lv$s The

6poN of th. IRGA to co! * cdibr.Ld teddlv @rding to $c itlllu'tioc of

nduf&turlls.
3,1,1 R.Ltiv.
'rt r 6nLrl EWC)
lraf spl6 w@ @U.cted aly lof fion .eh plst
in rhe domilg. A tully .Lvclopcd

E $ir.l\ $.be ddcd wilh ri.s fq!d, wntped in pLslc ziPp.r btg ad srod in a
@nlaind fiued eilh i@ at th. botr.n duins s@Pte coll€tion. F€sh wient (Fw) of
l@f wpla M eordcd @n anq tak€n to ltE |lbdtory. Ana 6king A6h wighii
the ldvca qw il:fus.d in dbiillcd MlA .rd kePt ov@ight !r @d temp.rar@ anq

whjch ihe tureid l!'dl .&h l.if ws E@ded IlF lov€s wr€ ceirllv
(TW) of
blon d dry wfth ! riss FF prio. to dd.diMtion of tueid wighr
'ftd all sPl6
qw ovcr-.ld.d a1 70'C for bduing dry w.iCls (DW} Rvc E calculated aing ihc

RWC - G W-DIit/Tll'/-Ds') 100

3.45 C.ll n@bd. .t biliry (cMs)

Icah lcaf Mpld q€lE 6llei.d s for RwC lav.s !ft iiE d with deioniad mrer
to Movc auf&. cont dioalion &d ltB bloit d d.y Twdlv sEll laf diee fton eeh

splc rw sbbcrScd in lO sn ofdeioniz.d v!l.r i! dlt cl@ vid5 and L.P at @n

ienpd$rc in d8k for 24 h. Th. viab *!e 3h!k@ vigoroulv pdor io the decniMtion
of ondmt !@ of th. $luli@ m€3su.d sing .n el6ltical cnndetivitv m€ier' Th. vials
9@ lui@lavcd for 15 Din dd @!ducta* I.gEin obsved All m.asNndts *@
@oded ar roon tcmp.6t@. Ccll nMbme stalilitv wd c.lcdat\td 6 MiProc'l of
el'liE eU injuy (Bld dd Ebq@A l9El) Bils th. fouowing fomura:

cMs '/F I( l-r,nl)/{ lcr/ct I x lc'o

wbdq Tl= Iririal Ec ofstls ssnplc

T2= Fbal EC of sres spl€

Cl= bnid EC of@otll rdple

C2= Iinal EC of@nirol gamPle

 !.4.6 lx.f orEotic DoLnful

Lof spl6 *4 collarcd N for RwC. Lcrf tupl6 *@ toa

teloe - in a tEa
20oc for svd daF. IlE fi.z€n lesf l€av6 \|@ thawd dd rh. @tt ep qrr&tcd by
ruihi.g thc sbDle wilh a glirs nd Osoric poicotial of ih. e[ s.p w nBuld
lsine & osnobelq (wcgr 5500).

3.1.7 Toa.l rolobL pnGin .nd OG rtivity ot ldondrrr .!ryD6

Laf Bmpl.s vft collccred s for RWC. Firc sn of 50 rM @ot.d poiassiM phosphate
bura GH 7.8) E uscd ro gnd rhc l6f surt. (0_259). .rhe dE!.r ws rh.r
ccnnituged lt 10,000 rph for l0 min !l 4t. Halfofihc i$lal€d sup..laror M Ed fo.
pot€i! d.i.nir,lio! u'!g th. ndhod of Bndford (t 976) {ttil. oths tdf for &e !ss.y
ofth. folloeing ddonddr dzrm6

3.4.7.1 SrIFDriil. dltblrs (sOD)

'nE @rivig of SOD ws dcteftin d Bing rhe mofiod of cimopoliris

.nd Ri€s ( 1977)
wifi enc Eimr nodificaliG. Tt I@iid nixt@ 6 tr.plrd by ,tlding j0 pM
NBT (NBT distvcd in phosphaic buffa), t.3 rM dbotravi& | 3 bM nerhjonine dd s0
nM phosph.te bufld (tII 7.E) !o 50 rl ozrrc *F&t. The oixrur m th€n
illmiDld udq fstlgr tmF of 30 W fd t0 nh. ThG phoror.dudi@ of NBT w
heAmrl by recording e iodrse in ab$or6ec. al 560 M uing a try-visible
sletolt'otoder€r (IRMECO U2020). O.c tuiid EixnrE wihour €nzyrc .xrr!.r ru
kept d conrol. IrE anout of o4dc r.quiud to j0 % inhibit rhc nt of NBT
tdudion .t 560 M in coDpei$r with @lirol 6 cqlrt ro oft uil of SOD,

!.4.?l C.t h!€ (CAT) tnd p.ronduc OOn)

Thc a.tivitie of CAT Dd POD ozrD.r v@ d.r.di,€d *@ding b Chde ed

Ma.hly (1955) wilh son nodificati@s. fte @don mixlw for CAT qls a brat of j
ml ortsiling 50 EM pLo+trG bufrq (!H ?_o), t.9 rdM Hlor,rd l00pi oz}rc
.xtet Chdg6 in rbelba@ of rh. etuijon cwry 20 s (€r!.d by Hro) dc-@nposirion
inio E o) \r@ l@rdcd !t 240 !m ed B€rc .xprcs.d !s lEot of Hro, dc@npc€d pd
nin p6 bg ofpFEin, The rcadiotr bixt@ for POD rc a tot l of3 nn @d!ini!g 50
nll phGphne b!fid (!H 7.0), 20 DM suai@l, r{) mM Hrq rnd 100 d .Dzymc
cxtlct, Ch&g.s in ab$rb&e of ltre c.cti6 solution.\qy 20 s wB E@rd€d at 4?0
M. O!. uil oI POD a.tiviry w cquiv.Lrt ro cbdgc in .hsft6nc pd ng ofpm&i!.

3,.1.?.3 A!@rb.te p.rultdrk (APX)

Ih. &tivity ofAPX B detaEi!.d foUowids Aed. sd Talrhashi (19E7) wirh bimr
nodifica1ioB. 'fte r..dion mixtft M a ioid of I d conlairing 50 mM potassim
phcph.!. bufq (pH 7.0), 0.5 bM 8.r$ic &i4 0.1 EM HrOr ed 200p1 enzFc
.xtract, Thc chag. ir ah6orte. ru @oded al290 M for I Ei., The dEr.
etivity ws qprcsd d U hl' c.ooin 6r= t O.t abobaM nirn ngi
"1r-t"

!.4E A!@rbic &id (NoMzyErli. utloiddt)

Asbic !.id @ dcimined a..ording to Muk!.rje s.d Choudbui (19E3). An doMt

of 5ml of 6 % richloM..ric mid {6 !*d ro gind thc ted @pl. (0.25e) foi
cxtrlid. To 4 rl of thc drac! 2 ! of 2 % dinihpncayt lrd.ziE (in &idic
d.diu) ed. drop of thiou.! (in ?0 % eihdol) *crc addcd. 'Ihe nntuF re h€atcd
for i 5 nin h a va&! b6ib .4t rhcn @t.d io @n r.nFEturc. Aia @lory 5bt of 80
% {v,t) H2SO{ wa tttdcd to ih. loldid whjle lcpilg ir @ ic. !r ooc. rh..b$rb.n€

ws E@rded a1 530 m The uMr of agftic &id 6nLn1 iD cach tupl€ E

crlculaLd ton a sta.d.rd {,@,
!.49 MDA (Mduodl.ld.[yil.)

TIF Lrcl of lipid pdndation in te@ of ttiob.rbituic eid @ive $bslaMs

(TBARS) cor@tration m deledi.cd &@rding ro yagi (1982) wilh minor
modi6.!ric- IAf riss (0.5 8) E qr.ct d by grindilg in t0 d of Ol % TCA
(tichlorcenc eid) dd entifrged for s Din at l5.O0o x 8. To t ml of su!.@rcnt, 4
hl of0.5% rhiob&b.turic &id in 20% TCA B add.d $d h.!.d ar 95t to,30 nin_
Tt€ mpl6 *@ c@l€d ed rh.n absbee E Ead ar jl2 m. v.lE fo, non_
 sp€ilic absrption d 600 @ w3 subt?.i.d. Ite .b$Ation cemci@r w cdculai.d
at 155 ttml cm ' tud dplessed s morl'/tDtg fi6h weight.

MDA lael (mol) = (AJl2m-A60oioyl.t6 x ld

3.410 Eydrog.n p.rcnd. GIrOt)

Hydresd p.roxi.L @ntor qlr amrdilg io velitoE ., ul. (2000). A!

dercmin.d
dornr of 5ml of 0.1 % (Vv) dcrnoM.aic &id GCA) E urd ro gtud l[. tdf
sple (0-25s) in a pr€{hill.d p6tle ed mond. 'nr. .xra.t w thd edritu8ed at
12000 rpn fo. 15 hil s
TtE suprErai (0.5 Dl) Dix.d with 0.5 tnt ofpolalsib
phosphaL b!ffd (pH 7.0) sld I bl of iodi& etui@. TIE stution B
Frrsiu
lhoDwhly nix.d ed alsoftecc sas !@d.d at 390 i1[|.

Glycine b.lairc co.Llt w.tr&min€d Cri.lc dd c6t.i fl9E3). L6f

lccording to
liss@ (0.5d ws hodog€nied in l0 n ofdirtifl.d mtd rnd tha fittdd. To I ltt of
th. ate! I nl of2 N HCI its add.d. ro 0.5 nt ofrhc.bov. sturioa 0.2 trrt of
por4ssiw bi-iodide elmioo E bix.d. Tlc Dixrw B shd@ rcu dd bl€d i! a
ie bdth for 90 min qith oc.lsional sbatjlg. Whd cotd, 2 ml of icc{ooted disrillcd
wdtd dd 5 Dl of 12 dichlobdcthdc xr|! rdd.d lo thc hixnre. Thc upFr aq!.ons
lryabdil.ld.dlrn.rhcat'6orb€Mofrlt toE or8$ic tayd sar |wded ar 365
m. Ih. mout of gly.inc b.rsie @ .atcutared 6oD ! 3t&d.d ry.,
3.4.12 Pmli!.

Thc polie.ont nr M d€r€mined a@ding to Ba&s e, dl (1973). L.aftissue {0.5g)

w@ homogoi@d in l0 nl oflo % sulpho-siicyclic a4id ed nlteBd throlgh filt r
prpd. Ar a@ur of2ltl oflcid nbnrdri! (F€pd.d by mixitrs l.2j nintydri!
in lo s
nl sl&irl @tic &id) dd !..ric &id wE.dded io ri€ fiti@r€. Th€
2 ml of el&irt
Iilisate wa nixcd rhorcughly ard he&d in a wl€l bath for 60 biuies at loooc. .rh.
Eixnft a rhd tul€d ad 4 mt of roll@ B.dd.d lDd bixed. .Ir,e chmodoe
cont nirg roludc *a $p.Fl.d hon aquou phe dd it3.ho o@ ws Ead
ar 520

53
m wing a speciropholorheld. Prelire cohcdtralion ws d.llmined Aon a sladdd
cw. ed th. following .qulion:

Fdol. pblirdg A6h wighl = (ps Folirc/Dl x El of tobder' I 15.5y c of wple

3,5 Erpc.inmt ?: Elt .i of rForbic ..ld on dDught llroGd that pLrtt gmt! h

Ar qp6im6i w st$ coldEt d i! eil udd pot @nditios to obwe l[. .fr.cl of
.s..!bic &id in rmrb8 dcdiu ofpbD$ gIoM i! eil undd dmoght st*, Trc viet
gctrottFs, a dsuglt tol.@t cultiw (Ch!te.l-85) &d ! &ought s6itive g.nolr?c
(5544{) wF @d ft.n wcrc 24 plaslic Duss 12 for @h Sdoqpc)
in th. expeimed. (

containins I ks of aHri.d sddy lth $il Soil w thorcughly nixed heforc fillins thc
por3 e th.1 .i.b pot hid l!. sG eil @dF€ilioL Eieh s€.ds of. SenotyPe wa sM

i! clch po! ald ar lhc.I!elge@ of r.coid laf, 5 haltlry s..dl'n8s rw hn in ca.h

pot, OptibE irigation s6 supplid lo ihc sldliIgs util s@nd Ld M fully
.xpeded. A1 lhe tine of lilling the poi!, tbre sarpl6 of th€ $il w€te latfl al rddom
io d.rqmiE rhe moirnft conlcnt d o*n dry bsis (.t ?dc} 'IlE moisruFEle.!. cwc

of roil sdple B d.l4nirld uiDg lbe flar p6F nelhod (Fa*c.n t"d CoUis4dge,
196?) e Nlofonowd* noisle6 ent oflh. eil hlhe pots,

WlEn thc $@nd l€af of plant! w3 tuly .xprod€4 I Ngs of @h e@O?e rcrc
.oniinuoudy $pllied wiih optinM nobor. dd luirition, 3 tnaintaiad ar n.0 MPa
dx!8h sts (by wi0toldilg }der} 3 dinlri!€d d -1.0 MP3 with 0.5 DM {{olbic
&id $laio! rnd 3 vi6 0.5 bM erbic &id solutiot in oPliDu rdoist@ cdditioN
'nE mohtuF con&nr of soil in the pot! B donitoEd by wighiag &e pots a.rvdav
ed keping l[. moistft uifm withjn th. !.t ofpois. ft€ dtotrSht stesd pot3 w.ie
k d .t {.0 MPa Dal! for &Budry biom&s! &d gre qcbeg. w @t&d an.. lhrc
€ts of alplicalotr of 8$.dbic &i.L

3.6 Elp.riDot 8: QTL M|pping

DNA tukd/QTL nappils rrudi6 wrc @ldwted ar NIBOE (NaiioMl ldstitutc of

Biotehslogy ed Ga.tic Elgjlqilg) F!i$bh.tl- An F, poPulili@ daiv.d Aoo |h.

59
@ss of drcugh ssitiv€ ed dtuugh tolefut pdnis (Mtjoned in 4tliq cxpdin6$)
re used for QTL dtlysi3. S.€dlilsr of th. pscds and th.n F popubdon *@
rtutsphded dd allowd to Srbw in ! plastic tub @nlaining 20LHdgledt nuLicnl
elutiod nd. $€r! t lot l of 180 F, pLnts sd l0 .!.h of lh. pdts Tm sels tfcr
trdspldtatioD, 20 c/0 @ ,pPli€d lo d€veloP deudt $re$. Aiia 3 weks of
PEG,@
of PEG@ ftc Pldis vw ndb.Fd agScd ad phmitPicallv $lqcd fo.
'lplicdid
ne1 photostithesis, rclatrv. {6i€r.ontcnt ed li.bilily sing th. melhods
cell m@btuc

deiH in @liq qFri|Mts. AnA @Ic.tirg srlryl6 for t!. $oE eid d.i4 ilE
eedlinsr w.c hddt d dd 31otd in ! t !2.. at -80t b s.Pant labled pl61ic zippa
b6gs- cmnic DNA of lhe noa spLs M Gxd&ted toF then l€ws Ning CTAB

nethod (Doyl. &d Doyle, 190). Ai.r dt!..rioA thc DNA ws.ndvEd bv PCR udng

sinple s€q@@ rcp.d {SSR) tritre 1o sludy PolvDorphisn b.lwer ile pNnr
gmotyFs, Ih. Flymrpbic Efft63 wc lh.tr 8.d to g.notlP @b indiiidual of tbe
F? poputalion, PcR produB q* M on g.l elelrophoresis ad dala of MPlificalioN

*4 eEd dd @!d.d fim g.l picnG t kd *ith th. h.lP of gcl <locM'd!ti@
systm. 'IlE li$r offdm.$ ued h lhc study e€ giv.n i! aPpddix U

3.6J DNA Ertnctlo!

Th.liod levB wE ercund in liqtid Nitlogcn i o 6E Powdd 4d tb'n lrdarercd r'

4 epFndorl lube. Hor (65'c) 2 x CTAE P% CTAB (WV), loobl"',t Ttis HcL (!H 8 0)'
20 mM EDIA (!HE.o), l-4 nM NrCl &d l% P\IPI bufcr B add'd b'fot the fiod
powdd $.ncd rbleilg ed M ieub6ted in wter bslh fd 30 minui6 Equd volu' of
cblorefolll/isodyl .l6hol (24t) *$ ad.tc{t and mixed lo foD e bv slovlv
'bdsiot
invcrt'ng thc tube a @upl. of tiB, tun
FaE ddorf tub. M
Mlituged at 13000 Dm

for 15 ninur.s in a nictocotdtug€. Sup.hn14t $lulion &on ih' top phrs {4

ftBfded to a rcw .pPddod rubc. rnw ph4 6 di$ldcd To tb' $Fr tdt
elulion 0.6 volM. ofchitl.d 2-popeol sluton s dd(l.d &d mixed nE slulion
M @trifucd fo. 5 bit SuPqMrdt slurioo I <ti$rrdcd ard p'[er *6 @!hed
wiih coll (sror.d in ii.*t 80% ethml IlF Flet of DNA w allo*ld
twic.
b drv L

M thm Fhy.ltir.d in distilLd v.tci. To diget RNA,lh' RNe I add'il tc'

'n4tc
th.splc. Thc alerb!@ of DNA s!, td.d by a W spelroptorob.r.r. Thc DNA
sElpl.s \@ tu od 0.8 % ag!tu* g.l b chak thG quality of DNA. Tbc mpl.s givhg
a s.d w@ discsrded. oft of rh. IEo DNA smpl.s, l4l wE of sood qulily whi.h
wF storcd al 4'C for Ne in PCR.

!.6.2 PolyD.ru. Cbttu Ractior (tCR)

PCR s Frfodcd in 0.2 d rcR tub.!. Th. iot l vd@. of tCR dne *a 20d,
@nr.ilins 4.8 d of rcR (dciosiud) *da, 2 Fl of rcR buf* (Fmdl4i), l-6 Fl of
MgCl, (F@.drs), 6.4 d of 2jdM dNT?r (F.mnta), 1.0!l ach or l0n8/ Fl fofl3td
&d @N FiD.r,0.2 Fl of 5 uilv jrl laq pobDc@ (Fm@Ls) 6d 3 Pl of l5ng

Arnplifi.alion wB pe.fomed in th. Mstq Cyoler Cbdiot, Epp€ndof, Gmary. The

thmal crcl.r v4 prcsruDed fo. 35 .y!16 of d€i.ruarion ar 95"C fot I nit,
m.aling.t 5G50"C (depending on individud prid€r) for I nin ed dt Bion it 72"C
fot I 6ir sith e initial denatEtion d 94t for 5 bin ed fnal qlqEiot tt 72'C for l0

!.5J SSR A!.h!i,

A ioid of 425 SSR pr@ paiB; 100 ElD lh. X8},DL 100 Aon (sUM &d 100 of lhe
WMS si6 (Ctu Li.k. usA) {!€ say.d on the p@nt spnoqp€s to deled
polymoryhic mk6
for genolr?ing th. populalon. 'Ihe @{omiMl polynoryhic
hdkef d.tcctcd in rh. paMti Bw !s.d to asy lhe Fp ttion. ft. d.tailed
info@don abour ite Drio6 !$d @ b. vi.eld .r w.lnearpw.ud&lov

3l.a Gd ELdbplodn'
Thc PCR F.d@ts of th. r*lioa mixnd sd dtlrzd by 2 % sgee g.l
clstophosis Ning in 0-5 % TBE bufrd. To F.Fft I x TBE butr r,4El of 50 x
lBE buffd *ts llrer &d lte volMc w badc uD 10 200 8tl qith dre$ll.d wilt ed
gody mix€d. A volMe of 100 s of thjs butrcr B mi\ed wilh 2 8 of agrce ed
tl of cthidiM bronide m added to th€ elutior IlIc
boiLd for 2 minut6. Thd 2,5
lulc wm lgarese elutioD vs poued inlo th. trly ed cmb6 *cr€ plac.d io it, As
61
soor a th. 8cl setrl.4 @mbs lr@ gdtly 1!16 o't, Matine 14. m removed Eli lte
bay ed e!! pul in th. t !L S!fici.lt qurntty of buffd B pou.d ir th. lrDt till thc
boffd I@h.d 2 m aborc th. g.l. To 20 d of tbc sple, 3Fl of l@djns bufq (5x

brcmphdol blE mix.d wilh le,6 gly.dI,0.1M EDTA and 2% sDs) wa nixed. A
rcllre of 12 rtl of tL @pli8.d DNA B .&tuUy lo.rbd i! ach rcl. Th. vElb *fr
.t n clMl w6 appli.d C.l w allovld lo M for
gative .ler.ode, Aboul 80 lolk of
lbout 2 boB a.d rh6 ohsed utdd W ligh! ad photosnrts gft t t n 6ing g.l

ft. dal! obtlired (in ExFribdts 1-6) wrc subjet d to ealy$s of v!ri.N. lsing
COSTAT eftqe. lsD B olcubi.d to c tb. ditrcrlrB .dong the t'Ea (Siel .r
dl, 199?). Phaoo?i. ri.ta of th. F populdtio! m subjeild io oftlation da.bsir s
by D.w.y sld LD (1959) Nirs MINTTAS conpl'd oftsaq Afra sdls of 8els, &.
S.ootypic ddr B erl}z.d by th. sraridic.l Foem MAPMAKER/EXP !6ion 3.0

(t&Lr.r ai., 1987) to @Nltuct s soetic drp. QTL c.rtognpho a 2.5 <wbe et 41.,
2C,0O B ulcd for d.t ctio.h.sSiq of QTll or th. mp by c@ptnilg plEoorypic &r!
of c..h F, irdividu.l lgain$ its g.notFic d!ta.
 CHAPTER.4

RESULTS

d.l Elp.riD@a 1r A$endt of drclgll lol.r.lce ot lro rbqt getoiyp6

(Ch.ls.l.E6 .rd 65:k6) snin b Dn
cdporativc drcugl tolclle of trc rtF.t gdotyF, Chlt wl'86 and 6544{ M
sssd by d expcriment .ondrctcd in sil undd pot @ndit 06 Dbughl 3t .ss iidrced
alrh. tillairs s:r,8p 3ierifddy aff@Ld G.blc dl) sF th dd e33 dcboee.hibutcs
ofboth g@types (tig 4.1). Th. g@qT6 difrct€d dl uaiti exaF for
si8lifcdtlv for

suts$onabl CO, co@ntltior (C). IrE nci pholostnth.nc dte (Pr, lrasp$tto! 6r€
(E), sroEdrl ondEtalc€ (&) .!d s"*lh (shd t*h ald dry UottB) of boft

soog?.s dcwe4 {hile sub-stomald Cq @n@dlation (O) i&Eacd utdd drcueht

conditioN; howd, this doughl iuduad delle M moc prc@lred in lhe dloughl
s@itir sdotypc 6544-6 cdpatd to Chttwl-86 (Fis 4 D

Doudi sfts also sisnificdtly aiTdted nMberol erliN !€r slik 100 sed wic]'t
'
aod goin yicld F plut of bodt Spmtypd bst hrd e 3isnif@nr cffet or pldt hcieb!

spik. l?ngth ed nMbn or sPikclcis (Iablc 4.2) Both gcnot Fs dif€ntl sigjlicetlv
for all rh. laits sMicd; Chal$d-86 blvilg rclatirely morc tMb€t of slas pd sPit€,
100 s.Gd wight ed gnj! yicld Per plet @4€ftd to lbe gmttT. 654'l_6 un&t

drcucl conditions (Fig a.2). 'Ihce resutb lhowd $at the cultjvar Ch!twl'86 *$
Gbliv.ly .lrougtrt rlsistant @bP.Ed lo g.mtyp. 65446.

42 Erp.riu@t 2: OPtinb.tlo! of PBG @!q...tio! lo i o.. drcugbr ttc! i!

wbc.t pL.t!

To asg th. optiom la.t of droudr st*! difdot c!n.dtr.li@ of PEG (0' 5' l0'
20 od 30 %) b!$d o! lbe otnohlitv of ilc elution, w@ applied to iL nuEient
n€diw. Dd! foi gs whag. pamet6 M r.@ded whd svnPtom of drcught
hadc vkible rtur tPo wts of PEC.pPlicriioL A!.lt6is of vdi.G G.blc 43)
Eve.Ld thlt.ltuuSltt 3i!6s ha<l a liiE@t inhibitorv.fre.t on th. !a pholGvnth€lic
B1e, lr&spiratj@ tat. dd stoMrrl @dsrtM of wh€1 $.dli4r wh.r@ sub stoMtal
I.ble Ma! rqo.B ftor rrdyrlt ol v|tule of lte drlr for tbool f6h ..d
4.1.
dry biob.s, r.. pboto.yltb.tL nt. (P huPi!.lio! I|t (t), llouf.l
onduct rs (3,) ud .lb-rtoDrt.l CO, corellntio! (Ct of tno Sdott?B
'that
(C!.kr.r.E6 dd 65a,1-6) tt th. d[.ri!a rt r. rnd.' s.ll-w.Lrcd .!d drelgbt
@ndtdon hElF |[ctrt !.
da L ct

Main.trcct!

I 20E.15...

Dought I 0.02.+.

I4@tb4
I 21.84.. 0.20d 0.60.. 0.t5. 0.004. 875.56

... = 3ig;G..,{ { o05, 0.01 rrd 0,001 lcEld n.p@iisly

 a Control s DrouSht

E'o lr
t- t

e' a
1

a8
€ r0o 6ro

Fie 4.1. 6hool fntb ud dry bloo.t , !.r r'c (P'[ tr'ltpLtttor dt' (D'
pbolorlattredc
rhtl l.notvD'l
lr;urrl .oldrcllc (&) od sb-.rout.l COr ocbtniio! (c, ot taordtsi'46
{Ch.Lr.l{6 ud 651.a{) .i th. titr rirg t.'C. Gtlm b t'lt) ud'r xc
dmrglt co'didou (Ddn +S E) in ElP.tindl r'
Trbl. 4,2. Mqtr rq!.rc! ftoo rdlt it of r.rioe of tt. d.l. to. PL.l hcigh|. tplkc
kndb, truob.r of;D[ch.t, trurbq of gmilr per sPlke. 100 .ad s.ishl ud enb
yicr per plnr of rro rnar gc.ottF (Ci.hrH6 rd 6sa4{) udd *dl nl.Rd
.!d dNrllt olditiont ln ElP*ir.la 1.

dt Splt 100
!.iCnt

!rd!
c&!
I l5_02... 20.66..

24.088 594. 1.30.. 0.57..

Intdlcrion

9.5t. 0.016

= si!6if@t !! 0 05, 0 01 ad 0 001 ldels' tlsletirelv

', ", "'
B = noGienific-td

T.bL .l3, Mo tqu.G frob r.fv|d of r.ri.!e of lb' &L rd for I

pbotolynrl.rlc dt liJ. r|dplntio! r.a (E). rlor.t l.ondud'Ne G) !ub-
lr"-,i CO' -"*"mt"" ti' ol an .r \Ttbtc6 azita'M L l *dlb83 of ln'
crlttur Lrtri 20OE difnla ordt rltd otPEG tqt
rh.n ln n[.ri'lr
'ppli'd
loludor to bd!c. drcudt 3tB h ElP.rlD.nt 2.

.tf ct

l 1.t5.. 0.1t. 512.15...

2 0.10 0.19 0.004 110.17

R.p

r, t, .ar = !ig!i6@r .1 0,05, 0.01 sd 0.001 l*ln sFctiwly

6 = noNiedliot
 t Drouiht

t Ir
t6
t.

{
!o
!
I En
I,O
t"
g6
T
t. s.
l3 ,t.

ft ae PbDl h.idt,.piL. Llrlt, lut r of .Dil4&.q !eb.r of F@ Dd rDlL,

1il0 ,..r1 w.ish. Dd gdir tud p.! pLra ol tio rt6t gooqpq (Ch.lr*16 .!d
65L-6) t|!n h pot @dq w.[ r.r.ttd .!d .tm[!ha otrdidoB (nd + S.f,,) b
Elp.rln.nt r.
61
 ir
!r

i 300

:,oo
;r0o

Fi& 4.3. Net pnoklnth.tlc nt€ (P")' tn

plntior nle (t), ltoDttrl cotrduct nce
(r) ud rurHtoD.t l COr or@tntlo! (Cl or ah..t (T d.u6 r.db@ L)
kdlils! of lrui 200E *Lo difi.Ml .o!.6a-lioB of PEG t.r.
th. .!lliv.t
.pplLd hr ri6lslrtio!toi ra drcudt tt|* (Dd + s.E ) ir Elpqi[dl2.

63
Cq oMeldd show.d a sierdnMi iEtle u..lcr tlbuglt @ndiiioB. The pldrs
.ufrdd s4e dowhl slrs rt 30 % PEG coadtatior dd wilt d a wel .n r
applicltior ofPEG. IrEy stoerd zeN !d pholoalalh6is, lFnce, drt forgrs qchdgc
of Dluts s not l@d.d ar this ld.l of 3tt8. nE lelcl of 20 % PEG M foud
opriDw sts ar whicl pl.ra showd t€@dblc rcdEtion in n l pLoto*nth6is (lig
4-3). Flrlbd qpaiocnts r@ @i.d oul uitrg thi. ldcl of PEC i! lhe nfiat $ltnion

,1.3 Opliiizdion of sorbi. xid (ArA) o!.Etlrdon

,1.3.1 EtperiD@t 3r a$6!Ddt of opllEu lw.l of .lNrblc tcid for Mtitrg
o.diun
A'alysis of Eidce (Table 4.4) showcd a sisnificldi dif€rence mong th€ a.allnedir

Gonirol, PEG, PEG + O.5bM A5A, PEG + ImM A!A, PEC + I ,5nM AsA. PEG + 2nM
An{) applied 10 hnk d irlhibiiory efrecl ofdrcught M
rh. pluts. A obwed otr fi.sh
&d dry wigltt of sh@t &d @! !.1 photosyntlEtic 6tc, trapiFtior nte @d srom6r.l
ondEtaD@, lowvcr, $b-slondd CO2 @Mnt*ion inc@s.d uda dmugh stes
(Fie 4-4)- Asrbic &id .!plc{rio! i! rt!. roodng ncdiu s eft.liv. in a[eviating the
rdv@ cff@i3 ofdsu8bt strich a delcd by ! Gl.riv.lr loE <leclt@ in th. filsn
and d.y wight of ster d wI $ @t, lct pl|olosl'octic nL. t!!s?irali@ nt ,nd
stoMtal @d@tar@ of rt plad5 $bj6rcd ro dmugllr r!!ss- AnonS lhe fou leveb of
sorbic &id .pplie4 0.5 iM lbvctl ro bG 0le nolr .ffetire.
4J2 ElFrioeol 4. Asao.ll ol opdDrn hv.l oI uorbi. ..id for folia 3pny
Ariltsis of Eidce (Ilble 4.5) showd a rignifiMt ditr€tue ddg th€ irellnmls
(conirol, ?EG, PEC + 0.5nM AsA, PEG + lnM ArA. ?EG + l.5mM A&A. PEC + 2nM
Ae{) applied 10 lh. plets. A signinmt .dv.tse eftcr of dreudt @ obcwed on A.sh
md dry widt of sh6I a wll s oot, nci pholosynthctic Ft , trdspi.tion dl€ &rd
slomaral @ducta@, howvd, sutslbmlid cor @ncdlraton m not afle.ted by
dou€h stres. Folid lppliGljon of $.olbic &id prov€d efr*tive in dl€viating ihe
advffi efl€cis of drcueht str6s 6 a l.ldircly lowd dd@e b lhe tesh &d dry w.idrt
of @t a wll d sh@g rct phor@ynthctic raie, trestir.tion nte dd stonor.l
6 ucronce va oblwcd i! th. platu !ubj@i.d 10 drcueht srEs (Fig 4.5). Anong ihe
fou la€ls, I bM erbic eid $lutior Fov.d io b. tbc bosr .trErive 6 r tulid slny
T.bl€ 4.4. Mr.! lqu.ro ftln .mlillr of vrrir.c of tL. drar for fr. |trd drl
biorN, &l pboddra$..ic r.t (P,), arupintiotr nt. (E), saor.t l colduct .c.
G) ud rob-.aomr.f CO! s|!Mtn.!o! lci ot shaa (rdraM 6tiw L)
i..dli.g! oll!. .lxirl LDrl.zI|E .obl*r.d ao dnlrtr rFd rld t!r.r.d rlrb
di{te@l Ly.lt of srblc nid (0, 05 r, 15 ud t DM) h t'h. rootilg D.dirn i!

1rj
'i' = sistfi@l at 0.05, 0.01 a.d 0.001 l.v.ls, rsp€clively
',
B = non{ill|ificel
t bL 45. Md q66 fno D.lyd! of r.ride ot lt. .lrt for f6b ud d.y
bioN, n.r plocFal.ilc na. (PJ tnuDbrrion n& (O, ltoua.l @!dr.tuc.
G,) ud lub-ttoD.t r CO, .o&@tr ion (C, of of Pb..t (TririlM t sivun L)
Fedlug! of O. oldvr. hri-2lx)E rutj..Ld to drcudt rtH. rnd lut d witb
difrNlt Lr.t ol sorblc .ct't (0, 0.t r' r,5 ud 2 dM) s . aoli.r lpny i!

.01 3!d 0.001 l.1tl4 GpcciivclY

N - Dor'"3i8iifi6r
 Ir
!r d3

:! j03

!u

i
: 0..

€r00

II €

I c
o,,l
0
o 00.5 11,!2
(nM)
0,8) aA rrotd.nlr (LE) rrdD6il (nM)
^'{
fii 4.4. bloE$t !d pbotott trn. c ml. tP',. tnilDirr'ior r'E (D'
FGt .td dry
im;Brl.t cooaucr.oe {&) utl llb_ttodnl cor @tr"ltnriotr {CJ or rb6i
ii,iri,:^ ooti'^ tt |;ir[e or rte cdrirt Luni''ooE sobj4t'd |o dmoshl
li** -a i-t"a dff"*;r bveb of.!.orblc r.id 0 I' l 5 dd 2 DM) itr
(0, 5'
$. @dng D.diud'ftl(Ed + Sl ) b E+.riD.trl3
 t
i,

lo

j
:r i-
te

@dr
^d@h!!(rMl

Fi! Frdb .!d dry bioDsn tr.t Dhollvolheiic rtt. lP'I tntrlpintion nte (f)'
4.5.
!;rd coodu.r.rc; {*,, .trd 3ub{toErhl CO, otrcerhtior lcr ofdrougnr nt"l
tfti.nM Bnttu L.t ;dlit$ ol th. culth.r L.strl'2ooE lubjf,r.d lo
atld rod tMl.d ei.t .lifdnt ld.t ot sorbi..dd (0.0.5. I l.5.trd ) dM) N r
folir. spr.y (oa! + S.E") i! ElpcriD.ol a.
4JJ EtpsiE nl5: At!.6sd.nl of opflnrn kv.l of .@lba.cid lor cd PriDilg
&,ltsir of vuia@ (Tabt 4.O sho$rd ! si8nifi@t dlfreMe dong lh. telDats
(@nttol, PEG, PEc + s€eds lEa&d rib 0jbM AeA" rEG + 3.cdt lsLd *ith lmM
AsA. PEG + *.ds i..atd with ljDM A&{, PEO + seds tELd with 2mM Asa)- A
nsled iDnibibry cfret of drcuehi rc obsw.d on sh@I ard @t f..sh and dry wcidli.
rcr phor$ynthclic hi., farspiFlion nl! snd liomatal @dw1an4, how.vcr. sub_
$otuiil CO, cotr@trutioD inc@.d undd deughr str€s (Iig 46). Asco.bic rcid
dppliction $ . FFswi.g s€ed trotbat w fodd cfrdtiv. in.llaiting th. tdvcF
cfs|l s . El.liv.ly low dc.tle in thc shot od @l AEI 6d dry wciglt, n t
phoiostnrh.tic dc, tus?iErion d&.nd sroMl.l cddet @ 8 ob*F€d i! the
pLrc 3ubjctld lo &owtl stes. Ano.8 th! fou ldcls of as@rbic &id 9Plic.l, I nM
slurion DFv.d to b. the oost etrelivc.

4.4 Elperin.nl 5: Conpliso! ofdlfl|isnt nodd ot.Forbic rcid .pPllc.lio!

eo$ic &id appli.d tuolghl ltt tuoting

Ov@l obs.flltion of th. plaaB sltowd lbil
ncdiun w Eldiv.ly mE ef@liv. in mliot liry the adm. .fr..13 of drcudt
sfts on wt|al pldts @6F.d to lb. applidlio. s foli& s?6v or tlolgh pfinitg

A sicnificei inlibiiory.tr*t of dmudt saBs was oh6€Fed otr shoot filslt wishi of
bolh $t.3t gcnoq!6, Chrkwl-86 ard 6t44{ (Lble 4.7). As@lbic eid lpPlialion
inptuvcd thcir sh@t fr*h {€idi in drcughI conditions .sP€ciallv wh.n sppli€d i. $e
r@tins n diu (Fig 4.4. cultivd Chd.wl-86 s't3 sistificetly slp.rior to 6544_6 in
le6s of sh@i fBh e.idt uidd both @Dlrol and drcusht @ndiriG.

Drougbt sts sigDifdtly t du.d mt ttsl sigbt ofboi[ g@otvF Bo|h gl!ot?6
{titrdrd sisni6@dy. Ia. cullivr, Ch*$tl-86 Fodu.d hie}tr tut fi6h bioN
mnp.r.d to thlr of tlc rliDtyF 6544-6 (Fi8 4 7) l tetid of drcughr ed Mrttic
ei.l ws highly sign6@t which n.s that @rbic rcid maliodtcd th. adv€6e
efi*ts of drcugti 3tes. M@ valB fd rool ftdh wighls showed $!t M.bic acid
TtbL M..tr sq|l.B fron .!t$lt of vtit.@ of th. drtt lot fal &d dry
4.6.
bioEs, ler plolotydh.d. nt (Prl lnBpindon nl. (iL .tonrLl onduchno
l&f .!d 3!Fti.Er.d CO: .o!@il|lD! \C) ol ,n6r tT.ttu adi,6 Ll
;;hs or tb. {lrivo Lu.!l-2008 'ubjet{ lo drcrght !tE. od lHr.d slth
din re;t |4.lr of ri.orbic .cid (0, 0.5, I, rJ .nd 2 dM) .t . Dr6ming Fd
rerh.ll in Ery.du@t 5.

B cl

8.11.1

I.blc a.t. Man !qu.B nld ulFn of v.ri,re of d.tr lor rn@t
nd dry bion.$ or doughl ttrs.d .d
ooNtrs..d 6 a.cl old
gelolyp.r (Cl.tw.l{6 Dd 6*16) witl uco$ic &ld
'n6t
difid.l ood6 in ElpdiD.la 5.

df
Mab.ffs
0.0.t.

Droudt 0.002.
0.0001ns 0.0018
lnl.turion
0.20. 0.0021Dt 0.00066

0.25... 0.00009ro

3 0.0003s

l 0.l7ri 0.0002.s
i'
i* ?
t- d
t

is

IB
S..
g- te
6:0
to3

!as
Eo,

i. eEr aar|Dd!(lno 06 &^tutur(.M)

Fh a.6. Fdb ud dry bioDsr, o.l pho.osvrth.tic-nt' |?,)' truDin'io! nr'rD'
tod'"rrmi (f, .ra .lLrbErtrl CO, co!c' nliotr lcr or rlot
irii"i ii^
"r,r'orr.t i.t #ati"s. or th. c dvr L'r'ri-200E subj'c&d to dmusht
r, r.5 ud 2 urrr) a
I;;;;i;i;;.i liui hv& or @rbi..cid (0,0 5.
'
pHowiDS ...d IMtDGlt (nd + $E.t b Etp.riD'nl :
 achL@.td och.aadoldn aiSaaadad aa54/t3iq{hr

t8
I

lcr
5

Idr

g
5

Iol|.c.4d|1d..'|bh

Lt. Coopriih' or |Ldt !d nor lch rd .lry bio8.r. of dnrd.

Fig
dd !oHtr6..d 6 we.k old pt .t! of tto sbat !.!otyp6' Chtlnd.lE6 (cb{6)
sd 55a,1-6 rtlh mrbi. .dd |pDli..dor i. dialdtrr rod6 (E.r! + s.E) b
6 ihc molr ctredvc fo. both SEmtyp6 $tE lppli.d dbuSh lhe mtiDg n diu
conp€r.d to vhd applied 4 foli& $r!y oi sed pa-sowing tr.atnot.

Shml .lry rei8ht of both g@typ6 .le d@s.d signjfi@0y uda drcugli sirs-
Cultivd Ch*Ml-86 Fovcd to b. supdid ro rh. g@BT€ 6544{ in ltu of shmr dry
wic}t (Fig 4.7). ftc delghl x erbic Did i qactio! rc hi8lly sienjftcdt which
sloq.d rbr the crc8tuB.ppli.rlid of eorbic &irl s.ffeliE in @lioElile thc
adld*.f.cls ofdougli sit!3s on bou wheat eenotyps, A$orbic &id applicd tbrough
the Mting nedim M Ehlively eoE .fr.ctivc.

Rmt <ty w.iehl of both gdoiyFs de.rlascd significandy udd dreug)i str6s, Mcd
valu Ml dry wiCl sboqld thar.pplicdion of erbic &id [.lp€d mainraini!8
for
develophdr uda drcught (Fig 4.4- Astbic &id alplicdion thrcush d. mtinS
mediM pbved to b. the Foe .Il€cli!€ no& oI applicadon h bo$ s6olyFs.

N.t plotosynth.tic dr. of both gdoiypet dde.s.d rigrifi@{y uder drcugh sEes
(Tabld E). Cullivd Chaksd-E6 show.d siglif@ily hisler rat of photosyrh€sis
cdp6Ed lo g@type bdd bo$ 3tes ard mn- sr* conditi@, Exogdos
65214-6

application of astbic eid significa ty !rctonlld th. cf.d of dsuehr b..rue th.
rel pho!$ynlhctic r.tc ofhlhgcno9?€sqai'inhiicd withth. appli@lion ofMo i.
eid. Ovcnll, @li!8 h€di@ B it bosr ef*liw nod. of applicrion of dtcoibic
acid {Fi8 4.8).

