Journal of Virological Methods 158 (2009) 63–69

Contents lists available at ScienceDirect

Journal of Virological Methods

journal homepage: www.elsevier.com/locate/jviromet

Diagnosis and strain differentiation of avian influenza viruses by restriction

fragment mass analysis
Kathrin Michael a , Timm C. Harder b , Thomas C. Mettenleiter a , Axel Karger a,∗
a
Institute of Molecular Biology, Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald-Insel Riems, Germany
b
Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald-Insel Riems, Germany

a b s t r a c t

Article history: Outbreaks of highly pathogenic avian influenza (HPAI) among poultry as well as wild birds are of contin-
Received 27 September 2008 uing major public concern, not only because of high economical losses but also due to lethal infections
Received in revised form 13 January 2009 in humans. Control of the infection relies on rapid detection and identification of the causative virus
Accepted 21 January 2009
strain which is carried out currently primarily by real-time RT-PCR and DNA sequencing. In a pandemic,
Available online 30 January 2009
however, the analysis of very large numbers of samples may become necessary within a short period.
A method is described for the characterisation of avian influenza virus (AIV) subtypes by restriction
Keywords:
fragment mass fingerprint (RFMF) analysis. Amplified genomic fragments encoding the pathogenicity-
Avian influenza virus
MALDI-TOF mass spectrometry
determining region of the hemagglutinin gene were digested with a cocktail of restriction enzymes, and
Diagnosis the restriction fragments were assayed by mass spectrometry. Characteristic spectra with sequence cov-
Restriction fragment mass fingerprint erage ranging from 75 to 100% were obtained for a panel of 27 isolates representing 18 relevant serotypes.
Three marker masses were identified that are highly specific for strains of the H5N1 virus. Within the
H5N1 serotype, discrimination of individual strains was possible by detailed evaluation of the spectra.
The procedure described is rapid, inexpensive and compatible with automation.
© 2009 Elsevier B.V. All rights reserved.

1. Introduction (Steinhauer, 1999). Whereas HPAIV strains, found exclusively

Avian influenza viruses (AIVs) have a natural reservoir in wild
aquatic birds in which they persist without causing overt disease.
However, upon infection of susceptible poultry, mutations leading
to increased pathogenicity can occur resulting in serious disease
in domestic birds. These highly pathogenic AIVs (HPAIV) express
only the H5 and H7 subtypes of the known 16 hemagglutinin
(HA) subtypes. Due to the potential of HPAIV, and, in particular
HPAIV H5N1 of Asian origin, to cross species barriers and also to
infect humans, identification and differentiation of AIV strains has
become of paramount importance not only for the management of
outbreaks in poultry, but also for deciding on measures concern-
ing the public health. Thus, diagnostic procedures should be able
to differentiate between the 16 hemagglutinin serotypes occurring
naturally, and identify unambiguously H5 and H7 serotypes of high
and low pathogenicity.
For the differentiation between strains with high or low
pathogenicity, the presence or absence of a polybasic, subtilisin-
sensitive endoproteolytic cleavage site within the HA precursor
protein (HA0 ) has been identified as a reliable molecular marker
∗ Corresponding author. Tel.: +49 383517251; fax: +49 383517175.
E-mail address: axel.karger@fli.bund.de (A. Karger).
among H5 and H7 serotypes (Capua and Mutinelli, 2001), pos-
sess a subtilisin-like polybasic motif at the HA0 cleavage site, a
trypsin-like monobasic motif is found in strains of low pathogenic-
ity (LPAIV). However, the linkage between genotype and pathotype
is not absolute, since an H10 strain lacking the polybasic amino acid
composition but with increased pathogenicity has been identified
(Wood et al., 1996), and H5-strains have been observed containing a
polybasic cleavage site but exhibiting only low virulence in infected
chickens (Londt et al., 2007).
Due to the constant threat of emerging new virus strains to pub-
lic health a rapid, reliable and inexpensive diagnostic procedure for
genotyping of AIV is of paramount importance. It should also be fea-
sible to test large numbers of samples within a minimum amount
of time (high-throughput).
Currently, influenza viruses are identified and characterised
either by virus isolation in embryonated chicken eggs and subse-
quent subtyping of their HA and neuraminidase (NA) by serological
methods, or by molecular techniques including real-time reverse
transcription PCR (rtRT-PCR) (Lee and Suarez, 2004; Ng et al., 2005;
Payungporn et al., 2006; Spackman et al., 2002) and DNA sequenc-
ing. Whereas virus isolation and characterisation usually requires
at least 5 days, identification of HPAIV strains by rtRT-PCR can be
achieved within 1–2 days. With rtRT-PCR-based diagnosis, the pres-
ence of AIV specific RNA is tested for by a rRT-PCR targeting the

0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.jviromet.2009.01.020
64 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69

Table 1
Universal primers used for the amplification of the HA cleavage sites in different Influenza A strains.

