www.kidney-international.
org
b-hydroxybutyrate attenuates renal
ischemia-reperfusion injury through
its anti-pyroptotic effects
Takaya Tajima1, Ayumi Yoshifuji1, Ayumi Matsui1, Tomoaki Itoh1, Kiyotaka Uchiyama1, Takeshi Kanda1,
Hirobumi Tokuyama1, Shu Wakino1 and Hiroshi Itoh1
1
Department of Internal Medicine, School of Medicine, Keio University, Tokyo, Japan
Ketone bodies including b-hydroxybutyrate (b-OHB) have
been shown to protect against ischemic tissue injury when
present at low concentrations. We evaluated the impact of
b-OHB on renal ischemia/reperfusion injury (IRI). Mice were
treated with a continuous infusion of b-OHB using an
osmotic mini-pump before and after IRI. We also tested the
effects of increasing endogenous serum b-OHB levels by
fasting. Renal IRI was attenuated by b-OHB treatment
compared to saline control, with similar results in the
fasting condition. b-OHB treatment reduced the number of
terminal deoxynucleotidyl transferase–mediated dUTP nick
end-labeling (TUNEL)-positive cells and increased
expression of forkhead transcription factor O3 (FOXO3), an
upstream regulator of pyroptosis. Although b-OHB
treatment did not impact markers of apoptosis, it
decreased the expression of caspase-1 and
proinflammatory cytokines, indicating that b-OHB blocked
pyroptosis. In a human proximal tubular cell line exposed
to hypoxia and reoxygenation, b-OHB reduced cell death in
a FOXO3-dependent fashion. Histone acetylation was
decreased in kidneys exposed to IRI and in proximal
tubular cells exposed to hypoxia and reoxygenation, and
this effect was ameliorated by b-OHB through the
inactivation of histone deacetylases. In vitro, b-OHB
treatment restored histone acetylation at the FOXO3
promoter. Consistent with epigenetic molecular effects, the
renoprotective effects of b-OHB were still observed when
the continuous infusion was stopped at the time of IRI.
Thus, b-OHB attenuates renal IRI through anti-pyroptotic
effects, likely mediated by an epigenetic effect on FOXO3
expression.
Kidney International (2019) -, -–-; https://doi.org/10.1016/
j.kint.2018.11.034
KEYWORDS: acute kidney injury; cell death; cell survival; inflammation;
ischemia reperfusion
Copyright ª 2019, International Society of Nephrology. Published by
Elsevier Inc. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Correspondence: Shu Wakino, Department of Internal Medicine, School of
Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582,
Japan. E-mail: shuwakino@z8.keio.jp
Received 16 April 2018; revised 16 November 2018; accepted 21
November 2018
Kidney International (2019) -, -–-
basic research
OPEN
Translational Statement
In this study, endogenous ketone body, b-hydrox-
ybutyrate is shown to alleviate renal ischemia-reperfu-
sion injury through its antipyroptotic effects. Its effects
were dependent on forkhead transcription factor O3
induction and associated with epigenetic gene regula-
tion through increased histone acetylation. Dietary or
pharmacological approaches to elevate b-hydrox-
ybutyrate levels hold promise in reducing the severity of
acute kidney injury including postsurgery acute kidney
injury and ensued chronic kidney disease progression as
well. Of note, because the involvement of epigenetic
gene modulation, priming gene expressions by
b-hydroxybutyrate before renal insults including surgery
can protect the kidney against acute kidney injury. Novel
therapy, the pretreatment with b-hydroxybutyrate, can
be a novel prophylactic strategy against acute kidney
injury.
etone bodies are small, lipid-derived molecules that
K serve as a circulating energy source for tissues in times
of fasting or prolonged exercise.1 The term "endoge-
nous ketone bodies" refers to 3 molecules: acetoacetate, b-
hydroxybutyrate (b-OHB), and acetone. Most ketone bodies
are produced in the liver, although smaller amounts may be
produced in other tissues.2 The level of b-OHB in blood in-
creases to 1 to 2 mmol/l while fasting, during which the liver
switches to fatty acid oxidation,2,3 and to even higher concen-
trations during prolonged periods of fasting (6–8 mmol/l)4
and in diabetic ketoacidosis (>25 mmol/l).5 Many studies
have shown that ketosis is associated with accelerated aging.
Thus, increased ketone levels in the body cause age-related
metabolic diseases.1 However, accumulating evidence has
shown that ketone bodies in low concentrations have benefi-
cial effects. Some studies have shown that b-OHB, at low con-
centrations, has antioxidative and anti-inflammatory effects6
and that exogenous b-OHB has therapeutic effects in stress
conditions, such as hemorrhagic shock,7,8 extensive burns,9
and cerebral hypoxia, anoxia, and ischemia.10 One of the pu-
tative mechanisms where ketone has a protective role against
tissue injuries is its effects on pyroptosis.11 Pyroptosis is a
unique type of programmed cell death that is distinct from
1
basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 1 | The effects of b–hydroxybutyrate (b-OHB) on renal function and histology. (a) b-OHB plasma levels were measured 24 hours
before and after sham or ischemia-reperfusion (IR) operation. (b,c) Blood urea nitrogen levels (b) and serum levels of (continued)

2 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI basic research

apoptosis and necrosis.12,13 Caspase-1 is a key molecule that P < 0.01) (Figure 1b). Serum creatinine level also significantly
leads to the induction of pyroptosis. Proinflammatory factors, increased to 0.43
0.09 mg/dl in the phosphate-buffered
such as pro-interleukin (IL)-1b and pro-IL-18, can be acti- saline–treated IR group compared with that in the
vated by caspase-1 cleavage and trigger or aggravate inflam- phosphate-buffered saline–treated sham group (0.14
0.01
matory responses.14–16 Therefore, pyroptosis may not only mg/dl, P < 0.01). Treatment with b-OHB reduced the level of
lead to cell death, but it may also play an important role in serum creatinine in IR-injured mice (0.24
0.02 mg/dl, P <
the cascade of reactions that lead to damaged surrounding tis- 0.05) (Figure 1c). In histological findings, IR-injured kidneys
sues.17 One of the upstream molecules of pyroptosis is forkhead exhibited brush border loss, vacuolization, and desquamation
transcription factor O3 (FOXO3). FOXO3 is a major transcrip- of epithelial cells in renal tubules. Tubular injuries were
tion factor that has functions associated with cell cycle arrest, assessed by tubule-interstitial injury score both in hematox-
oxidative scavenging, cell proliferation, survival, and death.18,19 ylin and eosin section (Figure 1d) and in periodic acid–Schiff
FOXO3 upregulates the expression of apoptosis repressor with section (Figure 1e) as described in the Materials and Methods
caspase recruitment domain (ARC), which leads to section. Both assays revealed that IR significantly increased
downregulation of the expression of caspase-1 and downstream tubule-interstitial injury scores. The tubule-intestinal injury
proinflammatory factors for pyroptosis.20–22 It has been re- assessed by these scores was significantly attenuated by the
ported that b-OHB treatment almost completely blocked pyrop- treatment with b-OHB (Figure 1d and e).
tosis induced by adenosine triphosphate and monosodium urate
crystals in macrophages,11 although the effects on renal protec- The effects of 2-day fasting and b-OHB on renal function in
tion through the regulation of pyroptosis are scarcely reported. mice with IR injury
In this study, we explored the effects of b-OHB on acute Because fasting condition is well known to increase serum
renal injuries induced by ischemia-reperfusion (IR) insults levels of b-OHB endogenously, we tested the effects of fasting
and elucidated the molecular mechanisms behind this effect. on the renal function with IR injuries. Male C57BL/6J mice
We demonstrated b-OHB has an antipyroptotic potency and were either fasted for 2 days or fed ad libitum (nonfasted)
protective function against renal IR injuries. preceding surgery. After 2 days fasting, the body weight
significantly decreased as compared to that in nonfasted
RESULTS group (Figure 2a). The plasma levels of b-OHB increased in
The effects of b-OHB on renal function and renal histology in the fasted sham and the fasted IR groups as compared to
mice with IR injury those in nonfasted sham and nonfasted IR groups (Figure 2b).
We used implanted osmotic pumps to administer exogenous The level of blood urea nitrogen and creatinine significantly
b-OHB or phosphate-buffered saline. The plasma levels of b- increased in the nonfasted IR group compared with that in
OHB increased to 1.28
0.34 mmol/l in the b-OHB-treated the nonfasted sham group. Fasting preconditioning reduced
sham group versus 0.33
0.05 mmol/l in phosphate-buffered the levels of both blood urea nitrogen and creatinine in IR-
saline–treated sham group (P < 0.01), and to 1.35
0.36 injured mice (Figure 2c and d, respectively). These data
mmol/l in the b-OHB-treated IR group versus 0.31
0.04 indicated that fasting reversed renal dysfunction in IR-injured
mmol/l in phosphate-buffered saline–treated IR group (P < mouse kidneys, which can be associated with the increase in
0.01), 24 hours after the administration of b-OHB. Twenty- serum b-OHB levels. We further examined an additive effect
four hours after the operation, plasma levels of b-OHB by fasting and continuous infusion of b-OHB. The fasting
were sustained at 1.40
0.28 mmol/l in the b-OHB-treated group was fasted for 2 days preoperatively and implanted with
sham group versus 0.37
0.05 mmol/l in phosphate-buffered osmotic pumps to administer exogenous b-OHB or
saline–treated sham group (P < 0.01), and at 1.33
0.32 phosphate-buffered saline for 1 day before surgery. After 2
mmol/l in the b-OHB-treated IR group versus 0.35
0.05 days, the mean weight decreased in fasting groups both with
mmol/l in phosphate-buffered saline–treated IR group (P < and without b-OHB infusion. The administration of b-OHB
0.01) (Figure 1a). The level of blood urea nitrogen signifi- for 1 day did not affect body weight loss (Figure 2e). The
cantly increased to 86.6
9.54 mg/dl in the phosphate- plasma levels of b-OHB increased both in the nonfasted IR
buffered saline–treated IR group compared with that in the with b-OHB group and in the fasted IR group as compared to
phosphate-buffered saline–treated sham group (33.0
1.38 the nonfasted IR group. The level of b-OHB further increased
mg/dl, P < 0.01). b-OHB treatment reduced the level of in the fasted IR with b-OHB group at the operation to the
blood urea nitrogen in IR-injured mice (47.0
3.05 mg/dl, concentration of 4.73
0.24 mmol/l (Figure 2f). The level of
=
Figure 1 | (continued) creatinine (c) in each mice group; phosphate-buffered saline–treated sham-operated mice, b-OHB-treated sham
(shamþb-OHB), phosphate-buffered saline–treated IR-operated mice, and b-OHB-treated IR (IRþb-OHB). (d) Representative kidney section
stained for hematoxylin and eosin in each mice group. Arrowheads indicate inflammatory cells or cell debris. Bar graph in the lower panel
represents semiquantitative analysis of tubule interstitial injury. (e) Representative kidney section stained with periodic acid–Schiff in each mice
group. Arrowheads indicate brush border. Bar graph in the lower panel represents semiquantitative analysis of tubular injury. (d,e) Original
magnification 200. Insets: increased magnification 500. Bars ¼ 50 mm. Insets are more magnified view of tubular cells. Inset bars ¼ 20 mm.
##
P < 0.01 versus sham, **P < 0.01 versus IR, *P < 0.05 versus IR. n ¼ 6 for sham and shamþb-OHB, n ¼ 8 for IR and IRþb-OHB. Bar represents
mean
SEM. To optimize viewing of this image, please see the online version of this article at www.kidney-international.org.