Tcrspianior ralc of both goor}Ts dec65.d sisific&rly urd.' doueht srls (rabl.
4.8). Th. s@O?.s difr€l€d lisnificd{y h Fdlpir.rioo Bi.. The applicarion of
Mbic &id lelpcd the pLdis 10 Minrai! hghd tr&spidriotr nt6. Asrbic &id
appli.d 0're!d &e Mdl8 ndiu rwtr.d ir omp.dritly hisbd minc@e of
It?$pi61ion rat€ oftF pldrs of both gaort!6 und.r sres @ndiliotu (Iig 4,8),

Stc'na6l @81&t3r@ ddlincd sigifi@dy in botb rtal g@t T6 utd6 dougt'r

drditio . Bolh g.noqT6 Bponded sinilatly ro drcudt srrEs in r€drs of slomairt
@nduct fte Asrbic &id hld no or d.dsirg cFecl on this g6 *choge
aftribu& (Fig 4.8). 's@irg
T.bL 48. M.D iquru fron udy.n of vt !e of d.L for !.i pholotvlthelit
no (Al. F.'lDb;dm nr. l4), rloD.t l o!d..t !4 (',I rlbdutd CO,
mN;t;dotr (c, of dFu8nt 3trcs.d ud lo.{ltskd 6 sdk old pb t of lro
wbat s.noryp; (C aaLE5 .nd 6s{_6) elth u.orblc ..ld tpPlt"tior b
dltr.@a Dod6 ir ElFriD@t 6.
(u
Mlin.66a
t4.731 0.0007nt
tt4.D..
3 4-72... 0.50.. 0.0004$

lnicncli@
0.12d 0..14n! 0.0001ns

I 0.t8s 0.0008n3

l r.9E. 0.26$ 0.0001ni

3 0.0009c t19.U.l

+, t', r'+ = siglifiMt tl 0 05! 0 01 lrd 0 001 l€velq EsPecnvclv

s = @n-si8d6c..l

73
 ach.lcqtN.g.!6'.lr.g&{b

I,
bdu**rdrrccd..
Fli ,LE. Conpriro!
_tr,f oa &t ptrotottltt d. r.r. (Pr)'lMtPlnliotr t c (D' 3roo'ttl
(C) of dblghl .rr's'd !d tue
--"0."t *. -U*-.t t CO, c.rda.dd
llra|.d 6 r*t-dd Pha. otrto that g.!otvD€, catkt lS6 (Ch{O 'nd 664+6
rhh Mo.bL.dd.pplicrno! iI d|It|rc nodq (6cu + 8.0.) ir Etp'rln'll6'

79
Sub.stonatd Co, conem"rion inc6d tig!fi@tlv unda doudt st6! @nditioc'
AMbic eid had a signinc&n .leftBing .llid on rhe substohttd CG @@ ralion
ofboth edog?s (Fig 4.8)

Dreu8ht @us.d ! scr. Edudion iI laf chlorcPbvl'a" @d€nt of bolh scnoqi!6 rt€
tm rprctyF difqld sigtificatlv foi thi!.tLrbi' Cuttiw' Cbtkvd-86 htd hiShd
cNompntl'a'' @ni.ol thd it r of gtutlF 5544_6 @dd bolh @nt!l &d i'tou3lt
sfts. Aslbi. aci.t applied lhnus! $c Foting m.diu M cfr4t'v' in ilc6ing
chlorophyll
_! 6nl. of bolh eoottFs {Fig 49, Folid sPdv or s'd pFewing
rqtDdt wilh ts.o$ic s.id did no1 inFovc chloophvll 'a" in av g'@lt?€ wder

co.Got of botl gdotvF Gtble 4-, rlow4'

_b'
Dou*lt $.ss d6Fs.d chl@phvl
rhc ondw Ch!ksl-86 B signifistry bighd h cblorcpbvll 'U' conrcd
u(Id borh
@ml dd drcugh 3EGs @dit6 @npdld @ goott?c 6544_6 Thc inMtion
lhai aMbic eid
betwen droodtl stt $ ud 4@rbic acid {as sisnficdt, sho{ing
applicadonin @lhg thediM *!s efiGdivc iD @tiodtins th€ advN ef*'ts of
drcusht by o.int i.itS dnooptvl "b'contcit in boll g@lvFs 3ubjat'd lo dougnt
sts (Fig {9. Ae.bic eid 6reug! eting n'diuf, wa Flalivclv nN
'pdi€tio

Drensb1 stres siSnilicstlv Educ.d @lltncnbns slalilitv (cMS) of both serortT6

Bol,\ s.noq?.s diff.rcd signif@llv for this atidbde' Cdrivd' chal$al_85
show€d

h,gher o€fl valu.t of CMs under dFught st s *fii'h dr*td tha 't
w tokrer o
drought sr* clnP@d ro s@9pe 654i1-6 (ris 410) APplietion
of @r!ic eid

nitigated the !dv* eff6r3 of dhwhl siGs by ilqasilg @[

Dchh@ $atlilitv of
both g@type Bdd drcugbl $r6s Thj3 ilc6ilg efrd
B mor FDddc'd wns
Mrbic @id M appli.d tllow! th. @ting m.diw
'nE osotic potcntial (OP) of learcs of Plant! of bolh what s'not}?6 subjecl€d to
sigrifi@ilv
dbuelt slres si8ltilicddv dd€ed (Itblc 410) charTsl'86 dilIcFd
ton 6544-6 s il sbo*d losg oP @mPed lo lbe g@O?' 654+6 (ris 410)-
Asrbiceid tlpticdior nfihd lowr.d lbc o66otic poiadd of both SmttTe The
I.blc 4.9. Me.! 3q!.rc. frcD u.lytit oI v.ri.tra of d.b for chlonphv[ ' (Chl r)
ud chlronDtvl ttchl b) o.l.trb oldreuabt 3tM€d rld noFrtrs.d 6 $4k old
Dldt' or ;; ther 8.!otyrs (ChrrP.|.E6 $d 654+s) wilh rsorbl' 'cld
ipptlqtior in dir.rclt ood6 iD ElFiiD.lt 5.
df C-il. can b
Mrin.ftcls
I 0,t2.

I
l
Ini.pctiod

0.02N

Cc@tyFxdrcWhlxAe\ 0.0,).. 0.00655G

,,1*,1.. = sigdn@r a10.05, 0.01 dd 0.001 ld.le, rcsPeciElY

E " rcNiSlific.trt
 achta @nt!l ocFaa dd{l aaLaS @n!!l aas{a drcoent

,|

I
.P

0.1
E
0.1

0.1

I
o2

cdrlll Rod{ FolLt s@rhl

l|od. ot &dd. .cld .opllqdon

Fir 43. CoDDrdlo! ol cNoropbvl . (Cht .t od chlrcrePb]l b (CDl b' cotrldfi of

a,i.Or ."i..0 oa msrsra 6 r..l old PLltt of rwo shdl g"orvF'
iffi+it rc{so -d 65't+5 't6 roiti" {id i! ditrsdr !od6
'PPlisdo!
(Dd + S.E) i! f,lPdindt 6'

82
T.ble 4.10. Md tqurra Inn ...ttri! of v.riue or d.t aor s[
.trbility (cMs), l.ra dootic Doldd.l (oP) Ed ehdr. *rt.r colt.trt (Rwc) of
dduetrt tl@.d.trd rotr-rtBkd 6 *..L old plt!$ ol tro f,berl
lch.kw{-86 .!d 554+5) witl .sorbL tcld .pplicrfbn b dlfLtut

da cMs OP RWC

1695.14'r' 15.88N
I 1391,20*

l J26_40. 0.14r* 184.5ons

305.(DB 0.018 152.66N

! J@.64.

l l02.l2d

l 71.35n3 0.032N

,, .., .r. = siofiEt 61 0.05, 0.0 t &d 0.00r t4ets, Espelircty

s = M-5igni6@t

33
 8
I

I
3

c.ntll R6{nC Folle s-rhs

Io.cGt*.Id$|k.d

Fig-1.10.Coop.riroi of .dl D.Ebru. rr.b[fty (CMStr taf dDoric pot ltirl (Op)
.rd EL&. o!r.!r (tWC) d dNar. trEt d od !o!{t q&{ 6 ,el old
phltr of rro'.r.r
qbdr gdoq?.rt ch.ts.!86 (ct-Eo dd 65a.t_5 rtth Morth .cid
.ppL.do! i! dir.ftnt ood6 (rd + S.E ) i! ErpqiD.lt 6.
.fllcr of Mrbic eid applicltior i! th. moting mcdm m @Fratively higher th4
th. othq tvo nodq in th. deugbt stqs.d pluB of both 8mt ?6.

R.l.tiv. wt r o enr (RwC) of both vlFll sa|oqF sistrificrndy d@s.d uder

dreleh( @ldiiioc, [oww ibis &d!a5. B 6oF promeed in th. g.@ttF 6544{
(I.U. 4-10)- Md volB elcr @!cnt slDlrd . stsh inpmr@l in
or Elativc
RVc of st*ed planls of both g.turtT€ with .pplicltion of Mrbic &id; howr this
cfr*r wmr sisrficr (Fig 4.10).
Dought slr.s oN€d a sigrficet im|!4 in lh.l.sfHro: @rcenlration ofboth whelt
genoRFB (Tabl€ 4.1D. ChrLa!t-86 had low.r HrO, @n&!t udd drcuelt str.$
@mpNd io $e goolt!€ 654+6 (Fig 4.ll). AMrbic .cid .pplic.tior help.d hodr
gcnorypes b bl€81€ stress by sigiitcmily Fducbg th.ir HrO, @!@tration wh.n
subj.cted to drcucl'1. Applicalion of a$orbic acid in th€ redns nedim prcved b b€ $e
Dost cf@riv€ node 6 ir dercaed tlc Hrq @nt.nl 10 ! bighd €xcnl in bolh gemi]T.s
udd drotSll sftss cdpd.d ro ilt olhdtvo Dod6 ofdpplicatio!.
Dreught @s.d a significr ieltle in Oc l@f MDA mteft of borh *lsl
slB
SEdoD?6 $bjeted to d&ught. 'IlEr B m siEnifi@t ditreM@ b.twn thc
gcnotyFs forihis attihn @rbic eid signifi@{y tldE d
Gi8 4.I l), Applicsrios of
th. lcaf MDA @!tor of both g.nogD€ urLir *sG. dcfrcit @nditios. HoB4q this
Edrcine efdt M mE p@u!c!d qiFo eolbic &id *6 qplied thtuueh l[e etirs

Tolal slubl. pFrein contcnl of borh Sdort!.s in.ilsd sigificedy uder .lroughr
strcs (Table 4.12). Both goolrFi diff.rd 3ignificEtly for $rs afl.ibule. Culrive.
Chalwal-86 shostd hiShq ttrot in ontcnt @np@d ro the gmog?e 65,14-6. Ascorbic
acid .pplicatjon ir
mting bediu ws Flativ.ly morc efl@liv€ in incMing
ihe th€
totd $lubL pm&in @G!t of bolh g@typ6 urda dou8ht slr4.

CAT (Calrla) &livity of borh gc'orrF i!@s.d ud€r drcught olditiois.

Siifica gdqF x d.oughr inrda.tion shovld thd {E F3po@ of gmt}?6

35
TibL 4ll. Ma! qr.E lroE D.lyN of Y. ne ol rt .ba. for f,tor b'r
'!d
MDA cort nls of d;uglt ttBrd .Dd noHtn kd 6 s!.k old pl'trt! of tworndl
gdoqF (Chrla.rSa Dd 65.&-t 'ill .sfti. ..id .pplic..ior in d{t'Ent
nod6 ltr Elp.rioert 6.

df sro? MDA
M.b cffaB

Drush

I dti6n
0.0028

0.03tu 2-813G

l 15.E8*r

C.@ttT. x dmugbl x AsA 3 0.1l*'

., .., ... = 3igrificsr d 0,05, O,Ol .nd 0

()Ol lcv.b epc€livtlv
 't.2

o2

tt
12

ii
0
! codbl Roo{n! Foll.r Sol|nc

MorL ol eorhl. rcld appllctlon

ng 4r1. Conpr'lkn ol g:Ot .od h.f MDA @DL.t! of droughl lias.d .!d mn'
!lB.d 6 .aL old pLllt of tro thea g.!oiy!€, ChrLt.l85 (CI{O ud 65{a5
ritb scorhi. tid .Dplic.tior h dflt Et rods (fto + S.E.) i! E:perirdl 6.
@ difleredl sder drcudt. MotuB. signifi@r irtetution b.tqen dsught x
scorbic &id @€al.d th.t t!6rbic &id M cfGctive in @diodting ihe adv* .l&cls
of d$ught by in@ing CAT &tivity of tbc pl.nts.

APX (Aet!'re p.rcrid!*) &livity of both s@gFs i*ta.d sistifiqtly (u'd.r

drcushi .ondiiioE (rig 4.12). Both s@tr?.s difidtd siifi61ly; chrkwl-86 b.i's
udd drouelt shd! ompdcd lo the genot4€ 65:14-6. Ascotuic
highd in APX &tivity
&id appliquor tulh.r incr..s€d lhe .ciivity of ,gft61 p.bxid.$. Th. cff.ct of
Mrbic &id w Gl.liEIy bi8!d ir @t'og n.diu ad s€cd pdning.
Dbud silBs .nbdc€d ln. a.tivity of leJ SOD (SoFDxid. djsmut&F) of
si9ifi60y
both genot}?6 (Igblc 4.12). HowE, th. dzyne activity w3 higher in chilwal-86
omped 10 that in g.mtrF 6s4+6 (Fi8 4.12). Exosmu sppliotion of o$ftic eid
psniculsly tlons! th. tudog nedid .!d s a foli& s?6y itnhd €dec.d SOD

@nvity of bolt g@typ.s uidci &olght @.dilio!s.

Ddudi shes sicl|ificetly ..nec.d th. POD (P@nd4e) activity of bolh soort?es
TIF g60$?6 difcrcd sigliti@ily in $c €tzymc elivityi Chakwal_86 b€ing
$bstlrdally highd i! POD &jlivity c!6pd.d to e€mtr. 6544-6 (t bL 4l2)
Exogms rppli.alio! of .$!!ic @id plov.d k' b. vcry .ft.lirc in i!).t4ilg thc PoD
ac,riviry in both*tEal scnot}?cs ei@ subjcLd to dDush s1r6s. Ofth! ditrqEt iodB
of eoftic @id applic.tion, Mtidg ncdiut M tE nost cllcclivc ir incrcsing iltc
blioxiddi eEyne @tivity ofth€ gpnott?.r.
Dought slrls sigljfi@tly d€cEsed t
crdogElou aecodic &id prodEti@ in th.
lc.f tis6 ofboth seiorype Glble 4.ll). TIE s@tyF ditr tld si9ifi6dy for thj.
tait. Exos@ou ,gplication of Mrbic eid aPPli.d rbrough difrdr modd pDnotcd
eoDic acid &cmulation in th. lov6 of bo$ g€nott?€s udq onlrol dd doughi
cond'1ioB. Thb aslbi.
a.id sl]uuldion w3 r.lativ.ly hidd in ce of rcotbg
n diu sppliori@ prniculely in ch.t*d-85 (Fig 4.13).

cLrinc b.t i* ont nl of bolh *tFt g@q?6 in@scd 3i9i6@dy uda drcu8ht
stFs (Tabte 4-13). Ir,c culdld, ch,kw.l-86 @Mdat d siSnificelly biels slycic
b.tain @npded to g.not}!.65446 (Fig 4.13). Aslbi. &id sigrtrficadly ind.ed
lhc slrrilc b€tai!. od.nt in both

88
T.bh 4.12, Ms rqrG fion @\||b ol v.it.!e of.h. d.a. for L.f r...1 ehblc
pDtei! olt !. .!d rtirltie of srp.bndc dbnut * (SoD)' pendde. (PoD),
dt |l|c (cAT) ud @rtrt p.hdd& ( Ix).4D6 i! dF.rtrltE.d ud
oo!{16.d 6 r.ek{ld plut' of iwo rbqa r@otyp.! (ca*sd{6 &d 65.145)
rith .@tth ai.t .ppli..tid i! difr.@r Dod.. in ElpsiDol 6.
df CAT APX soD POD

22.56..

Llusht ol|..r 0-064ns 0.48... 975.?0... 16t.95..

0.03.' 0.11.r t20.17ft. 209'42..1

btmlion
13.37i 0,15r 2.028

0.02. 2.14ts 0.12.. LnB n.56|

3 0.02. 7.02.

l 0.004.5 4.521]6 0.064. 17.E1 20.59s

"' = 3igificdt tl 0 05, 0 01 &d 0 001 l*ls' Its!€lirelv

89
 aC a dit l ECn{adErdn
.65a44@i!ol lalaa3doudn

€
litl Elo
€'
ir l.
;.
!

t,,
tio
E.
:ro
t'
.ddbrEFcu.c.El.
rdbd.6.t|cdqPl|s

!
1a

c.di@d{F.l|lld&€
b-.,g*d'|&

Fk 4J2. CoDD.ri.otr ol L.f lot l rolubL proci! 'ott'nl '!d

(CAT)
a'dvitiB or
.Nri't'
*"J-iO. Orri.r.- (SOD), !@tidr. (PoDI
-J.iil* rrrn .-vi. t ; ai'ogrr .r-"0 'ltdse '!d ph !
n-or*"0 6 'cldd
;i;-;;;r ;-"d!.. cr.k'i{6 (cb{o'"0 65'r'-6 sorblc
'nd
(Dru + 8.E , h Elp'rldcnt 6'
rpplletio. b dlficmiooUs
'rtr 'cid
TrbL a.13. Mem rq!|B fDD .!.lj6i! of nrt ne of tb. dil. for.*orbi. .cid'
sly.ln. b.t b. (CB), dd Dnlln ontdl of Lis of drcrgh !l@rd ud ooF
llBr.d 5 r4h old DL!t! of iro
'Lat !6o.yF (Ch.tr.lE6 !d 651+5) aitl
$@rbi. .cid .ppuetior h dirm.. Eod6 l! E4.rindt 5,
dt CE
M!i!-!&E
121.9!4.r* 979.15r*i
Dougl
3 5?6.6tr 9l4.l2N
Inttutiotr

I 0.9a 4739.63'.

17.01* t41,45.

3 999.63s

l 17.08r 129.43. ll9.58N

1.+ = sisnfidt la.l$ lqF.clircly

', '., at O05, 0.01 ard 0.001

ns = non-sisnifi@r
 .ot!@|ocBdqh...4c.tbl..lefu{fl

!
I
I
:

I
aCo

t
ro
i,o
1."
Jr
c..h|i..d,.i.5rldt.e

Flg 4.t3. Co|nl.ne. bd.ile (GB),.d Pnlh. otrL.l or

of .r.orbL rcid, 8ly.ln.
l6v$ ot dm!8hl stacd ..d &!{lsFd 6 wdk old plu& ol two vherl
gdo0?6, CbrLs.l{6 (Ct{61 td 554+5 rith rsrbh .cid .PPlic.don i!
difi.@t Eodd (rtu + S.E,) b ErF |!dt 6.
gcoott?cs ontler !r.s condilioE whd applied thrcud rh. rcoting mcdiM, A$o6ic
eid aplicarion did mr porc ctrcriE 3 fotid spay or praewing *.d rrErri@l@
cB @mulalion whd applied in botb sdob!6 uda ste$ aod non-str.$ conditios.

L.d fr!. @.mtlrion of bolh gmt}!.s i@s.d significbdy urd6 dDudr

prelirc
str.s. Thc gdot,lcs sle diffcrcd lislificetly fd rhjs atiribu& (Tabl€ 4.1!). culriv&,
Chrtwi-E6 slowd hiSlE l€d plolie Mul.tiotr lh6 thar of splorrF 55,t46.
Asrbic .cid alpli@iid hld m .frel or potire a..uutadon i! iL ptdb.
4,5 Elp.rhdl ?: Eff.ct of!.orbic rid o! drcugttitr..&drl..t pL rgrlui!

Anolysis of widc. of ihc dd! (Tdble 4,14) show.d rhar drcught srEss signincdly
afrel€d t6b ald dry bioblss, Et pt6t6y hdic nle, respiradd E& ed sloturd
@ndEt nc. of rh. tw \\lFat genort?6, Asorbio @id !d&d to the soil prcduc.d a
ri8ri6@t .tr@t on ttes. Fru.r.6,
DDrght srs si8nfi@rty de@.!.d (Fig 4.r4) rh. plalt ts! ud dry bioDAsr ner
photosynihclic nl!, traEpi6tior nr€ ond sloDatal condelAae. Howevs, d&ugh sr€s
iaqs.d Ibe $b-srobnd COr @n€i!!lid of borh gaoqFs. &.orbic &id
lppliqtion signifiotly inc@s.d th. fElh !d dry bioDss, n r pholosynitEric Ft..
trtupiBtion at , lroMbl c@dB0De ald Edu..d lhe sub-stond.l C02 @ncmtltid

thc cults show.d lhar eoftic eid atplied in lhe soit n dim ,r. .ft@riv. in
Eprcving pldr nei .!d dry biotuss by ..h&cin8 Er pnobsrnllBis of bolh
8.not!$ uder $rs &d non-st ss @nditioa. Culivd Chakqt_85 Dtuved to b. noE
toL@t !0 drcugh $.ss @h!@!d to rh. g@t!. 6544{.
T.bL a.r{ FGn o.t dty bb.!., na plotdvrlh.dc nt
Eu+inf'ot E ' (P,}
b. rtoorltt oduclroc tr,t ud nb{toD.td Cq.otrm.nd.n (CJ ofdB tck
otO'ptut. or t o gcro-i'Fr lchdo.l'E6 .!d 65440 u!d'r drurgh ' i!
"terrt;t r Dd .ppUi!8 05 DM uorbi.
$il br *ldtlo|.|i4 i! d' ruritrg
'cid
D.did i! Elp.ritol ?.

da
cl

., .., ... = sig.ifi.dr !t 0.05, 0.01 aid 0.001 lGELs, ct'.crircly,

E = non+iS ficrnt
 c I
E 3
r! I
t

_g
t*
g*
t 0,.

!1o
i-

Fk 4,14 FB! .rd drr blou.$! !.r ptororynrh.rt r.r. (Pr. rrulpindotr nte (t).
l.oDrhr .ooduct.!c. 6,) rd rub{roD.t.t COt conc.n.ndob (Ct or4 neet otd
pltrt ortnoab..l g.trotyp.., Cn.kr.l{5.!d 55:l.l{ urd.rdrcugh rorb$il
by v|tnholdbg arlq .!d .ppbila 0.5 EM D.ortlc .cld in th. reotirg d.diur
(nob + S.E.) ln EuoiDdt 7. WL.r., C rdcE to corholt CA=.o bl + lcorbic
r.idi IF dhtghti DA=Drcustt + .!.o.blc .cld.
a.6 Elp.riDdt 8: QTL M.ppirt

4,6.1 Pbootypi. srilg ot tn. ft poPlbtio! ftr rh. ft.ia

't|!t
d lo drclgnt'

The F: popul.tion Aon the bip.Mtll clos! bctwen a dought toldel cultivd
(Cb*qd-E6) and a dsught s6iliv. gcno!?. (6544{) w greM undd dreugl stres3
in hrdrcFnic culhe lrd s.@n d for tla t ils, Pu (net Photosv h.tic nlc)' t
(telpidrion rat ), &(srobdl ondEt ie), RvC (Rclalirc wst r Cont n0 tld CMs
(c.U Mmb@ Srrbiliry).

Illc &.qu.!cy dihibutios oflh. F poPditi@ for the tr.its @ 8i6 in Fig 4.l5 All
ihe Bftnet 6 sho*ld no@al distib$os with lrdsg.ssio!. Tte coftlation maoix of

the baiE is givcn in Tabl.4,l5, N.t photosynuetic hte @relatcd wiih sbnatal
condwt c, trspiraiion rat ed cdl hmbree 3Lbilitv. Relative vatct @ ent ale
Dcirively @rclat d wih cMs.

T.bL PhdotDi. orid.no! oooa ti. .r.i6 Pr (@r Pboro.tnll6h)' t

{.1S.
(trdpir..io! ni.), F (doD.Ll @!d!cL!e), Rwc (r.hliv. 'rt.r @!..!0 ud
clr|S i..[ E rbnn t..bili.y) !tudi.d b 5 '..1i old rt poPErrdo! of $. .6
bet*o! lh. rt..t culdv.r, Ch.h {6 ud tL. g.nof?. 654+6.

RWC E I
0.0E

E 0.062 0.15E

I 0.113 0.266.. 0.09

cMs 0.t6. 0.1E7. 0.06 0.18.

., .,, .. r = sisdji@r !l 0.05, o.0l lrd 0.001 l*b Fspetrcly

96
4.62 G@oryph Fri4 ol at F, Doprr.ihn uhg SSR ottt n
SSR8 (Sinpl€ seqEncc R.Fra) vw .mploy€d to idediry Pollmoahieh b.t*td th€

parni!. A to&l of425 Frd p.is cdPrisiig lhe Xgw (100), KSUM (200) ed
SSR

\rMS (125) si6 re .stld d lt pdal g.dotyp6 lo dd.ct Flaiid Poltmry[ic

nad.6 (th. Fi{|.ls ed 6e scq!trs gi@ in sPPddix). A@Eg ttc 425
li.e of
priffi, 365 dplifi.d th. gdonic DNA. Ano4 '! lh. dpli6.4 23 loi wrc fould
polynorphic (Lbl€ 4.15). Amdg ihe polymrphic lei,9 wft ePlifcd by th. XgM
si6,4 by rh. KsuM lDd l0 by lh. wMs. Twl@ o!. of rhc 23 lai Fgr.gd.d @
dooi@tly io r l:2:l ..rio, whilc ll 9w doEind. in 3:l 6iio, A lot l of 12 @-
doniml DNA Mrk6 \l@ weyed on {B mppilg Fpuhtion. Gcl pictws rhowilg
sbeofthcdonid lnd codoEi@t *gFgating bdlcl'.'! givd in lig 4.164.21.

T.Dh +16. Arpli6qltoo d.nn ol PtlaE 6pky.rl i! SSB u.ly.i of xhat

goolypacbjsd{6 d65446.
Ne. oa pobEorphlc pri!.t

100 35 xg@471-?A x8@617-64,

Xgw382-24, XgM497-2A"
&m3ll-2D, xgM497-lA,
Xg*na6-?8, XgM372-24,
Xgwn82-28

KSTJM 200 l?0 KSUM-I7, Ks!'1tfi76

KSUM.II7, KSUM.68

125 I0 t0 wM9t20, wM9r21

wMs-26t, slrs-t69,

wr\,r&2?6, x,us.2l8,
wM$292, WM926r,

wMs.293. WM9l02
It ritqEcy di6.tb. of lt. n ir, C.iiS (cdt Edbd..a.Dfi.y} RWC
4l5.
(Flld* r.t . o!rdr), Pr G.r pLob.y!rt6b), S (tnuDintto! r.r.) .!d t!
GtoD.r.l @ndo.b!@), rftdLd b 6 s!.t on r: DoDubdon ot the .Mr bers@ ti.
dbrlhr Ei.t !t *Let.dakr., Cbfs|}S6 Dd lt. dnogtt &!dah. gtrot
5541{. wrta. ,r'w' ildt & ba! y.h. or tr. ar.ta b Ctrte.}S5 ;ift lir.
".
bb.l rrrE h.th... oa dI. of ah. ir.ft h fsailc
 PI P2 PI P2 PI P2 PI P2 PI P2 PI Y2

fis:1.16. ooreoLl !ud.t *hh lhe Drired (tarnir! troD lcfl, 2a9-2a. 518'58.35{l
d t99-!i|, 2'3a5B .od aE+2D ot v.sm Frts ssR Pth.n lIorl4 doEi.ur bd
.o{obh.!t lo.i Pl= Ch.lfl.!86' El- 65.14_6, M- DNA l.ild.r (DNA fngd'nt
ptufd. of thc bddd i! livetr i. rppddL IY)

M PI P2 PI P2 PI P2 PI P2 PI P2M

fis 4,17. Prrc rl trF.y sitb lh. prir.F (trr.dra ltud Lf') XgsD 3ll''D' 617'
PolvDorplitD Pl- Ch'Lell46'
iipri lC?-rA. wMS tor, ;ta Kst'lnr'l 19 'tdils ponL
rs.rf<. u= ur,r uaa.r (DN fngD.nr of fi. rrddd i! gtvd in
rpp.ndL III)
 M ?l P2 PI Y2 PI P2 PI ?2 PI v2

Fi! 4,18.P.r.or.l td.y sil} lb. prituE (ttriing aruo |.ft) K!rD-120' Ktuo-
I i5. vitrnl30. vsuh.ri3 ud K!urn36, Pi= cn.lfli-46, P2= 6544'0, M= DNA
hd;br @NA fnsuert prclil€ of fte l.dder i! given i! tpDend! Ul)

PI P2 PI v2 Pt P2 PI F2 PI P2 ?I I2 PI v2

fir 4.19. P.m.d !un.t

t[ priD.n (lhriirg lmn oDp.rl.fil WM$26a. WMg
249- WMS-271. WM$272. \ ',lrls-2?3, WM927a, WM$275' (rt rtiry tron low.r
l.ft) lvMs276, wMs2a2 ud wM6-284. Pl- ch.Ltrl86' PI= 654'6
fi! .1.20, .rn.y tiat pri@r XgEd 3t'_2A lhdiog ptHt!' Ct'La+
PopoLlio!
ii'aii #Jis+-rrzia;g ;d r0 ildddurt rmb o' F DoPd'tton M= DN^
i-aiil0riir'i*;, p-d or |! bdd.r it glvd ln ryF ndh llr)

910

t''.i',1.i"'#'&I,x":9,*fiilffi i.i?;?;$'T"fis*i'TT'iI
iloi* rtr.ii--i., n-o; ol &G bddd r livq iD rPp'ndn tlD
Fir al2. Popuht o! rrn.v wili Dr|[r WM$l2t !Do'i!g p'E tr' CD'Lttl-36
.il oli"
,i,it rnr .r-*''ftb li bdivldo,! rnD th' Fr IDDuhdoD M= ItNA
Lii- tole r.p.i p.tt olrhe hd&r ! rlt6 b
'PFrdl'
trI)

iilt'ffff
jiT::ii1#l',l;##'il#rffi'1jtrffi ..l:"T:l
ih. lrdd.r i! giv.. ir .DP€.di! IID

102
d53Li !g. d.b{i, dd M.p o!.t'!.60!
urlrge aDtrsis ihb!8! lh. MAPMAKER/EXP rcsullld in linksc of 4 ssR l@i on '
Uorigc grelp on 2A qlcd cb|ll|noqtr. T!. iottl @! ld8$ B E?.5 cM.

The FsulB of linlagc .mllsis .lo!g wi{t g@otypic &d phemtvpio trail data 9@
iEpod.d b $. !oft*@'QTX cartognrt r V 2.t QTI,I
qw idddfied bv tudjng
r*idi@ b.t*@ edrd g@oqF .d ttit Ob@q?c) BiDg SMA (sinslc oitq
drlysis), lM (int osl 6,ppi!g) .!d CIM (c@pci& inleP l htppind n'thod! Ilt
fl8l g.n tic Mp @!!rucld is shoM in Fig 4 24

Fou Eai(6 a3s..id.d tith lbG e!rc iddtifi'd bv SM'\ five

phvsiologicd ttElis

@L.ls .!silr.d with tbE trait! by IM ed foui Bkd deda&d wilh thE
taite
9 QTk' 4 of th'e 9w
by clM CtabL 4l?-4 19). IM a.d CIM @lldlirclv
'lct4t'd
nctbo<b Th.lrbl6 etpl'lnlh' QTL pcitio4 t'OD st!.
a'd ph@lvlic
folbd by boll
wirlrc (*) {.ooni.d bv tb. coEbiltliot, I QflJ for CMS' 3 for RWC' 2 rm
tlil In

nct photo6tdhdb ed orc for sloDatsl @dwtan€

eln dttet€d No DdlG ould b'
foud linlcd with tbspiatron 6tl

103
 xSr|n 3t2na

t(sut|r-119

Tonl m+ did.M E7 5cM

Wheat chtomorome 2A

QTL &rP,d.cct dib.rCIIvt

*
I glr d.b.r.n drcugh lM
for CMS

t QIL hr RM d.r..i!d $ough

qILfdP,.t
IM
t bd6dCctr,
qrl fd c[{s dd.t dtrsgn c
0 qI1 fo. RWC d.tlsd th!|4b CIM

ffi #"ffi""-.,1#.m;l61ffi .Hfi J:ffi f"*

T.bh 417. qfli d.let d ror nd Dtotodt.lh.iic nte (PJ e[ n'Ebn@ ti'bilitv
riMsr, ttnrir.t .no0."r.". GJ r.t ELliv. rtld olt trt
(RWC, (norgh sbgl'
ir.rjr ut* fNo tDe r;popul.riotr of r cMt b'tva! ddrshl rol'nrt
clltie.r. Ch.[a.]E6 dd drrlll toillc g6otvF. 65"1'

X8M 172'2A 0.003r'

0.00t..

., .', ..' = sigifcdt at 0.05, 0.01 ed 0,001 ld.ls. FPclrv'rv

(?t' D'dbnn' lobilitv

T.bh Qrb &rai.d lor mr Phobvnrl'rk nl' "[ (Rwo ftnls!
.'d .t'tiv' {'t'r @!tor d'udr
4.tE.
Liii iii'iit 1i"4""...e {&;
-Dop!r'do! .* b'r'd tor'Fll
iil;i il;;s-;-" tr. Fr
' or
a."C;!edtiv' geoot" 6sl,t{'
.-J*J, ilifu.iat -o
I.OD pJ%
Inil QTL OTL poritlon

KSUM-I l9 255 cM
Qh2A M
21.2.M 2.5 2
cMs QcMS'AM KSUM-t19

2.1 3
QCMSb2AM

l?.3 cM 2-8 t9
RWC QRwCazAM Xc"d 172

2.5 5
21.2c^
QRWCbZAM KSUM-ll9

10t
T.bh 419. QTl{ rl.l4ted for n.i pbotsvolhdic nt (Pr)' @l r@bro'
ICMSI rb;t l .ondrct !c. (g, ud r.ttdv. t.t r olidl
(RwCl
Codp;iG rnt n.l ['r.pPi!r 6ob th. F, poputlilo! ot r 'rc$ b'rr@
toL;lr cuhia.r. Cn**d-66 r dtulght.olriv. s@olvDt,6516

Trdt QTL potitiotr \2

QTL 'i
KSUMN19 26.5 cM 2-5 t7
QPn2AC

KSUM'I I9 27.1 cM 2.6

cMs QCMSa2Ac

QCrvlsb2AC Xgm 497 4.4.M 2_1

KSUM'l 19 2? cM 2.1 t9
RWC QRWC2AC

d. dcfircd bv "Q" folt{ed bv $e dd '4" ot "b" @ 10 dilleentialt moF

QTLS
"on}d
thd on€ QTX for the se lnit *trilc 2A stan& for th' chbmosomc Imbd QTLs

dcred.<l bv lM dc d.sis8lcd bv a "M"

*tdle QTL9 dctatd tbrcueh CIM e
d6isrur.d by "C". QTLS d.td€d bv I .ft.I MnpitrU ed cmFdtc Intdal M!9Ping

*@ atl at Ftt6bility P< 0.001,

@mbnrE $dilitv ed I for rclaliv'

Ovddl, I QTL for nd Pholosvnthdis, 2 fot 6ll
IM d qdl s ClM SingL
wl.I conl@t vEe d.tectld on $c 2A chsnoson' bv bod!
narkd , l)sis ercded signifi@t (P< O o0l) r'ldioDshiP benr€n ssR @!cr x8"
lMt t clM bo& m'rlb& d'tdicd
t @@on QTL
497-2,{ and !d Pnobsv h.!c nL
6t 25 5 cM A QTL ibr
for ft| photosylihdis "QI'n2AM" and "QP!2AC' eP@tiElv
thc Edk{x8M
sieBrficlltlv ai'o'iat'd (P< 0 01) with
,torrrrt -oa*u*. ** ro,,oo
&d 'QR\VCb2AM $d fowd
197-2,r by SMA Two QTts for RWq 'QRVCa2AM"
thrcu8! CIM
ihe lM d.thod. O@ of th€* wd al th' se losit'oo al$ detd'd
by
CMS' I bv SMA and 2 bv IM 6 w'U
3 CIM rE'
,O**"r a) * Ott,
"'
 CHAPTER.5

DISCUSSION

Dbushi stns-induetl rcdwtion in vield of nsjor crcps Ptnicurdv @rcds

6ults in
striclcn a@ or
food shdta8.. To @h,M a 3Nrlimble illd of fdd crep3 in dDudt
die w 4 biologids e rryinS ro imprev. dtought tolod@ of *b'ar
orhq 6ps;
'nd
how€, lh. sucds is tinit d de to thc mutiigcnic dd @mptd Mnft of lhis t!it' In
of
rie D€sdt 31udy, e ellon wd nEde io dmine whcltci 'xogenou applicaton
eorbic .cid cd impreE *lst sroM undd dtousbt sttlst QTrs ehl'd |o deudt
lolefue vlt .bo dploFd fd ihen EliPullri@ in bcdirg prcgnG ained at
inpDving droulhr tol€lle id wheat

The culs o(Findr .dt ili!8 asstunt of cdpdnvc dreueht

of lh. 8ro"O
rolc6@ of tw sdetic.lly di!!F *d..t s@otvr6 (cbtlsl{6 ad 6t4:l-6) sbowql
thrt drourlt str ss sisnfic&tlv red,sd i$h sd drv bioffi of both
g'no4?6

d.terdjn€d 3t th. dl€nng sLg.. Redsd gre*th 8t utdd drcuehl st'$

h6 ben
FporLd in all Plrlt sFi6 (Si@ er dl 193; Astmf id O' ka!t,
19 l Vill€gd cl
a/, 2ool: Kh.r ?t at, 2ool; Ktllrrm et al.'2007;Kr6dLt tt dl ,2cfi5; Amin dt 2009)
'l
Since, biodas. cniMtion is an index of plst grcstl (Be a 41 2009) s rcd ction it
bioDs is @Nid.i.it s an .dv@.fre.loD golth ofplets
(Neils4 2006; Praba et

al.. 2009). di (2008) rcFrts rbd dbushl sfts tfrdti bitosis' @U clolsadon
Hlsitr €r

ed dpsrion which rsult! in ithrbired grc*il Gdi6 tt dl (2ooo) tld Isji

et al

(2003) als sgucd ihat dmugh Ed@s @U divbion which in tun hmp's so*r!
Ceu

smwrh deFds o. walcl $dabiltv Undd drcushr' slar $PPlv ton xvlm ro
h
clo44irg lnd dividing elb of odistcn ie Edrctd d@ to *tich sror1ii 'fi€ded
(Nondi,1998).

