ISSN 0027-1349, Moscow University Physics Bulletin, 2016, Vol. 71, No. 1, pp. 135–138. © Allerton Press, Inc.

, 2016.
Original Russian Text © V.A. Spiridonova, T.M. Novikova, O.V. Snigirev, 2016, published in Vestnik Moskovskogo Universiteta. Fizika, 2016, No. 1, pp. 119–122.

BIOPHYSICS AND MEDICAL

PHYSICS

Obtaining DNA Aptamers to Human Interleukin-6

for Biomagnetic Immunoassay Nanosensors
V. A. Spiridonovaa, T. M. Novikovaa, and O. V. Snigirevb
aBelozersky Institute of Physicochemical Biology, Moscow State University, Moscow, 119991 Russia
bDepartment of Physics, Moscow State University, Moscow, 119991 Russia

e-mail: osnig@inbox.ru
Received August 19, 2015; in final form, November 2, 2015

Abstract—We used aptamers, which are functional equivalents of antibodies, in order to develop a nanosensor
immunoassay system based on magnetic nanoparticles and a SQUID magnetometer. Selection was used to
obtain DNA aptamers to interleukin-6; their affinity to the target protein was characterized by surface plas-
mon resonance. It was shown that the biotinylated aptamer binds to magnetic nanoparticles that were func-
tionalized with streptavidin.

Keywords: magnetic nanoparticles, streptavidin-biotin, DNA aptamer, aptamer primary structure, aptamer
secondary structure.
DOI: 10.3103/S002713491601015X

INTRODUCTION In the present paper, results on obtaining DNA

The present study is part of a project that is directed
toward the creation of methods and devices for an
immunoassay scheme that would employ functional-
ized magnetic nanoparticles (MNPs) and a sensitive
magnetometer. The magnetometer records a change in
the rate of the Brownian relaxation of magnetic parti-
cles upon their binding into clusters by molecules of
aptamers,, which are small DNA or RNA fragments
with the length of 15‒60 nucleotides, as it is carried
out for an antigen–antibody pair [1‒3].
The nanosensor biomagnetic test system that is
being developed based on magnetic nanoparticles with
an immobilized aptamer to proteins accompanying
oncological diseases such as interleukin-6 (IL-6)
could be the basis of a new generation of diagnostic
medical devices.
In the present test systems, e.g., ELISA, monoclo-
nal antibodies (MCAs) are used. Aptamers (aptus,
from latin, means “suitable”) could be an alternative
to MCAs, both for therapeutic purposes and for the
creation of biosensors. These RNA and DNA mole-
cules have high affinity to a given protein target. To
date, a great number of reviews on aptamers and
methods to obtain them have been published (see,
e.g., [4‒10]). With a chemical structure that is funda-
mentally different from antibodies, while they are no
worse than antibodies for the specificity and affinity of
the interaction with target molecules, aptamers make
it possible to develop novel approaches for the creation
of test systems instead of conventional immunobiolog-
ical methods.
aptamers to IL-6 by selection based on a combinato-
rial library of nucleic acids (NAs) and the results of a
search for binding conditions of the aptamers that
were obtained with the IL-6 protein and MNPs func-
tionalized with streptavidin for construction of a bio-
sensor system are given.
1. MATERIALS AND METHODS
SELEX (Systematic Evolution of Ligands by Expo-
nential Enrichment) was used for aptamer selection
using a combinatorial library of NAs [11, 12]. The
method is based on the selection of NA molecules that
possess some affinity to a protein target.
1.1. The Immobilization of the IL-6 Protein Target
Using a Nitrocellulose Membrane
Nitrocellulose membranes with a size of 5 × 5 mm
were incubated in a protein solution in a phosphate
buffer (140 mM NaCl, 5mM KCl, 10 mM NaH2PO4,
1.8 mM KH2PO4, pH = 7.4). To decrease the possibil-
ity of nonspecific interactions of the DNA of the ini-
tial library, positions in the nitrocellulose membranes
that were not occupied by IL-6 were blocked by phos-
phate buffer containing 1 mg/mL of bovine serum
albumin (BSA) during 20 min before each of the bind-
ing cycles. Upon obtaining the aptamers, a combina-
torial library (CL) of NAs that was proposed in Elling-
ton’s work [13] was used. Below, the primary struc-
tures of the combinatorial library and those of

