JOURNAL OF VIROLOGY, Aug. 1991, p. 4198-4203 Vol. 65, No.

8
0022-538X/91/084198-06$02.00/0
Copyright © 1991, American Society for Microbiology

Antigenicity of Rabies Virus Glycoprotein

A. BENMANSOUR, H. LEBLOIS, P. COULON, C. TUFFEREAU, Y. GAUDIN,
A. FLAMAND, AND F. LAFAY*
Laboratoire de Genetique des Virus, Centre National de la Recherche Scientifique,
91198 Gif-sur- Yvette Cedex, France
Received 25 March 1991/Accepted 30 April 1991

Although the number of antigenic sites on the rabies virus glycoprotein that have been described regularly
increases with time, no attempt has been made to carefully evaluate the relative importance of each of these
sites. Here we provide a more precise description of the antigenicity of the protein in mice of the H-2d
haplotype; we developed this description by using 264 newly isolated monoclonal antibodies (MAbs) and a

Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest

collection of neutralization-resistant (MAR) mutants. Most of the MAbs (97%) recognized antigenic sites
previously described as II and III. One minor antigenic site separated from site III by three amino acids,
including a proline, was identified (minor site a). Despite their proximity, there is no overlap between site III
and minor site a; i.e., site III-specific MAR mutants were neutralized by the six MAbs defining minor site a,
and vice versa. One of our MAbs, lDl, reacted with sodium dodecyl sulfate-treated glycoprotein in Western
blots (immunoblots) under reducing conditions and was therefore probably directed against a linear epitope.
A MAR mutant selected with this MAb was still neutralized by MAbs of other specificities. This linear epitope
was called Gl (G, Gif). As a general rule, we propose to reserve the term "antigenic site" (either major or
minor) for regions of the protein which are defined by several MAbs originating from different fusions and to
describe regions of the protein which are defined by a single MAb as epitopes. It would be interesting to test
whether the same regions of the rabies virus glycoprotein are antigenic in mice of different haplotypes or in
other species.