Dt ush slFst sie!fi@tlv suprsted isbs of eai6 ps s?ik'' l0o Gd

wish dd
gan yield pq planl of both qh.{l gdotvp.s i! thc pl6cnt lfudv Thw rsults suppon
de arglhdt of Shao €rur' e009) thd drcught dDsticallv atrccts plmt8rowthard
developB€a! linitilg ltd F fomln€ of creps Klar .r al 090) al$ sludicd ilE
yi€ld

r€3DoN of nine whelt cdtivG and epon d thal grlin yicld of 'll $lt'!t coltivdr
decrs.d lndd dreDsht.onditioft such dtou€trl-bduced l€ductior id ield ha be'n
obs.d b olh( mp3 sh 6 mde (Anjh 4 al. 20lll bdltv (Ron8'hu .' 4l
to AnjM
2006). eybce (Ftdd* a 41 200D axl Frl biUct (Ytdw, 2010) Ac&rding

., .i. (201 l) {to!rh-ind&.<l Ededd d PlDt gro*lii dd dcvclopmnt tfeb

ilowr
prcduton dd Srdin filling, lading to rcdMd gnin vi'ld R'duction h sowlh in rcd
of biomss dd vicld of planls u(lq droudt b'd r€pon'd nainlv du lo
slttss hE

de.Med nd photostithdis (Leidi d, ai , 192: Nicolts dd Tm'r'

1993; Ashaf' 2004i

ttd li*lor, 2005; R@ t I al , mcf,, Attu et al Asfu^f dxl I@t'4 2007)

N6tr€ '2OO'1i
qeplq Sh.h rnrl Paulsc4 (2003) esimrcd thd SO % trcld of shan is dditld
For
(201 1) Gpod'd ihat gai!
noE photGtttb!3h dFng natMtion Re@tlt, Adu
€'
'i
4d inhibn'd
Iilli4 udd <ltought is Edlc€<l de to inplircd similst' ptnidoning
Accordiry to Fdooq ?r ar'
elividca of.!4t.s involvc.t in $dos ed stanh svnih'$s
deficit dE to disption in
(2009),laeld Fdiu oI cto!6 N scvfttv hmp€r'd bv w'rd
gs dchegc $tich ld.ts io ttducql sia of &d sinl nsuca 4'nballv idibinng
sG
phlo4 t@ditrg 4d siDn.r. !!sld!!d
trd ldniiiodng"

ln ihe pllst shdv, @dpdadvelv lowr $rp?t€3'ion in etowt!

td vtcld of i!' cultiw
6544'6 s tb' shoM in ted o{ ils
Elalivelv lo*d
ChalMl-86 @bpd.d to gdDlvp'
l! rh' pFlqle1!dv' d'cEN in net photosvnih'sh de to
r.duc,tiotr in pbotostdhois
dreueht slr6s al$ w4 p,ral'l with
d€d€se in pl&l trespiration and stomLl
$h'ar cdlivs
.r 41. (199s) sMied ttlc efcct oI dsusltt on sPnns
conductaru.. El Htftd
*ft
sd foud thlt n.t Phorosvtthctic rric dd sroo'lll @'d!c[t!e
suta$dnallv

sra$ Sibne Edt3 @ cpotud in odEt creps *b

4 Mi4
rlduc.d du. ro dtuuehl
(Ari ed Albbf, 20ll) @non (t'idi er dl 193)
3unflow (Panloi' et ol- 1999)
(Beslls dd Paul' 1993) alfalfa (Yowli
*rgnM Grig aa ql)l64hd, 1983) 6uri d
it the pNnt stulv
, o-t. ZOt O) .na ot u (e.io ' a , 2009) D'c@$ in photosvnthesis
to tdu@d stonulrt conductsnc'
(coFic' 2oo0) ed lov'r tra6p@lon
nay bc affrbuted
Mold €r dl, 2Oo2; tad plels uldergo lclh'l
Podp'lti et a/ ' 20lo)'
(Codic, 194:
n*, *t*- *'r* t n abotln of w&r i5 rnlsaind (Tit td Ztis't' 2@6|
ma
T@sliaiion Bt of both wh.al g.notvFs in th€ pest study d4tts'd wilh iM$sing
dsusht srts. nti dcds.d teslinnon 6old harc ttcn du' to hiett't sbnai'l
6isr.ne uldd drcu8hL Cldft of no@l. is orc of the npid phvsiologi'd chlned
tlEt @u udd &o!8nr cl€b!.haadra .r .1.' 195)- It h4 b'd Gport'd
th'r wiliron

ir iomtil condMc€ ddd dmlglll aff.s ttNPiratiob dtc prcPortonally moE

thd
photo.ynih.lis (Mdtin tud Ruiz_Tms, 192) bq9@ trdspir'tion of mlcr ilrcugh
stoMra ir 50G1000 liD6 mE tb@ the co idsLe (reh'i, 195) SiM *ald ed
COr tlow hotb o.cu rbmugh srod4 e ptoidldlhd3' bupirali@ dd bion6
pbdrct or @ codelat d with @h othd (Moniei0! 1977)'

Cdtive Ch.tw.l-86 itr th. pr.sl 3hdy M Glativclv hidq in

pholosvdnes's'
Tlis
sdpinion 6le ed $onabl conducbnc! conPed lo e'noBF 5544_6
could hav' be' dE to
difrercne eE cxchmge chMtqisd6 of fie t*o 8ND?GS
'n
(l9E3r w of the ed lhd g'*lic
ther inldl drouehl 6istas. Potftd BlM
( d a/ ( leee) cpon'd Sddic
vdiad@ disrs wilbin stdi.s fot dmugh' Lolcrue Mlt
v&idron of rtFd gdot T.s for ict photostnlh*b udd drcu8ht' Th€ drcught lol'dce
trd pbot6Fthcais ddtr
ofa Dldt is diretlv Gldr.d to ils dbilirv @ MnEin hig!(
(Chrndra 20Ol) b@aurc il atrct! aI tbc ptt3iologicrl
a'd biochcEcd
drcught
to gre{lh ad vield stlvmcl ai
qw tle ofilr view
(1990)
Fs4sa ofPlads tldcd
thar *heal 8em9?6 with highci !d photosvdh6is 4d RWC u&r drcusht &uld be
photosv lFsis shot
drougltl tsistant, Mo@v$. st!'!t gobttT* havi4 highd n'l
ed Kevomoto' 1992) h hs b@ EPon'd tbit trtt€l
hishd yields (Ritch€, 1990i Gent
d to dDu€ht (ASstrqar
vdi.ties q h lowr vi.ltt PoEntitl 8@dUv mE sslFibL
r8l Sinb., 1987) whichb diddt Aod iht ptedt tudv c\tiivd Chakwl'86 b'its
Mr found ro be droueht eislanl
hrghd ir yrld pordialospsEd b 8'notvP' 6544-6

wlilc assing lhe opdnu lcv'l of 'srbic a'id ctredrc

iI rcotiog dcdlM' for
it *s foud thal sorllic eid
folie spny d a! & s.€d t€ttndlt in the Pr€s sMy'
alplicd thbueh ciihd nodc consid"adv dLviaEd
th' advd etr@ts of dFught
tlmugh lhc dting D'di@ c'uscd
ArOoug\ ar fou ldcb of Mttic *id tpPlicd
of U" sbdl s'€dlins subj@icd lo
inpo!.@nt i! gto*lh a.d rcr Phoiotyn[Etic dt
ooe Sbnlab ad
drcught bM of s.orbic did prev'd b b€ th€ mdl €ffddve
irds, 0.5
Neuman (2001) ale optitnizcd M$ic &id lev€l std rcpon€d 0 5 mM ss4orbic acid to

b! l[.non .fl4tiv. doe in Doiing E€dim of nuti€nt solulior ro 6dmi. tomb

sc.dlilgs 3n $.d with NaCl or !EC. Tb.ir BdG slFved thlt a$lbrc 4id w
.trsiv. in incrasins fi.sh wisll of osmoticdly stcsed todaro s€.dlings A$!r a a/.
(2009) .ls epli.d s.olnic *id by ditrqlnt Dods b sI st.$.d *d.41pLllr qd

foud thdl etine ncdru *6 the mst cfr€ctilc Dod. of eorbic &id apPli.atior
T!.y foud ilEl 100 ng^- (_{.57 d|M) $olbic ecid in thc Doting aFdiM or 'dl
sltEs*d qhdt plsts in a hydrcpodc cult& qFindt h.lp€d lo @inrsin tbe gowln
ard @utemded oxidlriv. stcs by incFasing of dtioxjd^r' kid et dl'
th. l*l
(2009) Epon d tba. 500 ad 1000 Dg L' l*k of .srbic ,cid elulio tlplicd i! rhc

roodng m.diun of wbcrt .dli ad s..dlings subj.ci.d to sall 3t $ sert ellecliv€

in

idprevilg stl tol.fuc. of *nat

Fotj! ltDlicadon of lglbic &id .le prctcd vdv cff.ctiE in altdialils th' advcF
efTe.i! of douslt st s Plants sPnv.d vith as.otbic scid solution showd higha
gFsrh dd Pholostnih.tic oL. tdspitllid de dd ltoddd @'dstaft' @nD"€d ro
th. ul@&d otus Asons th. fou lcvels of 6@rbic @id sPnv w4 I nM 'sco$ic
&id solulio emrqt to be th. mon eftdiw in @e)iodting thc adt'e 'ffds
of
dmught. HMn! dr al (2009) alpli.d 100 Es/L
(-0 57 nM) e'bic &id d a folid

spdy to ruie Ptels subj.de.t 10 solinirv ste$ 4d t€pon'd Ud il w hirllv eflcctile

in @ut radi.g de ldvcEe Gfrdls of stBs by o}leilg

gro*th cbloFphyl ptgrddG

ant lh. homores IAA (indoL 4ttic &id/uir) &d GAr

(sibb'rcllis) md tducing

o&dati!. dd.sc b n@bd6. Dolatabddid al (20lob) td'd (50' 100 6d 150

'r
n8/r) !$olbic eid on mia pl'!t3 $bj.'Ld b dreu8ht 3rN md fou'd
100 150
'nd
ad\@
ng4 (-0.85 nI,0 of a$lb'c rid apPlic{ton 'ftttjv' in m'lioBlin8 th'
.f.ds ofdbugbt stEs al difrGFot sr€F3 ofpla gwtb Khad tr 4' @010) !$d 50
ptt E tt'a
sd r00 E8/L levels of dcorbic .cid 4 folid sFav on &"rtca conPesnis
IOO n8& vdy .66hc in udiondne thc adv*
of sh s$6s bt
foud 'ff6r3
.!n rcing tbc gos4b ofPldis

Asrbic eid applicaion s . pE{owine 6*d pinine tt'aiEdt in rbe pEsni studv
vs d$ foud .fl61iw i! aU.vialng lhe odva* cf*t! of &ought i! vlal st'dlilgs
110
Asorbic &id lpplicdion s a pc-ewi!8 *d lttltddt .nnrMl tlE snerL ocl
photosyn0Fric ra1e, ed stodat l @nduclec ofthe pldG subjdtcd io
tr&spindor ratc

dousl . Amns tlc fou Lv.h of .$codic *id a!pli.d, I dM or .gftic &id 6 l.€d
soaling ehiion prcved lo b. the sDsr €f.cijve ln cont8n Al-H*ini .nd H@da
OOOI)foud 0.6 nM 6.dbic &id slution lo bc vcrv e{i.ctit for pF$*ing sed
tet]@t of wh€r ro oulaact d. adrl* .f.s of sdr sEcs on whd pbnB
ndj$dn ?r al. U009) ued loo br/L (_{ 5 mt!0 6@lbr eid 3 a pF$vin8 se€d
rrarm in mi4. Th. pldt! soM tod tE s..ds sw stbjeLd to s'liF slrls lr
@ foud ihai lbrs lev€l of aslbic eid solution for s.ed soaking M ctr'dive in
oclio6ting ih. adv@ eftcll of salitit R@dv' Baghizd'L ald
Hajdohffiadre@i (2011) appl,cd 0.7 nM a!.o$i. a.id a a prc_swins sed
iF.tndt to otE pb s gou urdcr 4,2 -0-4 Mla PEC induc€d {touglt
Mla,rd
srress, Th.y fould thst as.orbic @id at thr! @nccntratio! s cfl4tiv' in €nhecing
sDr,th ofdreudt slr.lsd okn *€dlings.

Higld groMh in a$oi'ic &id lEld Phrs unild droudt sa6s mv b' atlll_bllld to
imlEe in @ll .livbion ad 4llcxposio. s n davs d imporrdt rcle in @ll division
&.t *U itl .xPAsioo (PigMhi dd Folq' 2003) Hcncc, 'sibic &id uv be
csnnal for pl&t grcs4! Ii hs b.G! ElorLd tbit apoplastic Mrbqt' h ! @factoi fot
prolyl hy<hoxyle e'iich a.1ivat6 hvddvPDline dch glv@prcicis *di'h @ Equn'd
for Gll divisio!.nd qpuion (SnirDofr, 1996,2000) Fulncdoc, Mrbic &id acls 6
ao+ubstat of Fc{ioxvgqrs which bd a ml€ in posf itamlatiolal modifi€adon oI
ell etl lol.ins (AEgdi, 194)- lt is .le irvolv'd in lbe svnlhdis of 'lhvlN'
gibbeielliD,td dthocyoirs (snimor, 2000) so, th€ .slhc @id_induc'd 3ros1! in
*tE!l plolts in th. Prcsr snt(tv Dish h.ve ben }€ du' to pr'du'tior of
gtox4h

prnotins hodon., gibbscUins HMein dr al (2009) Eponcd tbd erbic @id

apph.d 6. s.!d elkiDg or folis a6v @!n.nt lo 3alr lced
tuia plds incdstd
lbeir adogcmE IAA ald GAr @nr.6ts

Erosdou aPpliot'on oi 66bic &'d in $. pre snldv al$ 'ncG'!'d

nd

pboiostrthctic 616 of Pl4t! of bolh e.notvFs uldd @diol ud doug)ll

(in bolh

hytlropo c sd $il cultft) Silgh.t al (2001) eported lhd .slbrc

&id added to fte
sil i|rlfud pholosF$€sis of pleE subjetd to drcoght strd Sinibrlv' Atbd 4/
'r
(2009) .lso foud m incrcas€ in nei pholoslhihsis of whcd pls t bv applicdion of
Mbic &id udd salt trrss. A@lbic eid d m mtioxidet (Mie!.I er a/, 2000 hG
ihc alility lo niti8are $e rcgatirc efr*ts of slesc d pldtt bv @$alizing h@ful
oxi<ldls (DoL&lbedid e, ,t, 2009b) ltnich d@tgc pl&t tuobffi sEh s rhe
rhylaloid mdbtua. 'ftq! @ nEv Fpoil3 shich dcpid lhal tpplicltion of @'bic
&id b€lps pldts to iol€t tc st$s by it ctivali!8 dd sclvdgilg lhae onddts or
rcs.tire oxygd s?ai* (Foyd dd Hdbituon, 1994; Nocter and Fov'r,
198i Sndofr

ed vhErd.2000; Dolatabadid et412o09b) ''tr iD'I dl Qut9) sPplicd &*olbic eid

6 . folir spay oD drcugli sEcs.d oka Plets lrd foud e in.!!s in pbtl
pholo3ylth.sis un td dtoughl s.6s ln t!. Prsent srldy' tftough lhe
edbic &id
whca! howv€t'
a$li€tion ituough a[ 3 dod6 hrr' a pGitivc .tret on &oush st6$d
ln. €flcd of tqrbic did appli.d ilNugh th€ @ting n'diu B
Elotiv'lv high'r

comparcd b that eppli.d 4 a foliar spdv or sed

soaldns llis mv b' du€ io th' een

thrt in rcoting DediM onliluou $PPly of Mbic rcid is

lv'ihble lo ihc pldl
@npaFd b the oih4 t$t nod.s

IniheDr* llc alplicariot of sdbic eid inda*d tansliBtion Fr€ ofeiat

srudv,

Dhltr gtos i! hydepdic cdt@ s w[ s i!

$il @ndilioN @dq dtousl sftss
Plets show.d hiShs Fqor @ a$nic 4id whd tdd'd
o |he @dna b'<hh
llBpintion Fle w fFn'd ir o|{I! Plar s $bj{t'd to
drouS}t
SiFnd inde in
Usts djft!'n th'ir
wil! fi.Ioli& apPlication of sorbic &id (Af,in a al' 2009)
dte Alto tr t/'
waq stru by Ggulalin8 3lotubl @nduc@4 e'l ranspmtion
il9?O suggcsied fiarlowstoBdal @ndEt'n@orhigh
sto ttl6isru@ i3 e adaltivc
pl$ts bv dccBirs 6k
pdrabdd.gai$r drcu8h barls. P'c6c wter losr toD
't
of trmpitarioo U tc pl€sr suav, sloMIll
conducr'@ dcclin'd signifi@0v in both
qh.d 8.mlyp* undd drolgh @ndrtioN groM in hvdrcponic cultu€ ed
soil

ooting nedim in@ed

Howd ih. atptic.tiotr of eotbic &id P'ilculdly in lh'
nel photosynth'tic 6tc
sloElal @ndEl,G of pl&ls th'ebv iNEtsing $et
eficiocy dcpends or chlmbplast pigmens slt !s chlotuphvlh "!' s'l
Photosynih.trc
Flc in Photocheniol r€a'liont ofphotosvnlh6is otiz
dd
"b",qtncbplay o iFpoir
112
Zes.r, 2006). nr Fsult! of thc Ftsdl $!dv 3how l['l Mler dcficn sisl|trd0v
Educcd th. Laf chlooPhylt "s" &d "t' @ni@r of bo$ whc't
gcnottT's his B

rnaloSou to s'lslhs ben.stia obw.d in sulow (Zdg sd Kirkhm,

196;

M6ivl!!|lm, al., 200%) i@ (P.reagd, 2oll) bdlev GrNu a al 1999\ n'ib

Dolaiabadid .r al. 2009a) ed olaa (Anin .r zr' 2009) 4 wll a stt'5 o!'loveru'
201 l). Thc dlclt@ i! r!1'r d'ficil ha b"n qon'd b l,j.
cblorephvl contenr lndd

Dla@ dE to ii! photo{xidation tud d.gFdltio!

(Anju ddr,2011) F8t deeradalio! or
c Mophyll d@ to thc.Dttrctd a.livitv ofdnoFphv[$ @2t@ uldd drousht sta
hd b.4 Eponcd in the leaves of{hdt pLrls (Mihailovic dl, l9?) ln ltte
p€e
'/
study th. M-s:romrsl d.cEs in phoLctt0Eu urdq d$uCL dsv hfr' bcn clued
cl orephyll. E{li€., cl orophvll ha b€n shoM ro brv' 3 positive
by dcgradation of
Flaiio. wi& phobsynlhdis (G@ sd Li. l99d) s this pholost h'trc Pig@l hd a
Mb rele i! thB l.y pt@.ss (S.i@ d ar' l99E)- In lh' lGd $udn cdtiva
Ch.k$rl'86 had highd chloophvll "a' !d 'U' @ ett thln that i! genotT€ 65446
ud.rdrcld sr* ltbab@ Fpon d th|l th. cldorcpnvll@nLnr of diough sisErt
g..otyp.s of whdl, bdlev di mai& rre hidd €onPared to rhar in s3itrve
gEootyp6 ud.t dbugbt-h4&ed oxiuirc 3tB (Rdg'Hur 41,2006; Pastod ard
"
Toppi, 1992). So, chlorcphvll 6!i.nl M .osidecd a noLndal inclcant of dnudt
bl.me in n4y plad s!ei.$ (Roog'hu ., dt' 2006)

h UE pRnt strdy, !$orbic &id .ppli.! threud i[' rootue m'dium wd tnorc
effdtiv. in i.ctcding the cblobphvll €onidts of wh€at Plmrs subj4l.d b drcu8lt
@np&sl ro rhat a$lied thtough foliE s?6v or s'€d $ditrg Sinibr NIls
v@
obtain.d by Si!8! et 4l (2001) wh.n thet applied ar@'b'c acid in
th' @tri8 nedim of
a/
drough slr6s.d csia pl&B ed foud isE5cd chlrorepbvl @DEIr!
Amin
't
(2009) al$ I€pon d !d sorbic @id'indu.d ircils in chlotuPhvll onl4ts
ofoka
plet3 ebj.ctcd ro .trclght. Az.{in ?r at @0ll) foed & inc@ in chlrotpphvll
pigrd.ds of etl slrs*d d!l@ wh.at with lhe a9pliqtio' of eolbic eid
i! @lirg
m.diM. Dold.badie sr al (2009.) appli.d a$olbic eid d 3 folie spEv
b miz
pldls ebjotcd ro dtoughl aEd corclud.d lhat .glbic eid uv in!rcve drcught
6ist ce of pldtr by PEvcding d.gdttiot of chlorcphyll cod€nts of Plets sinild
113
Bulis s€l€ rcpoded in $tEat (KlFn., dr,2006). maiE (H6!&'h et 4l ' 2008), bail
(Dolstaba<ta dd
6ndit d cr,2ol0), B'Nie (KlE., a/, 2ol0) ald @n@r bcd
Jou!.sloi, 20q) subjet d to s.linilv cE ss

Calluld m@hdd€ sbbilig My b. cdidqld s a phvsiologi"l iodicdor of do!8hr

Gktire (Irit! 19s0i PFbablida e,41, |9l; TriPlthv,2000) In th' P'Edt stult
both wh'ai
dlouehl stress sienificin{y rcdu@d lhe .ell nmbtuc llabilrtv {CMS) of
Aon pltDr ells
8@tyF- DFueh st* €ls elldd D.nb!@ d,fug' '!d leloge
{Yokota a al, 2006) including distorrion of ftvlakoid
n@bdca (K!is 4i ' 1981)'
'/
thi5 is bdle of lN i! laf ffgor Gdtitg in @llubr d€bv&ttioA wttich in tuE

cass los of i €eity of nqnbns A tiSdfiadl cfel on CMS of wh.3'l @d'r

drcught st*s ha ben t.Fied (Khda-ChoPo and S.loi'' 2007)- sibild results
*€rc

sl$ r+ort d i! sehm (Sulir@ t9?2) ri@ Gndhv, 2fiD) &d @iz' (P|!!@h'ddn
etal..1989t.

C.tl n@bre sitbiliry ell tuDbl@ injEv) is sidelv lsd 10 n4!e

(FiF!.d of

lolero@ ro vdiou !ftses $ch s drcughl (Blm ed Ebaon, l98D ed salinirv

(t-Doltt dtd witlits, 1983) l! dctmiodon is opid ttd sidpl' (s' ive ad &stir
1974; BIM ed Eh.MtL l98l) lt b4Gs lLe ntc of io!
Aob !ftiscd lctf
'mu
disca. In ihc D66t sMv, .ul$vat Cb*$d'86 Mintsimd
bighq cMS uad€i dreughl

sn s *tich Gllels iE higld dreuglt iol@t dilitv codped io lhe

g@tvF 6544{-

Applicarion of s@rbic eid h th. pes.nt studv incrctqed

the CMS of boih r'lFal

8@t Ts $bjeted lo dDudt 6!4i.lty wh.n alpli'd

i! lh€ @litg d'diu C!|live
ihc aPPticntion of
ch!keal-86 shoved hi8h.t CMS th& thal of 554'L6 d@ 10
'xo8@u
&eo6ic .ci.l, It ha b.4 rcponcd th.t th. eff6l of @tbic eid b €tnrac'd wh'n
rypli.d ro tol@t lsicti.s of *ttar d th.v
Bpord bd to qogmu 'PPlicatio of
eolbic @id (Ath{ 3r al, 2008; Azzldjd d al, 2oll) Majnt'mce of cMs und'r
<lrougl'l sits by applicltid of erbic eid Dav h'E
bdn de ro irs edondol
prop€tty {hich pddcd ndblw d!m9. by oxidanE

ftc @oric poLnlid (OP) of borh vnal 8@lvF i! lhc Pttsot sudv d@tted

@nsidedbly Eder drcueltt si6t Ch!k$d'86 cno{cd lowd OP c@pdd to th.| of

g.nottF 65446. ThB drough rcduced Motic poh$d or ${r'd l4rea slEs lhat dt'
16B tuintaii..l t4or Gmic .djud!6r Osoric ldjusor d adiE
tl@ush
loMi.s of @[ o@dc porotid u&r dreush Plavs. vitd ole itr platt go${h ard
ddcloDbdr a'd prclide Bisr.@ to *.rd &ficn Gx(lb* dd Mu'ho*, 1990;
9s*ri, 199). In l[c peut sludy, .pplictlid of asrbic &id 6leitlv in th'
mt g n diM nr0!4 d@s.d th. oP of thc dou8lt srrcss€d lldts of boih
g@otyp6. Folis sPay or sd ltdtn !$o$ic !4id slFw€d a litd' etrel on th' OP
nt of

of ihe whear rlmts. M.inlai&nm. of cdl tutgor i5 ibDotst fo' swi!€l ed pmper
firctionins ofpldt m.tabolis (T!iz dd z.i8a, 2006) b.cae all viial r*lions tatins
plee in ple1s depdd on th€ lkilabilig of oFinM mount of wts (Kh@_Chop6
dd S.lote, 2oo7). Pl&ts Mint in c.ll lugor thrcudt osmolic adjNtneni lt is Eponed
that osotic adjuitn4t ha ! Positirc cod.btiotr with pLd PrcdwtiYitv udd wal€r
de6cir (Ludlow ed M@how, 1990). Suflow.r cdtiv4 having hlsh vi€lds o'ler
drcught s4 rcpon€d b show hidl.l OA (Chindti a ar, 2002) ne ph'noo€mn of
oA M fi81introdE d by BrcM dd Sibp€on (19?2) ft Gf6 to loEirs of Moric
DoLntirl by@Mulatilg ! *i& tu8. of @nFtible ellrlcs or (moprctcl4ls sh 6
mim @ids (prli*), sus6 (a*ioe) asl qldctEv amodu @npoudr (sltcine
b.tai!e) uda dreught 5rB, (Robinton.!d ,66, l9Eq Mllajs .d Tuteja 2005;
Asbnfald ImIa4 200?; Atrj@.t dl. 20ll) ftis ibp(ove earq ofeus bv
'Dkl.
irctsins lheir elute @ndntr.rio! ih@by hcBirg tugor' nombl @ndrctlm ad
hft. ner phorosrnilais (Oupt! &d B.do*it , l9E7)

ln ihe prcet wlrd contcnt (RVC) of borh *hat s@orvPes d€.@ql

nudy, rcldiv.
urdd drcueh conditioE, A nmbd of 3tudic! rPon thit RWC of *lEal d4@ed
udq dtuught (sai@ ,l aa, 1998i Khallna4hopn and scloie 200?) whicb mav b€ ut
'
lo 4l % (Siddiqu€ .t al, 200D. Id a !$dy by KtlM ed Sineh (1998) dtuuslt Educed
RWc orurart a sFcies. sinild dcfte in RwC w @fltlv obcefled in tuie
udd drcuehl slr6s (Ali ud Ashiaf, 20ll) Natad ald Gupta (2006) Fpoied rblr
droughr stEs dec@s RwC of both Cr .nd Cr plants. In vi€w of the drcu8lridu'd
v&iation ir plmt wter elalioN, cFp Plels Day b. eE@€d for deughr toleme on
lhe b6is of ua&r Etation p!m.16, It hs b.a Fponcd rb't the cultrm with hiCI
osolic adjlstont show hid RM dE lo .o!t!c.d tu8o. (KllM 4d Si!s!, 198)'
115
Maidrinilg hiSh RWC unda dm!€!t b cocidad to b' a dtoogbl !!.bta!t D@luuo
(Stc6 a at, l99O) l! lhc PFscnt $udn Ch!t*tl'86 thovEil alalirtlv hishtr RWC
u.da dbugh ltrds. This D.v td. b.c! dE to dinL''M of loE o3nolic
pot'ntitl

rhrolgl osoli. !.lj!$renr E rlid 3nrlid .bo rtonodn!'d lhal &owlt ttrtul'd
ddrivars ofst n miluit d bishd cl.tirc wdq laf risB cdPdld io th'
@lrq in

sdirilc @6 (El H!fid .t dl, l9s). Mrb d 4, , (1989) u!'d hid Rwc " ! *l'crid
diaid lo d,flGmfut. bctllrlar dFught Bittt !!d $c'Ptiblc gdogT.6 of horLv
DuiI8 douglt 3t!$, fi. pb $d.i l.lilio pLv 5 imrort'r blc b6t@ 0t'
*tivatio of thc ulioxi&ln &f.u. sttLd Eli6 on rhd (Mcsdi ' ar' 195;
bld no
KhrDFchopn !d &loi.. 2004. I! lh. prB.6t iudv' !$dbrc &id 4Plic'tiotr
siglifMl.tr cl on Rwc ofpld& r,it.*i*, Silth tr d' (2001) tt$ Fpon'd no 'fttl
ofdog.losly lp9li.d .scodi. &id on RWC of C4$'4 plrnts'

I! dE ptls.nl stuily, lc.f Folie cdc.oidion of boih wb'd scloqF ift@sld

ic
u!d6 drcuCt 3tr6s TlF fnditS3 r!! i! .grcoltr vft! m alid sttdiB
i! qnich
dh!!..d l.3uDul{ion of ptllis @d.r drcllgh I4 ha obsdd i! diff.mt croP' '
g

Niz. ( !j!s ., .1 , 201 l), $rh..t (N.vv.r &d W'li4 2003i Ho!8 Bo t' 4i ' 2006)'
ncc

(chordh., d ar, 2005) 6d sultloE (M|nivD[n tr al, 2008)' PDlift i! o* oftbc

Eost iDponttt osnoFoLctltB Fdr.d in P|{r3 ir t!'por
lo stes lt o $!biliz'

rh!sub4luls stEnG lilc pid.is !!d E rnhrD6 tld it tl5 rlpotld ro svcngc
8c idicd! (AS$f ed F@L4 2004. I! tL. F!.cd firdv cultivr ChLsl_E6 showld
higD.r l6f plllic ..lunuldion ttd lhd of lbc 8@typ'
6544'5 Ch'nd@ld / 4r

(2000) dlo tpolt d lhd Folin @@o!.don ru bilhd i! sli's !ol@t conF
sr to

sus..pdblc oltivs of *tE! Siiils tslts

qw obs'€d it d$ush tolcat
cultivdvlind of ric (Cbordhsv ., 4r', 2005), sl'|oM (Mdillttd tr 'l' 2008)
!trd

ceI, (Aziz .r ar, 2000) b lb. Fts.d ltrnv' .,cotiic rcid qPlicdid in d' motiry
n diln 3ligh{y inda!.d Folilt. coMt tio of bolh g'ootvp'3 $bjd'd to dmuShl
sts; howd, ttB i!6!ring Gfr6t 6 not !ig!ii@t l'iLdi*' Anin tr ar €009)
fould i.caed DreliE coftdrtstio in orn da!t3 ud'r dtouSlt 3tB3 da
ro

dog.rcB .!pli.dio! of erbic scid.

116
Clyci!. bctlin is ! qlltlnlry
.mrloniM @|npourd, @mo.ly stdhsiz.d in
iftpbrt 3 or &oudt lol.rur pl.rls .!d PltF o impod! ml. in dmonc.dju!h6t
(ssiiMoto dd Mut!,2002; Yokot .l 41.2006). AloIg with Folitu n is @aidcr.d a
ffi of lh. por.nti.l oiglni. o.mbr6 bd@ il protccis sv.6l 4lluld @Dp.rtd€nls
ofpt.nr.r (Ashnf, 2004i Adnf&d F@|.d, 2007). In rh. prlsr
rl'ldy, 8lycirc b.iairc
cor& {hdt smtyF3 ilcEsrd liifi@tly
of both u!&r d&ugll str*. In ! nMbd
of snldid slrin. bctrii. a.cMul.lion h3 bG@ tllon d ulda dsugl and otbd
stlss in n dy sreia Mh a !pi@L ssglr b..t, baLy' sunflos€r and ii@ .lc
(Dsntid .od TEb!, 2004i Y*ol! dr 41, 2006; Moiv!t|@ ., 41, 2008). I! lhc Ptlst
study, Chdoil-86 *uul|Ld sisificrd{y hisbq slFirc b.Li!. @DPEd to
g.tutrF 6541.6 dE ro irs dro!8h iol@t .bitity. Aslbic &id tld . siSnific.tl
i@@bg .fcd o. gltliF bcldlc cod.ol in bolb glootyps oldd 3tB a wll a M'
lirs @nditid!. Howh, llE cf.cl w @Friliv.ly hi8!d wt o .!pli.d ihrcwb
th. turi.g D.diu'r. Itc i! @t . si!€lc Epod in lil@nc enich 3hos ltc cffc.{ of
&id.pplielid d glycin barin @ .otofpLnt3ulddtlougllodili@
'$ftic
DmuSh sr83 hdlB oir.lda d tt .-liE oxys@ spocies (F rcoq a 41,
produciiod of

2009). Tbs. Ercdvc oxygF! spei6 (ROS) .r. Ety h.tdftl fd PI&l t@bl'c
pridily dG ro t ir $ilrty io iliti.t ! wicty of oxrdtlirc chai! rtactioN @
lnetEalld f.ry acidt (Sbime 2000; Mitdcr, 20@) Droughl st65 i! cil|d 'didtliw
3t6s' tcc@ of lipid Frexid,rdon of 6dbr&.3 by 0@ ROS (BuL ., ,l' l9E5)-
Clos@ oflrodr.r urd{ dreugbt st* le.d! to r d41r* in @r con . alion h laf
tir$! r$lriDg in e !.cunuLdo ofNADP Who NADPII i3 li6iti!8; o,(vgcn && $
d.ltadlirc !*ptor.nd k t d8.d io sFdid. Fdicil *ttich k filihd r.dtEld 10
hydrcgd p@nd. (C!da{6, 1989) *tich cr|s lipid Frcxi&tio! ol nmbEs
0ribld ., aa, 1984 Aeda wios ta.tiE qvScn +@id p&du..d in
1999). Of th.
pbds uldq abioiic aitcs, HrOr is tb. mn hrmtul bc.!l|!. it is highlv tonc 8td
c.lg oxidtirc do!g. in l..fc.lL th!1 Lltb io ih. disptid ofdcLEbolic tDctio '
inlibiiion of Cdvi! cyclc .trd 16 of cllbld i.Lgriry (S.it&r ed Sristlv4 2000;
A!t6f,2009). Dburl s!!$ c{$.d ! siEdfidt i*ce io t!.laf Hto! cor6t tio!
of boih wh.!t gcootn6 itr th. F!3.nt ltudy, ftb it .Elogou to whd hs be! r.pon d

tL7
dliq thar deughl 5lr.ss in wh*t l.d to ! sub.tantj.l incrte iD E2q &cMulrtion
(S.im.r ai., 1998). tllg! tu6E tion of HrG s.l& foed i! d@ ctP (stchlb ct
dl. 2010) subi6t d 10 {lroulht sires.
'nE Hlol l4el hs b€n FPortcd lo iftt.e undo dFught dE lo slt@lat' oridts
ra.tion ofphobBpi6tior in pdoxiem.s (corps er at, 2o0l; Noctt et dl '2002) l^
.ridiior! stomttl dosw uldd dtuu8Lt latle b td@tio! in intcEal cq m@|!!lrd
which enled phoioEspitlton dd hcM podution of HrO, in hjsh mouts (Fover
,, d/.. 1997; Mnla, 2002). R.dEtio! of nilochondtid .le!!n telpon ch'in 3le
podnes ROS sucb s HrOr which c!!€ dm.g€ ro DNA, potcins ed lipids (M'nconi
.? a/., 1995; Mollcr, 2ml; Ap.l h lh. pt!$t $!dv' cultivd Cb'ksd-
aDd Hitt, 2{Xr4).
86 sas Elaijv.ly low in HrO, pobably duc 1o iis high tsist G b drcugld_induccd

ond.riv. slrs. Droudt iolcnd cultivlB of *nc.t sho*td lowa conidts ofHlo: in &
dliq 4 wU (Kl!m Chopa ed S.loie, 2007) Sinild Fsdls \rw Epon'd bv
s1lldy

He dr at (2011) h whst. MolN &d Abd.!A"n (2OOE) EPotud e inc@ in H,O,

@rteft in mize und€r dsush sE s, How.tr,lhev obs.d lhd th. Mout of HrOtr
Dtud@d i! drcught toLnnt culdvs ws l* @Dlacd &oudl se$itiv' ofts ln
to lhe

th. rEst stldy, Mbic &id applic.don hclp.d both g@lvpca to tolcrre sfts! bv

Educios i!.n H?O, @@ntr.tion wh.n subj*t€d to drcusl This mdd bc du ro the
dliorid&t ttoFrde of !9lb1c !.id ed its n q alilitv Il ba betr
'cs!6sing
cFn€.t that scoibic &id acts 4 a def€se.Sarrtt oxidstiYe sft$ (No'tor tnd Foy"'
l9E; Snimfr, 2000) AlX d..ooPos6 Htq to HIO bt 8i!s aslbic aid a a
suhat whjch is th€n conv€ned to d.hvdnd@rb.tc. It th€ pEsot sttdv, appl'cdior
6f Mrbic &id delioFr.d th. adv@ .fr6ts of drcugh bv d€sing d' HlO:
onient ir lavd of dought slrss.d pltnts This melioniive €fi6t w4 noc
prenounc.d vhd n E sPpli.d in ih. N&g n diu Tle |sltg sllgdl tbat erbic
&id lppli@tion inpoE! pldt drcugh tolcrue bv slv€ngilg ilF F!'tire oxvgd
sFci$. Sibild Fsdis wrc obt iftd bv A?z.dh a at (201 l) in dllm *h"t mdd salt
sir6s. 'ft.t tPpli.d 0 7 hM asrbic &itl i! thc @tit8 n'diM of sall
sftscd dlm
stat s.llings, The beat d sdlinSs slD*d lowr HrQ ont6l So thtv infdtd thit

lla
exogrnous rpplication of !sc.6ic &id 6iy at$ .r}o@ srlt bl.li@ of *n6t bv

@utlricdng ih. deg.rcus oxiddis thbugh ils &tioxidr proFnv

els
fotution ofMDA *ticb b a br!t!d@l
Drelght induc.d pr.ductio! ofoxidlrts
of oxiddiv€ ndbt@ dlbase (Mond a ar, 2007) It pbduccd dE b liPid
'!
Fo*idatio! of lddbIlB @$d by tlf ROS such 3 HtO! (sEim ., aL' !998:
Bl)lsi er za. 20ol) ald @ s e bdiqbr of oxidativc ddaee ln lhe pFnt
b€ u!.d
study, dnughi stss c.u€d a si84li@1 irftale in thc l€af MDA conrent in boil whqt

s6ogT.e shm €t at (2009) ale found biSh MDA @ntdt in tlnurlt !!6sed shdr
lqvB. Simild r.sult w.rc sls obs.ded ir rice (shehab e, zr, 2010) mulb€rv (c$a er
aL, 2Ol0) ald F! (Motu .r 41., 1994) ploB $b.idt d io dbldt stts ln pa Pluts'
hpd pcroxidarion ws cponed ro incde 2.4 db6 udq drousl rDlsffod.,a!'
1994). Howd, in thc pBtrl
alpliqtion of @!bic eid alplicd tbtuld all lhe
study,

th@ no<16 ws .fl4trv. in dclioEtine thc adv@ .f€cts of dFuSlt bv Fdwing ile
MDA cdcnt. This de.tlg iD MDA @ntar B doE wbd @rbic eid ws applied
in th. @tin8 ncdiM. Iris @uld b. duc ro ib mlin@s lupplv to lhc Plmt
Futh.dorc, Ani! er $!t foli{ application of I mM lMlbi' &id
al. (2009) rcpotted
M ctrccliv. ir dMinS MDA of d@dt st6s.d oka plrnts. Thu' it n'v t' $id
thal so$ic &id G efratiYe in .ilming drcWht iol€tuce of pldt3 bv prot'ding
ndbllB tbrcugh i!.clivlrid oflh. Edirc oxvg6 Aei.s podEld 6d'r si's
d.@g. ..us.d by lhe @livc oxvg€d sp@i€s is @ur€ract'd bv veietv
The oxi.lltire
'
of.i4E tic tnd @!-cizyDatic eliqidd conpoulds F.duccd Pldts in (AFl 4d
Hin. 2004), 'ftese dtioxid&ts naintain idl€8rig of Photosvnthetic ud ol'hd @ll
@bbtu6 (H.vu, l99Ei M@Bo$h lttd Al.gE. 2oo2) lE (he pltql srudv'

dtuldrt slm! signi6@{y enh&c.d lhe &tiviry of th. enz}maic dtioxidel!' APX
(aglb.r! pdotidle), POD (Foxids), CAT (crtde) ttd SOD (slpdond€
disrnut6$) in lavd of bolh gootvFs. E&lia iudi6 3t'!$
also EPort thlt drcughr
(H! s'
sisdncaltly id@s.d lhc a.tivig of SoD sld ArX in &e lave of oai4 Pl'nts
al. 2008r Mouasa ard AHel-Aziz, 200E) His! soD, APX ed CAT @liviri6 udq
drcughr strcs wde foud in de s {e[ (Shcl8b ./ 4r' 2010)

l19
AIX !s aslbd. as e detton ddor in tb. f$t st€! of the etlale-gtut tliom
cycle md is €oNi.lcrcd the moetinlondi Plmt pdxidde in H!O) d€toxincliiot
Neior .nd foy4, 198)- Both catal& dd lh. eo$.lc-elut throft cvcl. e rdv
inporrdr i! E O, svoeing Crrale beirg a t.t@dic h@€antlining .nzyn has a
hish dcion 8l€ bu1 ! lo{ ajIinig fot H:Oi. e it only mov.s lhe bdk of Hro,
(NiU.t tu.t d/., l9?). h onn"s! APX lqd6 a Edwiart (@rbare) dd ha a
hishd aflinity for H?Or, allowing for lbe sarclgirg of lmtll doDls of HrOr in nde
sD€ifrc l6.io6. CAT ed APx .lo4 *ih SOD plav ! dain reI. !o codtcn t Or-
(suFoxidc adical) dd nro, (Mtrda 4 LisA et al 2003; Bltbwi cr z' '
a! , 2OO2;
'
2004). In ilE presni study. Chatwal-86 shovld hiSlcr otioxiddt etiv'9 conp€rcd to
lbrt of g.NRT. 654G5. Drughl Bisiltt 8.tut ?.s of ri4t i! @lid stodid als
showd hiShd &tivili4 of SOD, POD, CAT ald APX !!dd dtuughl 8t'ss @mP6r'd 10
lhos of the smilivc o!., (Kl4e4hopl! &d S.lote, 2007). Antiolidd abilitv
depails on lhe saity of thc atls s wll s lh. d*l@Ed,! st ge ft vdis
'le
ftom sD.cics ro sFcict &d amng di$Edi culti6 of ! sPeies (Mittld dd alisk6.
199} Although all modes of ascorbic eid aFlicatiotr wrc eff4tiv" how'v'r' dcorbic
@id .ppli.d tbmugh lta @ting mcdim hrd !.lalrvclv highd cffets in rhc P|!gr
sllr(ly. Exog.rcu application of alcorbic eid rpon d b he efl4tiv€ in nitiSsliog the
's
adv.6. .ff..ts of douellt ad salinig in vdioB crcp sFci6 bv .nld'irs th' etivili's
of$e enzymatic dtioxidets (Atbe ?t dt, 2009; g.&*io e' 4i 2009; Dolatabo<lto €'

a]..2010i.