Kidney International (2019) -, -–- 3

basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 2 | The effects of 2-day fasting and b-hydroxybutyrate (b-OHB) on renal function in mice with ischemia-reperfusion (IR) injury.
(a–d) The effects of 48-hour fasting on IR injury. Body weights (a) and b-OHB plasma levels (b) were measured 48 hours before (continued)

4 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI basic research

both blood urea nitrogen and creatinine significantly
increased in the nonfasted IR group compared with that in
the nonfasted sham group. Both fasting and the treatment of
b-OHB reduced the level of blood urea nitrogen and creati-
nine in IR-injured mice. However, combined treatment with
fasting and b-OHB treatment failed to show an additive effect
on these levels to that of fasting condition and b-OHB
infusion (Figure 2g and h). These data indicated ketone
bodies in low concentrations have beneficial effects, on the
other hand, high b-OHB level around 4 to 5 mmol/l might
not show higher renoprotective effects or possibly may
worsen acute kidney injury.
b-OHB suppressed the pyroptosis in IR-injured kidneys
To evaluate the effect of b-OHB on renal cell deaths in IR-
injured kidneys, we first performed the terminal deoxy-
nucleotidyl transferase–mediated dUTP nick end-labeling
(TUNEL) assay, the classical method for the identification
of the apoptotic cells. TUNEL assay showed a significant in-
crease in TUNEL-positive cell number in kidneys of IR-
injured mice as compared to that of sham-treated mice.
Treatment with b-OHB significantly reduced the number of
TUNEL-positive cells in IR-injured kidneys (Figure 3a). This
suggested that b-OHB has renal protective roles in IR injury
by its antiapoptotic effects. However, the expressions of
apoptotic molecular markers, neither Bax (Figure 3b and c)
nor Bcl-2 (Figure 3d and e) were affected by the b-OHB
treatment. We focused on another type of cell death, pyrop-
tosis, and explored the expressions of genes related to
pyroptosis, including FOXO3, ARC, caspase-1, and the
proinflammatory cytokines IL-1b and IL-18. The mRNA
expression and protein expression levels of FOXO3 signifi-
cantly decreased in IR-injured kidneys compared with those
in kidneys of sham-treated mice (Figure 3f and g, respec-
tively). Treatment with b-OHB increased these expression
levels of FOXO3 in IR-injured kidneys. The mRNA expression
level of ARC (Figure 3h) significantly decreased in IR-injured
kidneys as compared with this level in the kidneys of sham-
treated mice. Treatment with b-OHB increased the mRNA
expression level of ARC in IR-injured kidneys. Consistently,
the mRNA expression levels of caspase-1 (Figure 3i), IL-1b
(Figure 3j), and IL-18 (Figure 3k) significantly increased
in IR-injured kidneys as compared with those in kidneys
of sham-treated mice. Treatment with b-OHB decreased
the mRNA expression levels of these genes in IR-injured
kidneys.
The effects of b-OHB on pyroptosis in hypoxic HK-2 cells
The effects of b-OHB on pyroptosis were examined using a
human proximal tubular cell line, human kidney-2 (HK-2)
cells, which were exposed to hypoxia (5% CO2, 1% O2) for 24
hours followed by 12 hours of reoxygenation (5% CO2, 21%
O2) with or without b-OHB. Cell viability assay revealed that
0 to 10 mmol/l b-OHB had little effect on cell viability. Cell
viability decreased in hypoxic-treated HK-2 cells compared
with that in normoxic HK-2 cells, although cell viability
significantly decreased in normoxic HK-2 cells by the treat-
ment with 20 and 40 mmol/l b-OHB. These data indicated
the high concentration of b-OHB has cellular toxic effects.
The treatment with b-OHB significantly improved cell
viability in hypoxic HK-2 cells up to the concentration of 10
mmol/l (Figure 4a), while higher concentration of b-OHB
decreased cell viability. To evaluate the effect of b-OHB on
pyroptosis and apoptosis, we measured the expression of
genes related to pyroptosis and apoptosis activation,
including FOXO3 (Figure 4b), ARC (Figure 4c), caspase-1
(Figure 4d), the proinflammatory cytokines IL-1b
(Figure 4e), IL-18 (Figure 4f), Bax (Figure 4g), and Bcl-2
(Figure 4h). The mRNA expression levels of FOXO3 and
ARC significantly decreased in hypoxic HK-2 cells as
compared to those in normoxic HK-2 cells. These decreases
were ameliorated by treatment with b-OHB at the dose of 10
mmol/l (Figure 4b and c, respectively). The mRNA expres-
sion levels of caspase-1, IL-1b, and IL-18 significantly
increased in hypoxic HK-2 cells as compared to those in
normoxic HK-2 cells. These increases were attenuated by the
treatment with b-OHB at the dose of 10 mmol/l (Figure 4d, e,
and f, respectively). The mRNA expression levels of Bax were
significantly increased and those of Bcl-2 were significantly
decreased in hypoxic HK-2 cells as compared to those in
normoxic HK-2 cells. These increases or decreases were not
affected by treatment b-OHB (Figure 4g and h, respectively).
These data indicated that these in vivo effects of treatment
with b-OHB in renal IR injury can be due to the direct
antipyroptotic action on renal proximal tubular cells.
In IR injury, reperfusion insult following ischemia is very
critical due to the increase in oxidative stress followed by the
induction of inflammatory response and cell death. To
explore the effect of b-OHB on the oxidative stress, we treated
them with H2O2, which is the main culprit in the patho-
genesis of IR injury.23 The mRNA expression level of FOXO3
significantly decreased in H2O2-treated HK-2 cells at the
concentration of 2 mmol/l (Figure 4i). Cell viability decreased

=
Figure 2 | (continued) and at the time of the sham or IR operation. Blood urea nitrogen levels (c) and serum levels of creatinine
(d) were measured 24 hours after the sham or IR operation. ##P < 0.01 versus nonfasted sham-operated mice (shamþnonfasted),
#
P < 0.05 versus shamþnonfasted, **P < 0.01 versus nonfasted IR-operated mice (IRþnonfasted), and *P < 0.05 versus IRþnonfasted. n ¼ 3
for shamþnonfasted and shamþfasted; n ¼ 4 for IRþnonfasted and IRþfasted. (e–h) The combined effects of b-OHB treatment and
fasting on IR injury. Body weights (e) and b-OHB plasma levels (f) were measured 48 hours before and at the time of the sham or IR operation.
##
P < 0.01 versus phosphate-buffered saline–treated nonfasted mice with IR operation (IRþnonfasted), #P < 0.05 versus IRþnonfasted,
and **P < 0.01 versus b-OHB–treated nonfasted mice with IR operation (IRþnonfastedþb-OHB). Blood urea nitrogen levels (g) and serum
levels of creatinine (h) were measured 24 hours after the sham or IR operation. ##P < 0.01 versus phosphate-buffered saline–treated
nonfasted mice with sham operation (shamþnonfasted), **P < 0.01 versus IRþnonfasted, *P < 0.05 versus IRþnonfasted,
$
P < 0.05 versus IRþnonfastedþb-OHB, ¶¶P < 0.01 versus phosphate-buffered saline–treated fasted mice with IR operation (IRþfasted),
and ¶P < 0.05 versus IRþfasted. n ¼ 6 for each mouse group. Bar represents mean
SEM.
Kidney International (2019) -, -–- 5
basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 3 | The effect of b-hydroxybutyrate (b-OHB) on pyroptosis in ischemia-reperfusion (IR) injured kidneys. (a) Representative results
of terminal deoxynucleotidyl transferase–mediated dUTP nick end-labeling (TUNEL) staining of the kidney section in each mice group.
Arrowheads indicate TUNEL-positive cells. Bars ¼ 50 mm. Semiquantitative analysis of TUNEL-positive cells is shown in right panel. Original
magnification 200. (b–k) The quantitative real-time polymerase chain reaction analysis of mRNA expressions and Western blot analysis of
markers related to apoptosis and pyroptosis activation including Bax (b,c), Bcl-2 (d,e), forkhead transcription (continued)