The glycoprotein of rabies virus is believed to form
polymeric structures that project from the surface of the
virus particle. These surface spikes are responsible for
induction and binding of virus-neutralizing antibodies (7, 23),
determination of virulence (5, 6, 8), and stimulation of
lymphocytes (3, 4).
Neutralizing monoclonal antibodies (MAbs) raised in
BALB/c mice immunized with rabies virus were shown to
delineate numerous epitopes on the viral glycoprotein (11,
24). Their pattern of cross-reactivity with MAb-resistant
(MAR) mutants selected with some of these MAbs was used
to define three groups of epitopes on the challenge virus
standard (CVS) glycoprotein and five on the ERA glycopro-
tein (14, 15). Some groups contained a single epitope recog-
nized by a unique MAb, while others contained many
epitopes defined by a collection of MAbs isolated from
several laboratories.
Several overlapping epitopes certainly define an antigenic
site. This is the case for antigenic sites II and III of the rabies
virus glycoprotein. Antigenic mutants selected for resistance
to MAbs delineating site II were found to have one amino
acid substitution located between positions 34 and 42 or 198
and 200 of the glycoprotein, with the exception of two
mutants which each had a mutation in an intermediate
position (19). If most of those mutations are within the region
where MAbs bind to the protein, as postulated for the
majority of MAR mutants, then site II is a discontinuous,
conformational antigenic site. In contrast, mutants resistant
to MAbs delineating site III were found to have amino acid
substitutions that were clustered in a short linear stretch
between positions 330 and 338, except for one mutant with
an amino acid substitution in position 357 (22, 26). Several
isolated epitopes were also identified on the rabies virus
*
Corresponding author.
4198
glycoprotein. For instance, sites I and IV have up to now
been defined by a single MAb. More recently, a new epitope
has been described for ERA and CVS strains. This epitope
has been considered unique in that it was defined by a
neutralizing MAb binding to the denatured glycoprotein (1).
An escape mutant to this MAb was shown to have an amino
acid substitution at position 264 of the glycoprotein (10).
Two neutralizing MAbs of human origin have also recently
been isolated (9, 16). Both failed to neutralize the same
escape mutant (RV 2-22C5) selected with the murine MAb
2.22C5. One bound to the denatured glycoprotein, while the
other did not. Whether the two human MAbs would recog-
nize the same region of the glycoprotein as did MAb 2-22C5
was not investigated.
Regions of the glycoprotein which are recognized by
MAbs of new specificity have often been termed antigenic
sites. As a result, as many as six or seven antigenic sites on
the rabies virus glycoprotein have been described, which
does not reflect the actual antigenic properties of the protein.
Using 266 neutralizing MAbs derived from the fusion of
spleen cells from BALB/c mice immunized with beta propi-
olactone-inactivated CVS virus and our collection of MAR
mutants, we have made a more accurate evaluation of the
relative importance of the different regions of the rabies
virus glycoprotein in the stimulation of the B-cell response.
In addition, this large number of neutralizing MAbs allowed
us to delineate and map new regions of the glycoprotein
which could also be antigenic.
MATERIALS AND METHODS
Cells and viruses. CER and BSR clones of BHK21 cells
were grown in Eagle minimal essential medium supple-
mented with 8% calf serum. The myeloma cell line Sp2/0 was
grown in Dulbecco modified minimal essential medium sup-
plemented with 15% foal serum, 2 mM L-glutamine, and 10
VOL. 65, 1991
mM sodium pyruvate. Hybridomas were grown in the same
medium with 0.1 mM hypoxanthine, 0.4 M aminopterin, and
16 mM thymidine.
The CVS strain of rabies virus and its antigenic mutants
were grown and purified by previously described procedures
(19).
MAb production and characterization. BALB/c mice (pur-
chased from IFFA-Mdrieux) were immunized at a 6-week
interval with two intraperitoneal injections of 100 ,g of
purified, beta propiolactone-inactivated CVS. An intrave-
nous booster injection was given 4 days before fusion.
Spleen cells from immunized mice were fused with Sp2/0
myeloma cells, according to standard procedures (12).
Hybridomas secreting anti-rabies virus antibodies were
first characterized by an enzyme-linked immunosorbent as-
say (ELISA) against the whole virus (20) and then against
1% sodium dodecyl sulfate (SDS)-treated virus. Hybridomas
secreting antiglycoprotein antibodies were detected with a
membrane fluorescence assay performed against nonperme-
abilized CVS-infected cells by using fluorescein-conjugated
anti-mouse immunoglobulin (Silenus). Neutralizing MAbs
were identified and characterized in a plaque neutralization
test (2) performed first with CVS and then with a collection
of representative mutants (19, 22). The following mutants
were used for the characterization: J17, J12, J21, K2, K5,
K3, K14, K18, A17, P3, and J26 (mutated in site II); AvOl,
F67, and B1506 (mutated in site III); and D65 (mutated in site
I). Any MAb which failed to neutralize at least one of the
mutants listed above was considered specific for the corre-
sponding site. When ascitic fluid was needed, the hybrid-
omas were cloned once more by limiting dilution and then
injected into the peritoneal cavity of pristane-treated