AIV isolates Subtype Forward primer Reverse Primer gI accession

a b
A/USSR/90/77 H1N1 HA-1057.1-F HA-1232.2-R 90572600
A/Chile/1/83 H1N1 HA-1057.1-F HA-1232.2-R 133754112
A/HongKong/1/68 H3N2 HA-1057.1-F HA-1232.2-R 14009691
A/duck/Ukraine/1/63 H3N8 HA-1057.1-F HA-1232.2-R 125716855
A/duck/Czechoslowakia/56 H4N6 HA-1057.2-Fc HA-1232.2-R 126722204
A/chicken/Scotland/59 HP H5N1 HA-1057.1-F HA-1232.1-Rd 60702
A/Cygnus cygnus/Germany/R65/06 H5N1 HA-1057.1-F HA-1232.1-R 157101128
A/teal/Germany/WV632/2005 H5N1 HA-1057.1-F HA-1232.1-R 136054911
A/dk/Vietnam/TG24-01/05 H5N1 HA-1057.1-F HA-1232.1-R 109941945
A/HongKong/156/97 H5N1 HA-1057.1-F HA-1232.1-R 2865379
A/DK/BC/26-6/05 H5N2 HA-1057.2-F HA-1232.2-R 83817209
A/chicken/Italy/8/98 H5N2 HA-1057.2-F HA-1232.1-R 12667086
A/tern/South Africa/61 H5N3 HA-1057.1-F HA-1232.1-R 902754
A/chicken/Italy/22A/98 H5N9 HA-1057.1-F HA-1232.1-R 149930643
A/turkey/Heidemark/R30/99 H6N1 HA-1057.2-F HA-1232.2-R 23095874
A/hen/Italy/444/99 HP H7N1 HA-1057.2-F HA-1232.2-R 55056925
A/turkey/Italy/472/99 H7N1 HA-1057.2-F HA-1232.2-R 55056928
A/turkey/Italy/2043/03 H7N3 HA-1057.2-F HA-1232.2-R 149929823
A/GSC chicken B/British Columbia/04 H7N3 HA-1057.2-F HA-1232.2-R 50083037
A/turkey/Germany/R11/01 H7N7 HA-1057.2-F HA-1232.2-R 55056929
A/duck/Potsdam/15/80 H7N7 HA-1057.2-F HA-1232.2-R 55056919
A/turkey/Ontario/6118/68 H8N4 HA-1057.1-F HA-1232.1-R 115278238
A/turkey/Germany/22/96 H9N2 HA-1057.1-F HA-1232.2-R 57335093
A/chicken/Germany/N/49 H10N7 HA-1057.1-F HA-1232.2-R 125716851
A/quail/Italy/1117/65 H10N8 HA-1057.1-F HA-1232.2-R 115278203
A/duck/Alberta/60/76 H12N5 HA-1057.1-F HA-1232.2-R 119943225
A/gull/Maryland/704/77 H13N6 HA-1057.1-F HA-1232.2-R 125716847
a
HA-1057.1-F: 5 -GGR GAA TGC CCC AAA TAY GT-3 .
b
HA-1232.2-R: 5 -TTY TGA TGY CTG AAD CCR TAC CA-3 .
c
HA-1057.2-F: 5 -GGR ARA TGC CCC AGR TAT GT-3 .
d
HA-1232.1-R: 5 -TTG CTA TGV TGR TAW CCA TAC CA-3 .