6 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI
in H2O2-treated HK-2 cells compared with that in control
HK-2 cells at 3 hours and 6 hours after the stimulation with
H2O2. The treatment with b-OHB significantly improved cell
viability in H2O2-treated HK-2 cells at the dose of 10 mmol/l
(Figure 4j). To evaluate the effect of b-OHB on pyroptosis in
H2O2-treated HK-2 cells, we measured the expression of
genes related to pyroptosis activation, including FOXO3,
ARC, caspase-1, and the proinflammatory cytokines IL-1b
and IL-18 (Figure 4k). The mRNA expression levels of
FOXO3 and ARC significantly decreased in H2O2-treated
HK-2 cells as compared to those in control HK-2 cells. These
decreases were ameliorated by treatment with b-OHB at the
dose of 10 mmol/l. The mRNA expression levels of caspase-1,
IL-1b, and IL-18 significantly increased in H2O2-treated
HK-2 cells as compared to those in control HK-2 cells. These
increases were attenuated by the treatment with b-OHB at the
dose of 10 mmol/l.
The effects of FOXO3 gene knockdown on pyroptotic-related
genes expression in HK-2 cells
Our data suggested that the downregulation of FOXO3
could contribute to trigger pyroptosis pathway in hyp-
oxic HK-2 cells. We first examined the effects of FOXO3
expression on pyroptotic-related genes by using gene
silencing of FOXO3. Transfection with small, interfering
RNA (siRNA) targeted against the human FOXO3 gene
downregulated FOXO3 mRNA expression in HK-2 cells
with or without cellular hypoxic insults by using hyp-
oxia incubator (Figure 5a). This siRNA downregulated
the mRNA expressions of ARC (Figure 5b) and up-
regulated pyroptosis-related genes caspase-1 (Figure 5c),
IL-1b (Figure 5d), and IL-18 (Figure 5e) in HK-2 cells with
or without cellular hypoxic insults. These data indicated
that a set of pyroptotic genes is constitutively regulated by
the expression levels of FOXO3 in HK-2 cells.
The effects of FOXO3 knockdown on b-OHB mediated
antipyroptosis effects in hypoxic HK-2 cells
We next investigate the potential mechanism of b-OHB-
mediated antipyroptotic gene regulation. We transfected
FOXO3 siRNA into HK-2 cells under hypoxic conditions by
hypoxia incubator with the treatment with b-OHB. With this
siRNA, the upregulation of ARC and downregulation of
caspase-1, IL-1b, and IL-18 by the treatment with b-OHB in
hypoxic HK-2 cells were abrogated (Figure 6a to d, respec-
tively). Finally, the protective effects on hypoxic cell viability
by b-OHB were also blocked by the transfection of siRNA for
FOXO3 gene (Figure 6e). These data indicated that the protec-
tive effects by b-OHB on renal tubular cell was through FOX-
O3-dependent regulatory mechanism of pyroptosis pathway.
=
Figure 3 | (continued) factor O3 (FOXO3) (f,g), apoptosis repressor with caspase recruitment domain (ARC) (h), caspase-1 (i), as well
as the proinflammatory cytokines interleukin-1b (IL-1b) (j) and IL-18 (k) in each mouse group. The experimental groups consist of
phosphate-buffered saline–treated mice with sham operation (n ¼ 6), b-OHB–treated sham mice (shamþb-OHB) (n ¼ 6),
phosphate-buffered saline–treated mice with IR injury (n ¼ 8), and b-OHB–treated IR mice (IRþb-OHB) (n ¼ 8). ##P < 0.01 versus sham,
#
P < 0.05 versus sham, **P < 0.01 versus IR, *P < 0.05 versus IR. Bar represents mean
SEM. GAPDH, glyceraldehyde-3-phosphate
dehydrogenase. To optimize viewing of this image, please see the online version of this article at www.kidney-international.org.
Kidney International (2019) -, -–-
basic research
b-OHB upregulated histone acetylation in IR-injured kidneys
and hypoxic HK-2 cells
b-OHB was recently reported as an endogenous inhibitor of
several histone deacetylases (HDACs), including classes I and
IIa,24 which usually function as gene silencers. It has been
reported that the treatment of kidney cells with b-OHB
increased lysine-9 acetylation in histone H3 (AcH3K9) at the
FOXO3 promoter and caused upregulation of mRNA
expression of FOXO3.24 We supposed that the HDAC inhi-
bition by b-OHB contributed to FOXO3 gene regulation.
Immunoblotting analysis using antibodies against AcH3K9
revealed that in IR-injured kidneys, AcH3K9 levels decreased
compared with those in the kidneys of sham-treated mice.
Treatment with b-OHB increased AcH3K9 levels in both
sham-treated and IR-injured kidneys (Figure 7a). The alter-
ation of AcH3K9 levels implied the changes in the activities of
HDACs or histone acetyltransferases (HATs). Both HDAC and
HAT activities decreased in IR-injured kidneys as compared to
those in sham-treated mice, indicating that the decrease in
HAT activity played a more significant role in the decreased
levels of AcH3K9 in IR-injured kidney. The treatment with b-
OHB further decreased HDACs activities in IR-injured kid-
neys. On the other hand, b-OHB did not affect HAT activity
in IR-injured kidneys (Figure 7b). These data indicated that
the reversal of AcH3K9 levels by b-OHB treatment was
attributed to its inhibitory effects on HDAC activity. We
further examined this effect of b-OHB on the acetylation of
H3K9 in HK-2 cells subject to hypoxic insult in hypoxia
incubator. We found that histone acetylation levels decreased
in hypoxic HK-2 cells as compared to those in normoxic HK-
2 cells. Treatment with b-OHB at the dose of 10 mmol/l
increased the histone acetylation levels in hypoxic HK-2 cells
(Figure 7c). We subsequently investigated the activities of
HDACs and HATs in HK-2 cells. Both HDAC and HAT activities
decreased in hypoxic HK-2 cells compared with those in nor-
moxic HK-2 cells. Treatment with b-OHB at the dose of 10
mmol/l decreased HDAC activities in hypoxic HK-2 cells, while
HAT activities were not altered by b-OHB at any dosage of 1 to
10 mmol/l (Figure 7d) in hypoxic HK-2 cells. Finally, chromatin
immunoprecipitation analysis of the FOXO3 promoter with
distinct primer pairs for FOXO3 promoter revealed decreased
histone H3K9 acetylation at FOXO3 promoter in hypoxic HK-2
cells as compared to those in normoxic HK-2 cells. Treatment
with b-OHB at the dose of 10 mmol/l increased histone H3K9
acetylation at FOXO3 promoter in hypoxic HK-2 cells
(Figure 7e). Combined with the previous reports that AcH3K9
levels at the FOXO3 promoter regulates FOXO3 gene expres-
sion,24 our data suggested that FOXO3-dependent antipyroptotic
action by b-OHB might result from the inhibition of HDAC
7
basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 4 | The effect of b-hydroxybutyrate (b-OHB) on pyroptosis in hypoxic and H2O2-treated human kidney-2 (HK-2) cells. (a) Cell
viability in normoxic and hypoxic HK-2 cells treated with increasing concentrations of b-OHB. ##P < 0.01 versus normoxic HK-2 (continued)

8 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI basic research

Figure 5 | The effect of forkhead transcription factor O3 (FOXO3) knockdown on pyroptosis related genes in human kidney-2 (HK-2)
cells. HK-2 cells were transfected with small, interfering RNAs (siRNAs) specific for the human FOXO3 gene or negative control siRNA and subject
to hypoxic insults by using hypoxia incubator. The quantitative real-time polymerase chain reaction analysis of mRNA expression levels of
FOXO3 (a), apoptosis repressor with caspase recruitment domain (ARC) (b), caspase-1 (c), interleukin-1b (IL-1b) (d), and IL-18 (e). ##P < 0.01 versus
normoxic HK-2 cells with control siRNA, #P < 0.05 versus normoxic HK-2 cells with control siRNA, **P < 0.01 versus hypoxic HK-2 cells with
control siRNA. *P < 0.05 versus hypoxic HK-2 cells with control siRNA. n ¼ 5 in each experimental group. Bar represents mean
SEM.