Drcugh 6ind tpei6 @nlai! on!.6ti!clv heba lels of 6'loec@B

much

Mbic.cid. Maion d? dl (2010) reponed thil $h..t s.cdlirss ont'in 2 6 to 3 m8/100

g .sriic rcid *tit. eryhM @nlai6 15.3 6g/100 g dd ils onmtoton i'r@6

vith plut go$lh, h the lent study' drcudt stB d€tcs€d lt'@ibic
Gndogms

&i.t conidt of leav6 of both gcnott!€s Edlia flldi.s al$ repon tlal asftic &id
@!t nt of ri@ (sh.brb er4i.,2010), d.rl (Bdoli dr 4l 1999; Hoos'Bo a al 2005i
Khrld-Choph dd S.lote, 200?), sudowr (Sgh*i ,nd Na@i'la' 195), e'8}u
(zhdg sd Kn*bn, 1995) ed ndbenv (OdE er ar, 2010) d€ccas€d udd drou€'tl
$*. Bstoli .t at. (1999) obstd 28.5% dc.@ in asltic eid o or $/har 'or
s..dlin$ dE b dtowbl fr!s!. '&. dtorglt ilduc.d Edu.rioo i! .!cot!ic &id occtt3
bcdE !srb!!c ds r sbdt.r. to! APX &d it l|!.d '+ duing lh. t!@d of ntq
qtich eru did@l i! lh. F€.nt nidy s . d..Ms. i! .odoS@u $codic cid @ .6!
w Fnldwitt e im'u$ i! divity oflh. APX ctzyd€ Xhrn!3'CboPn od ScloL
(2007) .ls oted.d I tigtifcrlt d.cli!. i! lr.dbic -ft! cotial i! eb3! lo*!vd, lb.

lar€ of dreudt eliEd.d dd dlibit d .o iffi i! uotbic aid in ebeS6t

dnogbt !t..s. r,twi!., i! th. prlt dt tbdr, t &!Wh blard cdtiw Cb*sd'86
bld bighc. ...otbic *id cmpald to (d ofg@tyP 554'l_6 und.r ddrg!. ms.. Fovd
rld turlirm 094) FDorLd i&rd wi.tiod i! .otlogc.o||! $cotbic &id cooLot i!
rh4 Th. high.. cotbic &id cooLoi of . $.{ cultiw DCH *.! fdbd io bc
co.i.l.t d wilb lorv.. oxidrdw d!d8. (E&to[ .t d, 20{). I w tl$ oh.qved tblrt
rbc bish.r .!.o!bic ..id ..d6t ofl} qitiEBCH ltsulcd in t 3iinc! rnddidel

Folcrid lo niocboodrid Dd Fdisodd FciB Eilicr in @t!d studv, u@bic

*id N hishd i! lhc drolSh ioLtut $6at .r iw C306 e ch lhoqd iB 3uFlior
dol,tDl loLr@ as&d oridrtt ddrS. @DFtld !o olhd cdtiv.ls (S.im .r 4r''
1998). In th. pllol mdy, a(ogmut qPlicldd of ..cotbic -id qPli.d tho!8h
ditulol nodd pomt d scorbic *id ro@nldon i! nr. |otts of bo& 8coo9?cs
Holl,tv.., lb. .fret E hish.. i! cr* of rlotitrg d.diun aPlicdi@ Alcofiic aid
co!@t ri@ i! rb.ld6 of *i6t dd wr! biSha ebo scotbic rid B.pplid
$re!S[ l!! ootilg dldittn @DF.!d io lh. blir lpPliqli@ Th! dFs lhl t!.
t*dbic &id E trDlporr.d n@ od b lb. Lts Th. difttae iD cdcattdioE
rbo irdieLd rh.r rh. uD(& of $co6ic &ill !,at fiSbd i! oors coo!.ttd lo
ltdt rE trroud Uc l.r€ by foli&lpity.
06ll, i! $. F.scnt lndy .s(tic &id .@lied lo *lat tc.dlibi' bolh i! htdDFlic
$ wll c sil odt@ .Eclior.td tt ldtq$.r.ds of dreugh tt!35 on lhc Plort bv
@roldding didrliE de.gF ald bcre ioFovins c.ll |!dhe $bilitv'
.bloroph,flcoll6l!, ooolic djusb.ol .!d b trE el pholoByrttBi! &d gto*lh
conp.Ed b rb. @-t!r.d plol3, cdtiw chte.l-85 Prertd to b. doc loldlt lo
dreughl3ts cldFld lo gcoolyF 654{-6 wi6 F.P.d lo ft P6.i..t }6i!' 90*rb
rid 06.r lbrliolotic.l dlpt tioot .grjd dmoglt t!!3t
L2l
QIL iftppt4
ConrEtional g.naic ma!6 rs€d to h. @Dltietd fion phcnorvPic dab of rd ds
populalios. with O. adst of DNA bskd t .hlolosv in 1980t @ur'L gdctic
mps of pl&t dd mimal spdi4 e b.i!g @Nttctut€d A lo1of rcrh it ih€ lasi dddc
sirg sSRs io @lstruct gdciic b!!s &d tagging ofQTLs !.5 be6 Fpon'd in litlnlN
(ztuE et or.,2OOZi Zntu|et al., 2m5; He .r ar', 2006; Mccouai 't al-'2mziTot&t 'l
al, 2006; He ./ dt, 200?; DasIli er al , 2007; Nalili ., dl , 2010; Cui tr zl, 201 l a rvdg
et al,,2Oll). In ihe Prsdt snrdy SSR marlc6 wrc u.d b idotifv
drought
"sistarce
eld.d QTLSio si.!t For rhis grpoF 180 ildividu4ls of the I, Populalid fron th'
@s bcrqm a drougbl sistatt cdtild, ch!tul-85 ad a drcu{bl sinvc gdoivPc'
6544-6 {cE ,rdyzed for drouglt tol.li@ rclo&d t!il!, Pt
(net photoiynth'iic rd€)'
'
(irdspintion.6L), & ($omatd .o!ducb!cc), RVC Ecladre Wsld Cotclt) ed cMS
(C.ll Mdb6. $!bilitv). Fl poPuLtion is u*tu| for scFric otrpils as il mLis
aI

Fsible c@bi.dioG of P.tdt l rllel*

Thc p!.nott?ic d.r! ton t!. r, Flddid shosd mtnsl disEibdioc for tll itai|s
As lh. two psr.trre wc S4Licslb d'vqs uugRsiw
*8t€8diotr
wid lr@gesioD
of $€ F2 tbg.ny shoetd thal ttdsritild faloabl€ dllelcs for 'ach trdi'
both pdenis

| @g63iw $gFgation dulB *ln brgh

q low alds fo' ! $'il dbFs bdwa
(Pnoul' 4 al' l9?)'
ps@c 4d @tutog.lhq in lb. i&lividuds ofrhe F' presenv

pE*d study .$ci.rio oNhiion tn'ng |he phvriologicil EaiB sMi'd 3how'd
Itr the
ttttrstidion Fre
rhat Er pholdtlthBk posilivelv @dtlartd *ilh stodttl 'otdlEl{F
positrvelv coreltled viih
dd ell tndbtde sobilitv while Ebtive xdd coni"lso
wiih celi4 $udi6 (\vdg sr
cell Fdb6. stabilitv ft6e tsulB 9w in ag@'nt
ai.,2003; Malik dt c@ltd@ mlts Fldl thal lh@ !'its et i*'d
tl. 2009)- Tbe
prcrtd tlfrwh dct'dio! of QTrJ for $dt
tos.rhd on {rc @. chrcn@hc wti'h I
tll lcat'd on a linl'ge
tsc on dF s,m clfoEosm. in th' pc'nl studv TtGv !@
grcup on chrcDosome 24

pr.*nt snrdv sSRs w@ to id' iry polvmonbiso betwn it'c par'nts'

In lhe
'mploved
A lolal of 425 SSR p'iD.r Fils vw ssvd on lhe pdlnt smotvpe to dcttct PoT;
polynoahic neteB fq QIL 4altds Anong ftc 425 prime6 swcved, 365 anptined
6. DNA. Aiolg th* 23 lai v@ foud ro b' porynotphic- A lorymorphis of
5.41% {s found b.tw€6 the w!€t i! Fpon'd to be low in PolvmorPhiso
!...nt3,
(Rodd ar, 199s; Hddry 3r al, 200?) Kid$,i ., 4l @004) s1!di'd polvhporphisd
'/
beiw.en tw beadvhat SmottT.s &d found 90 out of ?00 SSR rok'$ (10'lo) b b'
polynor?hic. B{au!. of th. lN Polvmoryhisd in *tsr (Rodq €r di , 1998) Fldivelv '
ld QTl s h!v. beo (hler.d D lhis dp @nP.,!d !o odF slcid

Amlg lhe pobdorpblc lei fostl in i!. p|!gr sMv, 9 ltiEd w of th' XgrrE

siei 4iiob KSUM .nd l0 ton WMS. Twlv' out of th@ s'gF$t'd codonimtlv
while I1 v* doDiMt.'nl€ o{onim nqkd3'gr€s!&3I:2:I
whilcllte don]lml

ma*6 egrSate as }l .alio. Donindt nark'E cmot ditr'mtiate lhe homozvgoLs

tom hct@ygore $ e rct $ Gfrelivc in gmtvpiry In lbc
pl*dt srudv' 12 od of
rh.23 Dolynotplic ML.6 w.. @{oEiit4 b'!@ us'd for Nying lh€ populalio!

Morc fi.n 80 % SSRs t$d in shidv uplified norc ihaa onc @pli@n This ndnpb

l@us dplificalion w pbbablv bdus€ in hqtPloid *ttdt' ih' loci fiom

'vohtd
(Buteld 2r dl' 1999) sSRs e
tusion of A A ad D gcnoc anil thln dupticldon
populd Lb's
ubiqubs u.uraryoB (bg6r@ 4 41. lgel' Ttrv hare b4odc \ed
d6vs b€caue of their q&nsive epnone @v€6ge
6d Vmhnev' 2004) Ihis
(Cupta
2006) l! rh' pllst
prcFny Eald th.m idesl Ertcc for n4pinc Ocsb!'v " dr'
$udy MAPMAKER/EXP vas u.d 1o@dttucr t lidogc EAp A totsl of 4 d{klts wr'
$tB! cbrcDosone 2,A Th' nap dslance bctRs
nd*'u
linlcd on a lint<rgc sroup oi
diet4c' for QTL d'lEttoD
ws lppoxidtely 10_15 cM Il w in hamony urh bcsl

$dich is oNidced ro be l0 cM (Ke@v' I98)

'nrc b€ris of QTL analvsis in atl crePs b th' ofssi'rion b'tlrdsdEtic'uv

'tct'cnon
(Mcc'rch and DeBe' 195) Ihe
dcr@in d pl@ot'pd and +@i6c SaFric orncB
tt?ical si!8L @ltd ddvsis.livida popuhtion ido class bsd e'rctvp' at '@
on

nalker locus and ddl@s a QTL if thct! is t signifidt difr'@€ in ih' nc'n
@h Stoup NwltLvs tb' psition oI DN A m'dc
oo s geDdi'
phcmtpic eE for
mcthod sh s
6!D 6 .15 b. !i.d lo c€lqiatc Q'I! leldon lbrcugh sutislic'l
723
inre .l bapping- It involv€s Ls1in8 for in&Pcodec. in 'cgrc8dior ofml4uld mar.r
sd thc tiajt of inleFst I .Nat FapPing h$ ben 3se$6n Geder ed Bobtein'
l9E9)ind.G*ineQltrinF andba.tcospopulatioN

Aldbod nrny c@puter $ft$lns twh !5 MAPMAKER/Q-I. ]LABQTI. QTL

MAPPER &d Qsoe N Mit!!l. tor iddtiryin8 QTll btsvtt m4Pin8'
'!rcueh
howr, QTL canoehph.r is mst @ledy !5.d s n of6 eluiioE to Pbblffi in
ooF pact s4. For ddpL, MAPMAKE&/Q'I (lsdd .,4r, 1987; LiMln tt dr'
1992) c.mr be us€d for l@nbiMt inbt d lilc.s or olbs adEc.d poPubtions
(Kruglyak dd Lddd, 1995r Su$ dld DqEc, 1995) l! tht Pcot st'dv.3irgl'
nqtd ddysis! inrh€l mppioS ed compditc i Gdal nolping rcthods {eG u.rl l0
id4h& QTLS wirh th. h€lp of the QTL c$oEaphd presme sMA d.i.ct d 4 QTLS,

I nd pholosynlhesis 4d stoMld cod@iro*, $'lile 2 for ceu n.mblatc

cach for
iabiliry. lM ud CIM @ll4tiv.ly d.l*l€d 9 QTk od of s'bch 4 \lft @mmonlv
found. Inldal mqpira n dc it *id io cv.lui. Fgro6 bel9@ lld*ing rukcb
Gedd, 1989). Cobpsi!: iri.Nal ntppi!8 h.s ndha in@scd preision (JaN4
193; Zou dd z.ne, 2008). In de F*aI sndy, cdP6iL i dlal o.pping del.d
rlur n r photo6yntheis ed el.tivc srcr conrdt 9w lint€d to th. hidGat lliG
l(furt-r 19 rbif. @lt Ddbtuc ailliliry sat linkcd eilh Xs" 497lKSUM't I9
Th. alsorithh @d by the @mpuLr $ft*&.s is bed @ LoD (L8g of th. o&15) atio
Oa.rslly a LoD sF ofz fals pGitives whiL dct€ctioo of
2.4 ie lugg.slcd to svoid

OTk (Laod6 dd Boistein, 1989). h th. pBcnt studt QTLS for P', cMs &d Rvc
wiih LoD sor:2.4 w@ d€t€ct d. Howq, Ndlini./ 4r (2010) rcPon.d QTb
obtaincd {ith low stingtuy (LOD : 2.0) y b. bece bigler LOD sE lcavcs out

m. por. idl Q'Ik. QTL cinogE h.r al$ fildr llc R! valB for @h QTL throrgh
bultiplc r.gsiotr drlysis. TIF (tTk for n t photostdl6is. cell o@btu stabilitv

dd Elativ. *dq @nt Dl d.ter.d trcugh CIM in 0E Pr*nt ddv bavc Rr EIB of
I ?, 7 &d 19 %. Tt€ R'? vsl@ giv6 F|@t se ofd. tottl g.n tic vdi.lion qplain.d by

t24
QTL Dapping studis have bea rcport d in marv cr! sp€i4 @h 6 suniowi (ilw'
oL,2}Ol,rjstn aL,2W!), l.toE (JohM .t al' 2000) todtto (StevcB .l a/
et '
200?) Miz. (Guilidi .r al, 2OO4; wctckd.r aL, 2000, @notr (S@s' al' 20fi)'
e'

$ryhM (Bor.l ,, 41., 2000). belcy CYin .t 41 , 2005), evb.3! (Du €r al. 2009) aod ne
(Irip6tly,2000; La.6it erzl,2004iKtra et al,2OO7,R@i't etdl,200& Y'nYing"r
di.. 2008. Lin ., dl., 2ol l), ho*ffi, fN snldid in *tFlt Fpor rhc idotifiqtior
onlv !

of QTk, Fnic'n0.ry tur dmudt lolq!ffi. The PtEcat sndv w! ftc 6Ft ati'mpi lo
n ! QTtr for lh! ptysiologi@l ctit!' net tholotyntb's4 |rmt@G sbbilitv tnd
":ll
Elsrvc wt.. @nbt i! trtan r.ld.d to drcught r'e$ Th' 'lrought
$is@t cdtivd'
ws highcr fd lhes€ tFil5 0! uElt 6 hjghd tsdbic &id contc
Th@fot'
chrls€l-86
n nay t€ @Dcludc<l thtl th. lo.us4@i for {lc a$oftic
Ntid @Dtent D8!t alto bc liit'd
on ihl 3sm. clm|rwnc,

725
 CHAPTER{

GEII'DRAL DISCUSSION

Doleht sltes is a mjd@ns[ri to bigl6 @P yrcld in trEv Fns of [F wdd M@

rba 60 % of th. rcrld @ ba &did clinat and str6 fiom pqiodic drcuslt
{Kideni er 41., 2004i Sh@ a al., 2009). Supplmdd itrigtion f@ilni$ havc b.€tr
dereloFd io ov.rconc this pmbld but thcsc d. .ithq mt !!frcient or
'mg@dls
@r€ni6t on a ldg. @ of cbp bsb&dty in thc rcrld Dreught adv.Elv .frels a
wictr of phFiolosicat md bichdicd pllc.ss of !l&ts csing disruFion in
chloophyl pigEdts !d g3s qsttulgc, inhibitid of@[ dD.EioD disnIb.l6 in
elulc &cmuldron &d flodEtion of @tv. oxtg€n sF.i.Joxi.lart! qiich d.mgE
phoiosynlhdic s wll s othd celluld m@bntus (Kidambi. 1990; Ashnf od O'
redy, 1996; Lawlor and Conic ,n02, P.lE t a al.,20'2.Ptuba er u/ , 2009) Naturallv

plart sp€is on lard hav€ ddelop€d bdy adsplive stalegis ro loler.te w.te. deficil

th.cby @ini.ining gre*th dd d.v.lopNnt. Pl&l biologisB b.vc bd sndving ths

Dlr.t ad.ptirc nebldsd to lh@ fd gffiftg drouShl loltut crcp
'diPultlc

Duiry dr liilt haif of th€ last c6truy, plant brdds bav. b.en sing .mpiiicd @vs
@ncdltaiing on @mpdien of g.@lt?d for r@D.ble yi€ld udd drought slress
@ndltrou. In rh. 1980t ! sh.rp f@B sr.rt d m the physioloSical m.cbeism of
doudt Esi.t nc in mp plarts ard a.ubcr of phlsiologic.l elits liL rclltire sder
orictr! dcb.d laf *rr.. loss, doDlrrl t!sii.n€, n r phorosynrh.sis, srd w-
.trcituy, onotic adjuslndt ctc ((ffi, l9Eq I4ir! 1980i bn s .td Q@ie 1987:
Scho eld., ul, | 988; Mati! s, al., 1989) Ebtcd to droughr tol€tuc. wF sdv@l€d for
thei. eftetiv. us. io bEding po8rds aincd al de.loping drcugh lolctel cullivm

The Dreught tol.l.ne ndheim at thc noLculs lev€l is @mpl€x b.caule il involves

$€ rele &d p.nicipdion of a largc nMbd of s@*. ovd th. l6t 30 ye.n noleular
biologiss blE insnt d l€chniqB liLe, DNA Dark@ lo diiel Polygdidq@drative
raits inro individu.l l@i $lrch m b. EoiFial.d litc Med.[& !!its (Y! et al.. lryrt
126
ne .r al, Tdi.d.y, 193; Pd@ a.d Tom6, 1995; SLv.ll .t al ,2w;Wtnoor .l
1992;

al.,2oo8i wdg ?r al.,20ll), sDne of ilE pldt chs@1e6 rlated lo drought toL@@
havc sbo ben studi.d .1thc dol6ul& lcv.l (Mo$, ald T.a 1996; Mccouch,t al
2Wi z\sg et al-,2092iTd4 et a|,2004iB@i6 et d1.2009).

@siddble woild popdldon lt! yi.ld is very low in a ldge

wheat h stdple f@d for a
d@ught pr.ne aF of lh. wold. Biotu of wheal pldt i! rcduced W 10 40% uder

dreudt $s (viUe8!s ,, ai. 2001). Ihb Educdon is €u$d by d.ctts in plet grceth
dE to lowr Gl photocynthBis (Bhar dd Ra4, 2005; Ashnfsld FdL4 2007) Doueln
str6s io ehal b D@l&vasr,rilg duirg s.dli4 g@vlh 3 wll s duinS rrah fiUing
s1a8. (Adjei ed K (h.n. 1980; El-Fe dd Atle4 t95). DDught ioleree oI wheat at

ihc s..dling st ge is vdy inport ,l be.e dtc crcp Fodetivity sufl4 to a gr.5 cxlert
d@ 1o Edk d tillrilg ud d.t.io6Ld popubdon slatd, D@ lo lhe cfrons of Plor

b@d.R, yi.ld of drou€lt slricto els hls bcn DEh inprortd by the cullivtlion or
droudt rclisra veieiid (skomed .l al, 200l; Rajard, 2005; Asluaf, 2010).
Howcr, siill th@ is s lot of pocltial for ntrihq inprcvd.nt ofyi€ld by breding hig!
yi.lditrg vdidie for l[.rc aI6. T!. pldt ld.plrti@ m@hrnis lgainst drcugltt sLs
e b.iry qploi.d al nolelte la€l 6nd th. g@ lo.i r.spoB'blc for lhce adlgt tioc
tuy h. 6dded by ptrmiding ditr@1 tai! povidi.g ddapiation lo *'h.at plels a$iDn
dreudt str!$. Biologrsls @ sle veety of pbtt lodon$ involv.d jt
drg to tcd e

eUuts D.r'lolis for th.n .m[onlilc Flc reaiNr &ouglt str6s in plels (Hsll 4d
Bin3hlb, l93t Arrc., l96i Asbraf.!d H.riq 20Ol; Ar!f..r 41,2009). APPliotion
of g.o*th Esulators/vitMis swh 3 &orbic eid (Al-H.kimi ed HrEad., 2001;
Sirgh a dl, 2001i Khan e/ al, 2006; Dolallbldid sr dt, 2009!i AzzeAnE et dl..20ll),
elicyclic @id (setrd&bi et ai.,2fii0), bdzyl lddiE (Singh., al, 2001), li@tiolEide
(HM.in., &d ('sfuDreiatr . su.h a Slycinc bctai@ (D€hidl dd
"i.,2009)
Tukl4 2004) e bcilg sMi.d inidlg th. t c.rr y6 to lss lll.n mb to h.lp plants

I blr ba repon d in a lubd of studi.s rhlr eibic &id M.lioar.s the adv.e
ctret ofdrcueh slis otr *tal ed olbn 6op s!@i6 (z.id., al, 2009i Dolatab{die
.t a|.,2009i DolaJlt&l@ .t al., 2ol0t Azz.nift .t dl.,20ll), ln tb. pte$t sludy, th€
.tplierion of @tbic aid I sMi.d to.xpl@ ia roL in dslght tol.t,@ of q!@r
ai thc se.dling 3i.ge, A$orbic eid spplication help€d pl&ts 10minlain 8ro$t dd ner
pholosFlL6i3 Mdd str6. cotrdjtioB. AlthoDgh dl thF noda of alplicdj@ of
erbic &id ir s sd tqt!€n! t'lir sp6y ed r.oting n€diM we efr€.tiv. in
m.liohting ihc advqse efets of deughi stls o! wh.at plerx howd€r, ih. Mting
m.diM alpli€tiotr witb 0.5 DM B th. host efletirc, It* 6ndi4s suppon i!€
pdvioN Epon! which dolmfi th. .frectiwN of .s4oftic &id .ppliqtio! in tle
roring m.diu (singh ,/ al, 2001; Arle sr 41, 2009; AzediDe .r at, 20ll). The
spplietior of ascdbic acid in rhc mting ncdiu is Dort ctr crive b.caw in this mode
plsls gct @!tinb6 supply of eibi. eid. Th. .ffet of s€ed prinirS rsrD@t is
tenpoEry ed is rcdeed wiih the 8rcqth ofplml s th. cmpound absorbed id rhe kd
is gradully u&d up- TlG foli& llplicdon my b€ Elaijvely l.s cif*rivc be!&
$adic &id appli.d thtuugh th. l€B My mt @h ro de rargd sir6 ir appropdar.
concdtdtion cff&tiv€ for cauing . poFiDcnt €bmg. in m.tabolic p@ss6 i olved
in gtu*1h and odFr pldt athibd€s. Flrthcmo& erbic eid alpli.d 6
folis sFay
a

do.s not etlsm .co ir@N supplt of lhc oDlound.Itis nay bc rhc t!&n for a ltglcr
l.vcl of dcolbic 4id solurion (loM) ftqunld for folie spny conp@d ro rooling
m.dim (0.5 nM) h the p6dt study.

Io thc prst study, th€ eclionrin8.trcti of @!bic &id w* $udi.n by rpFakine

$e fieclionality of v&ious physiological parmeteB s@h s chlorcphyll pigments, @ll
b.nbme 6 c.! larivity of srioxiddl cn4m6 (SOD, POD,
stability, Elrrivc wLr
CAT), poli!. dd glycinc b.t ift 6ni.nr. Asorbic eid applic.rion is tnom ro
inFove cl oDphyll@ ents, netphob6tnth.sis (Sin8h er dl,2001i Dolalsbadim.r at,
200q Khm./ dl. 2010), @U mdbtu srlility (Anin./ dt 2009i Dolch!.di&., at,
2009b), pmli!. @ cnt dd..riviri6 ofthc rltioridlrl ft4he SOD, POD, CAT, Apx
(Zeid a at. 2008; H6wdn a at, 2009; AUe €r al, 2009). fte lpplicarion of sco$ic

aid ir the p@nt srudy helFd in Dlinilinjng chlomphytt @i$G ed i! frE hi8h nd
phoioryrrheb ofpldts by svdgjng rh. tu iiE oxygo sp6i.s, Aslbic ci{t b.ing
a polenlial dtioxidant minimiz€s oxiddiyc arls by $av€nging rhc Eactivc oxygen
123
sD*i6 swh s HrO, rhdby reducing lhc MDA @utlit prod@d .s a @I of
n.nbrd raovc oxv8o speci.s
dMage. Chlompls( 6 a najor ptoduchon siL. of
(ROS) in ddG (O@4b(c rr r/.. 198; Minld. 2002). As6ic @id a.t a a ebstii.

for APX to s.aMee ROS pFdu..d in ttytttoid EdbllB (Davev et d D@

'20for'
to which ihc cdl Mbrdc atability of Plsrs in de pF&nl!tudv wa alo mhlaio.d.
MoFv€r, .slbic aid applicalioa iL!@!.d th. 6@!c potntial of eus bv itu@ilg
0F @npdiblc slu& gtriuc b:rairc eiich b.t!.d it oMotic .djudbcnt of pbds
lheeby mainkining aI tugor dd hdce 8roslb. h hs b.d rcponed thli adbic acid
plaF @ inpon&r tule io c.ll division and c.[ €xPtuion by pogtssing ceU cvcle
(Pig@hl {d Foy€r, 2oo3). Apopldic is a @f!.ror for pFlyl hydtoxvle
'$lbate
vni€h activat s hrdrcxy prelin. gbropmlcin s,tich ir FquiEd for ccll division ed
drdion (Sninon 1996).

TIFas6ic &id .lpli€tion (0.5 dtt) in @ti!g nediM of drcugtrt stls*d pl6ts
gtuM in $ilwd al$.tretirc in @utcn ritrg lle adrce.f@ts of drouSlt or *'lFt
This Mbic @id c&.lso b. dppli.d udd li.ld conditioB. Eelid studies
shos thlt
.le ryon thc.felivas of0.5 oM.scorbic eid alpli.rtiotr in th. Nting m.diM
of pl'Dt' groM in sil udd drcWbt stBs (Siqb.t al., 2001) I@vi!8lh,l 0.5 mM

a!.orbic did cd be applicd in eil $dq dtuueht @nditioN 10 imprcve dreugni

6isLd@ ofth. wh@t c.op.

h My b. $ggstcd rh'r thc !.!d pdnilg with @rbic !.id wodd hclp in .nablbhh.nl
of visorou $edlines udd drouSlt siress conditio6. To hclp pl6tr for tchPoEry rclicf
,girn &oWhI stlss, folid sp6y of erbic @id ruy be applicd ed wh.n thc
inigalion wt . or Einfall tu expel.d, edlic aid tuy be add.d to th. eil
Applicadon of Mrbi. &id to shelt plea My be ilnhd t sLd io field tdajs- Ascotuic
&id is not ! v.'1 dp6!iv. subdLrc€ sd it My be srpli€d on @mNial sslc to
ihprew yicld of sbal uldd &@eht slrs @ditiN Tb. @lc@rrdion Equitd for
ih€ soldion as detemin€d in ll. pE*ni dpdina$ is vcry low 4d may be.stid.tcd
ihat i! e applic.rior pbgllme thrtudoul the grc$lh cycle of sbcai cop, ilcluding

L29
oft for e.d primi.s; oc or lru foli& alplic.tioE (d'p'!di4 oo l[' i'qui@6ts)
'!d
oae s a sil ,pplic!,tion, thc cosl rculd mt b. ovd Rs 2500 pd h&

Th. @Eplex q@tiidtivc !!ils slcbt s drolgli t'l@e mv b' t@ipuLl.d in o'tlG
ssiltcd eL.tion by d.tcctirg DNA Mkc6 iigltly linld io th€n Diffemt DNA
Ddkd syrids like RFI,P Gtelcntisi3 ., ut , 1985; McCoEb €r al, t9EE; Dcvc " ar'
1992; Ull@ ed McEdi6, 2000; Hetd et 4t ! 2OOl i lttdhe
a', 2001 )' AFLP (vG
" (VilliaEs al 1990i
et dl.. 1995: :ulni. et dl., 2o4oi Na.brt ./ ,t' 200D, RA?D 'r gtr'
Borevkou rr al, l95i Stub€r, 1995) .rd SSR (Cup!. ed vaslrcv' 2000; tt'
'r
2006i Nalini er di, 2010) drplotld to <t'td q@ritdtiv' ftir loci in
ctc. alc b.ins

vdiou @p sPc.id. Populaiob solh s F! bock@s' Rtrr, NlLs @ b.ing exploitcd

for tn.pping QTtr @ vdiou chmncomes of ddt g@onca
(DrcIM er at' 2001;

Gu .. 2002). Amtrg O. wiM DNA d(lc sSR m&k's e 6ct Popule

Dd

err.Niv€ly ued lor m.PPilg beaue rh6. cd diff.nntiat' b€r$cD honorysous ud

h.l.rozygoN l6i (vflshGv er ur, 2040.

h th. p6ent snlly, SSR ddk6 lr* u!.d to &t€ct loci fot Er pholosynihdir'
lspiBtio. 6rc, slona&l @tdELncc' clll ndble srtbilitv add E|,itiG wd'i
6nt6t. Thc F, popul.lion 6ob the cos {Ch!kMl-86 x 654+6r qplcsd nodal
disributor undd dought cotdido6 i! hvdmponic cdne G@tvPins
of l4l
indiv'duds of th€ Popdaiion dtrcueh SSR plimcB deccled I QIl
foi nel
phoiosynth.sis, 2 for eU t@bltr stabilitv ad I fd rcl'tivc mler @l€nt
d $e
olhd coF'
cbmnoehc 2,4 A f.w Phvsiologicd ftic like th's' h'w ben Ellped in
Fd cxdpl. in suflowr, 4 QTLS for sloMtd @nduclan@
(Hd€ ?r at 2001)' ii rice'
'
2 for trr phorosy h6is, 2 fd tlspistion t'le (I@g tt 4t' 2004) dd 9 for @[
I)mbm. elbility (TriPttlv "r ar, 2000) hw' b€d Mpp€d Oc!€dc naDling ofqhe*
for $Dc dnolh bled tdits hrs ten Elorted dlicr
in t fcw studiB (Mdg,l t'd

Te 1996: v.m a al, 20Ol: Dtehti .r al. 2007r Diab ?r ar' 2008) Howev'r' the
F*rt stuly *rs the lit$ ad.ofl ro 6ap shet Q flJ for dmueht toldt Pbvsiol€ical
hirs tik rel photosvnih.sis. cell m.mbmt stabilirv ad Elaiilc Mter
@!lat

130
ln lhe prcsldt sdy, lh. culiw C!rlwl'85 siicn i3 H6o@d'd d{tiw for
'&id contcnt !s wll a! orbel
dousht s i! P*iir! showcd ELti\elv highd alolbic
a.t

&dlgtn Bislo. t!ir3 (&l plorGvdent o66otic !djo!tb6I' cbli@

w'q @t.m
&d 4ll !@bmc ttabititv) &d Frfm.d bcttlr in ittr of
grerr! dd i'ld uldd

drewhl. Nd ptolGynth.tic rat P6itivelv cdrch&d wit!

@[ d'6bt!!t stabilitv &d

GLtivc wrd cooi.nt .l$ Doailivclv sith ccll @trhne sltbitit' So' 6'
cofrld
locu EspoNble for tb. €xpr.x!i@ of high a$qbic a'id tnav tbo b' F
str o the
s.e cb@o3m.. Mo@\€r, s lb alc!ftic 4id w cf"tiE in FitiiElitg th' drtM
of do4ni lrrat on stHt pLd 30 n oly t' e4A'd'd
lhtt ado!@oa iDc@
ce.1s
@dd itrptove
in dcorbic &id con&ot of whcat pl,"B threud s'nclic etgin'cring
dDwhttoldeeofqt.r
 CONCLUSIONS

Exog@s 4pli6tion of s.orbic aid h'lFd eh'!t plea lo

ocmticslv adjust
L
ih@s.lv€s by consi.ledblv d.cFsng th.t osoiic Pot'ntial
&d imrcaine slvch'
b.rairc@ ent Dd.r drcu8lt tt rss

2. tu o$ic silry'pliodon dcc63.d HtOr @st'trt

i! tbc L've of deught slrcsd
w[e!r planis bcrcbv rEdwilg l!. MDA @nt'ol'

3. A$o6ic acid .pplicltion ah. cobecd th' erivili's of lhc edondst c'zvne sOD'
POD, CAT &d AflC
ht@ highd cl
4. ltupro!€d €ll nonbm. dabrlitv, iecascd chlotophvu @dtnis utd
@npsr'd to ttt mo-ftatdl
photosrttltB! ad grDfi! of ascoibic |cft| [aLd Pldis
etr'ds of
o* uo* **t ** **a thar .96ic &id d'lida&d thc adltF
drcu$t s63 otr wlE3r bv pEv€ntlls ond{iE daD!g''

ol.$lbic &id (roori4' folin spdv ad p6$*rs 3"d

t. DiflcFtrl Dod6 'pPli'tri@ of drcusbt; hdwtcr' ltrc
tatDenl) q* cfr@tivc h utisCing ib' tdvcts'
'ftds
Ftirg dcdiu w tel.tirtty Dorc
'fr*tie
eoftic &i4 0 5 nM *nd!'6 for folid spdv or
6. for @dng n dim of
'pplication
!.€d Plinilg I blt't of ts'dbic &id $lmion ei! lh' Dclcft'dvc

lslbic rcid wF ob6dcd io bolh hv'trcponic !d $il svltsn'

?. The Posiriw.fre€ls of
udd &oughl s[Ess
-
8. Ile drolghr cbraal crntittr, Cbd*€l'86 Frfom'd b'lt"
* *t t*Ovc 6544{ Minlv dle to bigrtd cndoS4s
."t0., n' ecnotT'
"
o/t genol'?cs'
b€tween tbe two e,lFar
9. Cosiddrbl€ DNA polvnorphis (54t
bv sSR Pnne6
Cbtk*a1"66 tnd 6544_6 wa! found

d'ratiol Om QIr for GL pborosvnth'sia

for rs
10. sSR Find Prc"'d 8@'l
lor QIr
stlbilitv dnd o@ ior ltlaiiv€ wter q'd€nt wer€ d't'cted on lhe 2,A
6ll netnb!@

132
ll, F@ lhc Buls of @!r.htio snrdis of t!. F, Popd'lio' daivcd &oE 6c
q6!
cbr!ul'85 t 65,r4J, it Mv be 6ebd.d lhal ts QTk for @rbic &id mv tbo b'
l)ltgt or l[. 2A chFD('loc lidad to the QTIJ for net phoiosr bs4 en
E€nb@c $tbilitv ,nd rcLiivc *d.. @ddt

Future Procp'tt8

Th€ dos@N appliedon of Mrbic @iil @ltnEulv $lPlicd ro

*i41 pDnt
deughoul its trflcvclc til @n!it nlv t' t6Lit for
its undd douehr
'frelivffi
r!63 i! $il Bdr Pot @ditios
of @rbic !'id
!.4e $dc 6.ld ti.! blv b" @ttucr'd to 3t!dv r!' MtutEss
r fi'ld e'ds wib t$oibic
tid ptio'd
- -tn*irr r"r" Fot Gx'mPl' in
or $@ fotit aPPt':liois of
&ftI soludon Drv b. os€d. Duilg $'dling ritse' lw
"ppri"rrioo
iEigdio! lo {F pLnlt At lhe
.$qbic ldd ellni@ tu, b. arpli'd Ning vdv tstict'd
b"tplied
t- ** **"l! *. dth6b ttd eFin fiUing' lsrbic &id niy sselbic
"o*t irigdils thc 6'ld fouowine soil dr$sing uth
to lh. drouehl s118!.d Pl.nts bv

pL'nt s!€cies like sorSlu! hive

Edia stude shos thd ELlively dtougbt r€sillld
to vltcst M@vet' D
l@t a,* td", *"*o* eolbic &id @ntent onped
Fsislet g@it?e of whdt' Chak$l'86
ihe prsenl stody, ft s dalcd th't 'l$ur!t *har Mv bc clplord
** tO* t *"t*"*,*"ftic eid @ntcnt Gernplsn of
@ntlnt ond this mv b€ ddoit'd ibtouen
fo. hii cna"g""" -id 'tttiburc
""c"toi"
conrcnnontj/ha*s ossist d br"ding'
in *har bly bc
. f-to qrr,, ro. "*,Oit *id @ntdt cd o$a &olgl|t tol6er Eai$ i! @Nodond
u"*L *u a" *t t*' *Potuiblc dv !! iddcd bv
pvnhiding

be.diDg or gcrclic 6g!6ng'

133
 CIIAPTER-?

SUMMARY

Dbuebt is oc of $c mct d€hst ling dviton|mtal sftss sbich tdwlv af@i !

nufiinl(t. of ptanl mcllbolic Pless l6dti!8 i! ttdE d let Pbotosv h.8b $tich ir
nn €asd rcduc.dgrc{rl dd devclop@ni Yi€ld of mps ieluding whal is badlv
a.ffd.d on s vcry ldSe sM in th. wdld drc !o deuSltt str€$ Afthough wat€r @elres
h.ve bdn d.vcloFd for suppl€Mtal iriSBnon so 4 io supplv opdnM
*dcr lo cops'
howq, th.y s. rct clowh tunll tG .Fp .t E'n& plnidlsly in dtought prere
to

!@. what is . lrrDle food for a br8. hl||@ poplatiotr in lt'r' mrld To n*r fte
rquim. s of groqing !.€ds dE to goPuhion i.oes" prldetid of qtsl Ns1
il1.@e at 6 tnnud nte of 2% Atl pldt spccica btre en' mtudl tbilitv lo 6i5l
dous)l! howd, th6. ditra for inh@nt poi.ntial ofdrcuglt rcsititlc' Pldt beedds
have nad. a 3ignificd gaenc ioqovandt id inprcving drcusht Bi3l!@ of cop
plarll i$lu<ting *hat by tfuipdaii@ of veiolls tr.iB rEht'd b drcudt ltsistale lile
tr.I pbotoryndBb. @U ombtlE sdilitv' cl.riE ve @'ldt" v&r clatios &d
osotic adjudndr cic. Rdent lit Fnft shos fo@ on lhe @ of dog@E
applidlid of vitanhvorydic $luLs $eh s Mbic &i4 lhrdirc, sslicvclic &id'
benzyl addie, glycinc b.tai@, ptuline.tc to Meliorate th€ adlN efidts of dsueht

slns od oLnt!, If ! sig!fi@1 inProvcnot .ltoueh blefuc' of cr!6 bv th'

'n
appli@iion of seh ory4ic @6poun& is dd@ine4 th.v mv b' aPpli'd on
co@did sd. d PI&ts my te gcrticltlv iDpsled bv 'trhocins thtir poi'ntial to
itrfu tb€ cndoScms Lrtls of tb. subdt@ bv Scrdic 4gitFEg Fsts'
!n viry of t nMbs of aFrls ir b .vitt trt dr.l erbic &id is a powrin 4iioEd!tr1
{hich trct.cK pletg ton th€ oxidntivc d!mg. 6ued by lhe hadtul Fadive oxvgen
sFci.s Plod@d duins dtouslt strcs. tucorbic laid allryiat's ih' sdvN ofle'ts or
doughl st!$ by scavoging tb. nosr injuiou oxide! lt1o1 It is Gpontd llal bv
aDplicrton of @tbrc &id plrnB tuintsitr !.t Photoslntheis Ed hcM
gm*th In l[e
pl.$t pojecq thc Gr.ct of doscru |pdi.!lio! of agfirc &id a studicd or MEr
undd drcugtrt sL6s. Maint t),& of uifod deuslt st* tlmue[out ee cxperimottl
populatiotr is dificutl in $il @ldilioN eM *6€n greM in pot!, s lh' pladts ffi€
goM i! . htdsponic cult$ &d osolic $r.s I ddeloFd bv sing PEG@

Ts qtral smryD6, ! dnuglt Bistad cddw (Ch'ksl'8o od a dftugh sdiliE

goottle (5544-6) w.€ us.d in th. pBni studv Th.ir drcught rdisl!!@ ws tsrcd
dd.r sil 6ndin@ d ! pot .xFit@t DDusl st* GI-oMP.) s tpplicd bv
*ibholding wlt€r fiom iiu.drg sragc lill odui9. Dd. for gs *chege ch!tulenstiG'
gtus,th ald gnin yicld @tnponeds sho\td thal lhc ctttivd' cb,l*d-E6 *6 dsuglt

ble..nt @mFtd to th. gcnot!?.! 6544_6 s it w 'eldiv'lv hi8bd it rct

pholosyniheiic Er€, bio@s, nMb€r of gnitu pd spik., 100 sed
q.i8!t dd grajn vield

opdnu omotic sirs sls dciqoi!.d bv t pclininalv crpdinc il a hvdtopotuc

cuxor a!.1 it E fouod rbil 20 % PEG {4.6 MPt) {6 rhc oFiDun drcudr sres Lvel
pLnt! sbow.d oPtiDu sltptom of 3t!ss. Th.rc d tb@ tuin svs of
ar *,hi.b
exogcnos applicslion of a sub6tan@ to plers, ic, d a PG$Mng sd tredn'nl'
lhFue!.oodng 6cdi@ &d s a folie st6v TbG optinu @n€filrid ofateilic
eid rcquir€d s €ro8.rcu m€lionL the tdv*
application to of dreughl or
'fl615
vt6t pbds in .eh nod. qls dcimiftd bv .ssNrcnt of na photosvnth6t and
ero$t of s !i!gl€ vdidy, r,si-200& Il ss tuud thal tb' optim@ Lv'l of seibic
&id lpptidliotr for folid spdv and sd PF$*ing irahctn *6 I nM $tit' for

@rng mdiun it w 0.5 bM.

'n!. dost €fr.dit Lv.l of .glbic &id d.tdbin.d in esch node of appli€adon w6
!9pli.d on le glmlypes, Ch.kf,tl-86 ed 5544{ in eolhd apcrim@t Tb€ @rs
slD*ld that dl nodd of lpPlicaliotr of @otbic &id sft tfcctiv' in @uttronng
ue

adrtrc €ffccls of d$ughi sttls, howvq, @iug m€diM applicaiion M r€brivelv

mc .ffdtivc i! d.intaililg ret P[ot6tntb.s'! chlorcPbvU pign@ts' clait wt'r
contn! 4llnmbtue stabilitv. SlvciE bettine p'olirc' en'hecing ddogeno8 setbic
&id@ .nttldedvitidof@ridid!..@vtr6sw[s gtowhofplants$bj€t'dto

135
dr.ught sfts. Cullivs ChalTl-E6 Frfofrcd b.nd thd th. gdo9?. 6544-6 uader

dsugl|t str.ss .s wn a udd lpplicalion of acdbic eid

Th€ .f€cl of elbic &id on whclr odd drouehl sr.ss w3 .l$ lsss.d in $il
wl.d $.di!8r 8mM in Potr r@ dFsght 3tesd by witbhoklinS std TlE ,slbic
&id (0.5 ELo ws alplied to lh, pla 5 with iriSstion s&.. As$ic eid !$li@tion
mintdn d ftt photostalhsir dnd gre*th in rtoughitr6s.d pl&is of bolh x'bel
g@oty!€s, Ihu, il w.omludEd ihd ih..!.orbic &id .ppucation Mv b. etrcctivc to

For QTLn epi.& d F, poFiarid ddiv€d ton rLc cN' Chakvrt-E6 x 654r$ *a
grcM al@g *iih it* Fltnrs uda o€ooli. sEcs in MrcFlic a,sLE TIE &tlysis
cluLd tbal nct pbotGynth.lic nL pcitictv @dl.cd vith slob'ld @'d*L!@'
mrgintion d. &d @U |tMbr@ {tbiliv. RdltrE wr< @ e 'l$ DositiElv
@d.b,t!d with ccll |l@blrre nrbilitv. QlL olpPiI8 sntdid d'Ld'd 1 QTb'
orc for
o!
!.t ptotosy hab, oG for !.Ltiv. rlrd drdi ud tso for ell ddbolc sLbiliq
th. 2.4 {hel chsB@G. r6sta cultiw' Chal$il_E6 3how'd high
As th. d@g!t
Mbic &id 6 $ll 6 oth.r dtought 6i3lttt rtits (Relaliw *ttcr contcol rer
I6h md ell l!@btu 3Elilitv, ut't6 dreughr @ditions' $ d* l@6
Dboto6y
bc pfe"nt @ rtrts
EsFDsibl. foi tb! dptesioi of hish as.oibic eid @v ole
ihal lteibic &id
cbrcEo$re li.t d b the lo.i fttdtified. !t ne il@v hc cod'luhd
the.tllce ttrdG of dswht str* on wb'i' pl'nl! dd it
B.ffectirc i! nitig.rilg
My be $ee6t d dEt dd.8c@u idcd in eoltlic *id @nr'nr or whEr pl&Lt

tl[ousl 8.*tjc ogiIFbg @u!d inPrevc drught t!!bi.'e of

wbcar

t36
 LIfiRATURE CITEI)

Ack@n, R.C. dd D,R Krcig, 1977, StoEatd ed rcn{o4d tgulaion of sler Ne

in cotto, @m od sorSlm. Pldt Physiol. 60: 85G853
Adj.i C. B. dd M. B. Kjlklm. 19E0. Eltlulion of wini.r wh€at .ulliv6 for dDuS)t

Feisld@. Euphtlica 29: 155-160.