highly conserved M gene (van Elden et al., 2001a,b), followed by
HA and NA subtype specific rRT-PCR assays (Schweiger et al., 2000;
Wright et al., 1995). In the case of H5 and H7 AIV, molecular diagno-
sis of the pathotype [low pathogenic (LP) versus highly pathogenic
(HP)] is feasible after sequencing a fragment of the HA gene encod-
ing the endoproteolytic cleavage site.
The aim of this study was to develop a reliable, rapid, and poten-
tially high-throughput assay based on mass spectrometry for the
diagnosis and differentiation of AIV strains with special emphasis
on the potentially highly pathogenic H5 and H7 serotypes. Due to its
accuracy and speed, matrix-assisted laser desorption–ionization-
time-of-flight mass spectrometry (MALDI-TOF MS) has become the
method of choice for high-throughput genotyping and, particularly,
for the analysis of single nucleotide polymorphisms (SNPs) (Bray
et al., 2001; Tost and Gut, 2002). However, the marked sequence
heterogeneity and the large number of isolates hamper the dif-
ferentiation and diagnosis of AIV by classical primer-elongation
techniques. Thus, the strategy of this study was to generate oligonu-
cleotide restriction fragments from PCR amplicons covering the
sequences encoding the cleavage site of the HA, and analyse the
restriction mass patterns of both DNA strands by MALDI-TOF MS
(Liu et al., 1995; Wada, 1998). Since this procedure resembles the
identification of proteins by mass spectrometry of tryptic peptides
(peptide mass fingerprint, PMF), it will be abbreviated as restriction
fragment mass fingerprint (RFMF). Mass spectrometric analysis of
single genotype-specific restriction fragments can be applied for
the detection of single point mutations in numerous human genes,
and it has also been used for genotyping of pathogens such as vari-
ants of hepatitis B virus (Yeon et al., 2006), hepatitis C virus (Ilina
et al., 2005; Kim et al., 2005), and human papilloma virus (Lee et
al., 2007).
Recently, a set of primers was developed (Gall et al., 2008)
that allows PCR amplification and sequencing of an approximately
170 bp region of the HA gene covering the cleavage site. As these
primers were designed for routine diagnosis and target the HA
genes of all 16 serotypes the resulting amplicons were used as
starting material for the present study.
2. Material and methods
2.1. Sequence calculations
All available HA sequences were retrieved from the website of
the Influenza Virus Resource at the National Center for Biotech-
nology Information (http://www.ncbi.nlm.nih.gov/genomes/FLU/,
Bao et al., 2008). Redundant entries, sequences not fully cover-
ing the HA cleavage site, and those which were not expected
to yield an amplicon due to poor primer binding were not fur-
ther considered, so that a total of 3570 sequences remained as
a basis for the following calculations. Sequences were aligned
with the MUSCLE program (Edgar, 2004) and restriction fragments
were calculated by an in-house software based on EXCELTM VBA
(Microsoft) macros. Briefly, the program examined every sequence
for regions that allow binding of one of the primers from the
primer mix used (Table 1). Then, the sequence of the expected
amplicon was determined on the basis of the primer pair carrying
the least number of mismatches not exceeding three. Restric-
tion fragments resulting from both DNA strands and their masses
from this amplicon were calculated. The program also offers the
possibility of assigning experimental masses to the calculated
restriction fragments. All further evaluation of the data was car-
ried out with the EXCEL and ACCESS software (Microsoft, Redmond,
USA). Although the MALDI-TOF mass spectrometric analysis of
large DNA fragments up to 500 nucleotides has been reported
(Tang et al., 1994), generation of smaller fragments was desir-
able because of the higher resolution of small masses. Considering
a desirable mass range of 1500–9000 Da an enzyme mix gener-
ating preferentially fragments of 8–16 nucleotides was designed
and evaluated by in silico digest of all available HA sequences
(Fig. 1).
 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69 65

Fig. 1. Calculated and experimental yield of restriction fragments. (A) Calculated frequencies of restriction fragment masses of all available HA sequences from the database
(details see text). (B) Sample spectrum H5N1 strain Hong Kong 159 (gI|2833656) showing the preferential mass range of 1500–9000 Da for the registration of restriction
fragment fingerprint spectra.