activity and the amelioration of the decreased acetylation of
H3K9 by IR insults.
The renoprotective effects of b-OHB in the case that
continuous infusion is stopped after IR insult
Considering epigenetic effects by b-OHB, we hypothesized
that the effects of b-OHB on pyroptosis in IR-injured kidneys
could sustain even if continuous infusion is stopped and
without the infusion of b-OHB just after renal IR insult. We
continuously infused b-OHB just for 24 hours by the time of
IR (24-hour group) and stopped infusing, while in the orig-
inal experiments, we infused b-OHB for 24 hours before and
after the time of IR, that is, for 48 hours in total (48-hour
group). The plasma levels of b-OHB increased both in the

=
Figure 4 | (continued) cells, **P < 0.01 versus hypoxic HK-2 cells without b-OHB, *P < 0.05 versus hypoxic HK-2 cells without b-OHB, ¶¶P < 0.01
versus hypoxic HK-2 cells with 10 mmol/l (mM) of b-OHB, ¶P < 0.05 versus hypoxic HK-2 cells with 10 mM of b-OHB. The quantitative
real-time polymerase chain reaction analysis of mRNA expression levels of forkhead transcription factor O3 (FOXO3) (b), apoptosis repressor
with caspase recruitment domain (ARC) (c), caspase-1 (d), interleukin-1b (IL-1b) (e), IL-18 (f), Bax (g), and Bcl-2 (h) in hypoxic HK-2 cells. ##P < 0.01
versus normoxic HK-2 cells, **P < 0.01 versus hypoxic HK-2 cells without b-OHB, *P < 0.05 versus hypoxic HK-2 cells without b-OHB. n ¼ 5 in
each experimental group. (i) Time-dependent FOXO3 mRNA expression in HK-2 cells treated with 2 mM of H2O2. ##P < 0.01 versus control HK-2 cells,
**P < 0.01 versus H2O2-treated HK-2 cells for 3 hours, *P < 0.05 versus H2O2-treated HK-2 cells for 3 hours. n ¼ 4 in each experimental group.
(j) The effects of b-OHB (10 mM) on cell viability in H2O2 (2 mM)-treated HK-2 cells. ##P < 0.01 versus control HK-2 cells, **P < 0.01 versus. H2O2
(2 mM)-treated HK-2 cells, *P < 0.05 versus H2O2 (2 mM)-treated HK-2 cells. n ¼ 5 in each experimental group. (k) The effects of b-OHB (10 mM)
on mRNA expression levels of FOXO3, ARC, caspase-1, IL-1b, and IL-18 in H2O2-treated HK-2 cells. ##P < 0.01 versus control HK-2 cells, *P < 0.05
versus H2O2 (2 mM)-treated HK-2 cells. n ¼ 5 in each experimental group. Bar represents mean
SEM.

Kidney International (2019) -, -–- 9

basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 6 | The effect of forkhead transcription factor O3 (FOXO3) knockdown on b-hydroxybutyrate (b-OHB)–mediated antipyroptosis
in hypoxic human kidney-2 (HK-2) cells. The quantitative real-time polymerase chain reaction analysis of mRNA expression levels of apoptosis
repressor with caspase recruitment domain (ARC) (a), caspase-1 (b), interleukin-1b (IL-1b) (c), and IL-18 (d), as well as cell viability (e) in
b-OHB–treated hypoxic HK-2 cells transfected with small, interfering RNAs (siRNAs) specific for the human FOXO3 gene or negative control
siRNA. $$P < 0.01 versus hypoxic HK-2 cells, $P < 0.05 versus hypoxic HK-2 cells, ##P < 0.01 versus b-OHB (10 mmol/l [mM])–treated hypoxic
HK-2 cells, **P < 0.01 versus b-OHB (10 mM)–treated hypoxic HK-2 cells transfected with control siRNA. n ¼ 5 in each experimental group.
Bar represents mean
SEM.

24-hour group and the 48-hour group as compared with that
in phosphate-buffered saline–treated IR group. However, 24
hours after IR insults, the plasma levels of b-OHB in the 24-
hour group were dropped to the level in phosphate-buffered
saline–treated IR group (Figure 8a). Twenty-four hours after
IR insult, the levels of both blood urea nitrogen and creatinine
significantly increased in the phosphate-buffered saline–
treated IR group compared with that in the phosphate-
buffered saline–treated sham group. The treatment with
b-OHB significantly reduced the level of both blood urea
nitrogen and creatinine both in the 24 hour and the 48 hour
groups (Figure 8b and c, respectively). The mRNA expression
levels of FOXO3 (Figure 8d) and ARC (Figure 8e) significantly
decreased in IR-injured kidneys as compared with those in the
kidneys of sham-treated mice. Treatment with b-OHB
increased the mRNA expression levels of these genes both
in the 24-hour group and the 48-hour group. Consistently,
the mRNA expression levels of caspase-1 (Figure 8f), IL-1b
(Figure 8g), and IL-18 (Figure 8h) significantly increased in
IR-injured kidneys as compared with those in kidneys of
sham-treated mice. Treatment with b-OHB decreased the
mRNA expression levels of these genes both in the 24-hour
group and the 48-hour group. Immunoblotting analysis
revealed that in IR-injured kidneys, AcH3K9 levels
decreased compared with those in those of sham-treated
mice. Treatment with b-OHB increased AcH3K9 levels
both in the 24-hour group and the 48-hour group
(Figure 8i). These data indicated that the effects of b-OHB
were observed even if continuous infusion is stopped after
IR insult and that the priming FOXO3-dependent pathway
through epigenetic effects have long-term effects of renal
protection.

10 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI basic research

Figure 7 | The effects of b-hydroxybutyrate (b-OHB) on histone acetylation and the activities of histone deacetylases (HDACs)/histone
acetyltransferases (HATs) in ischemic-reperfusion (IR)–injured kidneys and hypoxic human kidney-2 (HK-2) cells. (a) The expression
of acetyl-histone H3 and histone H3 in each mouse group; phosphate-buffered saline–treated mice with sham operation (n ¼ 6),
b-OHB–treated sham (shamþb-OHB) (n ¼ 6), phosphate-buffered saline–treated mice with IR injury (n ¼ 8), and b-OHB–treated IR (IRþb-OHB)
(n ¼ 8). The lower panel represents the quantification of band intensity. (b) HDAC activities (left panel) and HAT activities (right panel) in
each mouse group. (a,b) ##P < 0.01 versus sham, #P < 0.05 versus sham, *P < 0.05 versus IR. (c) The expression of acetyl-histone H3 in (continued)

Kidney International (2019) -, -–- 11

basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

DISCUSSION Most investigators agree that a normal serum level of b-

In the present study, we have demonstrated that b-OHB
reversed renal dysfunction and reduced pyroptosis in IR-
injured mouse kidneys. The renoprotective effects of b-
OHB on renal IR injury may be mediated via antipyroptotic
mechanisms, the effects of which were dependent on FOXO3
upregulation and were associated with increased H3K9 acet-
ylation (Figure 9).
We first tried to develop an appropriate experimental
model in which plasma b-OHB levels were maintained at the
effective levels for organ protection. For this purpose, we
implanted mice with an i.p. pump (model 2001D; ALZET
Osmotic Pumps, DURECT Corp., Cupertino, CA) delivering
b-OHB, to increase b-OHB levels to approximately 1.3
mmol/l in the sham group 24 hours after administration and
to 1.4 mmol/l at 48 hours after administration. A previous
study showed that plasma b-OHB levels increased to 1.2

0.1 mmol/l with administration of b-OHB via an i.p. pump
for 24 hours and enhanced the resistance of the mouse kidney
to oxidative stress by paraquat.24 Another study demonstrated
that b-OHB prevented neural damage in a mouse stroke
model by subcutaneous treatment at a dosage of 8 mg/h,
which we used in this study.25 Finally, the protocol used in
this study facilitated sufficient delivery of b-OHB over a
longer period and revealed the detailed mechanisms of action
besides antipyroptotic effects. To confirm this renoprotective
effect, we investigated the effects of preoperative fasting on
renal IR injury and the plasma b-OHB levels in male C57BL/
6J mice. Previous research showed that applying short periods
of dietary restriction (2 and 4 weeks with 30% dietary re-
striction) as well as 3 days of fasting, conveyed strong pro-
tection against morbidity and mortality induced by IR injury
in the kidney.26–28 In our experiments, 2 days fasting had a
significant improved renal dysfunction in IR-injured mouse
kidneys, which was associated with plasma b-OHB levels
increased to approximately 2.0 mmol/l, which is similar to
serum levels in our b-OHB infusion experiments (Figure 1a).
However, the effects of b-OHB seem to be complex, because
raising b-OHB up to 5 mmol/l by the combination of 2 days
of fasting and continuous infusion failed to show the recovery
from IR injury. The toxic effects we have shown in in vitro
experiments (Figure 4a) might cancel the tissue protective
effects. Consistently with our study, previous study also
showed b-OHB impaired the cell viability of mouse bone
marrow–derived macrophages at a concentration of 20
mmol/l, while it did not impair the cell viability at a con-
centration of 10 mmol/l increased cellular proliferation.29
OHB is less than 0.5 mmol/l; a level greater than 1.0 mmol/l
can be defined as hyperketonemia, and a level greater than 3.0
mmol/l can be defined as ketoacidosis.30 Metabolic acidosis is
an independent risk factor for the development of acute
kidney injury.31 Ketoacidosis is also shown to be associated
with significant mortality and morbidity.32 Therefore, higher
b-OHB might worsen renal function in IR-injured mouse
kidneys and optimal serum levels lower than approximately
3.0 mmol/l are required for tissue protection.
We revealed pyroptosis is among the mechanisms for acute
kidney injury by IR injury models. Pyroptosis is characterized
by rapid plasma membrane rupture and the release of
proinflammatory intracellular contents and is morphologi-
cally and mechanistically distinct from other forms of cell
death.33–37 Several studies have indicated that pyroptosis
contributes to infectious diseases, nervous system disorders,
and atherosclerosis.38–40 Pyroptosis is sometimes followed by
the induction of inflammasome formation, which is also
pathogenic for the development of renal tissue damages in IR
injuries. During the development and progression of IR in-
sults, renal cell death and inflammation may influence the
severity and prognosis of IR.41–43 Thus, upregulated levels of
IL-1 family members such as IL-1b and IL-18 in the kidney
tissues and urine may serve as a prognostic factor for the
progression of IR injury.17,44 Moreover, in IL-18 knockout
mice, reduced tubular damage and improved renal function
in IR injury were observed.45 By inhibiting pyroptosis, ketone
treatment reduced the inflammatory changes in IR injuries as
well as decreased the creatinine levels and ameliorated renal
dysfunction.
In the present study, b-OHB decreased TUNEL-positive
cells in IR-injured kidneys. Although we investigated the ex-
pressions of apoptotic molecular markers, Bax and Bcl-2,
neither Bax nor Bcl-2 were affected by the b-OHB treat-
ment. Therefore, we explored and focused on another
mechanism of cell death, pyroptosis, because pyroptotic cells
also show positive TUNEL staining.21 Increasing evidences
have also shown that a necrosis-induced tissue injury pathway
rather than an apoptosis-induced pathway, has an important
role at the early stage of pathological progression of various
types of acute kidney injury.46 In necrosis-induced tissue
damage pathway, necroptosis is a highly orchestrated process,
where the necrotized cells release danger-associated molecular
patterns.47 Subsequently, danger-associated molecular patterns
activate the innate immunity to produce more inflammatory
cytokines including IL-1b and IL-18, which in turn aggravate