Asafld, GC Sri\25t4r4, T. A.@ and C.R M€oa 2005 Role of

S., R.K. sairao,
ABA, salicylic &id, c.lcim dd hydrogd Frcxid. on etioridel cnztm6
indudioo d wh.al s.edlines. Plsr so 169:559'5?0
ASerNd, P.K. ud S.K. Sinha lgE4 EIl4t of wt. slrcss or groin go*ih od
ssinilate pdnitioning in t$o cdtiwrs of ltEat cont?s1ing in th'n yicld slabilitv
in ! drcueht dv'rem. Am Bot 5l:129J40.
,AggN.l, P.K. ed S K. SiIb! l9E7 P.rfom4@ of *t)cd &d uilical€ vdidiB in a

vdiaue soil wlter.nviremdn lV. Yield @bPondf' &d their al$illion wirh

Srtinyield fi.ld CoF R6 l7:45-53

Alnad, S., R. Alnatl, MY Ash.li M. AsbFf &d E' A wmich 2009 so!floB
(Helidrlhs mtu L.) rtsff)t& to doughl st6s ai SmiDtion 'd sdliry
erceth dag.s. Pak J Bot 4l ; 64?'654
Atd, S.M. 1991. NuEiern bv Plmts stttt cE s 6ndirio6 ln: P6s!rli'
M (cd)
'Ha book of Ptet lnd CrcP s$c$- M@l D!t{tcr' Ntw Yo*: 227_246
Al-Hddni, A.M.A d.t A.M Hd d! 200t Coutrtdeion of sdiNtv
stlts on etar
pldts by gar salilg in a!.ot!ic &i4 thrdi! or $diun elicvlar'
Biol thnr'

44:257'261
Ati. Q. 4d M. AhrEf 20l l. Indenor ofddueht toLEne in
Mie (Zeo na" L) dE
ro qoSoou lPplicttion of fthalo$:
grc*il\ photosvnlhdis' wtd rlariod ed
ond.fie dcfcnce trhtnis Agon CtuP sci lilr4'
Ati. Q., M. Ashnf, M ShtLt z $d H. Ew'a 20os' Adclioralins €fr@t of foliu

apdi.<t Folin on nutridt u ake in *"t'r st'$'d ndz (Za ''dls L) plets
Ptl. J. Bor' 1(): 21 1-219.

\tl
Alia I.S, sDd P. Mobdty. 1997. InroFdMt of prolift in Foi6ling tbylaLoid
n Dhllc aslillr iie Edicd-ilde.d photodmg.. J. lhot@h.n. Pholobiol.
3Et 253-257.

Au.4 D.J. srd D,R, Olt 2001. Ihp!.1 of cbiliry lcnpdtuc or phoiosFth6is in
9m clihsL plds. TErdr PLot Sci. 6: 3542,
All€., L.H., K.J. B@r€ snd L.C. H'llmid. 1976. P@rt srotudd difhrsion 6isi.M
afLct d by sil *Er.r dd el& ndi.rion. Soil Crep Sci. Sa. Fl4 Pr@. 35: 42-,16.
AloM, R. S. Ekn!, FJ. C.slllq B.S. Gi6e!o. 2001. tni.Fctie .E@ts of oDE .nd
droudr sti.s. on pign€tris !trd &ijvid€s of dtioxidativ. atrt6 in Plrir
rr.ra Pl&t c.ll Enitron. 24: 90i 15.
n
Anb, B., G. M. eglsL E.M.R. Mab@d &d M. Hosleb. 2009. Eldlalion of
.Fctiotr.fer of drclshr sf6 *ith &db.le md s.licylic &id @ mc of
'
physiolosi.al and bioch.bical !€mcl@ i! oln (I116&s .r.r/s&14 L.). Rs. J.
Biol. Sci. 4:38G3E?.
Algaji, S.A. 2009. QII- mpping: a fcw key poinls. Int{. J. Appl. R€s. Nat Prcd. 2: l -3.
Arjub, S., xY. xie LC. Vdgl, M.F. Salatr\ c. Md ald L. wes" 2011.
Molpholosical, ph,siolosical &d bioc[dicd spoN6 of pldls to dolghi
st6s. Afi@ J- Agric- R6. 6: 20262032
Anonynous, 2010. P.kisi4 Eeomic Swcy 2010- l l. E nomic advisls Win& Fnunc.
Divisio4 Co!!'l)tMt of P*in!4 llluabrd.
AD.l, K.dd A. Hin, 2004, Readiv. oxyga spei.s: meiabolistr! oxi.Ltive stes, dd
sigrd lesduclior Aou Rd Plet Biol. 5l: 37]-199,
&afo, A.A., I'tA. Kldlg/ &d M.F, EI-B'lm 2009, Th. .fI41 of glycin bcrene or
.eco6ic oid on Snin gmilrtion ed lef tiru.hc of sghu pldts grom
udd eliniiy str$. Aut. J. CFp S.i. 3:29+304.
AnB, J.!., G.A. Slaftr, M.P- R.y.old! @d C. Roto. 2002- Pladt brc.ding ad d@ughr
in C3 casls. wlar lhould w bed foi? AIn. Bot. 89: 925-940.
Arf!4 M., H. R Atb.. .trd M. AibEf. 200?. Dc dog.toB atPliotiot of salicylic
&id lheugh lhe ooting ncdie
dodula& gro*lb &d Photo3tttlhelic cap@i9 it
dif|Ertly .d6pted spdng wh.d qltiv8 undd salt stes? J Pldl Physiol 6l
68559t.

133
Arnon, Dl. 19.19. Coppd.rzrr.s i! isoh&d chlorepLsts, polyph€Dbnd.se b rrra
y!4@ti. lldr Ph'3iol. 24: l-15,
Adg@i O. 194. Aslbalc 3ynd in pllrt d.rclopDot. J. Bi@ng. BioM. 26: 407.

Aiieoni, o. dd M.C. De Tullio. 2002. Ai.odic &id: dlch mE lbd just &
@!o{del. Bi@ho. Bioph}s. Acla 1569:1-9.
Arr.c4 RN. 1996. Plalt gDslh $bst ft.3: pdncipl6 ed applicatios. Chlpl@ dd
Hall, N.w Yorki 241-273.
Asada K. 1992. Asoftate p€bxidls.-a trydrog.n peioxid€ lMvdging enzrne in plturs.
Physiol. Plat. 85: 215-241.

Asada L M4l'6isN fo. sov.nging Eelivc molEulcs generared in chlomplats

1994.

udd light stEs. Id Brl@, N.R. drd ,.R. Bowld (..L.) ?hotoinl,biiion of
Photosldhesis: fbn Molcculsr Mcchrni$or ro 6e Fi.ld" Bios S.i€ndnc
Publish.R, Oxfod: 129-142.
Asad4 K 1999. IIE wtlr-qirq ctllc in chl@plaIs: svdgine ofa.tive oxysEns ad
djsiFlion ofq6 phdtoB. ADu. R4. Plsr Phy$ol. Pl,nt Mol. Biol. 50:601-
639.

Asada K ard M- Td.rhali. 19E7, PFdEti@ !d svagirg of adivc oryg.n in

phoiosrdhBis h: Kylc D.J., C.B. Otund .nd O. Afttzetr (eds.)
"Phoroi.libirioo' Ebaid, Ahi.rdd: 22?-289.
AhEq M. 2004. Son iDFi.rr ghFioloSiel $l6tid critdia fon salt tol@ce i!
pldls. 1106 199: 361-3?6.

AsbEg M. 2009. Biotlchlological app@h of inpoving pldt slt bl€fue sing

drioxidels d n!.l€ls. Biot !h!ol. Adv. 2?r E4-93.

Ashhi M. 2010, Inducing dblgltt tol.tlG in pla s: R.@t !dve6. Bior.ch. Adv.
26:169-183.

Ashnf, M. dd F. Kdih. l99l. ScEning of emc cult'va8nires of blek crm (/,sra

trrso L, H.ppd) for r€shira@ to wsLr str6s. Trcp. Asric. (Tindsll) 681 57-62.
AshEi, M. .nd F@bd. 2007. Rol6 of glycirc b.t jrc 6d prclift in inprcving plot
abiotic sr.e$ rcsislas., Envihn. Exo, Bot, 59: 206.216.

139
Ashnf. M. an t t.lv. O'lidy )g6 RcsPoNs of sonle newlv dwcloped salt-tolmt
gtutyF of spi.g wb..t io dla stlts U. Vttd Flatos dd ltotoqiu'tic
cap6city. A.ia Bot. Ndilddio 45: 29-39.

Ash6f, M- dd ?.J.C. rlanis. 2004 Potcnrid bi6!.Eic!l iodic{o6 ofsdbitv robtae

i! pl6ts. Plalr Sci' 166: 3-16
A3hdf, M. sd S. Malmood 1990 R.9FM offou ArorrEa sPei€s to dought st's
Envircd. E p. Bot.lo: 93-100.
Ashnt M.Y- l99E, Phroqdrhctic efrcicev of *tEt Edd $d!r sir* @dilic PaL

J. Sci. IndBt. R6.41: l5Gl63.

Ashlaf, M.Y. dd A.H Kb!t. 1990 Eft.t of deutht on $tt'!t vdi'ti6 dui4
\egFtadr! n!g.. &i. rodud- 2: 325-32?.

AshEl. M.Y.,ntl S S.M. Naqvi lgg5 Sidica or *!id upl'ke, g'dimii@ atd se'dlins

erc*rh ofwhat gdotypd undd rE!6000 itduccd uslcr

sli'$ Psk J Sr' lnd
R6,38: t3&lll.
Ah6f. M.Y- A.H. Kb! &d A & Aai. 199. C.ll Eenbtu' lrabilitv ad ils El'lrot
wilhson PhFiologicd P@csses b whal Acia'agm Hu8 4l;183'l9l
A$hf. M.Y., A.& Azni, A.H. Kh! &d Ss. M. N.qvi 1994 Vara clarioE in
difrq.ar t$6t (TiriM @stiw L) gtuttT.s u!d{ sil *t&r di'Scitt A€L
Ph'siol. ?ldt l61 231-240

Ait6f, M.Y., M.H. Naqli dd A H Kb4 1996. Evtbard of fou $t@ii8 tehihc
for drcughi tol6!!ce in whet (TitM aat'eL\' Actt Agro! EuE''t4: 2ll_

2m.
NuririoDl iibal.@ in *lt'ar (Itr'@
Aslrif, M.Y.. S.A. Alt tld A.S. Bbtni 1998.

4rsrlw L) g.nc'tyF goM d eil $t1* tE€s Actt PhFiol Plsl 20r 30?-
310.

Asbtor! ?.M.S. dd G.P. B.titt 194, A crnpa.isot of t d phvsiolory ed teroEv or

OdM (ecliotr ErrlhrcbeldFFag@e) sFci* ir diildent li8!t
mvib@entlr An. J. Bot 8l : 5Es597
Asnea S. M., J.A. Snydd and Y.R.r. la.2000 ABA-.lefci.n1 (aDal) dd ABA'
iruesiiire (rrilr, abi2-l) rNtrsld of Arobi.lopsis ha€ a {ild-tvpe slon'tal
EpoN to hu@dity. Plel cc ENio^ 23: 187'395
Atht rL A, Kbd tld M- Asbnf 2008. Erog.@ulsy aprli€d @r!ic 4id tllcvi'16
slllr-ind@d oxidiiv. 3ir* in qtar Envi@ Erp, Bot 63: 224231
Athlr. H.R. A. (}le sd M. tultrf 2OO9 lnduciDg sdt tolel!@ i! vh@l bv
€xosedouly aPplied solbic a.id $rcurl dif.rc nod's J Pler Nutr lz:
1799'1817.

A!ni[ R.B. l9E?. Son &d t!€n innuft€ otr ictd ed

c.op c!@&ristica of *ttd
slta @. h: Srivduv4 J.P, E PoF€ddu E Ae\tdo ed S Vtu ('dr')
.Drelgh Tdm&c in winLr c43b" WiLy lnttrsidc€, Nd York'
pholosvnib$is
Auria R.B., c.L. Morg4 M-A Fotd rnd s.G Bhsswst 1982' rbg l.3r
of Trith6 @sttv@ sid t Wd diploid and t'traploid sp@ics AE
Bot 49:

171-r89.

Avie J,C, A. Ouiy. G L.mar' J J B'@u{r l9q? Roor Polcin 4d

J vole'cc !d
vcg.rdive stodgc FoLin @ k v a4eic lutii'nt! for rlhlf'
sh@t Eerev$

CrP S.i 37: l lE?_93

Aziz. P.T, M.I. Nioget, F-kihd. 2000 Prolitc le*l b pdtlv un&r rhc @nirol ol
stt$
.bsiric eid in c@lr L.f discs duils rccovcrv fiom hvpctu$otic
Physiol. Plant, I l0: 376-183

Azz.dinc, F.H, chcNuch..nd M B&t201I lnpbrcDdr ofsalr tolctlM in duom

whal by dqoibic eid appli@lion t stt'ss Phvsiol Bi@lrd
7:27J?

R.C., BD Nslttl! v- Ch'dEl' ! shdmrssuld@d'

P- Chql]jia!' P'
Babu,
.lcyaElab s.KA Gr*L S P'lcbdt S Stn*ivd
LJ Sdl.rug' HT
w!& ed Nguva 20{3' GltEiic ttttysis of drolghr Fislarct
ir n@ bv
nol4ute Mkas: Alslcistion b't@ sondsry ltoti
ad ft€ld FrforDdc
CreP Sci. 43: 1457{ 469'

N IG{eo dd Y Ym'whr' 2004 Ola<xpE$ion of lsolG

Badlwi. G.H ,
id bbd.s cN@pb5ls q$ec6 1lF tol.t!@ ro sdr st* dd wrer
Foxidls
&6cit Phlsiol rlor l2t:231-{
la1
BlSbzdlh, A. 6d M. IraiimtEdDrdt!&i 20ll Ef6l of &oughl sress dd ils
inld@don with lgrblte dd slicylic &id or oloa (lt,ird ttdid' L)
g.milrtion dd sFdling 8ros'lh- J. SiFs Phlsiol. Bibchm ?: 5565'
BrisL, R, D. Pdla P.B-B- Acbey! Dd M K{. 1994. Nter.ti6 i! the activitie of
oxygd eav.ngjng d2ym$ ofwh..l l@v6 sulj*tcd to wter str€ss Pl4t c'll
?hysiol. 35:489495.

Brjaj, S., J. TdSoUi, L.F. Liu T.rl.D. Eo sd LWU t999 Ttssaic app@chd to

inc@e dchydtstior ctrcs toL@e in pldts. Mol BEed, 5i 493_503-

Bflue M.4., M.A. KsnD, A s.bid ad tr T.tabi. 2006 Efac of fertiliat
pol4sid on sre*tl yi.ld ssd nutielt upok of whan (tdlicun &stivu L )
@dqvrt rslr.$@ itioN. Soulh P..ific SMies 2?: 2!35
Baioli. C.G-, r. G6n a D- L Md(@ar'd J. J. Clid.t 2004. Miioch'n&i! @ rh'
non htg.t fr oxidativ. drn€e nles.s of wh.?n Criti'ud a$tieMLJ !
ExD. Bot. 55: 1663-1669.

Bdloti, M,o. M. sinontaohi, E. TmbBi, J B.lt@' J Monttldi dd s PutrLolo'

1999. Drcuehl snd wtcrinS'd.pend.i oxidativ. stEssi cff4t of &tioxidmt
@ 6t rTdifu @ttlwL.lw6.I. Erp. Bo! 50: l?5'383

Bs@. B. J. and s. B.ntLv- 1995, El@t ophoBis of polvester bdck€d polv&rvtdid'

g.h. Biorehniq6 t9: 558-73.
Bat6. L.S., LP. Vadt6 4d I.D T..c l9?3. R Pid d.t min lion of E€ prolire for
wLr 3h.s ?lot Soil 19: 205-207.
studi.s.

BedL. CL,. K.R st.v@4 tl tl N.udttq G.W. 'Ihir.! &d K'M Kirg' 1973
Difisivc Bist tr , tulPir.don .d pboiotldthdis in si!gL Llvcs of cod od
$ryhh in rclatio! to l.afwaar pokqrial Cu J Pldt sci 53: 53?-5'14'
Bc.rd, J. &d M. Ho. 1995. Bdl.y d@!.rclit6: .[.lc vdbrron ald Elpping Pldt
Mol. Biol. 2?: 835-845.
xE, ed N,C. Turnd 1976 crop Mtq dtficits Adv AgM 28: 16l'1217
Bcge,

B.gub, r.A. erl N. K. Pdl. 193. bfludE of Soil Moist@ on C'roMn, Watd Usc
and Yi€ld ofMui.td.I. Asbn Crep Sci. 170: 136-14l
BdbeUa M. &d C.M. r.uLcd. Effqcy of tleinclls for d.hying mesne of
199E.

shal leav6. IL s€n sre ad glin yi.ld udd ncld co.ditioB. furco. J. 90:
132-$4.
Bqjdi4 J.C. ed D.C. Ni.l*n 2006. varer &ficn eftlcts or mor distibuid of
eybc&, fcld po .!d chictpa licld crep. R6. 9: 2,18-253.
B@izky, R, dd S.D. TellLy. 1986. Tovld a &hnated li*agc mp of totuio bed
on iso?nes .d @doD cDNA s€ql&@. c!rcrie I 12: 88?,898.

B.oid, J., A. KU@, R. Smj, D. Spad ed c, Adin. 2008. Rcviry: br.ding uplsd
dce for dbughl Esisl$ce. ,. Sci- Food Asric. E8: 927 39.

B@icr, J., R. scraj, ,4" Kl|e, & V6up6e4 S. Inps, R.v.p. Cd{d4 L Oe, D.
SpaM drd c. Adin, 2009. The lsrge.ef.ct drought-Esisrarcc elr ?//2/
it|c|as Mlrr l4!.Lc in lp|{d rie, Ficld CmF R*, I lo:t 39t46.
Bha4 RM. ard N.K.S. Rro. 2005. InA@@ oflod load or TE8DDN of oln io *a&l
sftss, Indi& ,. Pldt PlDsiol, 10:54-59.
Blm A. 19E2. Evi.lcnce fd gdetic Eirb iq n dreughl Gil..e and ir implicltiotr!
pls
ror bE dins. Inr Dbughr Fsist ne in cmp3, wilh cnphlsis on ri.c. rRRI,
LG Bes PhilippiB: 53{8.
Blm, A. 1974, cenlt?ic dpo4 ir $r8h@ 10 d&Wht sr€sr, . tlal tisE M1d
Flatio$. Cbp Sci. l4:691{92.
BluE, A 1988- Pler bre€dilg for sblss @viromnls. CRC pGs, B@ Rrroq Fldid4
USA:223.
BlM, A. .!d A. Eb.i.oa l9El. Cc[ trmbl@ drDilily s a of itowbi dd
heai totcEn@ in ehcar Crep Sci. 2l:43-47,
'|'om
Blm, A., J. Mayd dd
cozt6. | 98t. A.sidio. b.rEn pLfi Fldwrir dd eec
G.
physioloeicd @mpoD.nis of d.owhl ska.ne i! wbar, pLd Ccll Envimr 6:
2t9-225.
BohE( HJ. !d E. Slaeld& | 9& pt4t 3rw adlpt rioF@liog @rrbotis dd..
cw. opin. PI&t Biol. l: 257_74.

143
Devkov4 t., l.B RMuss.A A. KiUi& ed A Kl'iDlofs
B.J. Sleff.@D Y. Jin,
195. MoleulE idt6 fc tesftnilg nulliplc dt rdsld' g@ in bdLv-
In "Pb!t Odo@ Itr, Ah6tEcl3 of Tt lltan d@al Cotf'Grce on lhc Sl.rB of
Pldn G@F. Re!dcb-: 10: l5"t 9 JrA t 95 .1 sd Diego' Califodia, USA-
Borttl A.K., C.L. Ha@d sd R G H.@ll 2000 Doe Minlaining sen lcd.g in
elghM inpov. yi.ld dder drcudt? II Dry mtt r Pr'duction dd vi'ld cop
S.i.40:103?-1048
Bos.o, v, Valpu.sr! dd M-A- Bol.llL 2001, Pl&l €vid@e for a rcle of salicvlic eid
ir thc oxidltive d&ag. by NaCl &d @otic sltss itr '4t'O'dorrh cdlings
PLd Phtsiot, 126: 10241030.
Bowld. C.M., V. Mdrlgu ald D IrE. !994. SuPer oxide disuiile 4d stres

told@. Amu. R.v. lldl Phvsiol. 3: 831 16.

Boy.r, J.S. ) 996. Advs@s in dreush plels Adv Aeon' 56r lE7_218
loL6c. in

Bndfod, M. l9?5. Rapid dd qwiitatrv. Ddhod for q@titaion of nicrogt@

q@liti.s ofptllen ufdizits th. primipL of plblein{t! bindi!& An Bioch'd'
121284.
BFy, E,A., J.B. Slc arit E Wdtibvt.2000 R..po6 to tbrolic slt6s6 ln:

Gruits.n. W. B Beh.llM ald R- Jo8 (.ds)'Bi@hdbltv tnd Mol4uld

Biology of PLDrs'Ancn@ s.ci.iv of Plot Phvsiolosrstsr I l5E-l203'
B@nq W.M. 2006. H.altbful$s &d nulritioBl quttitv of ft6h Y'dE
prcc€$ed &uirs

,nd vcSclabl6; ! r€vi4, Foodldic. R.eech Int.mrio&l 8i l_45

Bone, K.w. 2o0l R.vie* of sntuic.l m.dod! ror Qtl b'pPhg in dFlinc al
cfrss.s.l$ AniMl 30: 44-52

BoeD, A. D, &d J.R SiD!6oL l9?2 Wsd tel.tioB of $ear-lolcfut vcsr$ t[' rclc

ofi tellul,l polyols. J. Ga Miclo.72: 58q591

BEk , JJ., cmblc, JL Ha6dd.nd J.E Quisnbqrv- 1985 Pl&r moDhological
P.E.

and biochenicd FsPos6 to Acb wlt r daicits l R€slones

io glutlthio@
rduct s adivily &d panqugl ssitivitv. Pl4t Phvsiol T9: 415+19
Bulcler. M.l-. R.L. Jml and D.R. kaonic 1999 sequ.M cbracldiz3ton of
orc@lellites h diploid and Polt?loid ,Po,,r.a. TbdL ApPI G€n't 99: 123-

t32.
C.dcm\ s.E. 1989. Bi@h.6isLy ofoxyS.n loxicity. Amu. Rs. Bi@h@- 58: 79'l | 0

Cet s. A"G. B.J. Blss !trd P M, G!6shofr. l9l DNA mPlii€ti@

filgEFinting uing vdy shon snitlr, olig@ual@ti& priffi Bioclhdl 9:
553i.
Caid, J.E. A. Audebe4 c.E- Mulli rnd A.H. Pi@ 2009- Malpilg qutdritaiivc rdft'
l@i sociated {ith @r soerh 6 tD].^d ne (O4td satua L.) qpos.d lo $il
w.r€defi.it i! fi.ld eith @nttsting $il ptopcnics li€ld Crcps R6 ll4: 108-

I18.
Cdso, L.M., M. M in 6d B. Sab.Er' 2001. lLO, bcdiard the inducdon of
chloloplasti. NDh @mpler undd phoiooxidltive str€ss in bdlev. Pl'nl ?hFiol
l2t:145G1458,
C$t lli, S.1., L Gtub.rc, N. Mu_roz, S Gifh, E L Coloob4 A. Ribona' E Bid'ibosr

ad C- L|M 2010. Oxiddiv. dtn gc tid alnoxiddl defetrs a porcnnal

tulclro6 ofsahiol@t C@cht|)t c'lietu L. g@otvpe Fl@ 205: 622626

Csnonguy, Y. od A.H. M{rbri 192- Laf gEs dclElgE in wrd sEesed @@on
b@ ed cpaty bed. CrcP 3.i 32:98F986.
Cdivclti. L,.I. Riz3. !.1v. Bad@l, E Mla@alli, A.M. Mstragelo, E Ftuci4 C'
Mm, A. Tonlelli &d A.M Slslra' 200E Drewhr blelEc irPro\'hedt in
cop pla s: d i asldt€d vi.w fton bFeding to genonic li€ld cops Rcs 105;
I,14,
c.c4lli, s. 1096. Pc'tive g@tt?. bt dvrcmcd D|ereion in
irkptlltio of
Elaij@ lo scliMbility dd bioditlBitv ln C@pc' M dd c L na@€B
('& )
UK:
"Ptet ld.aptatio! &d @P iDFovdcnl, CAB lnLtu'non'1, Vallingford
4674E6.
Chrilllyr K. V,, P.P. Jlnr, D SDrds dd A, PdD-lutrdn Reddv 2003 Wlrtr s[s
ctr cts d phorostnihdb i! difrGl bulbarv cdtivsis, Pltnl cftsln R'guL
40:?5+0.

145
cbrsc, B. ,nd A.C. M&hly. 1955 A!s!y ofc!i.I4 &d Frexid!$' Mttt- E"'_vml 2:
164-775.

Chrldn S. 2003. Eftds of laf .Bc on st !Pi6ti@ dd €Gsv dch&8' of f'd

Mol Biol'
Afo-.tar4 a mdripulos Ec€ {€i.s ofcdt"l Himalavs Phtsiol
Pl&is 9:255-260,
chands.k&. V.. R.K. s.im &d A c. Snvathva 2000 Phvsiologicol md bioch'nical
r.spor.s of hexaploid ed |tryloid whal io droueh slN. I Agron Crp Sci

lE5,2t9-221.
clsq M.M., J.P- M!r@ dd P@ua 2003 udtstltditq pLnl tlsFls !o
J-S,

dreughlAoo g@6 lo lh. *iolc pls! Futrcl Pl6t Biol 30: 2l+264'
Ch.a, O. lid P.M. N€lll]M 1994. Hvd!$lic aismls Aoo th€ @B 6pid ceu
'nd
*.ll hrldcrins in sowing mai4 l..vB, e. Plinarv r€spoMs to PEG indued

wat rdcficils, PlerPhvsiol l04i 1185-1392,

gencs' Prvr8o ud
Cheng, 2., J. Talsolli, x. lt@g dd R Wu. 2002 lvhe1 LEA
P,{Lil95r. e !e debvttnlion ioLtu4 of ftEgmic tie (Ory2a tdiw L)'
Mol. Bt d.l0: ?1-{2
ChilMd. C.A.. J- !e.pn ud A-r. Hdl 2002 Osoric 'd.i[(d'ni ed lcld
@inr.ll,M undd drcuslt in sDnow Ficld CoF R6 ?5: 21t246'
Chloup.tq O., B.P. Forsd dd W.T. Thons 2006 The Gtrar of @i_d*!rf
gcncs on

sik h field-greM barLy. Tlleor' APpl. Gd.t I l2; 779'?E6'

root lystem

Choudhary, N.L., R.K. saim ad A. Tyagi 2005 Expresion of deltdl'PvNlincj'

cdboxyl.te synrhel* g@ duiog.ltoush in ne (Ortd ror,w L) lndie I
Biochd. Bioph)s. 42: 36Gl?0.
Cho@y, K,, S. R!l@i atd s.L A9i. 20Ol. A@uEult'tion of LEA ptotlitu in sdr
(N8CD stsscd Fdg scdli.gs ofrie (O'rz tdrim L) culive B@ R'rt
'd
thc! &gEdstion dui!8 tdvlry fiom sali.itv 5li8 J. Pls Physiol 160: I 165-

Clo$. T,J, l9?, D.hy&i6: a comoMlity in thc cspoM ofplilt! 10 d.hvdlation dd

lov tcnDcratrc. Phvsiol PLti. l00r 291-6.

L45
c@h8d, H., L. Col|' X.L. Rou ed T. An glio. 2002- U@Elitrg t!. cff€cB ofddl
hy&&lics oa slo@r.l closw duiDg mld sr6s in Mlnur, Pl&t PhFiol, l?E:
282-290.
condoq A.O. sd R.A. Rjchlds. 1993. Exploiting gfttic veiation in taapinfon
efrci.ncy i! star: e.sromnic vid. hr Ehldirsd, J.R., A.E. HaI ed C.D.
Farqulw (eds.) *St bl€ i$top.s dd plel @bon-mler rclolioB' Acad@ic
Pes, t ndoni 435-450-
Co*li4 P.l. 2001. R@t rdve6 ir ile tute ard bi6Flh.sis of aslbic @id in
pl&E. Pler Cell EnviF!. 24: 383-94.

Comjc, G I99. DDrglt $r* and high lighr etrcrs on l.d phoroslDlb6isr 279-31] In
Bal@r, N.R. ed LR. Bo*y€r (eds.) "Pholoinnibiiion of phobsrith€sb, fton
mleuld meh&isDs io tlt fi.ld" BIOS Sci@tific hiblblEs, orford.
Conic. G. 2000. Dreught shess ilbiits pholosrath.sis by decring slodtat apcrte,
nol by af€ding AT? sFrh.sis, TFnds Plet Sci. 5; lE7-188.
corp.r F.J., J.B. B.@e rad L.A.D. Rio. 2001. PfrriloF6 s a slre of..elivc
oxygcn speci.s ed niric oxide rigial bol€cul.s in tlor c.lk. TFndr plet Sci.
6i 145n50.
Counois,8., C. Mclsre4 P.K. Sinh4 ra pnsa4 R. yadav dd L. Shq. 2000. Mappi!8
Q-rIl Nwiatcd eirh dFush woidsNe in uDtdd rice. Mol. Bcd_ 6: 55{6.
Cui, F-J. Li, A. Din& C. Zbb, L- Wdg, X. W6&S. Li,y. B&,X. Li,D. Fds, L.
Koig, H- Warg, 201L C,ndirionil QTL eapping for pl6r heighl wid resp€.t ro
the lclgth oftlc stilc rrd incEod. in re EppinS polutarioa of s!ar. ,nFr
Appl. Gen€t, 122:1517J6.
CushrEtr. ,.C. and J. Bohn d.2000. c!|Mic alp@h€s ro pl&r sllw iol€6nc.. Cu.
Orir. Plg,t Biol. 3: II ?-124.
CulLr J, M' D.W. RliN ed &S. loomi& t 97. Thc inpoiec. of ell siz. in ihc ,arc,
El]ltioB ofpl&ts. ?hysiol. Ptdr 40: 255-260.
curld. Rw. R Chud.l, T Htd! S Alutslllh@h.i 2006 Dev'lot@l of
tnd
equcre cha.addized DNA oat6 linked to tcnp<uie dcpetd'@ for
flowr indu.lio! i! lvche (Ilcrl .ritr air s.n) culrivds Sci- Hon l0?: 264_
270.
DaLi, M,, D. Tayal, v. chiMl6ey KC B&lala 2009. Abiotic sts$ ard ABA'
ond

inducible grcuP 4 LEA ftom &dri.4,4Pb plsvs ! t€v 6L in salt dd drcndt

ioleEnce. I Biot€ch.ol. 39i 13?-45,
Ddshti. H.. B.Y. SMadi, M. Ghonn dia, MR Nag[avi ad s Qwi 2007 QTL

AnalysG for Doud$ Rcsistarce W!.ai Using Doubled Haploid Lines ht J'
'lt
Agri- Biol, 9: 98n01
Da!.y, M- V,, M. V Mlntlgu I Ditlq S. Mdt , K A!8eloi N sdimff' L J

Bintrie, J. , Stib, D. F.lcll &d r. lLlcba 2000 Pl&t Mrbiqi eid

chcsislry, nndion, m.obolisD, bi@ilbilitv Dd of po63ins J Sci-
'ff'd'
food ald Asd. 80:E25-E50.
Davidson D.t- dtl P M. CbeEtid 1987. hflmc of pltcthvlde glv@l isdu€d ml6
on 6[a prededon i! sFine *isi crep S'i 27:
1185-l 18?
defciB
of pluts to
Deni!& A.B. 6nd V Adass. t992. PbotoPtottc{id &d otbd tlspolG

luSh Aou Rd. Pldt PhFiot Plalt Mol Biol ?I: 599'
lisbi slt ss
Ddinl, T eil l. Tuka 2004. Dca eS@oB Slldtrebdtift atr'ct drioxi&ri!'
sysran of d@ !€.dling untu NaCl ttahcdt J
PLlr Phvsiol l6l: loEl100-
K Kudt 2olo R6DoM o(
D.EircwtaK,LS.Sb ov!.I F.di'!. K Odgi'va od
h'at 6d lidt s!€3 J
orya.yslati! I lnnsforned roba4o plads 10 drcugh'
.Agren. CroP S.i. 1961 90 99

Ddnirvsta K,D. Z!sh.r4 R Dinitov, ! si@v!"Sroilovs" M strmdov4dd U

stts on Rqbiso in whelr chdS* in the Rubis@
Fell€r' 2009. Drcught
'trals
Pldr 3li Il29t138
ldge subunii, Acta Phytiol.
polvmoahic DNA
D€v6, KM dd M.D. Gd.. 1992 Thc u!' of @doo
anplified

ndleu in wbdr Th@r' ApPl Cdd 84: 567-5?:

Devey, D.R. ttd KH Lu, 1959' A @rebtion ed Fthocfftcicnt lialtsis of
@nron€nrs of cr.st d wh..t 96 sld Prc<luction' Agtur J 5l: 5l5J 18

I'A
 D Bdschd' M.M. Nehit ad ME' Sorll!'
Di!b, A.A., R.V. Xrltcty, N.Z Oztun{,
2008. Dmughl.indcibl. gdes md ditrernti'llv
qPcsd eqLc@ Egs
ascia!.tt w h onporcds of dDuglt toLm@ in dud wh'.r Sci R6'
Esavs 3: 009425.
Dipt6k, A.T. lgg4 Anlioxiddts ed di*i!' prcMrion Mol ArFds Mcd 15:291'

376,

Dohrab6di& A. S.A-, M. Modrtrsln4} dd A5il4 2010 Efl€ct of dcorbic rcid

KS
irails or
foli& .pplicalion on vield' vicld conpo*lr tnd s'lesl noryhologicd
Not Sci Biol 2: 45'50'
lrain @m urd.r sld d.ficii ttr!$ conditios
Dolahbddiaa A-, A M. Sa vi sd M Stldi6
2009r All€viadon of Miq d€ficit siress

.ff.cis bv folid lpplic.liotr of sco$i' &id on z"a

tt"r L J A€ron crcP sci
1951i41-355
(Vil!di!
Dobid{di.a A., A.M. S&svi ad M S Heifi 2009b Effdt ofAs"rbic 'acid
q raf Preline Aduulation &d
F.cdinS oo A ioid'ni FnztG Activitv'
of c@ls ('rasi" i4d L) uda
sdt Sr'ss Codition J
Lipid P@xidrdon
Sci. Tehnol Agic Na! R6 13: 6l l{20'
Doldlho.lis! A.Rs .td 2009- lidpa't of *gemB sdbic did on
'o@8bsi t'it! 'f cl)ttmn ban $bj"t'd io
adiotjdldt -iilitv ed e6' pbvsiologicd
sdiDly str6 Norbor Holt AStobot cluj lT;165-172

DoMtoq vJs 1983. Osdoiic adjustrcot duilg wltq stt6 pddr5 u'
ph.losvn0Fsis .ppordts 4rbst Pboto ribilior Pldt sci ltit'r l0: 13?'43-
i
riss Focs 12: 13'
*r,.,i.r.-i," -rt" t- Ilolarion ofPlant DNA fiod alsh

15.

wes, dd D Yu fd s.€d Yi.ld ed drelsnt

2009 MlPPrng Q'ILS
Du, w, M. S. Fu

su!..Fibili9 indq in sov-b'a (cl'et*

@ L.)ems diffcrc dvmnnenE'
G.nd G.rcnics 36: 721-?31
J.
! LC B@itgs 200? lntq&tios b'tq@
Duaa' B-. Y- Yeg, Y, Lu, H Koryclain4'
-..-
&d Aa't'v}* n Picea asPenn r' ExD Bot iE: 3025-
drouglt strcs, ABA
3036.
 Y S!i(M., Y lto, M KNg4EG Dubo@! S Miur4 M s€iki' K
Dubolzcl, J.C.,
sbinoz&i dd Y Y. Sbimati 2003. osDREB ec6 in ie' Otza
sdtiw L'

dcode deeipdon 4tilaroB 6ar tuEtion in dreuelt-h4li s'll 6d

6ld
mposiv€ g€n 4pllsion Plant J.33:48?4%
Dwitst L. I.T Ohm, S. Ma.t@ie, F. Pat!6on, s C@bFn R Rltclife l9'{'
'!d
of . DNA Mks {ilh 0F H63id Ov tlsislae g'rc H9 in
whan
Asilrioo
Tb@r. Appl G.n€t 89: 961l_96E.

Et dssd, LdI moryholo$t .nd Efl..tam' ir rlldoD b war'r a'd t'npeam

J. t 9E0.

strEss. h "Adspt tior of planrs to w!&' tld higi

Gr'!€i'tu€ stress"' e& Nc
TUlm dd PJ Ksdd John Wil€v 4d Sons, N€w Yo*: 295-308'
n'thods
El-F{, LA, ed AY Alld lgg5 R6pots of$Ee $t!'d cuhv6 to $wing
diff.ctr $age ofgre$lb. Au* Agric Sci 26:267-27?
tnd dmugh al
' 6pon5's of
Et-Htft4 R, D.H smit\ M. K!tu! ed K Smii lgg8 PhFiologictl
Spn.8 Dum whelt cdtivs to @ly'$ason dmwht in a
Medilerem
.nv'bil@i. AD. Bot 81 363'370
sd
EUsoitr D.s- 199- CO: atriclDol in n!ffiing pie fotst AE CO' cxchqsc
var6 sE s illlE c.rbpv.&ctcd? PLtn c'u E iren 22:461-1?2'
phorostdhdic dbon
Elsltli, S. ald HJ E{l 2005 Phtsologrctl linilltioN ro
Nimilation cottotr ddd wrr.t sltlss Crcp Sci 45: 2374-2382
'n
Minctd ttition ofPl,nls: FnciPl€s sd p'Bp'ctiv6 John wilev ud
EDdein, E. lgT2
sos, New Yotk
Edc!, G., S. lrlrnlia Jl. Itigov.D' M' S-Di& !d J4 Avi@ 2010 Bioldas

Danilonh& bolphotoev a*l *tld sia!6 of fou dftlfa g'rctvp6 subnilt'd to

pregr*ive drclsht dtd suh6€qwn1@ov'tv t Pl&t Phveiol 167rI14 120'
Fllina M ed C Pl4chod 1994 SloD'tial tnd photosv hetic
adjusti' or wler
d.ficil6 the sudlow CrcP S'i 34: 103-10?
cxpEsi@ of IElFsis in
Fa*r! M.M.. M-M I sou4 s L T. Lobnr' and LM F' ElQudni' 200?-
R5Ior of
veg.rdiv. gto*$ dd m' chcNc5l octiM s of Cl9rdrd
s'hryni"^ L
to folid lppli€tion ofas.orbic eid ed zim at
Nnhdia VorldJ Aetic sci l:

242-248.

150
Farcoq, M., A. Walid. D.J. lre, S.A. Chc.na ed T. Aziz 2010 Comp@tiv€ tinc
.ow &tur of the folie appli.d glycircb.t ire, slicylic mid, nitou oxid.,
bsimstereidr ald sp.mie i! i4gmving dreustrt rcsi51atr@ of de I. Agror
cbp sci. 196: 336-345.

F Nq, M-, A. w'Ii4 N. Kobty.sti, D. Fujita S.M-A. Bls 2009. Pltd drcuSltr

stnss: .ffers, mohadm! .!d Elnr8F6at A8ron. s$lair Dev. 29: 185-212

F.s.cr! Rc. &d N. Colisc@ry!. l%7. A filtet-psFr o.rlod tur detetEiling lh.
doisnE ch@ci.ristic ofeil, Aull J. E Q. Agri. Anintl HBbedry ?: 162- 167.
F.ldnd, M. 2001. Gsrn of cdliv.Ld w!.d. In: Eonjar! A.P. aDd w.J- AngG (.ds.)
''the Wdld what Book A Hiltdy of whc.1 Bedi4' tavotir Publishii&
ldis:3-56.
flek, J., ,. Bot!" J.I. Lorelo, C. conic ed T.D, Sh{key. 2004. Dim8ive ed
m.rabolic limilatioN ro photostlthdis !!dd dreu€lt &d salinity in Cl plarl3,

?bm Biol. 6: 1-11.

Flow, D.J- !d M.M. trlow. 1985. Cdltibu$on of (fmtic arljurncni to i!.
d.hyd@rion rol@@ of *&.-rts*d piglonpa (Cqiru .q@ L. (nillsp-)
l6c. Plant Cc[ ENirctr 9: 33-10.
roy4, C.H ed J. qarbi@r 1994. Oxys!! e.tboliu.nd tle tguladon of
pLobsynhetic electon t:&spon. b: For., C.H ed P- MdliMu G&.)
.caws of photmndaiv. srt ss,nd @liondon of d.fe@ s'tsr@ in planl.'
Boca Paton, CRC ?cs, Flodd4 USA, l-42.
Foylr, C.H. 2001- Ptusp€cb for cnhroc.m.ir thc sluble etioxidel3 d@rbst Dd
glutalhioft. BioFetof l5: 75-E.
foy.r, C,H, 2002, 'Ite @ottibutio! of photoEdhelrc orfger oelatDlism 10 ox'dativ.
lnz, D. &d M.V. M@go, edi[o., Oxidiarjv€ str65 in pl. s.
sE6s in platrts. In:
Tlylor ,!d Ft@is hbli$cB:, N.w Yo& USA: 33{6.
royd, C.H. ..d G. Nocloi 2000. Oxygc! prcGrirs in photo6ymlBis: rguldioi .Dd
sisralins N.w P!r'iol. l,16: 359-3EE.

!51
Folq, C.H- H.L- JL Dat ed l.M. Son 1997' Hldbgd p'rcxid' atd
Dcgado,
glutaIhioF- .!sid!d ndhdis of eldrarory scs tolctue ud siSnalin&
Pbysiol. Pla . l00i 241-254.
Frcdqick, J.R. C.R. CdP aDd PJ. Ba@r' 2001. Dreugtrt-rfts €lIdis on branch ed
6.insld s..d vi.ld ed vrcld @E9oMG of d.tlrEiEtt sybed Ctup Sli 4l :

79-763.
cd! M.PN. 195. PholoEdhcir. It$n$ duilg grsi! 6ning in winkl whai Aeron

t 86:159-167.