2.2. Chemicals and enzymes
Go Taq DNA polymerase and dNTPs were obtained from
Promega (Madison, WI, USA). ThermoSequenaseTM DNA poly-
merase was purchased from GE Healthcare (Piscataway, NJ; USA),
3-hydroxypicolinic acid (3-HPA) (Bruker Daltonics, Bremen, Ger-
many) and ammonium citrate (Merck, Darmstadt, Germany) from
Sigma–Aldrich (Steinheim, Germany). Primers for PCR are summa-
rized in Table 1. They were obtained from MWG-Biotech (Ebersberg,
Germany).
2.3. PCR amplification and restriction enzyme digestion
mixes given in Table 1 and the following temperature profile:
30 min at 55 ◦ C, 2 min at 95 ◦ C; 40 cycles of 15 s at 95 ◦ C, 30 s at
55 ◦ C, and 2 min at 68 ◦ C. Primers were taken from a recent pub-
lication (Gall et al., 2008) with the modification that only the AIV
specific sequences of the reverse primers were used.
The amplicon was purified by agarose gel electrophoresis,
extracted from the gel (Gel Extraction Kit, Qiagen, Chatsworth, CA,
USA), and digested at 37 ◦ C for 1 h with a mix of 1 U each of restric-
tion enzymes CviKI-1, MnlI, Hpy188I, HinfI, and Nt.CviPII (New
England Biolabs, Ipswich, USA) in 50 ␮l of reaction buffer containing
50 mM potassium acetate, 20 mM Tris–acetate, 10 mM magnesium
acetate, 1 mM DTT, and 25 ␮g bovine serum albumine.

All viral RNA samples (Table 1) were obtained from the national
and OIE reference laboratory within the Institute of Diagnostic
Virology of the Friedrich-Loeffler-Institut. An approximately 170 bp
fragment of the viral HA gene was amplified by one step RT-PCR
(SuperScriptTM III, Invitrogen, Carlsbad, CA, USA) using the primer
2.4. Sample preparation and MALDI-TOF MS
Cleavage products were purified with magnetic beads (Genop-
ure oligo purification system, Bruker, #201302, Bremen, Germany)
according to the manufacturer’s protocol, and the final eluate was
66 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69

Fig. 2. Assignment of experimental masses to the restriction fragment map of aligned HA sequences. The sequence alignment of approximately 123 nucleotides (residue
numbers in line 2) of the HA genes is centered at the cleavage site of the HA protein corresponding to nucleotide positions 85/86 (line 1), where the precursor is cleaved
into the HA1 and HA2 fragments. Serotypes (HN classification), potential pathotypes according to the presence (HP = highly pathogenic) or absence (LP = low pathogenic)
of sequences coding for multibasic amino acid motifs adjacent to the cleavage site, and gI accession numbers of individual isolates are given in the first column. Expected
restriction fragments (boxes) of the respective amplicons were calculated for the positive (above the bold line) and negative (below the bold line) strand. Interruptions of the
bold lines in the range between nucleotides 50 and 82 indicate gaps in the alignment resulting from insertions in individual sequences. Grey boxes indicate that oligonucleotide
fragments of the given expected masses have been identified by mass spectrometry.

spotted onto the pre-crystallized matrix (1 ␮l of a solution of 10 g/l
3-HPA and 1 g/l diammonium hydrogen citrate in water) on a
400 ␮m AnchorChip target (Bruker, Bremen, Germany).
Mass spectra were acquired with an Ultraflex I instrument
(Bruker, Bremen, Germany) in positive ion linear mode at 19 kV
acceleration voltage and 400 ns delay time. The instrument was
calibrated with a mix of oligonucleotides (Bruker, #206200, Bre-
men, Germany) in the mass range from 3646 to 9192 Da. For all
calculations, mass tolerance was set to 200 ppm.
3. Results
In-silico digestion of the expected amplicons of all available HA
sequences showed that the primer mix used was expected to yield
high numbers of restriction fragments in the desired mass range of
1500–9000 Da which was confirmed by the mass spectra (Fig. 1).
All spectra exhibited the highest number of intense peaks in the
calculated mass range (Fig. 1B).
A panel of 27 AIV strains with sequenced HA gene (Table 1) rep-
resenting 11 relevant diagnostically to the 16 HA-types occurring
naturally [H1N1 (2 strains), H3N2, H3N8, H4N6, H5N1 (five strains),
H5N2 (two strains), H5N3, H5N9, H6N1, H7N1 (two strains), H7N3
(two strains), H7N7 (two strains), H8N4, H9N2, H10N7, H10N8,
H12N5, and H13N6] was examined. Eight of these were predicted to
be highly pathogenic due to the presence of a polybasic amino acid
motif adjacent to the cleavage site (Fig. 2). Reverse transcription and
PCR amplification with the modified universal primer mix (Gall et
al., 2008) covering an approximately 170 bp gene region flanking
the cleavage site of the HA protein was successful for all samples.
After simultaneous digestion of the amplicons with CviKI-1, MnlI,
Hpy188I, HinfI, and Nt.CviPII, high quality spectra could be acquired
for all samples.
3.1. Acquisition of RFMF spectra
In MALDI experiments ionization yields are generally not
exhaustive, so that complete coverage of both strands of the DNA
sample could not be expected. To extract a maximum of informa-
tion from the sample, the experimental conditions were adjusted
to achieve the highest possible sequence cover from the spectra.
Experimental masses were assigned to the corresponding calcu-
lated restriction fragments of both DNA strands (Fig. 2). Within the
shown 123 bp stretch encompassing the coding sequence for the
HA cleavage site, sequence cover varied between 75 and 100% with
an average of 87% which allowed the nearly complete reconstruc-
tion of the amplicons of all isolates from the respective spectra.
The average sequence cover immediately downstream of the cleav-
age site was 90% for all isolates and 95% for the H5N1 subtypes.
High coverage demonstrated that digestion with the enzyme mix
was efficient, and the bulk of the fragments fell into the calculated
preferred mass range of 1500–9000 Da.
3.2. Differentiation of AIV strains
Spectra from AIV samples of different serotypes showed char-
acteristic mass patterns allowing unambiguous correlation of
virus and spectrum. Sequence similarity among representatives of
serotype H5N1 was considerably higher, but still, by combination
of individual peaks, differentiation of all five H5N1 strains was pos-
sible (Fig. 3A). The presence or absence of the masses used for
 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69 67