=
Figure 7 | (continued) hypoxic HK-2 cells with or without increasing concentrations of b-OHB. The lower graph represents the ratio of
acetyl histone H3 to histone H3. (d) The activities of HDACs (left panel) and HATs (right panel) in hypoxic HK-2 cells treated with b-OHB. (c,d)
##
P < 0.01 versus normoxic HK-2 cells, **P < 0.01 versus hypoxic HK-2 cells without b-OHB, *P < 0.05 versus hypoxic HK-2 cells without
b-OHB. n ¼ 5 in each group. (e) Chromatin immunoprecipitation assay for acetylated H3K9 levels in the forkhead transcription
factor O3 (FOXO3) promoter. The percentage of input DNA values were enrichment levels of immunoprecipitated promoter
fragments determined by quantitative polymerase chain reaction normalized to the level of input (nonimmunoprecipitated) DNA. #P < 0.05
versus normoxic HK-2 cells, **P < 0.01 versus hypoxic HK-2 cells without b-OHB. n ¼ 4 in each group. Bar represents mean
SEM.
AcH3K9, lysine-9 acetylation in histone H3; mM, mmol/l. To optimize viewing of this image, please see the online version of this article at www.
kidney-international.org
12 Kidney International (2019) -, -–-
T Tajima et al.: Effects of b-hydroxybutyrate on IRI basic research

Figure 8 | The effects of b-hydroxybutyrate (b-OHB) on pyroptosis in ischemic-reperfusion (IR)–injured kidneys in the case that
continuous infusion is stopped just after renal ischemic insult. (a) b-OHB plasma levels were measured 24 hours before and (continued)

Kidney International (2019) -, -–- 13

basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Figure 9 | Schema depicting the mechanisms for renoprotection by b-hydroxybutyrate (b-OHB) against ischemia-reperfusion (IR)
injury. In IR injuries, both histone acetyltransferase (HAT) and histone deacetylase (HDAC) activities decreased although the decrease in HAT
activity was more responsible for decreased levels of acetylated H3K9. These changes might downregulate forkhead transcription factor O3
(FOXO3) and apoptosis repressor with caspase recruitment domain (ARC) leading to upregulate caspase-1, interleukin-1b (IL-1b), and IL-18.
These gene alterations resulted in pyroptosis and renal tubular injuries after IR insults. The treatment with b-OHB inhibited HDAC activity and
further reduced the HDAC activity in the IR-injured kidney and ameliorated the decreased levels of acetylated H3K9. This effect by b-OHB
reversed the pyroptosis gene alterations in the IR-injured kidney and ameliorated renal dysfunction.

necrosis and triggers more inflammatory reactions.48,49 We did trigger of apoptotic or pyroptotic cell death as evidenced by
not investigate the expressions of necroptotic molecular markers, the present data showing that gene-silencing of FOXO3 by
including danger-associated molecular patterns. However, there siRNA directly regulated pyroptosis-related genes (Figure 5a
is possibility that the renoprotective effects of b-OHB may also to e). Our data have shown that the treatment with b-OHB
contribute to antinecroptotic mechanisms by decreasing the increased FOXO3 expression both in ischemic kidney
proinflammatory cytokines including IL-1b and IL-18 through (Figure 3f and g) and in hypoxic HK-2 cells (Figure 4b). It is
the upregulation of FOXO3. also reported that the treatment of kidney cells with b-OHB
FOXO3 is involved in the inhibition of cell death and the increased lysine-9 acetylation in histone H3 at the FOXO3
promotion of cellular growth in ischemic renal diseases.50 promoter and caused upregulation of mRNA expression of
Especially, downregulation of FOXO3 can be a primary FOXO3.24 In these backgrounds, we examined the effects by
=
Figure 8 | (continued) after the sham or IR operation in each mouse group; phosphate-buffered saline–treated sham-operated mice,
phosphate-buffered saline–treated IR-operated mice, IR where b-OHB treatment was stopped just after IR operation (IRþb-OHB [24 h]), and IR
treated with b-OHB all through the experimental period (IRþb-OHB [48 h]). Blood urea nitrogen levels (b) and serum levels of creatinine (c) were
measured 24 hours after the sham or IR operation. The quantitative real-time polymerase chain reaction analysis of mRNA expressions of
markers related to pyroptosis activation including forkhead transcription factor O3 (FOXO3) (d), apoptosis repressor with caspase recruitment domain
(ARC) (e), caspase-1 (f), as well as the proinflammatory cytokines interleukin-1b (IL-1b) (g) and IL-18 (h). (i) Western blot analysis of acetyl-histone
H3 and histone H3 in each mice group. The lower panel represents the quantification of band intensity. ##P < 0.01 versus sham, **P < 0.01
versus IR, *P < 0.05 versus IR, $$P < 0.01 versus IRþb-OHB (24 h), and $P < 0.05 versus IRþb-OHB (24 h). n ¼ 4 for each mouse group. Bar
represents mean
SEM. AcH3K9, lysine-9 acetylation in histone H3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