Cnt M.P.N. sld RK Ketoooto lg2 C!tuPv photosvnthdt aod Espintion in

*int r slEl .dapLd &d ulad.pt d to @.eliot Crep S4i 32: 425-431'

Oi@opolili.!, CN.4d SK. Rrs t977. Su!.roxi'h' dkmDr'* I O@moce in

hiSrMpldns. Pls Physiol. 59; 309'3 | 4
Gitrd(RM. lnl L.T Ev!!t l9Sl. ?hotodvtdBi+ orhd lon i@ing snd vnu Astt'
tuv. Pblt PhYsiol 12:485'509
ciu, B.s,, R. Appek, B ObqhohLr, AM. B.u.ll. CR B€B€lzelr JL Chahoub'
B

Chulcy, F, Dvoblq .t. Itu g4 M Kclt6, B Li, W Mccombie' Ir''R

Ogih@'

Y.F. qr..tid ald T. Sa3*j- 2004. A w*shop @ wlEt G@N

s'qu'dins:

Int @tioirt VIEat C@edi@ G@'tica 168: 108?'1096

Cmnc R.$eh on

cillh@, D.r. .nd A.D. Dodg.. lg8T chlomplalt srlp'rcxi& dd hvdroSo

p'rcxlde

systqD! fion p@ ldE: sont! wiario Ptanl Sci

50: 105'109
svcngilg
ratc of
Gin6.z. C-,Milchtll ard D.V. Lonl6 1992 R'gplalio! of photottlttesb
v.t
9S; 516-524'
t$b sunfloM hvbdds N.tq $der stss tbtrt PhlEiol
Si'fancli' S V'cchi sd
Giuliei, S., P. Lmdi, M C Sdguincti, M Belloni' S Salvi' S
R. Tub.w od cL{dtlaizdion of @t-ABAl r mjor
2004 lsoreDiztion
QTL afr€cling @t tairs &d l€'f ABA @Fftdon in Mjze v QTL
Mav 24-28' 2004 al
Id€ntifidion ln: "Ptoc Rockcftld lourddion Wo*shoP"
CIMMYT, Mcxi@
Gosq D. R, E. P Miltbold $d M c LUd 1994 Altioiidet Bpor ro N'Cl
rntl slrssilE cultilt! of cotlon Crep Sci 34:
706-714
sit s !.lt_rol.fur

La2
Coyal, RK. 2004. Sdsi$vity of dapoftupintionIo dobd {miDs: a c& strdy or
did zonc ofRljrslhan Indi& Agric. water MMgc. 59: 1- I l.
C|!d, A- A. hloor, J Schond.baid, H. Si.dld, K. Pillql C. li!.hbcclq G. ve@I,
RG Htu l9l. Constr@tion of d RFLP @! of bdlcy, Th@r, Appl.
G@.t.83:25G256.
O@id C., D. IDI ed F. Tardi{ e[ ditisiotr E& 6 be
2000. Spltial dbt ibutjon
.Ldu.cd toE lbd of P34@ tire r.rivity in tuiz. loB greM in @ntrrsiirS
@nditiotu oftdnp€nn!. sd wrcr gt!fta, ?ldt Physiol 124: l39l- 1402.

Gtuia, C.6d F- T.rdi@. 199, Wata dcficn ard cPslial patten of lcaf.l€velopm.nr
vabbilily In Espong @ b. siDuLt d ui!8 . siDpl. md.l of lef
tlevclopn nr, PIdt Physiol 2l:609-619.
G@ier, C., D. lE€ md F. Tardid. 2000. Spaiial disttibuiion of.eU divhion lale cd b.
deduccd &@ lhlt of Plk<L2 kit4 &iivity i! mj4 l6rcs gbM in
co .dfning @didG of leeentu. rid ea&r 3t!s ?la!t PhFiol. 124: 1393-
1402,

Cria€, C.M. rad S,R G6ta!, 1983. Rltid aey for lhc dctctuie{on of rd€r $lublc
qut.frlrt innmiun c@pouds. Plet soil 70: 303-307.
Gtud4, S.T. 2001. WlEai. Ile Crcp. In: "Eftyclop.dis of Food &i€res ed
Nurriion" EIsEviq Sci. Lid.:6130,

Ouhr,.{D., $neopia, G.K. Rai@i, A.& R.ddy.2010, A! ilcgnrd diagrc31ic

ryplo&h to urd4tld drcught toltue iD nulb.ny (M,ru id,6 L.)- 1106
205.144-151.
Ge, P. ard M. Li. 1996. Studic oD phoioErrhctic .h@lc.istica i! rie hytrid
prcg.lid 4d lh.t p5mts. L cblorophytr @ €!q chl@phyll-protcin @Epld
&d chlobphy! nuor.sme kietiB, t, Trcpical Subbopical Bot 4: 60-65.

Gupr4 A.S. &d GA. Bdkditz 1987. Oshorjc adjustEor, srEdast volme ad rcF
sloo.sl D.diat d sid si6 irhibirio of phoiosFth6is h mte!. Plsr
Physiol. 85: 1040-1047.

Gupt4 ?.K. 2002. Mol@lq hdk6 ed QTL a!.lysb in mp pldb. Cu. sci. 8l:
113-1t4.

153
Cnpi4 P-K ad &K. V.llhney.2004. Cqtal Sm6ica: d ovdia lD: crPi4 PK
ed R.K. vshr.y (.tts.) "cdat G.nonics' KIuw Dodrccht' nle
Nethdhrb;l-lE.
Hall, J,R. ed S,W. Bingh@. 1993. Inplct of 8m*fi FgulaloB on Kotskv blucSas

sod bdsg.h6t snd itdtllation PdraneLs, I!; crmw, Rw ' N E cbfttie

ud RC, ShdDD (.d!.). "l!t oaliotl TEfgnss S@i.tv" t Grc! PublisltB
Cor! Koss, USA; ?01-70?

HaDryu! M,, S.A. Kb6. eK ShilvIi, A, Khta N, AtD'd $d J-J- lE 2010' Eff6r
of poly.Uyl* 8ly@l induced dbught str€ss on ptvsio-homontl attributes
of
$!t€rn- Pslc ,. Bot. 42: 977_986.

Ho'.2., C. w&g, X. Sory, V G@,I Gou C. Li, X. Chd ald T zhog 2006'
Cb@rcrisic! &v.lopMt 8d ntlPilg of Cdrrt@ ,tr,,,t d'dYed EST-
SsRr in alloleF.ploid @tlotr. Iloi Appl G.n t. I 12: 43F439

HaMo A.D., C.E. N*q A.I- Iw dd E.H. Ev€Mr 1979 Ca9eitv for PDlire
Pctt

a..@uldi@ dEing vacr sE s in b.rlcv sd it inplicrdc fot bFcdi4 ror

dtuught rcsisla&.. Cmp Sci l9r4E9491-

tl,r P.D- W.A, Cr6s ed t.V. St d.o 198. Dissling tbc rc16 of osoly'e
a..uddion dunng sttls& ?lad C€ll Envirer 2l: 535-553
Itdis, D. RS. TliFlti tDd A- Jolti. 2002 O.-f.in s.cd FiDi's to iDpo€ cbp
€sllblblm€d ed yi.ld in drv diFcl'ecd€d ric.' in: Pddcv S. M Monimq' L
wltlc, T.P. Tmng, Ic lrp6 ald B. Eardv (G<b-) 'Di@t sdi's: Rcs@h
StaLSiB md Op9onmfti6" InLFltiott Rj@ R'!@h Institutc' Mdil4
Philippirc: 231-240
Hasslnci!. R.A., FM Bs@nv, Dn4 Bdrls ed RR- KlElil 2009 PhFiolosi4l
cEd of nicorimi.le ed 4orbic 4id oo Za uavr pl&r l_chsges D gro*lh'
$tu cl.\E r ddlbolic stivilie.td on{btiw def@ sy'rds R6 J A8nc
Biol. Sci.5:?2-El.

tlrudry,.{,., A. Cdci, C. Rsv€I, T BtLilo4 D BiGI' C Potat! I- Hochq S ?oi6' S'

Sdtoni 6d Gl@in 2O0? Grindin8 up wheat a nsive lo$ of

S, nucl@tide

.li6ity si@ doD.si€tion Mol. Biol Evol 24:1506-15l?'

Eal|!s!|)aD B.l.G,. v. MlhaLtlbni, B,v.S. Rcddn N- s@lhldt., C Hdh snd H H l
C.igd. 2002. QTL Mppug of slav_g@n jd two sorghm tdnbinat inbFd
populations. ftot ApPl. G4t. 105: 133142.

Hrv.u, M. 198. Cdt.noids i! ndbl@ sialiliz.si! cblorcPlds T@ds Pl&t Sci-

l: l47.15l.
Htlau! M, a!!d F. Tlrdy 1999. tis of chloFpvll wilh linit'd r'dation of
pholosyrthdis se adaldvc EspoN of Svns bdlev l&dr&s 10 hidli8hl
dd hat st!!s. Ausi I. Pldt PhvsioL 26: 569-7E.

He D.H., ZX. Lia x.L at!g, Y'c. Ni€' X,}. G@, YX Zl48 md W Li 200? QTL

dappirg for c@nooic ttsitsblsd on ! dos' genctic maP of coiton wit! PCR-
b.t d 6t B siie rhc ini.6pel6. ws of CossWiM hnstr6 x cot,pi6
6strr&tr€. Elphtfo 153: lEl19?
L., x. Ji4 z G& lnd L Ru"hi. 2011. G.no9!&&pend' 6pons4
of whtat
He.
(Tritifu @ntuiL) ,g!/,inss b dDushq uv-B Ediarior ed fteir @nbi!'{t
str.ss, Afri@ J- BiotaL 10:4046.4056.

He. S. H. Ohn sd S M4kcrE. 1992 De@lDn of DNA scq@e polttorphism

dong vhcar v&i.n6. Thor Appti. Coa 84:573'5t8-
Hch idk, T., M SI@ub, S. wngi, A S.ls.tr'r dd J Nidltuis 1986 Co$ttu'tior
of 8@.trc linhSe n ps in tui4 ed ronlio uitrg Buiction n?gn'nt
log!)
polymahis 'Itsr' Appl. Gdr ?2r ?61_769'

Hetndali , G S., tl. E. sbBhidhd 4d S Hitldbau 2000 Mol€cdd 6ek'r 8&rist'd

ItggiiS of Dorphologrcal atrd pbvsiologic6l E its ud( $e @Esirg boins
Fsic !t psr wgtidive $!8. in !i€ (O'rz tz'iE L) Euphtrie I 12: 69-78

H.mhdcz P.. D.A Laurie, A Manln ed J w Smpe 2002- Utilrtv of balev and whctt

simplc s.qu@ FFd (SSR) natt'6 for gc!'lic of Hode@ cbil6*

'!"Itsis
Tdror.lcr. 'nFor' Appl. G€net 104:?15-t39
and
A nli
nde,D.,LFabE,El.Berios'N t reur,GA Ch,,si' C Plochon'
ST otd
tr'jls in
L. Gdzbiftd 200l. QTL ttdvsis of Pbolostdl6is ed wara snnE
Exp Bot
s!'fro{q (Eelt nth6 atuM L) udd gFcnhous' conditiotu J
52:

1E57n864,

155
HiFn &w-P. .rd S.T.C- Wright. 1973. Ihc mle of .ndos@u a!$isic aid ia th.
EspoN ofplelr lo strlses. J. Erp. B<'t 241 769-7El.
Hnsb, K.D. 2004. ftc Calcih Conudru. Both V€retile Nulri4l md spccific
sisdl. Pbnt PlFiol. | 35i 241&2142.

Holmbdg N. sd L. Bnbw. l99E. Ioprevilg *6s td.ma ir plers by s@ Fesf.r-

TMds Plel Sci. 3 | 6l -66.

HonE z. R@vrl of ftcdbar inhibition of d.lta (l>!}lolitr -s.qboxyl.le

2@0.
sydhaalc Fsults i! irws.d prolie &cuulliotr .d pbt ction of pldls tom
osmdc alrc$. tbnt Physiol. 122: I 12F1136.

Hons-Bq S., C. X. Ya$ C. LiYc. z. X-Ni8a W. Ga!s" Y.Y. Bins, Z. C. Xing ed H.

Z,!-Mb- Ilv.sligatid o! lb. Flali@ship of lrolin wilh *dsl6it-
2006b.
drcught undd eil w.ia deficii!. Colloids md Surf@s B: Bioint ifes
53:l l3l19.
Hons-Bo, S., L.Y. Cnt! O.Vq J.H. a.ng, Z.li. Lr ard Y.C. Hu 2007. Cbeg6 of enc
dti-oxidatiE phrliologi.al indics 6dd soil waid <Lfictu Mong l0 wh.a1
QmiM @stiw L., stxnwt d 1i[€mc st!€!. Colloids ed slrfaB B:
Bioint rfaccs 54: 143-149,
Hons-Bo, S., L.Z. Suo dd S. Min8m. 2005. ch&g€s of eti{xid.tirc €urm6 .nd
MDA onte u e. soil Mi.i dcliciis aolg l0 *hat (If'r,.th aanetd L.J
g.@typ6 rt daludion !og., couoid! !d sEfrce B: Bioilrqfag 45: 43,
Hons-Bo, S., L.Z. S@ dd S. Mins&. 2006a. Osturic Egrlrtion of l0 $ra (ftitiam
@,iwr L.) s@tyFs ar loil mt r d.[cit!. colloi.ls ed surf@! B:
BioinErhcd 47: 132-139.
Hufslda, E-V,, H.R, B@m4 T.E. Jr. C.rra ad HJ. E5l- 2007. Cnno9?ic r".irrio.
fd oEc physiologicd tleits afl6tin8 drcueit toltu in Soybeu crcp Sci. 4?:
25-15_

Hud, E.A. 1971. Ce w b@d for d@udl ffiislr@? h: lrea K.K. and J.D. E stin
(.ds.) "Dreudt injuy Esistance h crcr6" cssA SFc. Pub. No. 2, Co! Sci Soc.
Am. M.di@ Wi5,
Hu'd, E.A. 1976. Pldt bEding for dFughr cislle. In Kozioelti, T.T. (ed.) "water
Dcfcits 6d Plet G@l[ A@ddic Ptlss, N.e Yort4:3|7-353-
Hs.i4 M., M,A, Mdik, M. Fmoq, M.Y. AslEf !!d Ch.!@ 2008. IEpothg
droueht toLtuce by ao8doN alplic.tion of glycineb€tai!. .nd slicylic &id in
sudowr. J. Ag@ Cbp S.i. | 94: 193-199.
Iuca, P. md S.A. Qwi.. Vat6 rlatiou. In LuFo4 F.C.H. (ed.) "wlsr
19E7.

Bedins: Ib eie ific b$is" ChalDan dd Hdl, rrndd:313.33?.

Ishiidi, M., T. M'Ltd$. S.Y. Hro.!d T. Tliohe. 1995. Expr6siotr of tle b.l,ire
ald€hy.lc d.hydog.@ g€n€ in bdLy in 6FBc 10 o6mdc sts md absisic
&id. ?l6rt Mol. Biol. 27r 307-315.
Jajmi, v. 2009. Efer of w&l stts d smhatio! of ffi wldt cdtivd Vdld
Acad.ny of Scie@. Engi!.6i!g Tcclnoloo/ 49; 105-106.
R Copi. P. MrnivalrErr M, co@ihiDyaeatrr & Sndh!& ed R
Jal@I, C.A.,
Pdndldve 200E. Artioddar pototial and htlole altrloid pbfile vai.tio6
with qnld dcfrcits along diffa€ot pris of two varieties of Cado@dd r@.8
dd Sufcs B: Bioilllrhas 62i 312-3 | E.
Colloids
,a!FA RC- I93. InrdrEl E ppi.g of nultipL qodtir.rivc riit ldi. Cdic 135: 205-

2|.
Je$lioigtu4 S., T. T@jiada B. Iongd.e &d s. Rrjaos.@kul. 2004. vrlidlrion of
QTb for drelght nsiso@ ir tE iesoic inEoersion lic of rie. v QlI-
id.nnfiedon Ini "PN. Rock f.lld Foundalon Vorksho!" Mav 24-28. 2004 at
CIMMYT, M€no.
J.!M, H.E ad Vr- Mo8.!sc!. 1984. Yi.ld dd.urrior @.Lnts o spring *n rt
subj@tcd to Mler at vdiou grel1h slags. Acra Asic. S.ed. 34: 527J33.

Ji@.a A., J.A. Hdddea C. P8to.i. LA.D. Pjo lld F. Ssilla 1998. Role of rh€
rerb.lGgltt Ub@ cycle of ni(tchodria ud FDxieG ir rh. s.l*s..@
ofp.a l.w.s. Plani PhFiol. l l8:t327-1335.
 jizeng 2004 MapPing qu'nttbnve
Ji.g. R. c. xi@pin& H- zb!d&!8; o. Ning snd J
i.ait loci (QT!) for importatl l8tonomic itlits in *tst unda dinfed aod wll
iFisaied onrliiis v QTL ldentilicltion. '?roc R@tefellet Found'tion
wo shop'May 24-28, 20ol at CIMMYT' Mqico
H.T N8lyen ard L. Cbv 1984 osolic adju$m'nt &d solui'
Johrson, R.C.,
Mmubdon in $o vltd g.notvpe dificiry i! dblght rcssttle Crcp Sti'
24t 951-962.

Joh@ll R.C., W.D. MoEninw& DM. FcFs and JJ

g'ilbolt l9E? taf
tlFlostnthais ard c@dudld of *letld Tritic@ spsis ti difreMl
e314

poldnah. PIdl rhysiol. E!: l0l+1017-

Iohson, S.M., SJ. Dohcny ard RR.D Croy. 2003 BiPhdc supercxide g€Mdtiot 'n
polalo 1ub€s, A elf dplrying rctpone 10 sit $ Plet Phtsiol ll: 1440_9

Joh$n. v.C.. L.E. Jekea w Ocboa, Rv Wijk, I

PdeIm, DA Clail ed RW
Mich.ln@. 2000. Leitc., a 3hallow'@t€d crcP, dd Iactaz seniol4 il5 *ild
progdito., difd ar QI! &i,'rtit rg rool echrr4nre ald dcP sil *dct
dploitatiol nFi C'd.t l0l: |0661071-
A!Pl.
Kiis. w.M. 1987. Efets of w&r dcficiB o! pboloEdhetic dprcitv Plvsiol Pl4t
1l:142-149.
Kai$r. WM., c. (aie, N.iDeis l98l- PhotoEdthdtu urd'r
S- Schoffi ald S.
onotic stt$, Diffqbti.l dovcrv of pholosvnthelic &1iviij.s of neD'
.E mes, intacl chlorephsts ed lcaf slic6 anq d?osw to high solutc
conceft aiioB. Planra 153: 430.435.
Kr'Ers, A.Y., A. Menlir, B.B. APdtu dd O. Ibilod.. 2003 Tlt inflM@ ofdrcudt
st!3s on em*1h, yield ald yi.ld comPoicnb ol elected mj4 gcnot Fs l
Agic. S.i. l4l:43-50.
KMoshilr, A-, i- Wad€, L Ali, S P.6!a,. Zs& S Sdta@g !d T Nguvd 2002'

Mlppilg Q'[r for mt dorPholo$/ of a n@ populadon adalted lo Einlcd

lo{ldd @ldirios. Ib@i ADpl. C*t. 104: 880_893
Krul, R. i974. Pobntid ret photcy h$is nag bves of w€Elv drcudtt !r6ed
'n
whclt cultivs ed iis rcLlionship to srdn icld CaJ ?laa1&i 54:8lI-El5

153
Kuslilc LK. itrd R. Bhrt 2003 Whv k tddos. d .xccptioDl plol.in sllbiliel? An
adlwb of th. th.ftEl st bilitv of poait! i! th. trdde of th' @npatble
osolrlc r.hrl$.. L Biol. cho.218t2645&26465
K.3ey, M.J. l98 Th. Firciplca ofQTL edvtb (t nilirn l mdholnics tppst'h)
'I. Exp.
Bot. 49: 1619-l623.

K.ev. M.J. .!d H.S. Pooii. 1995. Ttu g.n tictl s|.l'sis of qNri|tivc t"ails

Ch'otM and Hdl. bndo!.

K.y!e, S.20lO. Th..frc.1! of dlough yi.l4 Fldivc wLr @lc4 pb'irc'
!iB! on

3olubL c{ho[ydrd., rnd cltlooPtyll ofbtEd e].al cullivs J AniiEt Phlr

S.i.8:1051- 1060.

Kbdil, S.E., C, Nr!.4 A. Azt ald L-AH B.dou 2010. md of wsld strlss &d
lsrbic .cid on soe. dd?tolotid tod bi@bc(nic.l @EPosiion of &,mt
,ariliM pbtrt J. Alu. Sci. 5: 33-46.
Kba A M.s.A. Alur4 H.R Alhr .D.l M- Alht|t 2006- lnt.rcriE !tr .i of folidlv
.ppli.d .$rbic l.id tnd 3dt 3t* od shal (fdtd @rt@ L).1lhc
s..dlin8 d!3c Prl. J. Bor 35: 1407J414
Kh.a A., L lqh6l, a Sh!h, H. Nrllnt, t A!D!d lnd M lbnlio 2010 alcvi.lid of
ld!re.rat5 of sdt tft$ in btsie (rt4t td .dP.tt!) bv pG$witg sced

ftdml*ith ncorbic eiL An EE!1 L Asri.. EDvimn S.i ?: J5?'560

Kb4 A.H., M.Y. Aduf, S.S.M. N.qvi ud Kn. siddiqui.. 1991. Rcdisrrihti@ or
$ctn o$ohydrd. i! dFuslt reisl.lt &d sFeotibb rrEt cdtivlts udd
r!l.r 3!rs5 co.diti6 A.r. Phlriol. Pl&1. 16: I9l-198.
K!d, ll|{8., N. Hutslib .nd M. Iqt l. 2001. Efc.r of Mtlr stcss or growlb end vi.ld
cdDon4E of Miz v&i.ry YHs 202. .,. R6. (Sci@) l2: | 5-18.
KlDio-Chopr., R !trd D.S. S.lor.. 2m7. Acclitnrlion to dDut!| .Ess gcDc!a16

oxid.rirc rts tol@ i! d@gl|r-sistltl the twPtiblc sb.d crltiv6

bdcr 6cld condilios. Envim Eio. Bot 60: 27G281.

Kh.y!ln.zh!4 R. Gtolmia S- J&nrdj+-Soolrin od R alibt+M.hb@tlaled

2010. Effets of Pm stB on @tu qntierlt (ka nay L, e g.min tiotr soge
world Appl. Sci. J. I I | 504-506.

159
Kjaj S.?., ?-Cri.q P. Mauly, P. Criq R. Hcinz, A. Pcmul, V. Nishidi.dlsu, E.
HoF?, L. C6lr,bin l, N- P&i.ao .rd A. sirafi. 2007t C.n tic wi.biliiy for
physiologicd tlils undcr dDwht olditiN ad diffcdtti.l qpGsio! of wL.
sirs ss@irtld gces il sbflow lH.tiadthw @hrB L.). Theoi Appl. C...t.
tt4: r9i-201 .

Kisj, S.P., P. Tdi!, P. Maur, P. G.icu, R. Heilz, A. P@uli, V. NisbiElMu, E.

Hopp, L GaEbin l N. Pdicgo.trd A. Sm6. 200?b. Glndic anabsis ofplsr

wier status .nd orDotic adjwhlnt in tudbimr inbcd li*s of sunflow
urdd nro wGi trcatnents- Pldt s.t. 172:773-187.
Kidlmbi, s.l-, A.G. Msbh.s dd T.P. Bolg.r. 1990. Mineral mncntralion in alfalfa od
nin foin d infEnc.d by eil doi{w lel. Agbn. J. 82: 229-216.

Kii, D.W.,dd H.R ByD 2m9. hnue Fttatr of Asia drougl ud.r globol vhing
$€@io.'Il'@r. Appl. CliNbl. 98: l3?n50.
King, S.w-, R.A. vicvlins dd H.T. Nsurq. 199. Cheg6 in mRNA sp@i€s duing

dswht st cs in winte. Nteol. Crcp Sci. 32: 822{25.

Kidlwi, F., A.K. Fit2, C.LB. Cu€diq B.S, Oill, G.M. Pad*n.nd M.V. Girlcl.2004.
Id.rtryi.s qwtitalive tai ldi (Q'I!) lior d$ughr iolcme ir b@d vlpr
(TritiM @stiw L.). V QTL id. ificlrioL In: "Pe. Ro.kefelq Foudlrion
Vorkshop" May 24.28, 2004 ar CIMMYI, M€xi@,
Kls, A.E., LA.M- Ddldi od A- Carorc3. 1990'ft. salicylic &'d signdl in pldt!. Plei
Mol- Biol. 26: 1439-1458-
Koiwi, r! L Nabni|mi, M. So, v. Mitoh^di, T. Toyo@u d T. K6tih4 2004.
Tisspccifc lddiztior of e ab!.isic &id biosynth.dc .nzlme, AAO3, in
Anbidop3b. Pldl Phrsiol. 134: 1697J707.
Kopla J., A. Fmjc ed
welwqih. W. 2004. MetaboliL pofilinS in pl6!t biology:
rhtfom &d d.sd'dim. G@@ BioL 5i 109125
Kol@, V., S. M.lysh.v, A. Votlolov lrd A. Boj@. 2001, A g@ric 6a! of rtr
(S.@/r csr.a/, L.) ombinilg RFLP, i$zrBe, p.oLin, dicrcs.tellite dd gen
l@i. Th@r. Appl. G€net. 102: 709-71?.

1@
KEnd, P.J. 1980 Dtuugh ttes &d ongin of adaPtttions ln Tum6' NC ed PJ

Kt!@ (€& ) 'Adaptatior of pL.ls ro wl.r ald lempcduE stBJ' John wilcv

ed Nd Yo&
SoG,

XJicg D, & sd R B, ttrtD&h... lg83 Photosvnthdic raL dLol in el8hu:

Sto@t l and fa.i.t! Cftp S'i ?l2:?89'796-

no6rob.tal
in n@ bv
KrislBta G.L .!d K.S Mutv 1979. ADelioEriotr of deudt idurv
chdicd senY. Cu. Sci. 4E: 264'265.
KulshEh!4 S,, D.P Mishn ed R.K. C!pi! l9E7 cheg*
in @n1dc ofcldorcphvll'
rt
prteis .nd liPids in vnoL cl oftpllsts ud chl@Pbn odbonc filctios
{tff.Fnr letf v .r Pohdd in dDu€hl Gitlnl ed esirive 8@rvD6 ot

wher Ph.bsYnlhdro 2l: 55J0'

KuFe, A. ltd D P. sinS! t99s Ue of phvsiological
indr'6 a! a $rdirs itchniqle

foi deueht toldalce h oil$ed ,'dric4 Speies Ann- Bot 8li411-420'

Kuru, R., R VduPns.d dd G Gddic eal)tis ofanfed lowlsdd nce
N Atlin 2007'
lndi': Hditahilitv
drcudl loLrucc udd nitually'a'Min8 sn's '!st'm
in

4d QTL eff.cts. !i.ld CroF I(6 l0l:42J2

D'tiv' ESctaiion lr Tllffi'
Kllro@, o.r. 1980 Adalttiim of r&G vtt't sElsscd
'n
srEse" John wil'v ed Sos N's
Yo*:
N C. utd ? J Kiser
('ds ) "Adtpiation

Ku.od!, M., T O@! ed tt loagtm lggo Chdges in cblorepld !€roxidd$

leaf sce'nmts Phvsiol Plot' E0:
&tiviti6 in Elation to cl oophvll los iI bdl€v
55!560
l Elilieus!
FujitrE!' 2005 Thc of so$1n Dd lursd u
Kulsla M., A G.lrlsia
p@l Ei[.t (P.D'ittr@ S{d!'d (L) IEk')
dndls wilh diff'dl @t
3t!6i' Phnt sci l68:l'14
strEt B dtd o3tncFg tli@ u!d'r drought
1995 Sl|md swival of lqvdina
rypyo;*i",,r-, V. ra,opout* ald Y Metas
""''
,"?da L Labiata) udd Mcdit !n@
6eld
*ur**u .-o t"t"lt '
d'mase through d€'Gdd chlorcphvu
coditioGr .void4c of Pholoinbibilorv
@ntcnts. J Ex! Boi 46: lE2tlE3l
 Ladjal, M., D. EFu dd M D!d!v. Ef.ds of d$uent Fdndnidos on
2000
th@otol.@c. of photosysh Il ,!d wptibilitv of plotosvn@ to hd sn's
in cedet secdlins!. Tree Phvsiot 20: l2l5n24l
qat'r d€fici1i! 4
Lafitle. H.L, A.H. Prie &d B courlois 2004. Yield rspoGt to
Upldd ri* mf'ping poPlalidr .isi.lios mong trais tnd g@tic @!tc6-
F 'rhd- Gm.t 109: 1234246
Appl,
r4.t!@8, U" H. Ellcgm ed L Aldc|ss. 1991. Tle lbunde@ of veioB
polymoahrc nicFs.r.llne nolifs difr.6 b.t@n pl.nts sd ltnebnles N@leic
AcidsR$.2l: llll_ll15
Ltgdaff, J.V., G. Oglld &d H.E. Eiglc. 1961. codrol of osotic p6sw of cultuF

$ludoB *ith Poly.thyl@ sltol Sci. ll3: 1486

!dt6, Es- 1989. DNA finsprpriDiilg o! irisl Ndft 339: 501'505.
!dd6, E.S. ed D. Bolst iL 1989. Mapping Madelid f&l('is urdcrlvils q@titariw
tiiis uios RFLP linla8p maps. GenctiG l2l: 185-99
Ldter. E.s.. P, OE6. J. Ab6!@on, A Bulow, MJ Dalv, SE Lincoln dd L
N.*htrg. 198?, M4o"ker s inidedvc @Dputer Ptogm for @sltu'tin8
gercric |ilflgc Daps of dFiNld lid Bnral po! latiols Cdomie 1: l7l_

181.

Le8ridge, P.K. ed Chdnft. 2004 Ti. Prirciplq ld€ntification itd applicaion of

mol4uld nlrl@B In: r,ra H dd c W@ (€d! ) "Biol4bnolosv in

AericulluF.nd Fo6try" S!!itgd, Bdlia C€|]@v 55:3-22
brchd, w. 2001. Physiolosic.l PL.l Ecolory' SFingd Vcd.& Bdlia G.|]m!: 505.
Lehd, w. 1995. Pl&l udq srrs, li: Pl$iologicd Pldt Ecolory, SpriDg.FvdlaS'

Laui.. D.A., J.W, Sn pe ed M.D. Calc. 1992 DNA bdker techniqes for gen tic
a$lrsir in bdlcy. Inr Sh.v!y, PR (ed) "Bdlcv goetics' bi@hdistv'
noleul.l biolos sld biolclmlogy-Biot .bmlo$/ in AgicditE" Wallinsfod,
tlK 5: I15n32,
Lawlof, D.v. 1995, Photostlth€sili prodNtivity &d svitomdt, L Exp Bot 46: 1449_

1461.

152
 tcais lnN Sdimtr(cd)
bwlorD.W.l995b Th. Gf*ts ofwtcr d.fcit on Pholosv
EnvituM.nl &d plant @labolisn fldibilrtv ed @lination
Oxford: Bios

scidrfi c Publishcar 129160

dhon sinil'don and
Lawlor, D.W. aad G. Conic 2002 Limiolior lo Pholostdhdt
arsid.d Notdis in clalion to sta d'ficirs i! ti8!6 pl&te Plut ceu
E^itu.251?75'295
L€id,, E.O., M LnP.z ttd J C Gri.l@ 1993 Sodhins lnr iol.dc' ro slt sE* in
@fion genolvpet: Pholosy hcek, slomalll @ uct.n€ ond fspiDtion'
Photos,4th.tica 28: 383'390-

t idi, EO., M. SilbdbGh MjM S@vd and SH Up6 l92 S'linitv tnd oitrogd
5: 591'604'
nutrili@ o. Frnm ald @tro! plets J' Plrnt NuE |
m@btu6
L@pto4A.C.mdRP Willine.lgSl Evid@ of bnciv 'fl@ls
of stlr on

h: SapLs, R.C. lnd G.n TocDnid€n (G& ) '"lant imprcvalcnt for iftisal.d

@p poduction unld ituEdirg ssline conditioN" John Wil€v

& SoN' Nw

Irpli@, O. . t. Buitidc 2010. Dcsielio! blateq Fbm s'noEics b rbe field

PLlt S.i.2: !'ll.

L4tire. O, N M. Ai!.non, & Deltou' alil GA F' Hendrv l94 Th' invol@t of

dpi61ion in frEc radictl Fo@sst! duinS loss 6f ddia'rron

rolde€ in
gmidling Zd rurr L rhl Phvsiol l04:13331119-
rivitrq t. 19?2. Rcspo.s.s of pLdrs to s!€s Acadmic ?rcs: Nd
'trvi'oMenial

1980. R.sPo!$6 of pldts to ovirctE ntal stts 2d G{t Acsldic ?B'

I-edtl t.

tlne chdl' or
Lev-Yadu\ S.,A Goph* ln1|S Abbo 2000 Arch@logv
agioltuc. Sci 2ESi 1602-1603
Xrr RP sinsh Y Y QUa'dXc
Li, G-Q-, Z F. Li, W Y Y@&Y AE&ZH H''Sc
xia 2006 Molc.dd brypirg of sliiF nBt Gisitne
gd' YiCH42 in Chins
*nd cdiivq Churn@i 42 .od its dLlis tih Yr24 {d YA6 Thd APpl'
Gaet ll2: 14341440.

153
Lise; Y., Q. ch€n, Q Liu w zh&g dd R Ding 2O0S Exogpnou slion
(Si)

in bois of
incr€as6 dtioxiddt €izlm€ activitv $d rcdees lipid Percxidatio!
sh{rl!s.{t bdlev (t!,tdtM tds@ L )' J Pl6t Phtsiol t50: I15?-64'
Li.bl6, D.c.. D.S- Kling .nd D.J. R..4 19s5. ADtioxid'trl
potetio! of phspholipid
bilay.$ by q-lctoPhNl Contol ofdnoophcol srals ed liPid Frondltior
by

$eibic eid ttld glutalhioE. t. Biot Ch@ 261: l2ll4-l2ll9'

Vuard Ylc
Lii- Y-R, s€. wq SFE Ch.o'T-H Ts8' C-S Ch"! S< Kuo' H-P
Itsilg. 2011. MapPing of q@titati!. lrait l@i fot plant h'ighl ed he'ding
ddic

in tvo intcrsulsD.cifi. crscs of lie ud coDpdison ercss ortza

gos'
Boraiel Studi6 52: 1-t4-
Lin.2., D.X. Zhdg Y Ni., X Gu' C. Feng ed JM sl€*d 2005 Linkas' nep
con$ruction ant mapPins QTL for cotbn fihs qutlitv sing SRAP' SSR dd
Pldt Bled l24: l8Gl8?
RAPD,
wio
Lin6h. s., M. Datv dd E. tal6 lg2 CotsEucting Glreric MaPs
MipMkq,Etp 3 0, Whichod Ine Tab- RPt (3rd €dn) Cmbiidg€ Mss'
UK

Lit, M. dd I.A. Lutv 1989. A hPefldiablc niNtellitc dealed bv io

vitD
An
@pbf.lton ot. diiEl@t& Gpqt sibrn th' cttdilc 6EIc adotr ScB
ttu,tr Ctrt 'gr 197401.
J.
lcaf ea sd {aler us'
Liu, F. ard T H stuEcl 2o@1. Bioms ptniloning, sp'cifi€
.fhci4cy of tgetalt !l|),dth (,,,@atd8 spp) in !tspo!* to
*'tci 5lr6s
Sci. Honic- l@: 15'2?-
Liq F. snd l.H Slukl Lqf qds Elatiotu ot v'gfltble M.futh ('4'd@/ta
2002
slp ) in €spols to sil dtvitg Eu J ACron 16:137-J0
td& S.}. sxt J E. tlalgtd lgE?. Mdmds of CO'l assinillrion bv Plers il thc

ft ld .!d tbe lalodrorv. tn: conbs' D O tbl, SJ tt'g dd J M O &udo'k

'',
(.ds)'Tdhliqu.s in Bioprcducrivitv &d Photostithcsis ' 2d ed! ?qgabon
Pes, tddo!: 62'94
Lrni. C., s. Stlvi, A Parqualotu. R. Iu!'rGA A- Bl.M 2ooo lntegalid of AFLP
'nd
ndkcd into & Rfl?'b$ed dlp of dsd whe't Pldt B@d
l l9r 193-401'
Ludlow, M.A. rnd R.C. Mwhov l90 A qitic.l .\€ludion ofnlils for inFoving @P
yicld in *!t dvircMdt Adv. Agon 43:107'153.
t tinicd

Udlov. MM., AC.P. Ch!, RJ. Clddts ed RG Kaslsk. l98l' Adtpraion of

spei6 of cst rot ru ro mllr 3tts aBt J- Pldl PhFiol l0: 1l9_ll0
L@ C.. M.GM Pdtori tld S. Drisll 2004- Dousl @diols d HrOr l..@d'non'
qr.le (CAT) &tiviry &<l CAT g.tE dPrBsion i! *d'd E){P Bot 56: 4l?-
'
421.

Mr4 Q.Q., !r'. Ve& Y H U,D.Q.LiadQ zou 2006 Allaiarion o{ PlDtoidibiiion

i! drousbt_st6$d wh.d (L'td a€rdnu) bv folid-apPlied glvcinebebine J
PldtPh$,ot 163: 165'U5.