BALB/c mice.
SDS-polyacrylamide gel electrophoresis (PAGE) and immu-
noblot analysis. Purified rabies virus was boiled for 3 min in
2x Laemmli buffer with or without 2-,B-mercaptoethanol.
Electrophoresis was carried out in a discontinuous SDS-
polyacrylamide gel (13). Proteins were either stained with
Coomassie blue or electrotransferred to nitrocellulose mem-
branes. Membranes were prepared for immunostaining by
blocking nonspecific sites with 5% defatted milk in Tris-
buffered saline (TBS)-Tween (0.05 M Tris-HCI, pH 8-0.15
M NaCI-0.05% Tween 80). Blocked membranes were incu-
bated overnight with appropriate dilutions of ascitic fluids.
Membranes were washed twice in TBS-Tween, incubated
for 1 h with alkaline phosphatase-conjugated anti-mouse
immunoglobulin (Silenus), washed twice in TBS-Tween,
washed twice in TBS, and stained with alkaline phosphatase
substrate solution (1.2 mM fast blue BB salt [Sigma]-1.8 mM
,-naphthyl phosphate in borate buffer).
Selection of antigenic mutants. Selection of new antigenic
mutants was performed as previously described (22). Briefly,
dilutions of either a 5-fluorouracil mutagenized stock or
cloned stocks of CVS were incubated 1 h at room tempera-
ture with diluted ascitic fluid and then plated onto monolay-
ers of CER cells. Well-separated plaques were picked, and
small stocks of each putative mutant were prepared on BSR
cells. Only stocks showing 90% resistance to the selecting
MAbs were used in the present study.
Direct RNA sequencing. Direct sequencing by the chain
termination procedure of Sanger was performed as previ-
ously described (19). Reverse transcription was performed
directly on the purified genomic RNA by using synthetic
oligonucleotides to prime the reaction. Five primers span-
ning the extracellular domain of the glycoprotein gene were
used: (i) AAAAGACTCAAGGAAAGATG, (ii) AGAGGC
ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN 4199
AGAGACCTA, (iii) GATTACACCATTTGGAT, (iv) AC
CAAATGGTGCTCTCC, and (v) GTCCCAGGGTTTGGA
AA. They were purchased from Appligene, except primer 5,
which was kindly donated by D. H. L. Bishop.
Reverse transcription, amplification, and sequencing. RNA
extracted from purified viral particles was engaged in first-
strand cDNA synthesis by the general method described by
Sambrook et al. (21). Briefly, RNA in Tris-HCl, pH 8.3-50
mM KCl-5 mM MgCl2-1 mM each deoxynucleotide triphos-
phate (dNTP)-25 U of RNAsine (Promega)-7.5 U of avian
myeloblastosis virus reverse transcriptase (Amersham)-50
pmol of messenger sense primer (primer 1), in 20 ,ul (final
volume), was incubated for 45 min at 37°C.
First-strand cDNA-RNA heteroduplexes were denatured
for 5 min at 95°C, and polymerase chain reaction (PCR) was
performed with 5 ,ul of the cDNA synthesis mixture in 100 ,ul
Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest
(final volume) of 10 mM Tris-HCI, pH 8.3-50 mM KCl-2.5
mM MgCl2-200 ,uM each dNTP-0.1% gelatin-100 pmol of
each primer-2.5 U of Taq DNA polymerase (Cetus Perkin-
Elmer or Promega). Amplification was conducted for 30
cycles on a Hybaid thermocycler programmed to provide 15
s at 94°C, 45 s at 55°C, and 1.30 min at 74°C for each cycle.
Two pairs of primers were used to amplify the glycoprotein
gene in two overlapping fragments: A1-AAAAGACTCAA
GGAAAGATG, B1-AGAACTCCACATAACTTGAG; and
A2-GATTACACCATCTGGATGCC, B2-CTTGGATCGTT
GAAAGGA.
PCR products were subjected to electrophoresis on 2%
Nusieve GTG agarose (FMC Corp.). A band of the expected
size of double-stranded DNA was excised from the gel,
melted for 15 min at 65°C, and diluted with 5 volumes of
sterile H20. Five ,u1 of the melted agarose was subjected to
PCR amplification as described above, except that the con-
centration of one primer was reduced to 1 pmol and PCR was
conducted for 50 cycles. The product of single-strand ampli-
fication was extracted with chloroform and dialyzed four
times on a Centricon 30 microconcentrator (Amicon). The
final product (1 pmol) was sequenced with Sequenase V.2
(USB) according to the manufacturer's directions. The PCR
oligonucleotides were used as sequencing primers.
RESULTS
Characterization of neutralizing MAbs. From one fusion,
several hundred hybridomas secreting MAbs against rabies
virus were established. Of these, 262 were characterized as
neutralizing by a plaque neutralization test (data not shown).
They also bound to the membrane of nonpermeabilized
infected cells.
The ability of the 262 MAbs to neutralize a panel of 11
antigenic mutants affected in site II and 3 mutants affected in
site III of the glycoprotein was determined according to the
method of Seif et al. (22). A total of 254 MAbs failed to
neutralize at least one mutant affected in site II or in site III.
We did not find any MAb which failed to neutralize mutants
of site II and of site III, an observation which confirms the
independence of the two sites. In view of these results, 190
MAbs were assigned to site II and 64 MAbs were assigned to
site III. One mutant (D65), isolated in this laboratory with
MAb 509.6 (from the Wistar collection), which defines the
so-called antigenic site I, was also used in this study. Not
one MAb failed to neutralize this mutant.
Eight MAbs (40E1, 48C5, 40A1, 49C3, 52C4, 46D2, 49C2,
and 52A4) neutralized all the mutants. These MAbs, as well
as four unclassified MAbs (1D1, 7D2, 11C6, and 20A2) from
previous fusions, were thus considered possibly directed
4200 BENMANSOUR ET AL. J. VIROL.