14 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI
b-OHB on the expression of FOXO3, its FOXO3 dependency,
and the effects by b-OHB on H3K9 acetylation levels in
hypoxic injury. Our data suggested that antipyroptotic action
by b-OHB is performed through its HDAC inhibitory
epigenetic action.
Epigenetic gene regulatory mechanism is characterized by
its long-term effects and the present study showed the remote
effects of b-OHB on renal function after the end of ischemic
insult. A recent study revealed a long-term and remote effect
by the treatment with b-OHB. The i.p. injection of b-OHB
during an ischemic attack of the brain can provide favorable
effects on brain function 30 days after the b-OHB adminis-
tration.51 Another study also reported that 6-hour continuous
infusion of b-OHB ameliorated spinal cord injury 2 weeks
after the treatment, which is concomitant with the increased
H3K9 acetylation of the spinal tissues.52 It can be of interest
to examine the longer-term remote effects than in the present
study, especially the progression to chronic renal damages
after IR injury in this model several days after the termination
of b-OHB treatment. We also suppose that pretreatment with
b-OHB primes the epigenetic FOXO3-dependent pyroptotic
pathway because we observed the acute gene alterations as
early as 8 hours after the IR insult (Supplementary Results
and Figure S1). Therefore, this epigenetic effect explains the
mechanism how these relatively small changes in genes
related to pyroptosis pathway explain a dramatic improve-
ment by b-OHB. This priming effects by b-OHB can be an
effective prophylaxis measures for preventing acute kidney
injury after the various surgical operations.
We found that histone acetylation levels decreased in
IR-injured kidneys. This result was consistent with that of
previous studies of IR in other organs and cells.53,54 In the
previous report, in response to ischemia, the levels of acety-
lated histone decrease in the proximal tubular cells, probably
as a result of the adenosine triphosphate depletion and the
decreased in situ HAT activity. After reperfusion, the levels of
acetylated histone recover by compensation mechanism in
part through HDAC downregulation.55 The present data of
the decrease in histone acetylation levels after IR insults could
have resulted from the decrease in HAT activity and that
HDAC downregulation could not fully compensate for the
initial decrease in HAT activity. Several studies also reported
the renoprotective effects by HAT activation and/or HDAC
inhibition and resultant increased histone acetylation on renal
IR injury.56,57 The treatment with b-OHB recovered this
reduced histone acetylation probably through its HDAC
inhibitory potency,24 which might contribute to the amelio-
ration of renal IR injury. The mechanism in which increased
histone acetylation leads to organ-protective effects in IR
insults has not been fully elucidated. A recent study also
revealed that the expression of one of the HATs, histone
acetyltransferase binding to origin recognition complex-1,
regulated cell proliferation and regeneration.56 Although the
targeted histone is different, it can be surmised that histone
acetylation is associated with epithelial cell growth or regen-
eration, leading to tissue protective effects against IR injuries.
Kidney International (2019) -, -–-
basic research
In conclusion, b-OHB can alleviate renal IR injury
through its antipyroptotic effects. Its effects were dependent
on FOXO3 induction and associated with increased H3K9
acetylation. Dietary or pharmacological approaches to elevate
b-OHB levels, hold promise in reducing the severity of acute
kidney injury and ensued CKD progression as well.
MATERIALS AND METHODS
Mice and drugs
All the experiments were performed in 10-week-old male C57BL/6J
mice weighing 21 to 30 g each (Jackson Laboratory, Bar Harbor,
ME). The mice were cared for according to guidelines approved by
the Institutional Animal Care and Use Committee of the KEIO
University Medical School (approved number: 15044). IR injury was
induced as described previously.58 The mice were separated into 4
groups: phosphate-buffered saline–treated sham (n ¼ 6), b-OHB-
treated sham (n ¼ 6), phosphate-buffered saline–treated IR (n ¼ 8),
and b-OHB-treated IR (n ¼ 8). Two weeks before the study, the right
kidney was removed through a small flank incision under pento-
barbital anesthesia (50 mg/kg i.p.). After a 2-week recovery period,
the mice were anesthetized with pentobarbital (50 mg/kg i.p.) and
the left kidney was exposed through a small flank incision. The left
renal artery and vein were occluded with a nontraumatic clamp (RS-
5459; Roboz Surgical Instrument Company, Gaithersburg, MD) for
45 minutes. In sham-operated control mice, the kidney was treated
identically except for the clamping stage. For continuous delivery of
b-OHB (Sigma-Aldrich, St. Louis, MO), osmotic pumps (ALZET
model 2001D; 8 ml/h, 1 g/ml, dissolved in phosphate-buffered saline)
were implanted i.p. 24 hours before surgery and b-OHB was
administered for 2 days. Control mice were infused with sterile
phosphate-buffered saline. Mice were killed 24 hours after the sur-
gical procedure and the blood and kidneys were collected. The
fasting group was fasted for 2 days preoperatively with no access to
food and unlimited access to water. Fasted animals did not show any
morbidity due to the fasting. After surgery, these mice had unlimited
access to food and water. b-OHB concentrations were determined
based on a previous study.25 b-OHB plasma levels were measured
with FreeStyle Precision Neo (Abbott, Lake Bluff, IL) by tail vein
puncture at the time of the sham or IR operation in mice and at 24
hours before and after the operation. Tissues were prepared as
described previously.59
Tubular injury score
Paraffin-embedded kidney pieces were stained with hematoxylin and
eosin, and periodic acid–Schiff. In the hematoxylin and eosin sec-
tions, renal cortical vacuolization, peritubular/proximal tubule
leukocyte infiltration, and proximal tubule simplification were
evaluated and scored as follows: 0, normal; 1, mild injury; 2, mod-
erate injury; 3, severe injury. The tubulo-interstitial injury score was
defined as described previously.60 Tubular damage (epithelial ne-
crosis) in periodic acid–Schiff–stained sections was scored as follows:
0, normal; 1, <10%; 2, 10% to 25%; 3, 26% to 75%; 4, >75%.
Tubular necrosis was defined as the loss of proximal tubular brush
border, blebbing of apical membranes, or intraluminal aggregation
of cells and proteins, as described previously.61
TUNEL assay
TUNEL assay was performed using the in situ Apoptosis Detection
Kit (S7100-KIT; EMD Millipore, Temecula, CA), as described
previously.62
15
basic research T Tajima et al.: Effects of b-hydroxybutyrate on IRI

Cell culture and drug treatment
HK-2, an immortalized proximal tubule epithelial cell line, was pur-
chased from the American Type Culture Collection (Manassas, VA) and
cultured. For the hypoxic group, cells were cultured in hypoxia incu-
bator and exposed to hypoxia (5% CO2, 1% O2, and 94% N2) for 24
hours followed by 12 hours of reoxygenation (5% CO2, 21% O2, and
74% N2). The stimulation of hypoxia/reoxygenation was performed
based on a previous study.22 Treatment of cells with hydrogen peroxide
was performed based on a previous study.63,64 b-OHB concentrations
were determined based on previous studies24,29,65 and cells were treated
with b-OHB from 12 hours before hypoxia/reoxygenation or hydrogen
peroxide stimulation.
Real-time reverse-transcriptase polymerase chain reaction
Total RNA was extracted from mouse kidney tissue and HK-2 cells
using TRIzol reagent (Invitrogen, Carlsbad, CA). Equal amounts (1
mg) of total RNA from each sample were converted to cDNA using a
Prime Script RT Reagent Kit with gDNA Eraser (Takara, Ohtsu,
Japan). Real-time reverse transcriptase polymerase chain reaction
(RT-PCR) was performed using an ABI Step One Plus sequence
detector (Applied Biosystems, Foster City, CA). Sequences of the
oligo pairs are listed in Table 1. Glyceraldehyde-3-phosphate dehy-
drogenase or b-actin housekeeping gene served as an internal control
to normalize the expression levels of the samples. The relative
expression levels were analyzed by the DDCt method described in the
Applied Biosystems user bulletin.66
Gene knockdown of FOXO3 by siRNA
Transfection of siRNA against human FOXO3a (SI04916366; Qiagen,
Hilden, Germany) and nontarget siRNA (SI03650318; Qiagen) into
HK-2 cells was done using Lipofectamine RNAiMAX (Invitrogen) at
12 hours before hypoxia/reoxygenation stimulation and these cells
were incubated for 48 hours. The HK-2 cells transfected with a
nontarget control siRNA were used as control cells.
Nuclei isolation and Western blot analysis
The renal and cellular nuclei were isolated using a nuclei isolation kit
(Sigma-Aldrich). Samples with equal amounts of nuclear protein
(7 mg) were fractionated using 16.5% Tris/tricine sodium dode-
cylsulfate polyacrylamide gel electrophoresis and transferred to a
polyvinylidene fluoride membrane. Samples with equal amounts of
purified protein (50 mg) were fractionated using 10% or 12% Tris/
glycine sodium dodecylsulfate polyacrylamide gel electrophoresis
and transferred to a polyvinylidene fluoride membrane. The mem-
branes were then incubated overnight at 4 C with primary anti-
bodies against AcH3K9 (1:6000; Abcam, Cambridge, MA), histone
H3 (1:20000; Abcam), FOXO3 (1:2500; Abcam), Bax (1:5000;
Abcam), Bcl-2 (1:2000; Abcam) and glyceraldehyde-3-phosphate
dehydrogenase (1:5000; Santa Cruz Biotechnology, Santa Cruz,
CA). The blots were then incubated with a secondary antibody
(1:10000; Abcam) conjugated to horseradish peroxidase. Immuno-
reactive bands were detected using an ECL detection kit (Amersham
Biosciences, Uppsala, Sweden).
HDAC and HAT activity assay
HDAC activity was determined using a fluorometric HDAC assay kit
(Bio Vision, Milpitas, CA) following the manufacturer’s protocol.
HAT activity was determined using a colorimetric HAT activity assay
kit (Bio Vision) according to the manufacturer’s protocol.
Chromatin immunoprecipitation analysis
Protein-DNA complex were cross-linked with formaldehyde,
sonicated and immunoprecipitated with antibody conjugated
protein A/G agarose beads (Cell Signaling Technology Japan,
Tokyo, Japan) at 4 C overnight. Antibodies used for chromatin
immunoprecipitation were normal rabbit IgG (Cell Signaling
Technology Japan), anti-acetyl-H3K9 (Abcam). The immuno-
precipitated DNA was recovered with proteinase K and purified
with phenol/chloroform precipitation. Precipitated DNA was
analyzed with SYBR green Q-PCR. The primer sets used for H3K9
promoter binding assay were as follows: hFOXO3 1K-F
GGGCACGGATCGTAGAATAA; hFOXO3 1K-R ACGTGGG
CATTTTTGACTTT. The primer arrangement was determined based on
previous studies.24 The percentage of input DNA values were calculated
as follows: % Input ¼ 2%  2(C[T] 2% Input Sample – C[T] IP Sample), with
background IgG control values subtracted.
Cell viability assay
HK-2 cells were incubated in Dulbecco’s modified Eagle’s medium–
F12 medium supplemented with 10% fetal bovine serum with or