M.ggio, A aI{|R J. Jolv 1995 EfrGcts of M'tcsi' chloridc

on the Hvdduln
a Chdel-Mcdiated watd
Conduciivitv of Tomato Root Svsr€ns (Evid'n€ foi
Pathw,I. PIur Phtsiol l09 ll3l_335
Mr!.id, S. a l N Trd.j. 2005- col4 !.linitv dd drclehr 3rEs: An ovdid Arh
Biochm. BioPhYs. 444: 139-158
Mdjmdt', S" C CnGb BR Dunbtotr l99l' Activiti6 of
GlicL tld EB
c otDftyk$, ph6p!*ml pyovln qrboxvlle dd nbdos's l 5 biepboahiL
dloryls in lnc Fin tv laB of evbon duilg s'ndcn@ dd drousht'
Pbysiol. Pldt 8l : 473-180

Malik. s., M. A$iif' M TA M'liL 2009 Modlbtiotr it sros4l! sonc

sh.hb@ tnd
phtsiologicsl titribud ald fitt! qualitv in lplald
otton (Ga$)"iun l'j'rl,d

L.) due to ft.8o bt@t mutalion rat J

Bot 4l:215t_2166
of nel plolosvnthesis sd
M"If T. A, D v/dshi ald D S' Vi* l99 toh'dtarce
tr4sptatim cfroidcy ir lping wh€!i' L'"d aesrtw L" und'r drcuelt'
Plst BFed. (GeMY) I t8: 93_95'
P, C.A Jalcl R Sontlu!&ru !d R P@dBelvm
2008'
MdivaMao,
O$n@gulation snd ttliouddl ndltolis i! dought{irss'd tt€l'4rhu

4dru udcr ldldimfo! draclidec'R- Biologq l3l

4l E425

165
Mdirzntut P., C.A. LL.l, A. Kishoretu'r, B S&t!, & Son$dda'E' R
Sridhrid ald L Plmd!€lvd. 200?b. Cbng6 itr dtioxiddt m'obolis of
visn' unguiarldta L. wtlg bv Noli@D.elc undq wder deficir sns colloids
sufs6 B: Bioilt rftq 5?: 6q?4.
Mdieoa P., C.A rd@I. B Su}{, A Kis[oEkud' R so@lritrd' OM
Alae! tl}sho'@ dd & PecB'hm 2oo?d Go{$" bi@h'nical
nodific.lios and treli!. ndatolim in tttlid"'tu @@
L s itrducd bv
dsdrt str s. colloids srtfa6 B: Bioiat'rfm 59: l4I-149'
pLnrs-indudion n@lldis or
Mdo, J.2002- Eslv crcds in sviremm&l srtss in
oxidadv. sir.s. In: I@ D, Monttgc MV' cditos
Oxid'liv€ tE* in plads'
2l ?_45
Taylor anl Ft@is hbtbhqs, N'!v Yo't, USA:

Mecelis, L.f M, E. HeuvetiDr 6rd J Ooudrit'n

lga8 Modellins bioms podudior

@d yi.ld ofhoni.dtunl t cvid Sci Honi' ?4:83 Itl'

'ops: disut'* bv hMd €u
Mduund S.L l99O. Exp6ion of dt4elld!! sup"oxid'
li!6. Bioch.o J 2o6:213'219
ofstrq'detuit stits on Dhotosynbars' rB
Mania B. dd N A. Rui,-To!r* Efr@tile
timibrions" tnd o
qar'i uee !6ciercv in wb'ar
@bDo!.rls .!d @opomDt
(I",itd @rtM L ) PL!| Phtliol' 100: ?13-?39'

2010 Th' rctG of saro'n! in hMD nulriti@

U*onr'4,U z.. c'f z"-aJ c!@'
l?
Fvi*. Ad!UDv' Sapi'rti&, Alindtsrit' 3: E!r
A
lgEg traf mttr poLlcid' Elsti!'
st'r
MadqMA,JH BreMandH lcrgllen in
@Dr.!$, &d difrsivc rcsindlce s
scltding te'lDiqucs for d$ugbr Gsislln@

barLY Agron J 8l:100-105

in TrddsGen€ti6Il:482-
u"Co*rL S.ru -O nW Ooog" lgg5 QTLbapping 'ice
4E7.
Z.E. Yu, ZY- Wd& G s- Kbusb' w'R Coftne dd
M.lou.b, S R.' G. r'o'h'4
qid nlppiog of n@ chrcnoso64
'Ibbi APpr'
S.D.TanbLY l98E Mot
cdct ?6: El5'E29'

t66
Mcco@h s.R, L. T.rclm4 Y. xi! K.B. t bos, K Clsq M Valrd, B Fq R

Maghiru& Z. Li, Y. xins; Q adg,I. Ko.o, M Yuo, R lj'UstDD' R

D.CLrk. D. Scbnadcr, S CstinJtou, D. We tnd L Slcir 2002 D'vllopn@l
&.t tupling of 22'10 rew sSR ML6 fq ti@ lotw lotiwL ) DNA R6 9:
199.207.
McCu., KF. 0!d A D Hdson 1990. Dreught dd sdt toledce loeardr un'le6t'ntting
.!d applictlio!-Tro& BioLclml 8: 35E_362'

McN.il. S.D., M.L N@io, MJ. Z.iE'* tld A D H!l|s 200l Eslusd 9dr6ts
|!sr ovadprs
of choli* afll gltcie bet iE in tsg@ic toba'o Pl'ds
phoslho.lf@bnie, N'o.ihvl.rrtsf!@ Prd Ntll Acld
S'i USA
98:10001-5

MencoD, M,cLM sgheF, c Pidilo ed FN Ia 1995 AcriEted oxvgo

peduclion !d .leloxificadon in wh4t pl&rs $b'4ted
to a walet d'ficit
poerannc. l. Exp Bot 46: Il23-l130
p.ru ed Rv. K.ss.li. l99l ldlntifi@iiotr of Mks linkcd to
Mrchctioq RW. l.
69id nelhod to d'iel
dt ae |crisBs. 8eG bv bulk'd sgegrnl a!51t5i!: A
Pr@ Nad'
n *6 in sleific 8@ors l.gios usiEg *gcgari's PoFIalioB
Acad S.i 88: 9828_983E'

Mis@|, 4., J RoeLs, M Ruiz, I- Hmt'itta T' Sontlo' N Casilil! dd L Roftm'

in charv toMio
qat+ It
2006, Andoxida @ntenl drl t$ortdte erlbolid
t' Sci !6it Aglc 86:15251t5l'
rcl&io! to t€nFdturc dd et& ndittion qlt@l'
z lg? C orephvllGe acliritv in
Mi!rib;i6,N,M. Lt*'i' "od
D!'lctoviC
ad i$ dep'!d6@ @ th' nitrogen
Iftidt aetllflt L l€ava duing dtolght

iodfod .pplied Pld$ s'i- l29r l4l{'

oo niFat
drv cv'la i! c5lc3@B soil
-"_
Misd, A andc Tvld 2000 Efr'd of vcr 6!d
t\o gA3s's' /il'ottis stoloniltrzl tt@@ituL ?lan
nuficnt upi,tc of 'fiF
So1r?24:291'307'
cd tE6 totcme Tm& Plalt S'i
?:
Minl6, R- 2002. Oxiit'tire tri6s' dnioxi&or
405-410,
Minjd, R and B. ZiliGk s. 192 Mol€culd cldilg lnd cbt6't'Dzation ot a gc!'
enodilg Pe ctaoelic agrbst p@dd!$ J Biol clm 257:21802-21807
sE s indlg uPtgultdon oI
Mittova, V., M. Tal, M Volotit &d M Guy. 2002 Salt
e !ffcidt clldopL$ etioxid&l svri'6 ia tlt sslctol.fut *ild tobtro
E'c.l, LrxoP.Bl@ PeMIiiUrr ml in tbc cultivd'd 3Pei6 Phtliol Pl'!t
115:393-400
Mdvmi. P, 2011. Effe.t of w!&r d.foit !t63 @ me Phvsologicsl
tnils of siat
lTaii.m @ti@) Agric Sci R6 J l:546E
Mohar! M., S. Nair, r.S. B.trlu, U.P ?'!o ed J B'mt1 l99 MlPPing of ri@ GF_
ro bi ow' I ol gtll rndge o&olio drw
1l^'ot
g.n€ thlr @nf6 Esktance

Appl. G€nct 87: 782-788

Moll.r, L P LN! .trd A Hljlsn 200? Oeddive nodrficados !o c.lluld
compondr6 i! pl&l5 AE! Rlv Plstr! Biol 458-450

20Ol. PLnt bit@hoodtii ald oxi'l'tivc

strcs:
Mrll6, LM 'btod
imva, .nd B.t tDlis of Mctiv' oxvgd s!'ci4- Ad
Plaln Mol Biol. 52: 551-591

MottE,1., L C.sps, S{vdi' I- Kituv G GslibaedM M Llne

L. Si.bli S DuLi, E

2002. Th. .ffd3 of drelslt sln$ @

ih' phorost hctic PrlcsB of stt"t ed
v&ious h!}hars Acta Biol'
ot t btuncidlis 8@r:rFs oriSindins tord
s'loPs
Sz€.d. 46: l15-ll6
glv@b
FBsw of aq@E polv'thvl6c
Relationship
Mon"y. N,-f tCgs Osrulic
'___ 'het@ru 9l:76C?69'
nnd sigh sd vaPor PEsIut deficit PldtPhtsiol
e't of NP prodslio! in B sn'Phil TN
Monteith J.L. 197? clim.te tbe
'ffci€ncv
R S@. Londo! 28t | 277-294
l s rrechila RV Krucs and PA
Moran, JI., M Bda!'' l OMeDG'

Tejo l99a DrcoghildlB oxiddivc sL€s in p" planls Plsns l94r 146-352
in bighd Pldtr' AEu Rev Plel
f'r"rr* I V. ,SSa- O""""g''bt- erd stlq slr's
Phtliol 35:29'319'

r63
Moryr4 r.M. 2000. IffEas€si! thit vicld of{hal bv brc'dits for a @oagddion
gcn : tbti@hip lo wta $pptid aad daporadve d'Imd Aun J Agdc R6

5l:91-9?E.
Morg.t! J.M, md M,K Te 1996. ChrcnosotE! leaiion of t what osnoGs'xalon
g.ne uing RFLP dalvsis Ast 6lid J Plant Physiol 23: 803-806'
fot the &Lction of
Morysla, M ed J. vogpl. 1994, coopound Dicolatellit' PrineB
gcnclic poltDoryhismr U S. Patent ApPlicatio! No 08/326456'
H&'f.v w PowU 2002 Micm$ellis !f Prclcrntidlv NciaLed
MorydL.. M.. M
wilh mn-aFtitit DNA in pltnt gd66 Ntr Gd't
l0: 194 200

MoDt4udrv, !F, D Job.nd?J la2ml Anino &id

ehbolis I!: r!,' l-t aDd
t6?-21 I
l.F. MoFtculdrv (eds ) "Hdf Nitosd' S!i!8d' Bdlnl Gcrtuvr
Mz 200E CobPtraiiv€ rcspons of dreug'
toloan and
voussa H R lad S M. Abd'l
$ffitive naitc garotlFs 10 si4 strcss Aust ., Crp Sci l(l): Il-36
droug)tt

M A $r€t srics-induc€d chds's

Choudhwi lgS3 ltnplicalio6 of
M*qj€q S.P. and
i! /'e?d
b th. l€v.ls of €n&ic'nou &{dbic r'id dd hv'lbgd Frcxide
*.dtinss Phvsiol Phlt 58: l6Gl70
ofItNA in viro a a Foltd'6e'
Mllis,KB &d F.I.l@!t lgST Sldiic lvnthab
d.l$edtltclior Meth En4tol- 155: 335'll0-
chlin
chsgd in thd t!r' of'-
Mu@Boschc, S edL Alga! 20Ol Dougbt'irduc'<t 'tdox
.!@ftat' and rh' dit'rpcne @ndic eid in chlorepLds of laliare
lo@phqol,
in cdiosic &id @nrcntt Pl4llhFiol
l3l:l8lC25
spdi6 difldiie
Pldt asjng inftdB oxidariv€ stttss r
MuFBosche, S ud S ALgr'' 2002-

chlooptasts ?ldia 214: 605-615'

cortrcl of
n *, O. tRA JaE s tnd R-A tbE 2oo3 Oerctic
", """*", """tt"
s.diun.rctustoo in dru ehat Aue
I Asnc' Ra 54:62?-535
B, RL Aerild' c. Ksvq t LMavoEl
&dAF Hemlldcz 2002'
MuilcAEldor,
"'*-"'Cotp.*i".
rnoo of NtCl dd Polt€ihvld|c Gtvcol on
Geir'inlhot!
I Ason Cm! sci l8E: 21F24?
-O *tt* **
of Co*?4
"..**
 M tibhjli, A Asbdi, M
Nehir, M.,l- Etouafi, MA. Pagmtt , A.E Stleb, E lacono,
Azd<, H. Elzzo ed D. Bos.hct. 200l- Mo nnd [4kis€ m!, for e
indlsp.cific E@abinet inM popd.li6 of dllm \ltt.!l (Lr,.!D ru8d,t L
@ ad'). ftd. ApPl. Gdr 102: l??186.

N*@us. T.. M. Nonuta H. Moii, A.T Jlgpndrctr, dd T Ttlabe 200l A!

A Uc.L
i$zFc of b.LiE .l.tchyd. d.hydmeens. in bdlev. Plot Ccll PhFrol 42:
1088"9.
Nalini. E., s.c. Bhag$d J.*di, 2Ol0 coBlruction of g@etc li.tag. mp of
ad N.
bq.dqhrl, (Ttitiw @stiw L) uing m int dsi.lrl cos tad QTL na! for
spite rclat d E!it!. Tdtic@ Gctubje Gd€i. 5: l,
N.rrE, L. ald D.w. hwld. 2005- Phobsttlhetic PI&tFoductivitv lr Pessmkli. M
''Hd<l B@t Photo6y hdb 2d.dn. CRC PlK, Na Yo sUSAi501_524
NsvMi-la. c. Pi@im. M.F. Qu.n@i .nd C.L.M sd€ri. 1994 lntt@lluld
F.,
ndbdcs: Lii.tiG of spcrotidc Fod&lion cd cl4g6 in lhvlstoG of
N!@riotr pLDts ulotr .Lly&tdon dd chydr.ti@ Pn Rovtl Se
Ed,nbudt, UK 102: l8?-191.
NoMaK., K. Hltsi4 A Maj..4 F. I<taa S Afghs ad K Ali.2010 Fahlilv ofstlt
stcss to Pbnis: Moryhologi.d, phtsioloeicd ed bioch.hic.l sFcrs Afticd I
Biotech, 9; 5475-5480.

Nrtfd, H. &d D. GlPta 2006. Difraatirl *sitivi9 of C3 sld c4 pl' l to *d'r

d.ficit sr.s: Neiation with ond.iivc $tes ed erioxi&nts Envircn ExP
Bor,5E:locl1l.
NltlE, U, ad D.L Valia. 2003 Warlr shBs indrcld prolie ecdublio in
contlsting wh.at gemtlTes s aff.dod bv cdciM ard abscisic laid Biol PI6t'
46.n5-279.
Nt@h, M.t..Dd N. C TluF. 1993 Us of cbeDc€l.Lsicdrs and 3'n6cins a8'nts
to &t*t $tteal liB maiarai.ing slable 8ni. siz' duitg post{thBb dtonght
Fi.ldCmD6 R6 3l:155'ul
Ni@r, N., Y. Chiqle! B. Osdon, S. Sp@t, L. Anjlbd, P- Iaoy, F- L.s.ai, N. Foi!s.t,
P. Dufou, B. Met 2003. SSR nEka dd.lopn nr ton low @pv wh.!l
s€qu.ffi In: Pogn4 N-8., M. Ro|do, E.A. PogD! ard G. GaLrio (eds) "P@.
l0$ Int, wleat Gcn.t, SymC' P&!om, lialy: 1017-1019,
Niki. E H. Shina*i nd M. Mino. 1994. A iondrdisn-Ae Edicd &d biol%icd
.lefdc. Gatlni $Dppd ccnter, Tokyo, J+&
No.!or, G- ed C.H. Foyd. 1998. Aslb.L ed glurllhiorc; L€.ping activc oxvSd
wd.r co.rrDl Ann. Rcv. Plet Physiol. Pler Mol Biol 49: 249_79.
Noctor. G.. S.v. Jovddiq S. Ddsll. L. Novitslaya !!d c
g. Fov.r' 2002. Dbulltt
dd oxidatirc loa.l r 0rc levd of C3 pl&ts: ! pi.dodiMl re|. for
photoFspiration? Ad. Bot. 89, 841-850.

NoMDi H. 1998. Pbtrt *!r.r ELlioE .!d @nEol of eU .lotrgadon .t low wld
por.ntids. J. Plet Rs, 1llrl73-1E2.

Olirci M.J.. z.&d B.D. Misblq. 2000 Ttu .voludon of wseqtiv. dsi@lion
Tuba

rolct!@ ir land pldt. Phtt Ecolo$/ l5l: 85_l0O

Om!.bG, L, P, R. Eeudcm, A,C lgor &d M B€ce. 1998 Oxidatrrc ddn ee in p..
pldt! qpced lo qa16 d.ficn 6 ponAuat Pl.nt Phvsiol l 16: lzn 81.
Osa@i, M., S. Raj.M and E.B. KmPp l98? Br.cdine for noiste strded ,M
In Stil|slsv!. J.P. dd S. vqE! (cd!.) "Drougbl tolqln. in whGr @dlr'
wiley Inld Sci.n@, Ns York 15l-161.
P.rtovic- D.. Z. SsI4. K41!s.!d M Pleiq l99. A@linahdon io lobg.lem
S,

*nc. deficn in l!. tae! of ts sufl{)M hvbids: Photosvnth*i! el@iton

td$on ,!d carbon metlholim I. ExP. Bol. 50:127_138
?rgagdgiou, C.C- 6d N. Moiart 1995, Thc uNu.lv srnng 9,bili?ing cff@ts of
pbolosysi'm
slycirc beltun od dt€ siructue dd fu.li@ of ihe oxvgd_evolving
II @hold. Photosy L Re. 44: 24!52
P.rdo, J.M. 2010. Biotlchnology of $al.r atd salinity st&ss oletuc. Cr' oPin'

Bioi€hlol. 2l: l8t196.

Pa in$!. K,J. 1985. A 3iDpL ndlod for dct minitg the touda.v tavd 6islas'
'n
lefcov.tle. Plart c€ll Envio!. Ei 223.226-

171
Pssio!,!, I.B. 19s3. R@ts od dougl'r 6i!|,n4. ASnc wa&r' M@!g 71 265'280
P6siour.- J.B, 1994, Th. vield o. ftps in rlalron to drough ln: K I B@te B'mn'
I.M., TR. Situhir d{t GM. Plullcn (.ds ) '?htsioloev dd deteminations
of

mp yield" Am.d@ Socieq of Agrononv, Vilev I €dcidce, Madhor 343-

359.

P$rori. G,. P. MdliI)au ed c,H. Fotlr' l@siptioltl egdaton pEvdls

2000 Post

&c@urldon of glutal[iof r.duits Pd.in dd a.tivitv in rn' bundl' sheath

4ll of miz.. IEPlicdior on lhc silivitv of tute to lo* temFratuG Pbnt
Physjol. 122: 667475.

Pstori, G.M. ed v.S. Tnpi l99l. C63 llsislss! b€tl@ s?ter !d oxidlnv'
strs3 ir sdelt leav.s. I. Agic. Sci 12.289'294.
P.siori, G.M. dd V.S. Ttippi. 1992. Oxidltiv. strEss indws high 8t of Slo|.tio'e

rtduct!$ syDth€sb in ! drcu8trlr.sktalt mjzc strail Pl61C.U PhFiol 13:

957.961.

Paib$sul, w. 201 l. ExoepnoN ,b€chic eid cnn4q $gd a@uul.tion ir riqc (o'ia
sltih L) urdd dblslt slts
Asie J llrnt Sci. |0:212-219
P.lt2.i, D., E. DEyd ard A. Polc. 2fit. T.tFrduE d.pend.@i6 of etioxidlliE
dEyE6 in tqo @fissring.pei6 Plfi Phtsiol. Bi@hd.44: l4l'50.
P6srHi, M.199. grDd bdk of pldt dtl NP srGss MlelDelkd Inc, USA: 697
PiSr@oabi, c. ald C.g. !oy.r. 2001. APoPlstic erbate n.iabolis 4d it ole in
th. Fgulalion ofceU si$alling. C@. Opitr Plet Biol 61 379-89

Piil.io. C.. M.M. Charcs ad c.r. Richdo 200l Al€ratios in @bon &d nitogo
nciabofin indEd by waLr d.fi.it i! th€ slcms and laves ol LuPinus albB
(L.). J. Erpt Bor 52: 1063-1070.

PinlEio. H.A., r.M. Daltfilir, R. As.ddo, M. Ch$6, ME r,@no and C. Dootta

2005. Dtuught tol.trw i3 $so.i .d *ith @lirg d€Pth ed stomat l @lrol of
\t|ltt w n.bM ot Conq c@phqa Am Bot. 96: l0l'108.
PolL, A, 2001.Dilsiing lh. $p.roxidc distnuilsHerb3te p€Dxidaeslutlthione
paihMy D chlooplastr by b.taboli. modeting C@puter sinulations a t si.p
ioqards Flu Alalysb. ?ldt Physi'ol 1261445-462

t7z
PoEFU! M.I., RB. rr's, H Vitoti6, E.R. Go!c, A E<hEdo' v. RoliD, M c s&ros,
I.s.A. Con z, v.M. f@ih, EE. re6.rd L E dB. 2010 PhotosldtlBil
photoFoteotion dd etioxidol ..tivitv ofpuging nul edd &ougltt
'leficiland
@vc.y, Biolt6 .rd Bio@rg)l 34: 120?-1215-
Powr, J-F. 1990, RoL of DoistE stts i! ptdt nuttioirl firelioB' IE Baligd' V C
and RR. Dund (cd!.) "Cops 4 cDlulcd of nutd. e" Acnd€nic Pss,
Nd Ydk 4534?4.
P$!6. M.1.. .1.E. c.iG, R.C. Babu .!d H.R rrftt. 20(B ldcnlitr@lion of
physiotogi.al iraits udcrlybS culiivu ditr m* in deuglt tol@ce in dce and

xte{r J- Ago Oop Sci. 195:3046.

v. G!p.4 A. MuLhop.dlyty, N- AluugtD, Y.S. Sodhi ..d D Pdt l.
Pndbr!, AJ.,
2003. A hid.dtuity linllge Mp in ,'6daa Jrero ondiln nBtlrd) uitrg
AILP ed RFLP b!rt6. Ttor. Appl. Ca€t 105: 507-614.
PrEbdd.4 G.S. ed T. SbiE da 1987. Md!fu.ot of &ough bl€IlM in
@tude@Q@tih ehnqata L.). L Poly.thylctcglycol Lst of neasing @ll
@b.&|e sbbility- J. Craislrld Sci.3l:140-1la.
PE@tdd.a G.S. n S.rla Ic Fujit! od S. Osrlr 1992. lrrf *.rd rLrios,
osmtic adjultrcd, c.U mdbt4 strbility, Aicuticdd sd l@d dd go$ilt s
af.crcd by ircBilg w.td deEcik $re!u. J, Exp. Bot. 4l: 156!1576.
in
Pr!@h.'d4 C.S., H. S.Fla Ic Euji6 dd S.S. Osda 1990. Clll @bne
r.l.li@ a! .tr tl.d by pholphobB nutdtion ud.r si.r
stalility .!d led waLr
stB in mize Soil Sci. Pl.dNft. 36: 651{66.
Pmrlddla O.S., n Sdcora M. Krnyt dd S- Ogrrr 1989. R6!o|s of Glllire
go$tl 6t , watd Flatioc &d $luG emuLtion to i|r.gi!g ratd &ficits
in Mizc, J. Pldt lh}5iol. 135: 2t7-260.
P6&bEdr4 L Dwid ed JJ. Robcn. 195- Lsf *!r€r EladoN
G.S., T.E. D.Di.l,

aad ehG Mmul.tion in im glin erglM lic .xNbiting @fiEning

d.ouglt tol.mc.. J. Exp. Bot 45: 1833-1841.

Lt3
ftie, A. .nd D. Tomos. 1995- ti.lling gcG fc &oueht r6s1ee !@ ln
in L{tl8d

'Pl41g.nom€ lII, lbstr&ts ofth€ int dalional confd6@ on ihc $aix ofplel
g@@ tffih" t5-19 Jaa 1995 !r Se Die8o, Califonia, USA: 70
kic€. A.H.. K.A- St cle, B I. M(ft, P B Bmloudr ald L t' Cldk 2000' A codbin'd

RFLP&d ArLP Ln*lse Dtp of Vplalldn@ (Ottza tdiw L) us€d to id@iiry

QTLr fd rct pdeliatior obilitv Thlor' Appl Cen€t. 100: 49'56
Piiod. J.L., S. Qeic. M csl3e 4d DD. vid t9? Di*'ib8 @nplcr
physiolosicd tunctions tNugb ihe u!. ot molecule quanntaliv' g€ftli's' I E{p

Bo1.48:115l-1163.
a€cMulabr for crcp
Queie, S,A. 1991, Irnpli.atio6 of g€mtic difreMcs in ABA
ptuduli@ In: D.vi6, vJ. sd H.G JoB (cds) Ab6cisic *id: pbvsiolost dd
biochdistry" Biosi.nlifi c Publishd, UK: 22?-243
Q@iq S.A. ard G.G IoB lg?9 GtugTic vdiation h Ldwrq potential, sbMral

condwhcc dd absilic rcid co!@nratior in sPring slFal subjccted to anificial

drcuglt st*. Ad. Bot 44r 123-332.

Owiq S.A., M. Gull. C Calestsi .nd A SLed l94 Locoiion of gd' Egulal'ng

dmusht indu.cd aleisic &id Ptldftio! @ lh. lonS e of ch@osorc 5A or

whel, Tlteor. Appl G€rct 8q ?94-800.

Quick, J.S-, .1.A. Snonbagd, S. ChtshulL, B. Cliff64
JJ Johns'n ald F B P@i6
2001. RegisEatio! of'P6nic Red Nlelt Crcp sci 4l:1362-3

Ralnan, M., rA. M.lilq M,A. Choudl@v, M J. tqb'l &d Y zafar'

2oo4 ApPlicaion of

@don dplified polForphic DNA (RAPD) @hniq@ for th' idenlification oi

ndta [nr.d to r6li.i9 td.d@ in *iEl (ttdt @Jnw' L ) Pal J Bot
36:595602
tujld, S. 2005 Role of @lvdrion l planl bE€<lins ed biotdhmlogy in tut@ shqr
prcductior TukI l0!ll-
Agric lotdi.29:
Rljru, S. 2001. PbsFcts dd ptoiie of !6al Mins in tt' t*Btv 661@tuv'
lni Bedo. z and L Ldg (cds ) "wLat in Globol Envirc@nf'Kluw"
Acldcnc PublishcB, Dorddh! Th. N'tb'rl4'b: l0lll028'
R!F.z, M., J. Kot'cichidq B..rutE s A. A&od.! ed M. vo'jcilc 2010 Dif.'at
pan d of pbFiologicsl .rd mledq t!tDo6* to dt@gbr in 36dli.g' of oltr
.!d f..d-tyP. tdlct! (ttot&D tt rs@.). J. AsoD CroP Sci. 196: Fl9
Rlrro. EL, 2000, Pdid&c.ldyz.d oiiddi@ of6colb|rq SliEtlr.I, spocto!.oPic
.nd b.ctnisic coftlatioo! i! tlcott L FroxidrE. Sutx.U. Bio.lE.35: 3U'
49.

R 24 S.H., H.R. Alb& !d M. Alht!f, 2006 lnfl|tr of .rogcrouslv .PPlicd

,lyci'Eh.[i!. on 6.
PtoloBrdLric cg.ity of t9o dift@0v ldrgl.d qhaa
cullivc u!.16 llrl str.$. P& l. Bor 3E: 341'351.

Rlddy, R,{K, v. cblirDy! .td M viv.ttrrndlD 2fit4 Dro!€Dt-iduccd t!.pds of

pholosyltb6i5 ond eiioxidld @t|bolio in [igh.. Pl@li Plrnt Pkiol 16l:
| 1E91202.
Pcddy, Y.T.N. .!d M.M. Kl6n. 2(x)0. Efi.t of ! itlqiEll3 d so*|b' mlcr
cldiN .nd t!ft i.ld of d id seoti tdiln t. Hdi 57:125n29
R!y@ld!, M.P., A.M. Kd od Slrtic 2005. P$Ft for un|i3ins Pler' addiw
noh&i@! to in!.oE *nat |!d ots slF in dDugh' ttd 3dilitv-poE
ovirdn drr Ae A!pl. Biol. 146:23+259.
Rhod.s .nd D.Y.S.D!ru. 1994 G6.tic @tol of osmgd.lion i! Plas' b:
st gF, K (cd.) "Cclltld.Dd nol-lt|,r phvliolou of c![ mluN rgddid"
B@ toror CRC PtBs. USA 347-361.
Rhod6, D. .td H!!s A.D. 193. QuLror, .E oonim .d iarisv 3ulfotim
@Dtouds in hiSha phnB. An[ Rd. Pbat Pbvriol Phlt Mol Biol :14: 357-
3E4.

ruchld!, RA. 19E3. M{iPuldid of lc.f c dd ils cffcct od 86i! vicld in dtlsshld
wba! tulr- J. Agri. R.3- 34:23-31.

RiLhic, S.w., H.T. Nguy.o.!d A-S tiobdlv 1990. tt t eltd codt. od g,r
dchorg. Fnnct6 oftw vt .l S@o.!F diflclbg h dDl,ght blctle coP
Sci.30:105-lll.

175
Robin S,, !tS. Pllb!, R lrfitE, S celdrlg atrd s tlleca 2003.
B, Coutloi!,
Mapping osotic ldjsim.trt in e ldvt&d b&k{rcs inbrcd populttion of de.
th@i Appl. cdct 107: t2EE-1296.
Robilea M' dd l.A. Bll@. 2000. Infllrc of deught-iidEcd *Lr $r* o!
$yb.e atd spi@ch l..f scoftont "d€hydrcd@rbat€ l.rel ard !.dox sLtu
I - J. PlutSci. l6t: 271-9.
RobiMn, S.P sndc.l. Jom' 1986. A@uulation of eltci* bctaie ir chlobdai!
provid.s o.molic adiuoa€dldui4 sdt sir.$ Al|31 t. Plet Phvsiol 13:659-
56E.

Rddd. M.S,, V. Konurr K. Wendehlte J PLs..hke, M. Tin r, P. l,ov dd M\v'

Osd. l98
mitus.tcllit orp ofwhat Ocndica 149:2007-2023'
A

Rong{ur. L.L, C.U.O.P. C@, M. BauE, S. Gru& 6d S. Celr'lli- 2006 Ev'lutlio!

of chlomphyll con&ni ed llwrc!..@ pa@ctd 6 indiclios of dsughr
bl.l!@ in torl.y. Asn- Stri (Chi@) 5: 751-?5?.

Roubiv., R. S.IB8, R. t n u&dP veDarm.200? Photosldhaic gas

'xch4gc
chala.ledstics in thG dn.mt almond spei6 dwing dmud slcs 4d
$b!.qur t@vcrv. Envire.. Exp. Bor. 59: lla29'
Rctd, Kaia c C Holhook &d J.E. tlook 1995 ld@tifcltior of p@'r
K. S., C.K.
g.rcO!.s with iFps!.d drcught avoirt!ft. ftiri Pdut Sci 22: l4_l8 s
S.ali, L. dd N.M. Eolb@k 2005. taf bldEdie Adu Ra Ptot
Phvsiol Plad

Mol. Biol. 57: 361-381

S.dcehj.a S-Y. tn t Ylwi N 20(X. Ef.d *t&r &6cit sttlss on ScrDiution ad

of

{ly s.dlitrg gre*th in 3ug3r bet J Ago! cop sci l90:138_l'r4

Said, E.S. dtl D &pintll. 1982. Stltilitv whc't (u/i/E!u ddr'iwd L) indwed bv
*dd d€ficit
'n
d hi8}6 t@Fidc: losibl' Bedistio! by absisi' &id Aut J

Plalt Phytrol. 91 52q537

s!ni, H.S dd M E wcngd! 2000 RePrlductiv' dwclopd€ in rl'b frp' dring

douehs- Adv. Ag@ 6E:6e96.

r76
Saim. R.L, &d G.C.Sriv6tava 2000. Wa&r stress toLrane ot wh.d (Irni@
@rtM L) wi.tioB in hydros.d FFxi& @ul.tion ald 'nrioxi&nr
.ctivity itr tol€tu1 ed wcptibl€ g@rvp* J Agrcn Crcp Sci- 1861 63-70
S.nd. RK. C.C. Srivslav4 S AgN.l ed R C Mctrt 2005. Dff€lttB itr
diondet elivity in spoN to lalinig srle$ h tol.rui ed $!'eptible vhe5t
se@trT6. Biol. Pler 49: 8t9l
S.iM, R.K, P.S. Deshmub &d D C. Sdcna l9E Rol€ of artioxidtnt ststcns in

whal gcnotypd tol.rale 3!.s. Biol. Pldt 4l : 38?J94'

10 w.ter

SalMoto A.A. d.t N. Mudr4 2002 Ttt olc of dvcinc b.bnc in rh. potdlior of
pbnis nom siEs:cls fron tug.nic pl&rs. Plet C.ll EnvircD 25:16l'l7l'
Salib4otonbei v., M. C.le, J Philou ed M Blnt 200l G"ctrc
D. Lesloi!'

anilysk of or8@lcptic qudity in tlsh @k t tomlo l Mapping QLs for

ph)sical ! chmicd !!ii'nEi
Ar4l.Oerct 102:259.212
Salisbury, F.B. ed C.W. Ros. 200? Pl.nt Phvsiolosv Wldsworlh Plblbhi'8
Cmpdy, Calilmia USA
Srb.dl, N.H, A.M. Alqudd, J A A@Fh and c M McAn'has 2009 The etrcct of
ld.-GBirl dNught slrss o! yield @npo@!ts of fou bsrlcv cultis l'
Agon. Crcp Sci- 195: 427441
sdloo, M.M., Y. Liq S-M-d KDa Lx. dd D-w Bola 1992 lncd!€d
Hou

!h@81 stlbihq of ptor€ins ir te pRne of Mludllv ocuins osmol,les

Bio.Id. J. 3l: 527E-52E3
Sa@gs, Y. Cx, Jiag, RJ wrigtn, D. Yslir ed Ad P'tecon 2004 G"etic
di$ario! of @!on phvsiologi@l tlspoDg io did conditioB tnd iEtr inta-
rclatio$hiF uith PFdEliv'ty. Pldt C.ll Enviren 27: 261-27
saslda s. and M. Sugai t984. &esIols of tlns?iidon dd co!
'xcb4tg'
chdct ristie to 3oil moist@ stFse in fou Pldra8p sFci6' Photo6vni!'n@

lA:3442,
Sd. K. 193 Th. difeMce wirh sc'doat pinm dd pisMraLioD
.ssi.rid of sia

in Phlslus rdgeis c€n ti4 8: 552'560.

Sch..htnd, D.P. and J.Q.D. GmdSpr. 2006. Chedncd @l lo sh@l siSnalins undd
drcuC! Tr6ds Pldt S.i. l3: 281-2E7.
s.hafd, F-Q., H,P, wrng, E-E. Ken y, KL, Cu@, s-lvt M&th .nd C.R Bu.tr!.r'
2002. Cohp{ing Fcdol.ne Vit min E ed NiEic Oridc a MdboE
Aatioxidlnts. Biol. Ch.@ 3831 67118l.
Schonfeld. M.A. R.C. JohMn, B.F. Cder &d D\v Mornhinwg. l9EE water
Elations in {inter wh.at s dsugbt rcsilt.ne indtdlos CtoP Sci. 28i 52G531.
s.hBdz, ed J.A.D. Zeva.n.2001 Ch.ruleiatior of a tuvclcmteniod
S.H., x. Qin
claus. dioxys@ fiob pldis. J. Biot Chcb. 2?6: 25208-l l.
s€l@La, T., D- T@heU, E B@ ald K. Dixotr. 2000 Ac.tvl !.licvclic eid in
lrqbdopns tMiM: t\. tule of lsli.yclic &id i! lb€ .Gwulation of d.fe@-
Elatcd ta$.riPts ald ildwd rctBn@. Poc Natl Acrd Sci USA 93: 509'
5104.

Slopitn dd C. Plschon. 1984. Phtsiologicd Gpoiss of six b@ad vhct dd duM

rrllqt g.nog?.s to wor€r sEes. EnP\t1i'ca 31t 757-761
S@j, L ad T.R. Sircbn. 2002 Os@ltr. @wul.tion: @ n ralv imlEe ftp
yicld udd dousbl @idilios? Plr.r C.ll Erviml 25133}.41
Sshdi, C.L. sd F. Nawi-la. 1995. Su!floE sdtinss $bjeGd 10 ii.@i!8
w d d.ficit sLes: oxid.tire sit63.nd def6c! ndhdis Physiol Plul- 9l:
25-30.
Sh!h, N.H. dd C.M. Pauls. ddion of drcusht ed hish t ip.6t!r on
2003. Int
photosyn0Bis ed grai!_fillils of what Pler soil 257: 219'226
sbdd., A. rnd P.M. Ncl|lrlan 2ml. ExoscDor6 Mrbic did (vit Ei! C) iI).llas
6istr@ to slt slrs ald Edlrd lipid FDridariol J ExP Bol 52: 2207-
22t\.
shao. H.8., L.Y. Chq C.A. Id.sl, P. Malivqma4 R Pm€etrlvm' M A Sh&. 2009.

Und.st ding wat r deficit sti.s.induced chde.s in thc b4ic neidbolis of

higlf,r pl&B-biotahnoloeicdly {td gulllinablv inPrcving .8ricujlft dd ih'
@cnvi'lmol in did Esros of thc 8lobc. C ic RerBiotcchnol.29rl3l-l5l

173
Sbsiflou. M.R.. M.R. GbdEdba ed ?.r' Shsp 2O0S Muliplq ofmicbst'll'le
PCR

@k B in wh!!r. h: ?ogB NE, RonFo M. PosD EA G'lt'rio G (€ds ) Ptoc

l0rh Int. wEat Gdet, sldp., P.6tm, Iialv. 1050 1052
Sharn . P.C., K w€isins 1995 The
B. Huncl, P Wilter, G. Kibl' LC. GtidM &d
potcntial of dicbeLllii.s for hvbndi4tion &d Polvntu chajr Eaciion-bts'd

DNA fDsaFidbg of chi*pe (C'?, oietin L, 6td Elar'd s!d'e

Elecl$phorcsis l6: 1755-1761
sbcblb. G.C.. O.L AlEe4 H.S. Elb.ltagi ?010 Efi@ts of wios ch'bic5l as@ts for

alldi.tion of .troueht str€s in nc. pteF (OtPa rd"w L ) Not Bor Hon

Asrcborg cl!j, 38: 139-!48

999 Moldular EspoMs lo sitss
Shinozlki, K. ed K. Y@sllchi_Shjno2,ki. t
'tought
to drcugli' hcd
In: Ymaeuchi'shjraoul}j, K. (.it.) "Mol@de Eponse
@ld'

. l $h ir* in Conlolvi M8'

hi8h4 pLtl5'&G. ldG
@ {a$r
Siddioue. M,R,B., A. Hdid ed M.S Islan 20Ol Droughi
strtss
'fr41s
GlrtiN of*ndr Boi Bull. Ac!t! S'i 41:35'39'
Silv& EN., L,F.S. Sdrgio, RA Vi4gs ed J,A C Silvcin
2Ol0 1lr€ rele of orymic bd

ilo4dic slurls in tbc cmtic adjr&'ot of drc!8li{il6scd JatqP'a '@d

DldE, Envircn Exp. Bot 691 2?9_2E5

re!4t ed P C Strujl. l9l- Difrcltlc in dcv'lopF Dltl pla<icitv

Simec. 8., l.M.
md 8rc$'rh 6r. dong dreught_Bistdlt 6rd susa€Ptibl' culliv@ of dlM wh'at

(Ttricw t rgi.lud L. lt dww} Pbnl Soil t 57: 155_ 166

sinsh B. aDd K U3h4 2OO3 Sdicvclic a4id iDdwd phvsioloeicd

od bi@h'nical
gre*th IGgd- 19: l3?- l4l '
ch&gcs in th..t sdlirgs und.r *!r't st&s Pl&r
of lesdirc effcl or
Sinstl D.v. G.C. Sivsla\€ &d M Z. Abdin 200l An'lioration
6@rbic &id Biol
mrer sir.s in Cdr,a 4t8dl'rlta bv bo?ladenine edor
lbdt 44: l4l-143
or toladc to str€ss ln: ?ol'ssim in sils &d
si.ha, S.K l9?8.InflEM of PolsiM
CDp(Edsc.S SetLon) rottlh Reetth Iditute' Nd Dclhi
lndie 223-24'

Stiryca A. sd D hz!. 2010 Morc Aon bs:

plst grosrh uder linted w'ter' Cs
OPin Biotechml. 2l: 19?-203'

179
stiryq, A., D.S. Bod! T. Ob6L, D.l CIdq, H ctalvs, D.R Rvckc, M Addlltlja,
VO. Ata! V.F. B|!@g@, A.R Fcmi. rld D l@ 2010 D'wloFr@r'r dlge
speifciiy a.<t t! blc of nitochoidtiat mlrlolis in th. 6?oN of
AEbr.topsis lcaG to Fololg.d ntrld osiotic sts. Plot PhFiol l52t226'244'

sto@4 sd l.H. Del-v 2001. Sdcbing g@lic |el)6 for

8., M.P. R.ytulds
phFiologicd tlits *iih Poldli.l tu i!.r@iog vield t!: Rlvnol4e' MP' J-l
ftz-Montltctio &d A McNtb (.&.) "A$licdion of lhtsiolog} in \vlEar
B!..din8" D.F CIMMYT, Mqi.o: l?-2E

Slma I.. T. Cb!ay!, K Hdini, D. M6sdi, A Swour' dd C Abd'|Iv 2007'

ConpantiE snldv of ib. etr crs of d'lnilol &d PEG osotic sts on 3rc*1n

&d sold. {cMulalrd i!&s,@Poldac6'f@ Envirot E{p Bot 6l I lG

\7'

dd o.obolis of eorhc aid in pldts Au' Bol

Sbimfl N. 1996. The ndtiotr '
?8:651'669

2000 As&lbic &ll; n'tabolism rnd fisctioN of

a nuli-fa@ttcd
Siimofr, N
molecule cw OPin PlatlBiol 3:229J5

netoE
SniEoff,N, dd G L. W!..16.z)OO Asrnic r'id in
Dis: Biotrthd! a'd

Critic. Rd. DioclB Mol BioL 35: 291'314'

M M ChNd and E Mednno lg? Th' role oftbekic &id

seils,F.X,MJ Corci4
tnd *da alarios i! &oughl etPo's of subr@|jd clov4 J Exp' Bot 48:

l2El-8.
M R Sb!$!d' 2008'
sof.lidr A Mohdo4li. S Alsiz4 M MoS!'ddm dd
O., S
Mappbg of QTLS fot frost roLtsnce and
h4diis tiFc Nns SSR Mts n
b[€81 *bqt. 4616 t. Biotabol 9t 5Z@'5264'

Sca$ttl dsusht FspoD* orsl4r'd

Sojk!,R.E,Lfl Stolzv dd r.A riscnd lg8l
vh.arcdtivs Ason J T3i818'E'l4
lso
 pow of qpcdtMtrl d€sigs fq $e dcrcctio! of liIrlgc
Solld, M. 1976. Ot lhe
bd*!.n ndto l@i ard qMtilllis loci in cDss bdl*m inbrcd li*s 'nEor
Appl, Gcnd. 47: 35-9-
soltari, A., M. Cholipq ed E. zliiili. 2006. &ed Fwe ufdiztion aad se.dling
go$rl ofwnol s afecled hy drcught dd salinitv Envirc! Exp Bot 55r195-
200.

Son& X., X, Su!, ald T, AE& 2006. S.8llg|rion distoniotr ed itt.trQt on g.n ric

mpping in pldts Cbitw I. Agnc Biot!!.hml 3: t63159

Sralc. K,A. A-ll. Pric., EE. Shltbidbs dd ,R, Wirconbe 2006. Mslaaist d
!.lclio! to iniroel* !i@ QTLg @ftlllin8 @r !!its into e lldrd uPlodrie
vci.ty. TlEr. Appl. c€nct, Il2:20E zl
stcle. R.C.D., J.H. Tni., ed D.A. Dickcy 1997. Pitui es ard pdeduFs of

stdistio!: A biom€lric€l apploach. Mccnw'Hill, Ne{ Ydk USA-

Stcph.nen, P., O. Btt?A t. Knby, A. Colli6, K.M Dd6, C B6e md M D GaL'
1998. Fiffv lee nicl@i.llii. loci for th. *hal s@erc nap fteor' APPI Gldcr

n.4G949.
St.g, w. tur.bi., T.H. Ngutd lrd AS Hob&v l99o tsfv'r.r ml6t !!d 8&
cxchslgc pamct s of tuo qn |! g@ttTca diffdilg h dsughl llsisll@
Cop Sci,30: l05l1l.
sl.vN, R., M. Bulet, ?. Duffe, C. GaDhcry, P. B.ld€1.' C. Rothd and M Cassc 2007'

C&didat. gtus ard quetiirtirc tr.it loci aff.cting fruit d6$ic &id content in

tc tomato populatios- Plrnt Ph}!iol. 143 | t943' 1953.

Stoll,M.B,t WJ Davi4 2000 Hodn@.Icbdgd irdeed bv Ptdial rcol bn'

v€y..
&ying ofiEiS.t d gFF vim..1. Exp Bol5l:162?'34
Stub.r. C.\v. 195. Yield inpretffit sl|c.s uing Drte.f&ilitd'd QTL t'$fct
b.$€n @iz. liB ln "Pldt G.nomc lII, Aha.ls of ftc lnarndi@d
CorfcllN on th. Statu of Pbtrt Ocnom. R6€eh': 13: l5-l t J!4 1995 Se
'l
Di.go, Cdifomi4 UsA.

131
sullivll, CJ. M@heins of he.t ed drcurlt ekLse in gni! sorelu dd
1972.
bcthod of m.6@ndts hr Re, N.G.P &d L.R How (e&) Sd8Im in
tb'
wctrti* Ox&td.!d IBH Publst6 Nd D'lbi, Indi': 27-?64
SulliEll c.Y. dd.1.D. Elrir 1974. Plad pb/sologic.l cFM l(|
qart srBt Alrc
Mci@l- 14: ll3-127,
Szab.dos, L. ed A savole 2009. PoliG ! nd$nscfot'l mino &id TEnds Plml

Sci. l5:89-97.

T.i! L &d E. Z.igd- 2006- Pltd pbtsiolosv, 4d Siss Assiates llc

'ditioa
P0blbh6, S@d.d!nd, Mrsshuscts' USA'

Tiluno. S., E. Oikawa H. Kiolbiba ed T Nitho 2010 Asslnaf of gdctic divq$tv

ofaccessio$ i! B.a.sicn*e 8eftiic t€eurcd bv ft'qencv distribution &alvss

of S hlltotvFs. Tler AlPl C'4t 120: 1129-l l3E

V.. M.C. S.nguir.ti' E Chitrpqim' H Btbd'

M-B Sald BP Fct'r' RP
Tdde
Ellis, S Rhom!, W. Zolj!@!' R WNS!
utt R Tut'rcs 2004 ld'niifidli@
tpontdwum QTL aileles impoYing fi€ld
p'domlle of b&l€v
of Hodeu^
ondilioN AE Appl Biol l44:109-319
groea ud€r Finfed

T@busi, EA-, C.G. Btdoli I B'lt!m' IJ

GuidE! IL Adrs 20m. Oxid.ti!.
ddnlge to thytatoid Protei6 ir rdcr-s1tls"d
la6 of
arrr,M) PhYsiol Plet l0E: 39E_4Or'
dd H sm 2003 osotic slEss
Tsdu4 T., K Hd4 Y- Ydrugucbi' N Koizr$i
bler.!c. of tr&sgclic bb6tco eleGsrlg
t g@ dEoding 4 n@btss-LdoLd
l3l:454-462'
r.../dtik Protlinfrontob@coPbnt3 Pt$tPhtlol
,-*i*ua,t" T@l'DdSK Dld!fl' tsE? wtrq lEEs eJTes
'-'- "^O-.'CO dd nuuicnt upole or nG'
.1 r.or a-e",i-. rt* *sr€t pomtid mtslirarion
drl $vb.a Pltnt Soil' 103: l55J6E
tDrize

Te*sl.y, s D. l99l. M4Pqg polvst!6

AD( Rd Gedt 2?: 205-233-
*n" of oxid'lE d.!s indr'd bv drelehl tbougn
i*",* 2010 Alcviation
plsrs Am Eu!6i& J
looi*u". ettoIl (Ttttic'n ae'tt'\d L\
t
"t""to"u
AgnqEnvirco Sci 9: 20E 216'

132
T€nc, S., Q.Qid, D z€4, Y. Kuihire, K FujiDob, L tt@s sid
L Zhu 2004 QTL
traits i! ne (ODz
antlvsb of Laf pholxFth.lic m. atd EIarGd thv'siologicd
rallta L.). Euphttic. 135; l_7.
s.ldr Ir B![ii ad D ltis 2003 QTL for
TculaI. 8.. Nz. Wall'5 B. Pon r, M B.
r.btiv. wt r 6nt n1 in n.ld-8roM bdl'v ed Ucn sbbilitv lcrcs
M.didm.sovimmots nFi Apgl G'Et t08: lEl-188'
Ihoru tt. lggT Drought rcsis&tu in pl&ls Olvci&b'tlin' tnd sisotcuift
!..muldion i! dizc pldt. I!: Bdt, &K dd A'S Bls (€ds ) "Meb'Disths
of flvircnndtal sEess Bistte" Hsood Acldmic Publishes' The

TlDm, AR Xlo .nd R.P Shma 2005 Disringuishing I ie

C., T. MohlPlrta,
.oMd.ial whet vaieli* using RAPD bt$d DNA nnseryinis lndiu '
Biot@hnol, 5:200.206
'nDdrshos. M.F., loog Plel cold @li@tror: tezing bl.@4 8"6 ud Eguhbry

mcchdislns. Asr R.v- PLnt Pbaiol Pltti Mol' Biol

50r57l't99

Thuma B.R, B P. Chltdn' D F Cm'lo4 L M Bahnjsch 'nd C Uu 200l

N{dq A.