that is nonoverlapping with those already described for the

Mutant Neutralization with MAbs CVS strain.
The mutant selected with lDl was neutralized by all of the
Cl. Nb. Unclassified Site II Site III MAbs tested so far except the selecting MAb, suggesting
that this MAb is directed toward a new epitope, referred to
14 in
X 510~
u
en
C))
N
U -Wn
.~0 s 2D N4
0
vW 1 In
50C.
r-
%0 a
4
0 as epitope Gl (G, Gif). Mutants selected with 46D2 or 52A4
o o 0 o
0 0
..a a
0 5
%O atN n r- u 0 CN
o m
a

lev
OD
IV
at
IV Nq 14
C4
r1
i
UZ -w 91 C4
N IV Un In
(class 4, 5, or 6 in Fig. 1) were also resistant to MAbs specific
1 12 0 000 00000 000 000 0 0 to site II, indicating that these mutants were affected within
12 00000 0 000 00 o ( 00 00 antigenic site II. MAbs 46D2 and 52A4 should thus be
7 00 00 0 * 0 C0 0 0 00 0 0 0 0 0 considered site II specific. The mutant selected with 46D2
2 1 0 0 0
0 0 0 0 0 0 00 0 0 0 0 0 also failed to be neutralized by 49C2. This indicates that
3 1 0 0 0 0 0 0 0 0 0 0 00 00 0 0 0 49C2 is also directed against site II. The 40 mutants were
4 1 0 0 0 0 0 0 0 0 O O0 O @ 0 * 00 neutralized by 52C4 and 7D2. The specificities of the two
5 5 0 0 0 0 0 0 000 0 0 C) O * *0 00 MAbs which neutralized all categories of MAR mutants
6 1 0 0 0 0 0 00 0 0 0 0 @ 0 0 0 0
remain to be determined.
MAb reactivity with SDS-treated glycoprotein. The reactiv-

Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest

FIG. 1. Pattern of neutralization of mutants isolated with unclas-
sified MAbs. Data show resistance to neutralization by the selecting
MAb (0) and by other MAbs (0) and neutralization (0). Abbrevi-
ations: Cl, class; Nb, number of mutants per class.
towards new epitopes and were retained for further investi-
gation. Nine of them were used to select antigenic mutants
as described in Material and Methods. We were able to
select 40 antigenic mutants with seven of the MAbs. We
selected 12 with 40E1, 12 with 48C5, 7 with 40A1, 1 with
11C6, 1 with lDl, 1 with 46D2, and 6 with 52A4. In spite of
several attempts, we were not able to isolate any mutant
with 52C4 or 7D2.
Characterization of new antigenic regions of the glycopro-
tein. Newly selected mutants were cross-reacted with all the
unclassified MAbs as well as with selected MAbs specific for
sites II and III. They were divided into six classes, according
to their pattern of neutralization by the MAbs (Fig. 1). The
first class contains 31 mutants which were resistant to
neutralization by 40E1, 48C5, 40A1, 49C3, 20A2, and 11C6.
This result indicates that these six MAbs belong to the same
specificity group. They cannot derive from the same clone of
B cells since (i) two of them (11C6 and 20A2) were isolated
in a separate fusion and (ii) 48C5 and 40A1, which still
neutralized the mutant selected with 11C6, certainly differ
from the other four. This group of six MAbs thus clearly
delineates an antigenic region, referred to as minor site a,
ity of the 262 MAbs was studied in an ELISA with intact or
1% SDS-treated virus as antigen. All the MAbs recognized
the intact virus, but only lDl was positive when the plates
were coated with SDS-treated virus, indicating that this
MAb is probably directed toward a continuous epitope.
We also studied the binding of 39 representative MAbs in
Western blots (immunoblots) after separation of the proteins
of purified virus in SDS-PAGE with and without 2-1-mer-
captoethanol (Fig. 2). Only lDl bound to the denatured
glycoprotein under reducing conditions. However, when the
reducing agent was omitted, all the MAbs specific to minor
site a and to epitope Gl, as well as the two unclassified
MAbs, bound to the denatured protein. Under the same
conditions, 5 of the 11 site 1I-specific MAbs recognized the
glycoprotein, while only 1 of 19 site III-specific MAbs did so.
Mapping of mutations in antigenic mutants. To map the
mutations of our antigenic mutants, we partially sequenced
two class 1 mutants, one class 2 mutant, one class 3 mutant,
and one class 4 mutant (Table 1). Results supported the
prediction that mutants of classes 1 and 2 are closely related
and are affected at sites different from those already de-
scribed. We found the same substitution at position 343 for
two class 1 mutants (Gly to Glu) and a substitution at
position 342 for the class 2 mutant (Lys to Thr). It should be
noted that although the two class 1 mutants came from a
mutagenized stock of CVS, they could still derive from a
subclone of mutants which existed in the viral stock prior to
the mutagenesis. Alteration at position 343 confers resis-

a Number of neutralizing MAbs

reacting to PAGE-separated glycopr*ntei n b
MAb Treatment with Treatment with A B C
specifity SDS SDS + 2BME 1 2 1 2 1 2