Fig. 3. Differentiation of H5N1 isolates. Details are given from spectra originating from five different H5N1 strains [from top to bottom HongKong/156/97 (gI|2865379),
Scotland/59 (gI|60702), Germany/R65/06 (gI|157101128), Vietnam/TG24-01/05 (gI|109941945) and Germany/WV632/05 (gI|136054911)]. Panel A shows a selection of masses
that allows the unambiguous differentiation of the five strains. Expected masses and the corresponding sequences are indicated. Each sample can be identified by the
combination of characteristic peaks. Panel B shows a fragment with a mass of 8691.9 Da (CCAAATATGTGAAATCAAACAGATTAGT) which is highly indicative for HPAIV H5N1.
The less intense peak of 8676.8 Da indicates presence of an alternative fragment (CCAAATACGTGAAATCAAACAGATTAGT) resulting from the binding of a mismatched primer
from the forward primer mix for PCR amplification.

differentiation correlated with the restriction fragment pattern cal-
culated for the respective strains. Also, in all samples that contained
insertions coding for multibasic amino acid motifs adjacent to the
cleavage site (Fig. 2), unique masses corresponding to fragments
originating from these regions were identified.
3.3. Development of diagnostic markers for H5N1 serotype strains
In-silico digests of all available HA genes were analysed for H5
and H5N1 specific restriction fragments in the available mass range.
For this purpose, a list of all the resulting fragments was created,
and the prevalence of every fragment for the different serotypes
was calculated as the distribution of the respective fragment over
the different serotypes. Of the fragments showing high specificity
for H5 or H5N1 strains those occurring with a high frequency among
the respective serotypes were selected.
H5N1 serotypes represented the largest group with 1468 entries
of the 3570 in-silico amplicons. Despite the considerable sequence
diversity found within this group, three fragment masses corre-
sponding to nucleic acid compositions of A13C4G4T7 (8691.9 Da),

Table 2
Frequency of occurrence of three candidate diagnostic restriction fragments in H5, H5N1 and non-H5 AIV strains.

Fragment Sequence H5a (1675) H5N1a (1468) Non-H5N1a (2102)