135
136 SPIRIDONOVA et al.
complementary primers for the polymerase chain
reaction (PCR) are given
5'-ATGCATCCACATCTACG‒N30‒TTCACT-
GCAGACTTGAC-3'
R-primer 5'-ATGGATCCACATCTACG, L-
primer 5'-GTCAAGTCTGCAGTGAA
The constant parts of the CL served as the basis for
the creation of complementary primers, using which
nucleic material for further stages of selection using
PCR was obtained. The primers, CL, individual DNA
aptamers, and biotinylated aptamers were synthesized
by a solid-phase method using an АР-380В synthe-
sizer (Applied Biosystems) in the Sintol company,
Russia.
1.2. Obtaining the Desired DNA Aptamers
To obtain the aptamers, the initial DNA of the CL
and the immobilized IL-6 protein were separately
incubated in a phosphate solution for 1 hour. Nitro-
cellulose membranes with the immobilized IL-6 were
then transferred into the solution of the CL DNA in
the phosphate buffer and kept for 1 hour at a tempera-
ture of 4°С. The membrane containing IL-6 was
washed three time with the buffer for the removal of
molecules that were unspecifically adsorbed and the
desired aptamers that bound specifically were washed
off with water (Millipore Corp.) in a thermostat at a
temperature of 80°C for 5 min.
The partially enriched fraction of collected aptam-
ers was amplified using PCR. The single-stranded
form of the DNA aptamers was then obtained by
asymmetric PCR. The pool of molecules of the par-
tially enriched single-stranded DNA was introduced
into the next cycle of the selection. Altogether, five
rounds of selection were carried out. To obtain the
desired aptamers, the enriched fraction was cloned
into the pAL-TA plasmid [14]. Recombinant plasmids
were isolated from the clones that were obtained using
an agarose medium. To determine the primary struc-
ture, the desired aptamers were sequenced (Evrogen,
Russia). The secondary structures of the obtained
aptamers were characterized by the circular dichroism
(CD) spectra in a buffer containing 20 mM tris-HCl,
pH = 7.2, 140 mM NaCl, 5 mM KСl using a Chirascan
spectrometer (Applied Photophysics Ltd., UK).
1.3. Binding of the Desired Aptamers with IL-6
The affinity of the DNA aptamers to the protein
was characterized by the dissociation constant of the
obtained complex. For this purpose, surface plasmon
resonance (SPR) was performed using the Biac-
oreX100 device (GJ Healthcare, United States) of the
Center for Collective Use of the Moscow State Uni-
versity. The IL-6 protein was immobilized using a
Sensor chip.
MOSCOW UNIVERSITY PHYSICS BULLETIN
The concentration of the introduced aptamer was
varied from 0.01 to 0.8 μM in a buffer of 25 mM МЕS-
КОН, рН = 6.2, 140 mM NaCl, 5 mM КСl. The rate
of introduction of the sample into a flow-through cell
was 10 μL/min. All the results were obtained upon
subtraction of the background of the base line using
the data of the negative control cell. For calculating
the constants, the BIAevaluation 4.1. program was
used with approximation of the results according to
the 1 : 1 model (Langmuir).
1.4. Binding of Individual Aptamers
to Magnetic Particles
For binding to MNPs according to the well-known
streptavidin–biotin scheme, the aptamers that were
chosen for further analysis were synthesized in the
form of biotin derivatives (Sintol, Russia). In the
study, magnetic particles (MPs) with a size of 75 nm
with immobilized streptavidin on their surface (Ocean
Nano Tech, United States) at a concentration of
1 mg/mL that were obtained in a solution containing
sodium azide and BSA were used. To remove the BSA
protein that was contained in the commercial prepara-
tion, the nanoparticles were washed several times with
a phosphate buffer using centrifugation at 16000 rpm
for 30 min in an Eppendorf benchtop centrifuge with
cooling.
To control the purity of the preparation, the
absorption in the wash water at a wavelength of 280 nm
was measured using an Eppendorf spectrophotometer.
In the last wash waters, the absorption was no greater
than 0.002 units. The reaction of binding of the MPs
to the DNA aptamer was carried out in a volume of
1 mL. The suspension of the MNPs in the buffer was
supplemented with an equal volume of the aptamers at
constant stirring for 1‒16 h. Centrifugation with cool-
ing was used to separate the solution of unbound bioti-
nylated aptamers from the MNPs. The occurrence of
the aptamers that were bound to the surface of the
nanoparticles was controlled by measuring the absorp-
tion at the wavelength of 260 nm, which corresponds
to the absorption maximum in the spectrum of nucleic
acids. On average, approximately 15% of the DNA
aptamers from the introduced material were bound.
2. RESULTS AND DISCUSSION
Using SELEX, five rounds of selection were car-
ried out. In the first two rounds, a protein : DNA ratio
of 4 : 1 was used. Further, selection conditions were
made stricter by changing the protein : DNA ratio
toward DNA, thus, creating additional competition
between the aptamers for binding with the protein tar-
get. The enriched fraction of the aptamers was suc-
cessfully cloned into a host-vector bacterial system
according to the protocols in [14].
More than 30 clones were obtained. Clone no. 12
was chosen for further study, 5'-GGTGGCAGGAG-
Vol. 71 No. 1 2016
 OBTAINING DNA APTAMERS 137