Idcmindd@ of c!u!.t tl!!@shiF lbotrg tiils Erd'd to <tougbl

BinlG itr
Srylorar,r.r rcabr4 Birg Q[ dslvsk tr Exp Bol 52: 203-214
ToMi, F-, C. P&io[4 M.C-D Pinto !T l LD G@ 2001' A mp'rdivc sldv of
gulEtmc 6@rbdc ndabolis duing duil8 g'mimlion of P'tB Pt*'
L

e..!s.J E D- Boi 52:1647'1654'

Tonda. A., M. Koikc, K. Mochida $d Y osih@ 2006 ssR'ba&d linkge map wifi
lw Mkas uitg s int".qccific PoFlalion of @mon *h'si Th'or' Appl'
Gcnet ll2:1042_1051
Ircbs! A,, B. D.pk! ed HAH. C4to 2002 A sP@m' rcL
fd to@phdl tDd of
pholosystlo n fiuctuF
cl€nic.l singLl oxvg@ qlmhd ir thc @int'n,'@ of
.ll|frffin[inChlMtdatuM r'r't'afdti FEBS l'tteB 516: 15tr0'
TdD6lhy, JN., J Aeg, S. Ro!i!' T-T Nglrtln @d
Ht Nervd 2000 QTIr for e[
sit€s n!@r'
m.mble liabilitv MpFd i! rie (o')z ratlv' L ) udd dreus)tl
,AoDl. G.n t 100: I 19?-1202.

183
T$ii,v, M.E K. Ali, S. ba!€atd Y. Sugrnoio. 2003 Orewih ed g3 o(chdge of
tG eaiu cultivd uldd &lught snq$ Biol- Pl&r 46: 583-587
IlJlG,LB. 19s5. Chansls in tb. phs?hdou @oc olC4prl@ M ldd
duinr wrtr slts J- Pl.nt Phyel l2l:429.
pl4ts lnl
Tu.ad, N.C, l9?9. Drcughi Gistafte and ldapt tion to rlLr d€ficiis ir cmp
MEcl. C.rt' o.t RC Slapl6 (cdr-) "Stcs phvsiologv of ioP pldts" wiLv
I enscience, Nd Yo*: 343'372.

Tmd, N-C, 1966. Adapulion to w6&i dcncirs: . chdlglng p's!'ctiv' Aust J Pldt

Physiol.l3:175-190.
populus rowds
T?,, T., w. Wssxia dd A Ari. 2000 Goctic tdEtodation ot
imploling pllnt F.fomm@ lnd drought lolctrn@ ln: Jlia
SM dd SC
Minocha (.{ts ) "Moleuld biolos/ of lsdv
p)ets" Kluwa Ac&t'rnic
hrblishd, Thc Nctldlods ll5.
t Uo!, M. ltd wR Mcrcdith 2000. Go.'ic thka' rnq ard QTL tt'alvsis of
agononic &d fib.r qudirv tails h $ ilr6lei6c Fpulation' cottoD Sci 4:
'
l5l-l?0.
s.httg 6d H SruE l 2OO8 Cop nodct besd QTL &'lvsis
a@ss
UpEner. R.. f
indedon ed flo€ing
anvirdcds tnil QTL b$'d st'!@lion of tirc lo floril
EtNi@ oLruua \bl tucol 2l:205-216'
i
plo8@itos Euphldca 119: 17-23
vallour tJ 200l. whal pr-brddils usitS Pild
V!.sbsy, RK, I crcs*, L L ' Hrbrcl' P_ Sie&c"
M PEsad N Sl€!! t Lagndgc'
A. OllM 2006' G4$c m'pPing dd BAC
a$ignnot ol
L- Alt!.hd.d aod
Ml6 show noFuifm dlslibulion of 86es in th€ bl'v
EsTndiv€tl SSR

g€nom€. ThFor' APpI G@ei l13:239'350'

Es Balvan and
Hs' Dhltied'
vssb;y, RK, M P!,!.4 r'K Ron HNK sitrgh'

*ott ,*O rd' ification of Gight cluotusnd ed a ii@latelliic

"*. qeieh in bMd tn'!l. n@r'
D,rkq otr IAS dsialed *iih QTr for enin
A@l G.net l00; 1290-1294
velilov( v.. I. Yodev ed A. Edda 2000. Oxid,lirc $'as ad sorc edonddn
sFl€6 in *i.l 6in !!!lcd b.tu pb 3 Pbtecliv. olc of do8ltbus !olvaf6'
Plel &i. 151 | 59 n6,
v.m& v.. M.J. Fouikes, AJ Woda!4 R S. Bddlev, P D'S Caligdi ed r'W Sop''
2004. Mapping q@dt tivc lait l@i fd flag l6f s€l@cn@ s a vicld

delemi@t io $tler wh.at und€r opnnal and douglt-st6&d cnv@Me s

EupM€ 135:255'263.
Vi[.8,l, D., N- APdicio, R Bl.no od C- Rovo 20Ol Bi''|s @muhdon and min
slcm €longltion of.turun $4Eat goM uldq Mcdit'@@ condilioB Am'
86r.88:617{27.
v6, P., R Hog6, M. Bl€.kd, M. Rcijd, T V.D IE, M Ho!s, A Ftijl!6' .| Po! J'
Pel6an, M Kuipd and M Z!b.d l95 AILP: n* Gohniq@ for DNA '
Alg€rpr ing Nelcic Acits R.s 23t 44074414'
mtlpin8 of
Wog, 8., V. Os, X. Zbu. X., Y. ryq N. H@g tnd T Z:hs& 2007' QTL
in Upldd cotbn J
iel.! sd yicld @npondts for eli!. hvbld ddived-Rlk
C.ner cmn6 34:3545
w&& wes, s Y Kuot SS Kst! !'d w A su 200t E lulc€d dreudl
F.Z . Q.B.

tolcfue of tturse.dc ii@ pLdts cxpEsing a pa mdg@8e supdoxtd'

disutss!. J. Plalt Physiol 162: 455-4?2.

Va!8, S., CJ. Btn 4 ald ZB Z.!s 2006 Windo* QTL Cltlosl!9hd
vdion25
Statisrical Gemtict NonI Cmli@ Statc Univsig' USA

Wdg, W., B.Vidu an l AllDan. 2003 P1&t ttspose to dloughl salioiiv ald ext'rc
tdFrEis tovdd! g.i.ric ogitdilg fdsrres roletle Phra 218: I_14'
Wdg, Y.Y.,X.Y, Su4Y Zre,FM. Kong, Y C!o'CZ Zbng" Y Y P!'L
\vU d<l

S.S.Li. 2011. EmcbGntof actmDtrf,tt€ts'n'ticmapddQTLmppingfor

fany &id conlat in gnir Pldt S.i. l8l:65'75'

wMn. M.. At 8, g. R, ed Aslni M 2006 Eflect of lalicvlic a4id applied 0soo8!

@!ne m.diu on drcu8lt tol.@@ of wh't P'k J Bot 38:l127-1136'

Vciiing L, P, winid, B Hunel lnl G' Kdl 1939 Mi@r'llit' tMt'R for

nol4uld bF€ding J- Crep lrod. I l: I 1343

186
Welctd, C., B. Bou$ug., C Bocivdi, J.M Bjb.ut &d I. T.rdi4 200? Aft eun'
,nd rinl 3tlngth,t 86!tic.Uy lhk d *dd dcfi' A
it Fdz Pldts tubj..tld lo

QTL 3rudy of ih. Espont s of lcd gtoetl &d .niheig3iltine inLtd ro wtL'

dcfi.it l. Exr. Bor 2:339-349

V.kh, J. ed M. McCLIs.d l9l. FiqetPriltinS SaFdct ui.8 PCR vilh dlitarv
Fired. NeLic A.idt R.s. | 8: ?213'E
wdd€l. t.F. C.L. Brub*d ed A.E. Pdittl 1992 Oal.tic divditv io Co$rp,@
,t ntlr dd thc odgin of UPlrnd conotl Am J Bot. 79r l29t-1310
Viud$o4 S. !trd VJ. D.vi.i 2002. alA-b.!.d chmicd 3i8ltliry: thc .oordimtion of
BDoes ro stB ENi@ 25: t95'210.
in Pb!G. PLlr C.ll

Villckor H., S. Chem!&ol, M. It!v.y, M. S.lmudM, C. t rgctdtcb' M v

Md|!Dgu!, D. htc atd V.V. C@P l9?. Cldrs. it t si* for H2O2 atrd i3
irdbF eblc for 3t .! ddco.c in C-3 phn! EMBO J. 16: 4806 4E16
Wili@, LG.K, A.R Kuhcllq K.r. ItCs ,r. RtftLLi ed S.V Tilgcv. 1990. DNA
polydorpiis .DPlifietio bt ltbitrey Fitnd utcd $ Sen ric 6{tqr
Nulcic Aci& R€. l8: 6531{535.
Ir'q K.S.,R Joi6, L. Dlt4bqsd lti P. Sobil" 1991. D.tcli@ of Eicr@Llli&
pofnoryhis, wittod cloniig. Nslcic Acid, Ra 22: 3257-3258.
Xinsl.i, r-, X. Sdg g, P. Qicuying etd S. Yi odS- 2006. Rlgi3tltion of'Jinoa 50'
vnar Ctop S.i. 46: 9E3-5.
Y&!av, o.P. 2010. Dolg!! r..ponsc of Frl Diuc. l.!d@-b.!cd poluhli@ Dd deir
@s with.lic cobpo!i16. Fidd qopt R6. I lE:51-56
Y.gi, K. 1982. A$.y for ru cliniol si8lifi.rsc b: Y.gi,
lipid p@xiilc l4cl @d i$

K (.d.)'Upid Foxids i! Biolog @d D.dicinc" N4 Yo!* Acaddic PEs:

22342.
YrdEd.. M- H. Monshitt K. Ut@, N. Sbioa.li, KY .Id K SbiFzri
Shinoal,i
2005. Efl..1s of t!. Droliic scuutdion in p.tbia ulder droughl st!s. J
ExD. Boi 56: l9?l8l

135
Yamagxchi, S., K, Koi4Ed, M, U@, .td K Shinozld 1992 Molcdd clonils
S.

@d cbdet rizjlion of 9 cDNAs f6 gec rh,r @ csloGivc b d6ic'rdon

ir
ltohidopsls thalim: S.q@ .ldvsis of @ GDNA clone $!r ceodd a
puiaiE lr&se6br.e cl|'@l Plotci[ Pldl C.ll PLvsiol 3S:217-224'
Yary, P-tl,M.E CldlqSC Had RD Bowls dd GN' SonN l9E2 Lili!8with
*t&r stts: .volu!o! of omblc sv3t6$ Sci 2l7: l2l+1222
Yeg, w.1., P. I.RichJ D.AxtU,K v C C Bonltn, G Ejd!' M v
Wood,

Mickclbln ed D RM.s 2003 Gaog?ic wiatior for slvcirc b€tajrc in

eahud. CreP sci 43r 162'169.
Ye-Yins" Q.U., MU ?inr, xL QiaYT X(!W Fng&dHZ Li&e 2008 QTL
Mpping ed coGlsiio$ betwed ldJ silr potcdi'l dd
drcuht rcsisLr'c n

de un&r ullan t atrd lovled dlirenmds Act! Ag'o! Sin 34:|98_206

Yild,z, A.L, S Daenoo. A GMI. E Ceh€ta md
A L'&G!a 2009 Dough ldsEa in
J- As'on'
o$on: involvedc of non@vbatic Ro$$3vdsilg conpounds
Crcp s.i. 195:24H53

Yi!l' )tY., P.C- StuiL, F A V FdwijL P SraD

dd U Tans 2005 QTL snaivsis &d
in tdnbiGot inbt'd lin6 o{
QrX bsscd pt diciio! of nowils AsFloS/
bsrLy. r ExP Bot 56: 95?-976

Yokoia, A.. K Tablur. ad K Asktshi 2006 V!l'i sir's- L: Re' KvM' As'
biolosv or s!'s
Ptghavcndd drt K J' R'ttdv (€ds) "Phv$olosv ed nolduld
t39
it dd$" Sp'nsa, Dodech! Th' Nethtd'nd':
I
tole c.
I. slr , T Ghmv4 A slvou€ dd c AHcllv 2ol0' Efe'ls of w|er
Yo$fi, N.,
accMulation in /dditdga
d.fi.it $r6s os Sroslb, *6Lt (lhiioN cxl osolttc
333:20l2ll
i@atrl48dM laciti4ta I'{julolios C l_ BioloSis
_- c.Q, Y. B@' C.tt Shi'
Yu. cQ a*t S- G' 2oO5 C'detic div€Gitv tnd
Dons
RAID and SSR
*Ot*- a**O"U"n of Li!'!ins q!€dv ne d'Gct'd bv
EdLd Bi@hdiol CtaEr 4l: 261270

Yu, zH., D.J M!.hill' J M BodtrE{dsD Tokl€v l9l T'sgbg 9€6 for blast

|6itmcc ir !i@ via lirktg< to RFLP nrltds

Thd A!Pt' Gdtr 8l:471'76

137
Z€id. F,A., O. M. El-Sltih, A E. M. Gbdbb.nd F. E A Ilrahin 2009' Efr@t of

.xogc@B dcorbic a€id oo wh.ar tolc&@ to salinitv strBs @ndilio6 Atab

J

l4+l?4
Bioic.tsL 12:

aw&l,H,G.Zm& A Ani, ?ehtqr!, TT. Ngov'n, J N TtiPathv' AK Sdial'

C.

S, Robin. R.C Babq B D Ngnv@' S SsrkNg A Bhi 4d

H T Nguvel

2001. Id.rrtrg gmbic cei@ lssiared wilh c@pondts of dDught

sistale in dcer compontive nappinS within ad a.Ms 3p'cics Thdr' Appl
G.et. 103: 19_29-

Ge sxl T 216& 2002. Molcculd lint'gc Ea! of slloi'tllloid @lton

Zhaag, J., W.
(Goswltn hnsutw X G6Wi@ ,4tD4d'6e L) wih a hlploid populalion
Th@r Appl. Caa 105: I 1661 174

Aas, J.X. ard M.B. Ki*bs. 1996. LiPid p.rexi&iio! in $ahlll ad $nnovr
scdlilsi 4 iff.crctt bv as.otbic eid, bdzic eid dd pmpvl gallat€ J Plant

PhYsiol. t49r'lE9493.

Zher.2.S., Y.H. Xi&, M Luo,X.8.,U,XY.Le,L.HouDM Li &dY ?Gi

2005'
in
Cotullldion of I gmelic lidage oap .!d QTr edlsis of fibc'elor'd taits
upl4d @noo (Ctr)?im htr,rd L ). Frphviio taa: 9l_99
Zhrc. C. X.. L.Y. Guo, AJ.Ch.iut! H.B. She dd H B Yane 200E ?rcsp€clivc for
lppliDS ool..uld dd 8.fttic d.ihodbtoe' to inpmv€ wbst cultivG i!
drcught ovnolEdl9 C. & Biololid l3l: 5?9-5E6

Zhon,W., Y. Li, B.C zhe, R C. Cc, Y Z Shd, C \vanS aod

z T Huag 2009' Ova'

of TTS IRG g@ ibprcv.s stlt tnd dtoudt tol'@

dD6ion i! nce .I llant
PhFiol. 165: 166G1670
Zhu, LK. 2002. Srt snd drought shes sign l tdsduciion in dels Amu Rev ll&t
Physiol. PLlt Mol. Biol. 53: 247-273

ZLa!.v, z. &d v. Yod@v. 2004 EfftcE of $il dbugh on Pholosvnlh'sk ed

chlooPhyll fluoree@ in b.6 plalt3. Bulg J ?lst Pht6iol 30:3.l8
zou w., ud z.B. Z@g 2o0E. Stdistical @lrdds for nEp?ins noltipte QTL L'
Us.t cMics 2008: l-8.
 APPENDIX-I

HOAGLAND'S SOLUTION (After EPSTEN' 1972)

t/L
N 224

IA'{O3 l0l.l0 1000 l0r.l0 6 K 2.]5

216.t6 Ca t60
(CsNor ), 4Hro 216.16 1000

115.08 1000 lls.08 62

NTLHIPOI

MgSOa.?tt?o 246.4E r000 245A9 s f2

Mg

KCI 14.55 1.864 cl t.77

6r.81 t2.5 0.171 B 0.21

H:BOr

0.169 0.1t
MtrsOrll1o 169,01 1,0

2E1.v O,2EE Z^ 0.13

ZnSOr 7l{,0 1,0

Cu 0.01
CuSor.5tlr0 249.64 0.25 0,062

0.25 0.0,10 Mo 0.05

HrMooa t6t.97

468.20 30 0.3.l ll
FeEDTA
 APPENDIX-II

List of primers used in exp€riment

CCCACCATCICTATCATrcTC TGOICCT CCA^AGTATAC6C

CTGTTCTIC]GGrc,C,cATTAA AATA^GCACACAATTC|(6^TC,G
AAIMTACCTGACT,CAGGTC,C GGrcTCACCACCAAGA-^CAC
cc^c^^IcccrcTcrT^ocAT TCCACACTIAA^TTACATCCCC
C,CATAGTCAGACAATTCf TCTO GTGAATIGTGTCTTOTATGCTICC
rcTGTAGGCTCTCTCCOACft; accTcATCAC^TCCCACICC
cr^rr cAcGAcAcrcGGTOO GAIATGTCACC^6GCTCAC
ATTCGAC,GTTAC,C CGMGACIC GACrcGICC|(CCTATAAGACC
ACM^CAGAAAATCMMCCCG ATCC\TCCCCAIIGGACTC
caTcTTccc^cTrc^ccAtG cAfi ACTCAAATCGAACACCCC
1t cATCTACCfiCCTCTCTCTC CATTATACICCICCCGAAAC
ICCTCTACAAAC AACACAC CTCGCAACTAGAGGTGTATG
CCCT@ACAAACGACATC AAACCATCCTCCATCCTCO
@caT(i@rATc c€c G ACIOTTCGGTGC^^TTTGAC
c/\cacccrccAcc^rclc GTTGACrIGATOCGGGA@
TCAOTCGCTArC,CT C^CAO AAAACTTAGTAOCCGCGT
AC,CTCIGCTICACCAOCAAG clccrcrarATATcoccTccc
AATCCCCACCCATICITCrc ACTTCCTC,CCTCTCTGATCG
TACC^^^TCCAinC{C ICACC caTATCUGGICTCCfiCCCC
ATCTAATC^^CACCT'GGTG ATCICTCAC^]{CCGGTGAGA
TGTCATCATCCITTTGATIMC,G ACACTCT rCCTGGCAAIC
cac^GcaccTrcicct, ttc c^Tcccca c^TccTcaTc
TCCACATATTICGCCTACAAC CTTGACTICAAC,C{CTCACA
rTrccrcTc,cTAcGAMcAtAc ACTCACAAATCTCIAATAAAAC
ccA-A-^aaaacrccc_TGcATc CTCTGGCATIGCTCCTTCG
CTCAGGCACICAn6AOAGA,^A CAAACTTTGACTCAGACCA,{,{
c^lrcrT[cTcrclcT C,cc cTACCATCGA^CCTGAACAAG
CATCTCCTCACCCGGAATTC TGGT GAGA GGACGGAGAC
TCACAOAGAGAGAC|GGAGGG ATCTCIACAIGTTClcCrcrc
AATCArIGGAAATCCATATGCC
CCAACCGTCCTATTAG]!ATrc CAAIGCAC,GCCCTCCTAAC
cTccrrc,cccTAAGcTrc; OAGIG ACACACCAGC,CTTC
6CIG,4nCCTI(;Tft;CTACCrc
GCTTCCACTACCTACACTATCAIAC cIATtTTcMTTCT6TCCCACC,G
Trc^ArICAOTCTTGCCTTGC CI6CACJGN'LLAAr\AGTACACCC
OATCGAGTGAICT]GAGAT@ ICTCAAIIACTIGGACGTGO
AOTOOATCCAC ACGCTCIC ACAAGAAtrA-A CCCTTCCC
Acal]'rcTcccccaTccTc TTGTAAACAAATCCCATCC'G
TC,C CTGGTIACATGlTrcC crTnctTTcAoalrcac,cc
ACCACTGCAGAGAICACATACO GTC,CTCICTICTAAGTGTCT,G
CT,GTTCETAICTC,GI^r{ATCCC C^CACACATGTICCTGCCAC
AAGTTGAGTTGATCCGGCAG CCATGACCAGCATCCACIC
TCTTCIGCATCATTCCATTATCTrc CCTTCCT6ATCAACCfi ATTIAGG
TCATTGGIMIGAGOAOAOA C^^CCAITCATGTGCATCrc
TGATGTAGTGAGCCCATACCC TTGCACACAGCCAAATAACG

190
 ffi. rm...^^c^c Ei-^crcac^rcrcc^Tc
crc caccclc,GTTc^ .A 4! CC,CCTCIAGCCAC^C,CTArc
ACAMTACCC^4ACCCACCC
ft-ocAac^6ccc^IccM!
CT€TIOCTC^GCTATC4SIq GTGCCACGTCGTACCEQ
IcAcrarrcrrrccccf4
Gfrcrcr
C1TICTGCACCICTCTCIC!
^lcncceIq!
flrcrrcArtarrrc,c!!
cGACc,cAGMcrrM,{c AC
TTGi CCC,GMCGACT c^! it;6fr ii-rcaccarcr!
-T^cc^cc^c^crrctlGelirc
c^rrcrcMAraArq!44!4
d-cc-raarc^cAc,cMGcAe
CGACCCCGTTCACTTCAC
fl^cAGa^Aoccrcle4lll
^CICGCCGNGTATAGT(TC
ftAdfrA^cl'rcrrcAsa!4
TCCCTG6CICGTTCTATCTC cr^ccfr^GcAcraTl!!!!
q ccac^ AcaaATATCCAe
ACG.TCCCAGTCCACAAC
ffiA^ocMlccAcc
^
c r^^^rcrlq4I!e4 _qg+:g++#
-^^cacrMcrCTeS!q4149!9

c^cac^.^cccAccAfic4
-^
c,c
^rcTrrrracTcAcc4fq
CAACTGGTTGCTACACMA!4
cAcATcrrrE!
GCC-CTTGCACAAATC
-^c/\crcc^rc,crcccaco
-aaAM
GACAAACATG(€GMCMC^
ATCTC,G^TCTCGC^Cle
cr,oArarcrarrccArcEl!
ccMcaccArcfrcMarq
-^TGc^c^TAaficrcrccc
-crccc^rl.rncl9!4M4!9
cocacrTAc^GGACOII
cTcGccrrAc-racrc^rf!
c,ca-rac^ro^aMT^c444!19
a^cr^cAcarl@!q!eIg!
ffi l-c,crcc,{AGTc^c114!g

;ffi. ^Gcrccr^clE999!94
-rmcarrcccrAccl4!!9
i@
|aa^^^
!reg#4!s
^c^crrclqrcc
-lg4lil!!4++=
-r4
i;-crcrcrrc^c^rrccf!!9
*4:*:::##::
__!!s:+iffi
c,c^d-r^^a!c194{Iq
ffi
:::t+:+:+:=+#
I-TccrccctATrrrccA TG
Gcccleeq!9g
-arrcAAccrAcc^4Tcrcra
^cr^cTT
+#ffi
Arcf r^ccAracMa!!4!ll+g
rlQqc
]]r;trj:::s::#.
-^^c,c^cAcccie44qig
-,.a.,..,4.^mGr^caTTT
t91
-c,c^fi
-o^aa^cr^^c^cac
 sltr rcACGTGGAAOACGA!L
ffiffi
qlw
+;ffi ffi ffi
T^TC;CCGMTTTCTCC !44

-crMc^rccMc^aa^ql4!!

#ffi
-ri7;ffirrac^rTTcTc

r2
lr^cc r
ffitre
r

-MT^G^acccrcc!4!:I@
\TTCAA(^@4!!4u ll.N
r o@j!41444=
ffi
r.ffi,crc^TATrc
#ffi ^^

ffi ;;ffi.FliffiCCACATTG
ffiid^crcroccrc
lr3
:*ffiffi -..^
ffipi+=

ffi
l19 \rMs 55e -M.r.c^a,cc-racTAcr
cTGCqr r( | q!!trg]t r.:r.j
GATCAG T
(M1!44r44r.:{
-^^..-MAc^c^rrclcA
-...rr,.,r.,i^cTAccca
itT-vMs 665

123 xsf,l rP
XPngA
xFmlcD
-tsmre?L
1ll
tsmD:?L
D]
xsnlr:l!
xsnlT ?L
xc*na6E ss+Ht-rrcaccrccaf roAGGltcr

ffi
iitlx!".s5!Q scAl!l!:l+A:::::;-i- lc-,rrc^c!!4!ss4! !!
rar I xPi'rcl4
x*!m63j!

xFnroqil!-
x*6ro!l!
xFr'
'!lq-
Xsmll2.]B 192
 AcAAAcAc^^aArcAn !9q!9
ATGGAOAT TTT(jrd!4!44!
CG^ca€4!49

TTcAirrcAGrcflcrrlrlc
sgtgP:*+:
.#
-TGGric^CA
-c^Tcrcarc^cccc,a44Ia:
-ccAAccarccraI4Qlq4@
AGACTGTTCTTTCSn !i!

-cc^A,\IMAcrccc'rcclE
dflc,C1trAcrcrtcrl!
ccA-cccccrrc^eEq4!
r++*+#+#
!!+!!!!+::+=
g*+#+:+:r
.-rtrtr^.^.macccrc
^cMT^ararcc4lg
-TGcATcAAcAATAcrctco4
-AG^c-Icrrafucace !]!41l14:YI.]#;
e^-^ Tccarccaa^-^rlq llg++l+;j#
ACAGTGCATCG rIe4!!
GCCCCCTTCCACA-ATl i!ffi
9(=!ffi
-rac^rc 4*,1=-iE+:::#;-
-c^cA$c^Tcccc^^cMcA
-rcc-rcarcrcaccrlllli
-^^c^rcctcc^ccc^ce
trri4?Bl-^^cmccA,{/.c'tcn!194
+1*+#
4l-94Y}*jif***;
f*tu];ATi_ccc,rc,aMocc"aa
-Tcc-rcl-rrcc,ccMr^I4I99
ffirr.rB TacIrqI4!9!@9
!1+!l]#*+:
+++::1*-ei+#
ffi r-rtlle4sq9944!4gg!! l=1r+l+##;ii;
4+e#
ffi
r?3 ' dEm-rcrrrrmcra^ce!@
;ffi^TccAc^Tcrrc'rl@
6,r6erA Tcr!e4@94Iq4I9
c-r i ar^rrcl
r3l
crcccc
A^T GAG41|J64!llq!!
c,aAi@ ffi
ffi
^^c
flcarMcccccrcc^AT eiii:##Haffi
-6crr1Ac^ rc4qq
--Arc^rcrcc^rc-rccf
ffi
-crcacArAAcccccreq44l

-^r^ccc^^crcrccq4q!!! -crccacr^cccqqq!
cc^ccc^cca^c,GAm
ffi l]]#ffia
195

201
flcccr
ffi
rc^rclelq

cr6A GAc^^c@
-cAAc-rcacrocrcAcaq4!!9

-cr
^lTT

-cccrarcrcrcccccr!444
-GT^mcaAG^cAAGaq!4E
-AcrcAccATcAccAA
ffi
@S*sl++gF
frftIcMaMGGccr!4e4
^c^Accmrc^!!4
..c-^rrc^E!44^I
flccrrr^c arc!@
-c^c
l c-cAcATMcarcc^AcAAA
-^
ffiecArcccAr^M4I
I-rca^c,c^cc^carq44!q]
T-^r^r^crrcarAlciqqgg
afficccAcctAcncrcr
^$-TTGTcrorccc!!9
-^rrcrorcrolqlQg
c^._rCn{,cccq!4q449
fr6-ar^rrMAIqqq4I!4g
rcluqqg!
a^rc-rA
^
cflc1orcccarcorc
Trecra^cror@
ffi^c'rcr^!@11!
ffi-ccarrclq4g
cr-crc1ctA11$qrylq
f,-cccco^944qt!!I!
6-cacccAc4IgIg94!!
-a^c,€rclqlc6c"rAAcA
aF-^ccc^c^f!qgl{g
rc^-rcc^rcc1!{!-^rAu
clccc^ccsc
d--TAcATc
arc'i-crraAc4€4lcrrcrrc
-cr-acaccA!14!!IqiE9
c_-rcerrrrealg9ql!4
fi--^cr^ccaccca4!4sgg
c^tuffi4^cMc44!g
c^flc ac I9!ll!!
a66t---rad^
-^Garcoqc
ccc--Ac'raclqgEqgg4
A--Acd^cr;6cc449
^G--c^AcoQ49!4994
-^
6i6f@rq499
aa--crcc
!q4g 4s4$84!
ifecrccrrcc_ssa9scq
i;--cr^rc'r^!489!!4
^-=-rcrc^rcc$jSqgry
Effi=-^rrccarqlqlg44g
rc=.'.-=-^c,c^rcqccr.@99!]!
a-Trr,cac,c!qr-Tc,cc4
^ia-rcA^rqqcAl4
flrcccrctqglqtry
Gnc_-Aqeirq!!!I4g-!
-ccrc^cc^rcc^ccMq9
flrcc,.cccr'ccrcc^9!99
_rnc4!4Eg
iiA-Accrq49!9!!!9
-cc^A^rq44g!q!!94
c^-TrcroTcTcr^ cacAc
ffi-Trnc^c4444!49
-AcccrccracATccar
rrc-a^ArArcrG!!!4tI^!
daa-^cccrraale4Atll4l
-TGa€TAccrcAcaccca-A
florrcc"rccc44!qE!q
AfrmaA,{c!444]l!I9
cA-TcccrcrccccrAcMcc
flccrccrAq4q99
a-c^rc,c^r'I4!!!t9!49
f,rArc^ccrA-^^carcr
-rccc'rfl;c!!!4944q!
afficrMca@!!94
alrc,cc-n^c4!1lgl4!
i:l-ccc-rrAcceIq4g
-rrr-rarrrcAccrara<c
rA-rAcccr'rrr!M@!
c^-rcrcccelqglg
ca-TcccccccTlrrcrc
ca-rcAA^c9e44g]!q44
rcfficlq1gqgg
-rGcccccqlqg
tu_-crcc-rccrqqglge
i-cccocrrcrjlqIgg44q
;i-ccrc4rq!44194
ce=_rcrrcrccrccrcccf,lJ
a;-cccrccc^cl4!!4!4
ai6-c^rcAcc cacarAtcr
-cc^cArqq4l!4!E!
-rrcrccr6!s4@
ffi--ccaTarcc4acAr^r!
li-Ar!qq]!4tg!gg
flo,,'o,rlw9E!4
ffi-^rccc4c]@q499
Ac-acAcAe!qgq4!494:
6--^rcccra!!qrg!@4lq
iitu-r^calco_raq
-AcM!144949!9!9
c==---rMn!-q49!ry9
ii-_-cccrrl!444!19ry
i-MccuqE!Icqg
aGi.----cAArqi4t-499l449
i6=--crccrGlcjlqq4E
i:-^c^ccat-:ccrqalT4
ffia-@
-^ccr^c1!ry,@449
-ac,acAorc^crcc!41!c
A=--cGisJ{ffiryry
i;i---crc^n@4rqr9lr!!q
-c,crce!(^49994
-cAcc44!@
 c,cccccrcccaTccmcrle

cTccGAcMrc((cr!!4
-c,crccrcrrc,crr^caEqq
ccccTc,\arM r Murlillr
ffi
aft;-ArcAccc^Mrrcc
-rrdr^.6.^cacc^c a._rc
acrc-Ac-rc^Aa@4q
-rc,crcrccr^ccaaac!I!!
cacaccArc^c^@crlq4g
tEaa6iE;cArcrccrr!@ TCIG'CTACCTCCAfiCCI!
CCTCGCTCATCTTCl'TGCC
GAr"mTAmMCrr^ r!!! -c^rcrcficr,Gc^@4q
alorloclcG^( uu!!
^t
ccacccccATcca r(q I Lli 4#
iccrccccc^rclec44glg
tll AGTCfiA(! r6adrqil4
-rl,Ti..^cca'I^c-rcAG
r| CACC'AqE
ACTTCATTC
mcc^ccc^cr-rccrclIqg
G
+t*+::+;;#
cccAcGAGTACAACac\4!! ffi
#:*
-M.f,.^Grc^^cT ffiffi
:+t*:+;#

ffi
ffic^arrccA,rallq4
)32 ffi6 lAc{ccc^^cr^cc^rre
ffi t-TArc-c!44s!4IrlI
-Trcccncrrccrcrle!9
S4Ie4
=::ji-;;#:i+;#
flcd^cMcl^rccc^
#tr#ffi
ir-TcArccc-rc-rc6l!

ffi
aa-cArcccrc!4@l!

ffi
!33

cc^-Trcccc cccac^^9g
-rrcccrccA,lCArcc44!!

ffi
oat!!

ffi
TT@ACCACMC

302

ffi
TCAGGCTCTTE('^^@^L
195
 TG GA GGACACCTGGCTCGA GrcAGC^CCTGICTCCAGATC
CAAGACAACATCCCT6CATC accccAcAAcrAccATATcc
rmccrcc^ TTcAcrcTAGT GTCTCATCCCICTGGICGAT
CTTGGCACCCCCACTGCTTG ACIACCATATCTC|cAGACGC
!{ cr^ccar Tccocacccc
CCICACATCCCTCGAAGGAG CACACCAIAGCGCATGCAAC
GT@AAOTCrcCAAGCCAI@ CACACAC|CC CTCAGCCTGTC
CAGC CCICCACTGCCC^CC CTTGGTCCTC,GACCACTCAC
GTTGAC TACTf,(aACrACr; C,CAAACCIC,CGTCATTCrcIG
ACACCAATCACCTOATCGCC ACAGATIC CTCAACACCrcC
ccAT rcccracrccc lrcc CCATATCCGCAGCCGCA.ACAC
ll7 GACAACTGCCACATACTCACC TAACACCTCATCCCTCCACC
ATCCACAACTCC^^CCACAC cr@caTA@TccTcAcAAc
ACIACCA-TATTC{CACrcCAC nccATocccT tclrcrccrc
cT GC,C,CACC^TCAACCAT T'ICCATTC,CT^TGTTCTC
GACC,CAACCATTTCCATCAC CTOCAATACAACATCC{TCC
C,cGCACAATGTCAAGAGG IA CTC,GTCCTC]CAACACAC
ATCCACATCGTGCTACACCC CTOTCACTGO6CIACACICC
ccTc^c^c,GlcrcTcrl cAT CICrcT(,cTCACCTTtrJGT@
CCATCAGTCTCCCO CTGCTG lCAATCCTTCArcAAACCCA
GACIGAGC CCTICCAGA CA-AACTGGACCATCrcAGCTA
cATcA C,GTCM6AOCAGC CMTGCOMCCAAAAACCAC
CACGTAGC TCCAGCAGITT TCCTGTTCTTCfiCTTI-TCC
cco1c cAAr rcA cclc^ ACCATTCCAGTCAOrcCCT
Aeqcccccrcrccrcrccrc CCCATCJGTGCICCICCTTCC
.Dl QC^GACGC,GCTCAG6CATTC C GTTCTTCACCIICTCCACC
!32 ACCAAGCTCTCCTCAC CICI cccclcl crTrc,GAGATGA
cGT CIGCCTCAG^TCCCC ACATAA TC,C CACCCATAGI
GACCACTCCGCICAGAAATC CCTCCATTCGTCACAAGTT
TACrcGGATACTICCCrcTACG qTTC'TGCCCGATGTCCT^GT
MCCCTCACTAGOCTCTCCC gacTcrccAoAcAAcGcTo
cT CT,GGTCCTCC,Cft;CT A cacAccccTccacccA-Accc
4lqlcqrcrccrrcarcccr CACAAG TTTITItrTTCCCCCT
ATGC,CGAACACGAC,CA]{CT^
^CTACCCGACACAAGCCACT
fqrrccccTccl-rcToTcA Iq44rccrccrc^cTcacrTo
/TTG^AGATCCCC CTCACCT TCATGATGCTCCTACCCTT
ccTGcAGATAGC^CA^ ccclAo^c c ca^nccc
44l4lq:ancTc6^accc^o CGCT,CGTAC^66TAC^CAC
GTCGAC^GA-AACACCAGC,GA q@AaqcccrTcAAAncMc
9{CTCACCAC^C,CAGA rc cGACCTCCCCI_t(TrCTrcT
f \ccc,ccGTAcac,cTAcAGAc CCATGAGGAGCAC^ACIGCA
cc clcc^c^clcTrcrccc ACATACGACTCCA.ATTGIclc
CCACACCGCCACTGATAGTG ACAOCTCCAGGAGATCJC^@
CC^CAG^GCCCITAG GACIC,CrcTCCCTCICCT@
^@A
lcicACICIGGTCATCICCT ATACTGGAGIGAAGC]CACC,C
caATccTc'rfc^Tclccclc c GclccTccl-tccacaTrc
ACCTCAATTGGTTCTCTCC,c CGTGTCGTAOTACCCCACCI
ccACT,CGATCATCAO,LACTcAG
444CGACC^ arcMcc^Ca
TAACCCIAGCGACACCTCCA
4CCTCC,OACTCGACOATCT
CJCC'GTGTAT(IGICTC,CGCACTT IACr(.1-IC(ACC,6CCICGT^
TCCATCACTACA^CCACCCA
IqI:cAOCTCCTccATCAT
GAAICCGCICTCCCTA ICC TTTATGACC,A OCTC,CTCAC
153 CGTCTCC CfiCACTTT CCAT
TC,GrcTAICCTGATTCCIGC
AC .ITAACCrCACCCA^CCA
cr caccccc^caaM@4Q
_6Mcoccc^c^
c^c^r!4l
d6ca cac^r6c^c^crc44
Tr-cTcrcccac"rca&!Iq
-crcaarcGAfrcc-cAo^A
AT@
ccr^c^TcTtc
^Gc^gqq4
CACCTCGTG^^CTTCTCATT
CAACCCG16ACATTACC,CAI
frdfrccAca^cAorcq@
Effia^rarAcral!@
cffsc^c,cacl^ caGCA
FE cA,lcacrccraalee
TICAlTGCCAACCCT^C4Iq

ccccTAcrccAGq^(^
_acrcc^a^c!c4!I44!!
-^TctccicccAcMA
I r:

ffi
^o6c^cAc^roTccAlqlqf

4:+#

ffi
AcrcCc,crAcarccAc^Aqq
c^rrc^^Tcn-^cQq ! Iti#i*;ii#iiffi
G^ffi4^rcccrce4I
ffi
-Arc
rc c{cr4!tq[g
rcc^ccaqlc!119,, ^- _ffil i-rrd.Tccrctccc-rc
|

ATGfi6(-AGAuA4 ^ ' 'ru

A

330
-rrcc
9E$t#i:^.ffi mffi

ffi
Ifi cccarc^M(!M!44!:j!1 i-rYTffi.tuaccc16,cAO
TGAAGAAG rrn4!!4!!l m-.,.m.,^cc^OTcCAI
d-.f,,fra^c ctcAcAAA

ffi
;#ni'wcffic^c-
;i-r., rrcaal
cc^ cT

139

rffi ffi
ffi
ffi ffi
^fr 4l'='+'=",'lf ii:++---]_-rr€rrccncfl
cAlcccrA

ffi
ffi
!!!Hi;+;
rA!'':!ll::-!+e!::-

G2rr
koirll t97
 GCAGAOC C ACAACCAAAAC car olcc^oc^Gccfl4!
CAT,AAC^^CCACCCCAACAI

C^aaGGMGAGc,ccc4qf! crc@ccAAc'Eqlqq4
TCITCCCTaC^OTTTCq4I c,c{cfc^c{e!ql4!44!{
aMcccl44Q -crAorcaoccMcflcrcc^
TcrrrcccrrcAcMccA@
cc^cccoTcAr6rAc^AcIq
c^rcrc aicflqq:
^T('!!
ccc^ cc^^c^rcm^4! r!^ c^ccc G^ccrcc1lq
cac^cac^ c^c4!4le
-c^Acc^c6 -cr
ffi^Trdlcc^acq c^^
-AcorE-rccrrscrGrra@
crc carrc^6lfq!
^
arcc^cflcaccTrccrcf GrccccA.^-^cTAcccI4!!4
ffiGCAG A GGCfiCTAC
I;6l-rcrcAArc,c^GAooI
-McMcrrc'ccrc
4rl -cc
-rccc A@l€e -T(Trccircnoacc-ragqq
ccror^Gc^cT14!!
OGTACCCAGCTGd'TArc€
r^cc^ccrccr^cr^cc^444 GTG^CCnG^CCATaree4!

-cccc
-cc^
-^^c^rcAcc6Tc
 APPENDD(-[I

,s
ro
|0@

-to
-m
-o
_.@
g,
--
-attl
tq,

50 bD DNA lrddd (F.tuo..r)

 APPENDIX-Iv

Jr
Il
:iDI
tl|rl
3!l
at
-l
rl
-|t
rt

lm bp DNA hdd.r(L|toa.|)