A13C4G4T7 CCAAATATGTGAAATCAAACAGATTAGT 1052/63% 1046/71% 0/0%

A9C1G7T4 AAAAGAGAGGACTATTTGGAG 947/57% 934/64% 0/0%
A3C2G3T3 CTATAGCAGGT 1237/74% 1232/84% 5/0.24%
Either one 1445/83% 1435/98% 25b /1.2%
a
The numbers of representatives of the respective groups within the 3570 considered AIV strains are given in parenthesis.
b
Among them are representatives of subtypes H5N2 (16), H5N3 (3), H5N7 (1), H10N1 (1), H10N6 (2), and H10N7 (2).
68 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69
A3C2G3T3 (3435.4 Da) and A9C1G7T4 (6646.5 Da), with high pre-
dictive value for HPAIV H5N1 were identified as potential diagnostic
markers (Table 2). It is notable that all three masses represent single
sequences without mass degeneration, and are located at homolo-
gous positions in the aligned HA sequences. A13C4G4T7 is cut from
one strand of the amplicons by Nt.CviPII at both ends and has been
produced from digests with Nt.CviPII only (data not shown), which
may be of interest for high-throughput screening efforts.
Of the five representatives of the H5N1 serotype, three
(gI|2865379, gI|157101128, and gI|109941945) were pre-
dicted to yield restriction fragment A13C4G4T7 (8691.9 Da,
CCAAATATGTGAAATCAAACAGATTAGT, primer sequence in italics)
which was confirmed by mass spectrometry (Fig. 3B). A less intense
mass of 8676.8 Da accompanying the 8691.9 Da marker indicates
the binding and partial incorporation of a different, mismatching
primer from the HA-1057.1-F primer mix and, thus, represents the
C/T ambiguity at primer position 18 or position 8 of the fragment,
respectively. All three fragments yielded strong and reliable signals.
The occurrence of at least one of the three masses identifies H5N1
strains with a true positive rate of 98% and a false positive rate of
1.2% (Table 2).
4. Discussion
A number of different techniques have been introduced to
exploit the high speed and resolution of mass spectrometry, espe-
cially MALDI-TOF MS, for genotyping purposes. In most approaches,
the final readout consists of one or more characteristic masses
that are correlated with a certain genotype. Investigation of SNPs
or other single nucleotide mutations within a strongly conserved
background allows experimental designs in which differentiation
of few genotype-specific reaction products is sufficient. In the case
of AIV diagnosis and differentiation, the large number of circulat-
ing isolates and the considerable sequence diversity within and
immediately adjacent to the HA cleavage site together with the
restricted mass range available for routine nucleotide analysis by
MALDI-TOF hamper the implementation of established procedures
such as primer-elongation or minisequencing techniques (Haff and
Smirnov, 1997; Juhasz et al., 1996; Kaetzke and Eschrich, 2002;
Storm and Darnhofer-Patel, 2003), or the analysis of restriction frag-
ment mass polymorphism (Elso et al., 2002; Hwang et al., 2007) for
this purpose. Therefore, the restriction fragment patterns generated
from HA specific amplicons were analysed directly by MALDI-TOF
MS (Liu et al., 1995).
The prerequisites of reliable RFMF analysis are a robust PCR pro-
tocol and the design of a restriction cleavage that yields sufficient
numbers of informative fragments in the mass range accessible to
routine mass spectrometry. Inclusion of the restriction endonu-
clease Nt.CviPII was crucial in two aspects: the short, and partly
degenerate binding sequence CCD results in frequent cleavages, and
the fact that it is a nicking endonuclease which cuts one DNA strand
only inserts significant asymmetry into the resulting fragments
which was important to obtain high sequence coverage. To simplify
the protocol digestion was designed to yield small fragments, and
all further processing of the sample (Chiu et al., 2000) was omitted.
Nevertheless, the resulting spectra were of high quality and suffi-
ciently detailed to distinguish all samples from the panel, including
representatives of the same serotype (H5N1). Also, in all spectra
from potentially highly pathogenic isolates, fragments coding for