Wavelength, nm 1 the peaks do not correspond to the known values of

15 3 the resonances of antiparallel and parallel G-quadru-
2
plexes and duplexes. Most likely this is caused by the
presence in the solution of a set of conformers.
10 Further, the binding of DNA aptamer no. 12 to
human IL-6 was studied. Both binding with the full-
4 5 6 size sequence (12L: GGTGGCAGGAGGAC-
5
TATTTATTTGCTTTTCT) and with a short variant
(12S: GGTGGCAGGAGGACTА) was studied. The
0 stability of the IL-6 complexes with the 12L and 12S
aptamers was described using SPR.
Figure 2 gives a sensorgram of the interaction of the
−5 12S aptamer with IL-6. The curves reach a plateau and
a sharp decrease is observed, which is evidence of
rapid processes of association and dissociation in the
−10 system. The SPR data make it possible to determine
240 260 280 300 320 340
the kinetic constants of the association and dissocia-
Circular dichroism, (cm M)−1 tion of the aptamer complexes with interleukin 6,
which are given in the table.
Fig. 1. The temperature dependence of the circular- Upon comparing the affinity of the short aptamer
dichroism spectrum of aptamer no. 12. Spectra with a
decrease in the intensity are given at 5 (1), 10 (2), 15 (3), to the protein target and that of the full-sized aptamer,
20 (4), 25 (5), and 30°С (6). it could be noted that the long oligonucleotide
sequence has greater affinity to the protein target,
which is also proven by the equilibrium dissociation
GACTATTTATTTGCTTTTCT, since it was constants. For the 12S aptamer, the equilibrium con-
enriched in GG motifs that were repeated four times, stant of the dissociation of the complex with IL-6 was
which could make it possible to find the conditions for 190 nM. The full-sized 12L aptamer was bound to IL-
the assembly of G-quadruplex structures [15‒17]. 6 immobilized on a chip with an equilibrium constant
The secondary structure of aptamer no. 12 was of dissociation of 17 nM (Fig. 2).
described by the circular dichroism (CD) spectra. Fig- According to these data, it could be stated that both
ure 1 gives the CD spectra that were obtained within aptamers form a complex with IL-6 with high affinity.
the range from 360 to 240 nm upon a gradual increase It was noted above that the solution might contain dif-
in the temperature with a step of 5˚С. A negative signal ferent conformers. Further, the study determined
at 240 nm and a positive signal at 275 nm are observed which of the conformers has the greatest affinity to the
in the spectra of aptamer no. 12. The wavelengths of IL-6 protein.

Resonance signal, rel. units

Resonance signal, rel. units 100
500 (a) 1 80 (b)

400 60

40 3
300
2 1
20 4 2
200 3
4 5
0
5
100
−20

25 50 75 100 −50 0 50 100 150 200

Time, s Time, s

Fig. 2. (a) Sensorgrams of the binding of the 12S aptamer to IL-6 immobilized on an SM5 chip: (1) 800; (2) 400; (3) 200;
(4) 100, and (5) 50 μM. Along the x-axis, time in s; along the y-axis, values of the resonance signal; (b) sensorgrams of bind-
ing of the 12L aptamer to IL-6 immobilized on the SM5 chip: (1) 50; (2) 25; (3) 10; (4) 5, and (5) 1 μM.