Table 1 | The primer sequences used in the real-time PCR experiment

Animal species Gene name Forward Reverse
Mouse GAPDH 50 -TGTGTCCGTCGTGGATCTGA-30 50 -TTGCTGTTGAAGTCGCAGGAG-30
FOXO3 50 -TGCTAAGCAGGCCTCATCTCAA-30 50 -AAGCTGTAAACGGATCACTGTCCAC-30
ARC 50 -AGAATCCCAGGCCTCACCAC-30 50 -GTCAGCCTGCAATGTCTCTACCA-30
Bax 50 -CAGGATGCGTCCACCAAGAA-30 50 -CGTGTCCACGTCAGCAATCA-30
Bcl-2 50 -TGAAGCGGTCCGGTGGATA-30 50 -CAGCATTTGCAGAAGTCCTGTGA-30
Caspase-1 50 -ACTCGTACACGTCTTGCCCTCA-30 50 -CTGGGCAGGCAGCAAATTC-30
IL-1b 50 -TCCAGGATGAGGACATGAGCAC-30 50 -GAACGTCACACACCAGCAGGTTA-30
IL-18 50 -ACCTCCAGCATCAGGACAAAG-30 50 -TGTACAGTGAAGTCGGCCAAAG-30
Human b-actin 50 -TGGCACCCAGCACAATGAA-30 50 -CTAAGTCATAGTCCGCCTAGAAGCA-30
FOXO3 50 -AACACCTGAGAGTCAAGCAGTTGAG-30 50 -GGCAGAGTTAATTCATGGCAACA-30
ARC 50 -CTTTCTGCACCGTCATCTCCTG-30 50 -ACGCAGACTCTCCGCTTTCTTC-30
Bax 50 -GACACCTGAGCTGACCTTGG-30 50 -AGGAAGTCCAGTGTCCAGC-30
Bcl-2 50 -TGGACAACCATGACCTTGGAC-30 50 -GTGCTCAGCTTGGTATGCAGAA-30
Caspase-1 50 -GCCTGTTCCTGTGATGTGGAG-30 50 -TGCCCACAGACATTCATACAGTTTC-30
IL-1b 50 -CCAGGGACAGGATATGGAGCA-30 50 -TTCAACACGCAGGACAGGTACAG-30
IL-18 50 -CTGCCACCTGCTGCAGTCTA-30 50 -TCTACTGGTTCAGCAGCCATCTTTA-30
ARC, apoptosis repressor with caspase recruitment domain; FOXO3, forkhead transcription factor O3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL-1b, interleukin-
1b; PCR, polymerase chain reaction.