the multibasic amino acid stretch were identified, which may be
useful for phylogenetic or epidemiological studies.
Additional biostatistical effort will be necessary to establish pro-
cedures for the identification of virus isolates from mass spectra of
restriction fragments similar to the routine protein identification by
peptide mass fingerprint spectra (Pappin et al., 1993; Perkins et al.,
1999). Nevertheless, three masses have been identified which are
highly specific for the H5N1 serotype, allowing diagnosis by RFMF
of this major cause of outbreaks worldwide.
Restriction mass fingerprint spectra can be obtained within 4 h
after isolation of the RNA from diagnostic samples if the optional
(data not shown) gel purification of the amplicon is omitted. Thus,
the procedure is rapid and compatible with automation, cost per
sample is low and interpretation of spectra is straightforward, when
marker masses or combinations similar to the described H5N1 spe-
cific masses are available. Spectra are sufficiently distinct to allow
even the differentiation of individual strains within one serotype.
Acknowledgements
This work was supported by the FSI research initiative of the
Federal Government of Germany. We thank A. Gall for making avail-
able the PCR protocol prior to publication and Stefanie Jachman for
expert technical assistance.
References
Bao, Y., Bolotov, P., Dernovoy, D., Kiryutin, B., Zaslavsky, L., Tatusova, T., Ostell, J.,
Lipman, D., 2008. The influenza virus resource at the National Center for Biotech-
nology Information. J. Virol. 82, 596–601.
Bray, M.S., Boerwinkle, E., Doris, P.A., 2001. High-throughput multiplex SNP genotyp-
ing with MALDI-TOF mass spectrometry: practice, problems and promise. Hum.
Mutat. 17, 296–304.
Capua, I., Mutinelli, F., 2001. Low pathogenicity (LPAI) and highly pathogenic (HPAI)
avian influenza in turkeys and chicken, 13–20.
Chiu, N.H., Tang, K., Yip, P., Braun, A., Koster, H., Cantor, C.R., 2000. Mass spectrometry
of single-stranded restriction fragments captured by an undigested complemen-
tary sequence. Nucleic Acids Res. 28, E31.
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and
high throughput. Nucleic Acids Res. 32, 1792–1797.
Elso, C., Toohey, B., Reid, G.E., Poetter, K., Simpson, R.J., Foote, S.J., 2002. Mutation
detection using mass spectrometric separation of tiny oligonucleotide frag-
ments. Genome Res. 12, 1428–1433.
Gall, A., Hoffmann, B., Harder, T., Grund, C., Beer, M., 2008. Universal primer set for
amplification and sequencing of HA0 cleavage sites of all influenza A viruses. J.
Clin. Microbiol. 46, 2561–2567.
Haff, L.A., Smirnov, I.P., 1997. Single-nucleotide polymorphism identification assays
using a thermostable DNA polymerase and delayed extraction MALDI-TOF mass
spectrometry. Genome Res. 7, 378–388.
Hwang, S.H., Oh, H.B., Choi, S.E., Hong, S.P., Yoo, W., 2007. Effective screening of infor-
mative single nucleotide polymorphisms using the novel method of restriction
fragment mass polymorphism. J. Int. Med. Res. 35, 827–835.
Ilina, E.N., Malakhova, M.V., Generozov, E.V., Nikolaev, E.N., Govorun, V.M.,
2005. Matrix-assisted laser desorption ionization-time of flight (mass spec-
trometry) for Hepatitis C virus genotyping. J. Clin. Microbiol. 43, 2810–
2815.
Juhasz, P., Roskey, M.T., Smirnov, I.P., Haff, L.A., Vestal, M.L., Martin, S.A., 1996.
Applications of delayed extraction matrix-assisted laser desorption ionization
time-of-flight mass spectrometry to oligonucleotide analysis. Anal. Chem. 68,
941–946.
Kaetzke, A., Eschrich, K., 2002. Simultaneous determination of different DNA
sequences by mass spectrometric evaluation of Sanger sequencing reactions.
Nucleic Acids Res. 30, e117.
Kim, Y.J., Kim, S.O., Chung, H.J., Jee, M.S., Kim, B.G., Kim, K.M., Yoon, J.H., Lee, H.S., Kim,
C.Y., Kim, S., Yoo, W., Hong, S.P., 2005. Population genotyping of hepatitis C virus
by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
analysis of short DNA fragments. Clin. Chem. 51, 1123–1131.
Lee, C.W., Suarez, D.L., 2004. Application of real-time RT-PCR for the quantitation