MOSCOW UNIVERSITY PHYSICS BULLETIN Vol. 71 No. 1 2016

138 SPIRIDONOVA et al.
The kinetic constants of the association and dissociation of 12S and 12L aptamers with interleukin 6
Aptamer Ka (M–1 s–1) Standard deviation (M–1 s–1)
12S 9.8 × 10 4 0.5 × 10 4
12L 3.5 × 105 0.5 × 105
Using the high affinity of the protein to the aptam-
ers, binding of the biotinylated aptamers to the mag-
netic particles functionalized with streptavidin was
performed. The conditions of docking of the bioti-
nylated aptamer on the MNPs were tested at different
concentrations from 20 to 400 pmol/μL, with the time
of incubation of the MNPs with the aptamers being
varied from 1 to 16 h at room temperature. The degree
of the docking was assessed spectrophotometrically at
a wavelength of 260 nm, since this corresponds to the
absorption maximum of nucleic acids. The aptamer
immobilization on the MNPs was performed with
continuous stirring and was 10‒15% regardless of the
initial concentration of the aptamer that was intro-
duced into the reaction.
CONCLUSIONS
To create a method and equipment for an immu-
noassay scheme that employs functionalized magnetic
nanoparticles (MNPs), single-stranded DNA aptam-
ers to human IL-6 were obtained using SELEX. The
chosen 12S and 12L DNA aptamers were character-
ized by the CD spectra and dissociation constants of
their complexes with human IL-6.
The constants of dissociation of the complexes of
the aptamers with the protein obtained using SPR
were nanomolar, which corresponds to the constants
of dissociation of natural specific complexes of anti-
gens and antibodies. The biotinylated forms of the
DNA aptamers had the ability to bind to MNPs that
were activated with streptavidin, which makes it possi-
ble to proceed with the creation of a nanosensor bio-
magnetic immunoassay system.
ACKNOWLEDGMENTS
This study was supported by the Ministry of Edu-
cation and Science of the Russian Federation, con-
MOSCOW UNIVERSITY PHYSICS BULLETIN
Kd (s–1) Standard deviation ( s–1)
1.9 × 10–2 1.0 × 10–3
5.9 × 10–3 0.3 × 10–3
tract no. 14.616.21.0011; the unique identifier of the
project is RFMEFI61614X0011.
REFERENCES
1. F. Öisjöen, J. F. Schneiderman, M. Zaborowska, et al.,
IEEE Trans. Appl. Supercond. 19, 848 (2009).
2. A. P. Astalan, F. Ahrentorp, C. Johansson, et al., Bios-
ens. Bioelectron. 19, 945 (2004).
3. R. M. Ferguson, A. P. Khandhar, C. Jonasson, et al.,
IEEE Trans. Magn. 49, 3441 (2013).
4. R. R. Breaker and G. F. Joyce, Trends Biotechnol. 12,
268 (1994).
5. L. Gold, B. Polisky, O. Uhlenbeck, et al., Annu. Rev.
Biochem. 64, 763 (1995).
6. B. E. Eaton, L. Gold, B. J. Hicke, et al., Bioorg. Med.
Chem. 5, 1087 (1997).
7. S. E. Osborne, I. Matsumura, and A. D. Ellington,
Curr. Opin. Chem. Biol. 1, 5 (1997).
8. A. M. Kopylov and V. A. Spiridonova, Mol. Biol. 34,
940 (2000).
9. A. V. Kul’bachinskii, Usp. Biol. Khim. 46, 193 (2006).
10. V. A. Spiridonova, Biochem. (Moscow) Suppl. Ser. B:
Biomed. Chem. 4, 138 (2010).
11. C. Tuerk and L. Gold, Science 249, 505 (1990).
12. A. D. Ellington and J. W. Szostak, Nature 346, 818
(1990).
13. R. C. Conrad, S. Baskerville, and A. D. Ellington, Mol.
Diversity 1, 69 (1995).
14. T. Maniatis, E. F. Fritsch, and J. Sambrook, Molecular
Cloning: A Laboratory Manual (New York, 1982; Mos-
cow, 1984).
15. Y. Qin and L. H. Hurley, Biochimie 90, 1149 (2008).
16. S. Neidle, FEBS J. 277, 1118 (2010).
17. J. Bidzinska, G. Cimino-Reale, N. Zaffaroni, et al.,
Molecules 18, 12368 (2013).
Translated by E. Berezhnaya
Vol. 71 No. 1 2016