16 Kidney International (2019) -, -–-

T Tajima et al.: Effects of b-hydroxybutyrate on IRI
without b-OHB from 12 hours before hypoxia/reoxygenation or
hydrogen peroxide stimulation in 96-well culture plates (Falcon,
Bedford, MA). Cells were incubated with 10 ml of CCK-8 reagent
(Dojindo, Kumamoto, Japan) for 2 hours at 37 C. The color reaction
was measured at 450 nm with a SpectraMax Paradigm Multi-Mode
Microplate Reader (Molecular Devices, Sunnyvale, CA).
Statistical analysis
Data are expressed as the mean
SEM and were analyzed by one-
way analysis of variance followed by the Bonferroni post hoc test.
A P value of <0.05 was considered statistically significant.
DISCLOSURE
All the authors declared no competing interests.
ACKNOWLEDGMENTS
This work was partially supported by grants from the Ministry of
Education, Culture, Science, Sports and Technology of Japan
(26253053, 16H05315). The authors are grateful to Professor Ikuo
Kimura, Dr. Junki Miyamoto, and Dr. Junichiro Irie for helpful
discussions and to Novartis Pharmaceuticals for helpful support to
provide the place to perform research.
SUPPLEMENTARY MATERIAL
Supplementary Results. The effect of b-hydroxybutyrate on
pyroptosis in IR-injured kidneys at different time point.
Figure S1. The effects of b-hydroxybutyrate (b-OHB) on pyroptosis in
IR-injured kidneys at different time point. (A–E) The quantitative real-
time polymerase chain reaction analysis of mRNA expressions of
markers related to pyroptosis activation including forkhead tran-
scription factor O3 (FOXO3) (A), apoptosis repressor with caspase
recruitment domain (ARC) (B), caspase-1 (C), as well as the proin-
flammatory cytokines interleukin-1b (IL-1b) (D) and IL-18 (E) in mice
groups 8 hours or 24 hours after reperfusion. The experimental
groups consist of phosphate-buffered saline–treated mice with sham
operation (sham, n ¼ 5), phosphate-buffered saline–treated mice
with ischemia reperfusion (IR) injury (n ¼ 5), and IR treated with
b-OHB (IRþb-OHB) (n ¼ 5) for 8 hours or 24 hours after reperfusion.
##P < 0.01 versus sham, #P < 0.05 versus sham, **P < 0.01 versus IR,
*P < 0.05 versus IR, $$P < 0.01 versus IR (8 hours after reperfusion),
$P < 0.05 versus IR (8 hours after reperfusion), {{P < 0.01 versus
IRþb-OHB (8 hours after reperfusion). Bar represents mean
SEM.
Supplementary material is linked to the online version of the paper at
www.kidney-international.org.
REFERENCES
1. Veech RL, Chance B, Kashiwaya Y, et al. Ketone bodies, potential
therapeutic uses. IUBMB Life. 2001;51:241–247.
2. Cahill GF Jr, Herrera MG, Morgan AP, et al. Hormone-fuel
interrelationships during fasting. J Clin Invest. 1966;45:1751–1769.
3. Robinson AM, Williamson DH. Physiological roles of ketone bodies as
substrates and signals in mammalian tissues. Physiol Rev. 1980;60:
143–187.
4. Cahill GF Jr. Fuel metabolism in starvation. Annu Rev Nutr. 2006;26:1–22.
5. Laffel L. Ketone bodies: a review of physiology, pathophysiology and
application of monitoring to diabetes. Diabetes Metab Res Rev. 1999;15:
412–426.
6. Rojas-Morales P, Tapia E, Pedraza-Chaverri J. b-hydroxybutyrate: a
signaling metabolite in starvation response? Cell Signal. 2016;28:
917–923.
7. Katayama M, Hiraide A, Sugimoto H, et al. Effect of ketone bodies on
hyperglycemia and lactic acidemia in hemorrhagic stress. J Parenter
Enteral Nutr. 1994;18:442–446.
Kidney International (2019) -, -–-
basic research
8. Hiraide A, Katayama M, Mizobata Y, et al. Effect of sodium D-3-
hydroxybutyrate on amino acidemia in hemorrhagic hypotension. Eur
Surg Res. 1991;23:250–255.
9. Mizobata Y, Hiraide A, Katayama M, et al. Oxidation of D(-)3-
hydroxybutyrate administered to rats with extensive burns. Surg Today.
1996;26:173–178.
10. Suzuki M, Suzuki M, Sato K, et al. Effect of beta-hydroxybutyrate, a
cerebral function improving agent, on cerebral hypoxia,
anoxia and ischemia in mice and rats. Jpn J Pharmacol. 2001;87:
143–150.
11. Deora V, Albornoz EA, Zhu K, et al. The ketone body b-hydroxybutyrate
does not inhibit synuclein mediated inflammasome activation in
microglia. J Neuroimmune Pharmacol. 2017;12:568–574.
12. Lee S, Choi E, Cha MJ, Hwang KC. Looking for pyroptosis-modulating
miRNAs as a therapeutic target for improving myocardium survival.
Mediators Inflamm. 2015;2015:254871.
13. Nie H, Xue X, Li J, et al. Nitro-oleic acid attenuates OGD/R-triggered
apoptosis in renal tubular cells via inhibition of Bax mitochondrial
translocation in a PPAR-g-dependent manner. Cell Physiol Biochem.
2015;35:1201–1218.
14. Jorgensen I, Lopez JP, Laufer SA, et al. IL-1b, IL-18, and eicosanoids
promote neutrophil recruitment to pore-induced intracellular traps
following pyroptosis. Eur J Immunol. 2016;46:2761–2766.
15. Napier BA, Brubaker SW, Sweeney TE, et al. Complement pathway
amplifies caspase-11-dependent cell death and endotoxin-induced
sepsis severity. J Exp Med. 2016;213:2365–2382.
16. Pillon NJ, Chan KL, Zhang S, et al. Saturated fatty acids activate caspase-
4/5 in human monocytes, triggering IL-1b and IL-18 release. Am J Physiol
Endocrinol Metab. 2016;311:E825–E835.
17. Yang JR, Yao FH, Zhang JG, et al. Ischemia-reperfusion induces renal
tubule pyroptosis via the CHOP-caspase-11 pathway. Am J Physiol Renal
Physiol. 2014;306:F75–F84.
18. Wang K, Liu F, Zhou LY, et al. miR-874 regulates myocardial necrosis by
targeting caspase-8. Cell Death Dis. 2013;4:e709.
19. Ferber EC, Peck B, Delpuech O, et al. FOXO3a regulates reactive oxygen
metabolism by inhibiting mitochondrial gene expression. Cell Death
Differ. 2012;19:968–979.
20. Lu D, Liu J, Jiao J, et al. Transcription factor Foxo3a prevents apoptosis by
regulating calcium through the apoptosis repressor with caspase
recruitment domain. J Biol Chem. 2013;288:8491–8504.
21. Li X, Du N, Zhang Q, et al. MicroRNA-30d regulates cardiomyocyte
pyroptosis by directly targeting foxo3a in diabetic cardiomyopathy. Cell
Death Dis. 2014;23:e1479.
22. Wu H, Huang T, Ying L, et al. MiR-155 is involved in renal ischemia-
reperfusion injury via direct targeting of FoxO3a and regulating renal
tubular cell pyroptosis. Cell Physiol Biochem. 2016;40:1692–1705.
23. Robin E, Guzy RD, Loor G, et al. Oxidant stress during simulated ischemia
primes cardiomyocytes for cell death during reperfusion. J Biol Chem.
2007;282:19133–19143.
24. Shimazu T, Hirschey MD, Newman J, et al. Suppression of oxidative stress
by b-hydroxybutyrate, an endogenous histone deacetylase inhibitor.
Science. 2013;339:211–214.
25. Rahman M, Muhammad S, Khan MA, et al. The b-hydroxybutyrate
receptor HCA2 activates a neuroprotective subset of macrophages. Nat
Commun. 2014;5:3944.
26. Mitchell JR, Verweij M, Brand K, et al. Short-term dietary restriction and
fasting precondition against ischemia reperfusion injury in mice. Aging
Cell. 2010;9:40–53.
27. van Ginhoven TM, Mitchell JR, Verweij M, et al. The use of preoperative
nutritional interventions to protect against hepatic ischemia-reperfusion
injury. Liver Transpl. 2009;15:1183–1191.
28. Verweij M, van Ginhoven TM, Mitchell JR, et al. Preoperative
fasting protects mice against hepatic ischemia/reperfusion injury:
mechanisms and effects on liver regeneration. Liver Transpl.
2011;17:695–704.
29. Youm YH, Nguyen KY, Grant RW, et al. The ketone metabolite
b-hydroxybutyrate blocks NLRP3 inflammasome-mediated inflammatory
disease. Nat Med. 2015;21:263–269.
30. Fulop M, Murthy V, Michilli A, et al. Serum beta-hydroxybutyrate
measurement in patients with uncontrolled diabetes mellitus. Arch Intern
Med. 1999;159:381–384.
31. Hu J, Wang Y, Geng X, et al. Metabolic acidosis as a risk factor for the
development of acute kidney injury and hospital mortality. Exp Ther Med.
2017;13:2362–2374.
17
basic research
32. Bilici M, Tavil B, Dogru O, Davutoglu M, Bosnak M. Diabetic ketoasidosis
is associated with prothrombotic tendency in children. Pediatr Hematol
Oncol. 2011;28:418–424.
33. Dong T, Liao D, Liu X, et al. Using small molecules to dissect non-
apoptotic programmed cell death: necroptosis, ferroptosis, and
pyroptosis. Chembiochem. 2015;16:2557–2561.
34. Croker BA, Silke J, Gerlic M. Fight or flight: regulation of emergency
hematopoiesis by pyroptosis and necroptosis. Curr Opin Hematol.
2015;22:293–301.
35. Yang Y, Jiang G, Zhang P, et al. Programmed cell death and its role in
inflammation. Mil Med Res. 2015;2:12.
36. Schoenlaub L, Cherla R, Zhang Y, et al. Coxiella burnetii avirulent nine
mile phase II induces caspase-1-dependent pyroptosis in murine
peritoneal B1a B cells. Infect Immun. 2016;84:3638–3654.
37. Lorenz G, Darisipudi MN, Anders HJ. Canonical and non-canonical effects
of the NLRP3 inflammasome in kidney inflammation and fibrosis.
Nephrol Dial Transplant. 2014;29:41–48.
38. Eichholz K, Bru T, Tran TT, et al. Immune-complexed adenovirus induce
AIM2-mediated pyroptosis in human dendritic cells. PLoS Pathog.
2016;12:e1005871.
39. Yang J, Zhao Y, Zhang P, et al. Hemorrhagic shock primes for lung
vascular endothelial cell pyroptosis: role in pulmonary inflammation
following LPS. Cell Death Dis. 2016;7:e2363.
40. Vande Walle L, Lamkanfi M. Pyroptosis. Curr Biol. 2016;26:R568–R572.
41. Hutton HL, Ooi JD, Holdsworth SR, et al. The NLRP3 inflammasome in
kidney disease and autoimmunity. Nephrology (Carlton). 2016;21:736–
744.
42. Lin CF, Kuo YT, Chen TY, et al. Quercetin-rich guava (Psidium guajava)
juice in combination with trehalose reduces autophagy, apoptosis and
pyroptosis formation in the kidney and pancreas of type II diabetic rats.
Molecules. 2016;21:334.
43. Yang CC, Yao CA, Yang JC, et al. Sialic acid rescues repurified
lipopolysaccharide-induced acute renal failure via inhibiting TLR4/PKC/
gp91-mediated endoplasmic reticulum stress, apoptosis, autophagy, and
pyroptosis signaling. Toxicol Sci. 2014;141:155–165.
44. Chung SD, Lai TY, Chien CT, et al. Activating Nrf-2 signaling depresses
unilateral ureteral obstruction-evoked mitochondrial stress-related
autophagy, apoptosis and pyroptosis in kidney. PLoS One. 2012;7:
e47299.
45. Wu H, Craft ML, Wang P, et al. IL-18 contributes to renal damage after
ischemia-reperfusion. J Am Soc Nephrol. 2008;19:2331–2341.
46. Linkermann A, Bräsen JH, Himmerkus N, et al. Rip1 (receptor-interacting
protein kinase 1) mediates necroptosis and contributes to renal
ischemia/reperfusion injury. Kidney Int. 2012;81:751–761.
47. Mulay SR, Linkermann A, Anders HJ. Necroinflammation in kidney
disease. J Am Soc Nephrol. 2016;27:27–39.
48. Sarhan M, Land WG, Tonnus W, et al. Origin and consequences of
necroinflammation. Physiol Rev. 2018;98:727–780.
49. Yatim N, Jusforgues-Saklani H, Orozco S, et al. RIPK1 and NF-kB signaling
in dying cells determines cross-priming of CD8⁺ T cells. Science. 2015;350:
328–334.
18
T Tajima et al.: Effects of b-hydroxybutyrate on IRI
50. Nho RS, Hergert P. FoxO3a and disease progression. World J Biol Chem.
2014;5:346–354.
51. Lee BS, Woo DC, Woo CW, et al. Exogenous b-hydroxybutyrate treatment
and neuroprotection in a suckling rat model of hypoxic-ischemic
encephalopathy. Dev Neurosci. 2018;40:73–83.
52. Qian J, Zhu W, Lu M, et al. D-b-hydroxybutyrate promotes functional
recovery and relieves pain hypersensitivity in mice with spinal cord
injury. Br J Pharmacol. 2017;174:1961–1971.
53. Alsarraf O, Fan J, Dahrouj M, et al. Acetylation: a lysine modification with
neuroprotective effects in ischemic retinal degeneration. Exp Eye Res.
2014;127:124–131.
54. Chen M, Liu Q, Chen L, et al. Remifentanil postconditioning ameliorates
histone H3 acetylation modification in H9c2 cardiomyoblasts after
hypoxia/reoxygenation via attenuating endoplasmic reticulum stress.
Apoptosis. 2017;22:662–671.
55. Marumo T, Hishikawa K, Yoshikawa M, et al. Epigenetic regulation of
BMP7 in the regenerative response to ischemia. J Am Soc Nephrol.
2008;19:1311–1320.
56. Havasi A, Haegele JA, Gall JM, et al. Histone acetyl transferase (HAT)
HBO1 and JADE1 in epithelial cell regeneration. Am J Pathol. 2013;182:
152–162.
57. Levine MH, Wang Z, Bhatti TR, et al. Class-specific histone/protein
deacetylase inhibition protects against renal ischemia reperfusion
injury and fibrosis formation. Am J Transplant. 2015;15:965–973.
58. Yamashita J, Kita S, Iwamoto T, et al. Attenuation of ischemia/
reperfusion-induced renal injury in mice deficient in Naþ/Ca2þ
exchanger. J Pharmacol Exp Ther. 2003;304:284–293.
59. Chang YK, Choi DE, Na KR, et al. Erythropoietin attenuates renal injury in
an experimental model of rat unilateral ureteral obstruction via anti-
inflammatory and anti-apoptotic effects. J Urol. 2009;181:1434–1443.
60. Chang YK, Choi H, Jeong JY, et al. Dapagliflozin, SGLT2 inhibitor, attenuates
renal ischemia-reperfusion injury. PLoS One. 2016;11:e0158810.
61. Choi DE, Jeong JY, Lim BJ, et al. Pretreatment of sildenafil attenuates
ischemia-reperfusion renal injury in rats. Am J Physiol Renal Physiol.
2009;297:F362–F370.
62. Lee KW, Jeong JY, Lim BJ, et al. Sildenafil attenuates renal injury in an
experimental model of rat cisplatin-induced nephrotoxicity. Toxicology.
2009;257:137–143.
63. Choi HI, Kim HJ, Park JS, et al. PGC-1a attenuates hydrogen peroxide-induced
apoptotic cell death by upregulating Nrf-2 via GSK3b inactivation mediated
by activated p38 in HK-2 Cells. Sci Rep. 2017;7:4319.
64. Andreucci M, Fuiano G, Presta P, et al. Downregulation of cell survival
signalling pathways and increased cell damage in hydrogen peroxide-
treated human renal proximal tubular cells by alpha-erythropoietin. Cell
Prolif. 2009;42:554–561.
65. Kong G, Huang Z, Ji W, et al. The ketone metabolite b-hydroxybutyrate
attenuates oxidative stress in spinal cord injury by suppression of class I
histone deacetylases. J Neurotrauma. 2017;34:2645–2655.
66. Applied Biosystems. Guide to Performing Relative Quantitation of Gene
Expression Using Real-Time Quantitative PCR. Foster City, CA: Applied
Biosystems; 2008.
Kidney International (2019) -, -–-