and competitive replication study of H5 and H7 subtype avian influenza virus. J.
Virol. Methods 119, 151–158.
Lee, E.H., Chung, H.J., Oh, H.B., Chi, H.S., Jee, M.S., Park, S.N., Hong, S.P., Yoo, W., Kim,
S.O., 2007. Human papilloma virus genotyping assay using restriction fragment
mass polymorphism analysis, and its comparison with sequencing and hybrid
capture assays. Korean J. Lab Med. 27, 62–68.
Liu, Y.H., Zhu, Y.D., Liang, X.O., Siemieniak, D., Venta, P.J., Lubman, D.M., 1995.
Rapid screening of genetic polymorphisms using buccal cell-DNA with detec-
tion by matrix-assisted laser-desorption ionization mass-spectrometry. Rapid
Commun. Mass Spectrom. 9, 735–743.
Londt, B.Z., Banks, J., Alexander, D.J., 2007. Highly pathogenic avian influenza
viruses with low virulence for chickens in in vivo tests. Avian Pathol. 36, 347–
350.
Ng, E.K., Cheng, P.K., Ng, A.Y., Hoang, T.L., Lim, W.W., 2005. Influenza A H5N1 detec-
tion. Emerg. Infect. Dis. 11, 1303–1305.
Pappin, D.J., Hojrup, P., Bleasby, A.J., 1993. Rapid identification of proteins by peptide-
mass fingerprinting. Curr. Biol. 3, 327–332.
Payungporn, S., Chutinimitkul, S., Chaisingh, A., Damrongwantanapokin, S.,
Buranathai, C., Amonsin, A., Theamboonlers, A., Poovorawan, Y., 2006. Single
 K. Michael et al. / Journal of Virological Methods 158 (2009) 63–69
step multiplex real-time RT-PCR for H5N1 influenza A virus detection. J. Virol.
Methods 131, 143–147.
Perkins, D.N., Pappin, D.J., Creasy, D.M., Cottrell, J.S., 1999. Probability-based protein
identification by searching sequence databases using mass spectrometry data.
Electrophoresis 20, 3551–3567.
Schweiger, B., Zadow, I., Heckler, R., Timm, H., Pauli, G., 2000. Application of a flu-
orogenic PCR assay for typing and subtyping of influenza viruses in respiratory
samples. J. Clin. Microbiol. 38, 1552–1558.
Spackman, E., Senne, D.A., Myers, T.J., Bulaga, L.L., Garber, L.P., Perdue, M.L., Lohman,
K., Daum, L.T., Suarez, D.L., 2002. Development of a real-time reverse transcrip-
tase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin
subtypes. J. Clin. Microbiol. 40, 3256–3260.
Steinhauer, D.A., 1999. Role of hemagglutinin cleavage for the pathogenicity of
influenza virus. Virology 258, 1–20.
Storm, N., Darnhofer-Patel, B., van den Boom, D., Rodi, C.P., 2003. MALDI-TOF mass
spectrometry-based SNP genotyping. Methods Mol. Biol. 212, 241–262.
Tang, K., Allman, S.L., Chen, C.H., Chang, L.Y., Schell, M., 1994. Matrix-assisted laser
desorption/ionization of restriction enzyme-digested DNA. Rapid Commun.
Mass Spectrom. 8, 183–186.
Tost, J., Gut, I.G., 2002. Genotyping single nucleotide polymorphisms by mass spec-
trometry. Mass Spectrom. Rev. 21, 388–418.
69
van Elden, L.J., Nijhuis, M., Schipper, P., Schuurman, R., van Loon, A.M., 2001a. Simul-
taneous detection of influenza viruses A and B using real-time quantitative PCR.
J. Clin. Microbiol. 39, 196–200.
van Elden, L.J., van Essen, G.A., Boucher, C.A., van Loon, A.M., Nijhuis, M., Schip-
per, P., Verheij, T.J., Hoepelman, I.M., 2001b. Clinical diagnosis of influenza virus
infection: evaluation of diagnostic tools in general practice. Br. J. Gen. Pract. 51,
630–634.
Wada, Y., 1998. Separate analysis of complementary strands of restriction enzyme-
digested DNA. An application of restriction fragment mass mapping by matrix-
assisted laser desorption/ionization mass spectrometry. J. Mass Spectrom. 33,
187–192.
Wood, G.W., Banks, J., Strong, I., Parsons, G., Alexander, D.J., 1996. An avian influenza
virus of H10 subtype that is highly pathogenic for chickens, but lacks multiple
basic amino acids at the haemagglutinin cleavage site. Avian Pathol. 25, 799–806.
Wright, K.E., Wilson, G.A., Novosad, D., Dimock, C., Tan, D., Weber, J.M., 1995. Typing
and subtyping of influenza viruses in clinical samples by PCR. J. Clin. Microbiol.
33, 1180–1184.
Yeon, J.E., Yoo, W., Hong, S.P., Chang, Y.J., Yu, S.K., Kim, J.H., Seo, Y.S., Chung, H.J., Moon,
M.S., Kim, S.O., Byun, K.S., Lee, C.H., 2006. Resistance to adefovir dipivoxil in
lamivudine resistant chronic hepatitis B patients treated with adefovir dipivoxil.
Gut 55, 1488–1495.