Site II 5/11 0/11

Site III 1/19 0/19
C2
Minor Site a 6/6 0/6
Epitope Gl 1/1 1/1
Undetermined 2/2 0/2

FIG. 2. Binding of 39 representative neutralizing MAbs to the viral glycoprotein in Western blots. (a) Summary table; (b) representative
immunoblots showing binding in the presence (lanes 1) or absence (lanes 2) of 2-p-mercaptoethanol: binding in both condtions (A), binding
only in the absence of the reducing agent (B), or no binding (C). The positions of the five viral proteins were identified by staining the blot
with Ponceau red. The dye was washed out before treatment with antibodies.
VOL. 65, 1991 ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN 4201

TABLE 1. Mapping of mutations in new antigenic mutants

Class of MAb used in Name of Sequenced Mutation in:
mutant selection mutant region Codon Amino acid
1 40E1 1-8 320-360 GGG to GAG Gly-343 to Glu
48C5 AJ4 320-360 GGG to GAG Gly-343 to Glu
2 11C6 Ti 180-266 AAA to ACA Lys-342 to Thr
320-370
3 lDl Xi 258-380 Not found Not found
4 46D2 AD8 15-80 AAC to GAC Asn-37 to Asp
185-268
314-392
423-495

Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest

tance to all six MAbs, while alteration at position 342 confers
resistance to 11C6, 20A2, 49C3, and 40E1 but not to 48C5
and 40A1. Although these mutations were in close proximity
to those delineating site III (330 to 338), we could not find
any overlap between the two sites: the six MAbs defining
minor site a neutralized selected site 111-specific mutants,
and the two mutants affected in positions 342 and 343 were
neutralized by eight site 111-specific MAbs.
As the mutant selected with MAb lDl grew poorly in cell
culture, direct RNA sequencing could not be performed.
PCR was used to amplify the glycoprotein gene in two
overlapping segments of 766 and 1,023 bp, respectively (Fig.
3). Direct sequencing of the amplified products revealed no
amino acid changes between positions 258 and 380. The
epitope defined by lDl is then probably different from the
epitope described around position 264 by Dietzschold et al.
(10).
Sequencing of mutant AD8, a representative of class 4
mutants, revealed an amino acid change at position 37 of the
glycoprotein (Asn to Asp). This finding supported the pre-
diction made from the cross-reactivity pattern that the
alteration in this class of mutants ought to be within anti-
genic site II (34 to 42 and 198 to 200). This mutation
destroyed a potential glycosylation site present in the glyco-
proteins of all strains of rabies virus sequenced so far. The
electrophoretic mobilities of the two forms (G1 and G2) of the
glycoprotein were identical in the CVS strain and in the
mutant, indiKating that glycosylation of site 37 does not take
place in the parent strain (Fig. 4). A similar conclusion was
reached by Wunner et al. (27) by using chemical analysis of
tryptic glycoprotein fragments. As we did not find any MAbs
in 266 that failed to neutralize our site I mutant, the so-called
antigenic site I remains defined by only one MAb, 509.6,
from the Wistar collection. Direct RNA sequencing of the
glycoprotein gene of this mutant revealed a single nucleotide
change, resulting in an amino acid substitution at position
231 of the glycoprotein (Leu to Pro). The same substitution
has been reported for another escape mutant selected with
this MAb (25).
DISCUSSION
Although it is generally considered that the rabies virus
glycoprotein has six or seven antigenic sites, it is clear from
this study of 266 neutralizing MAbs that the vast majority of
these MAbs (97%) belong to sites II and III as initially
defined by Lafon et al. (14) (Fig. 5). Clearly some regions of
the glycoprotein are far more antigenic than others. A
special effort was made to characterize the eight remaining
MAbs plus four unclassified MAbs isolated in our laboratory
from previous fusions. Six of those MAbs were directed
toward a new region of the protein, probably covering amino
acids 342 and 343. One MAb, lDl, defined a new epitope,
which we called Gi. Given these results, which agree with
those found on a smaller scale in other laboratories, we
propose to reserve the term "antigenic site'" for sites II and
III. Other groups of overlapping epitopes which can be

A B C
A B

1023 bp-
w _ "
766 bp.-

FIG. 3. PCR amplification of two segments of the glycoprotein
gene. Lanes Aand B, amplification products; lane C, markers.
GM 2
FIG. 4. Electrophoretic mobilities of the proteins of CVS (B) and
mutant AD8 (A). The destruction of the first putative glycosylation
site by the substitution of an asparagine in position 37 does not
change the electrophoretic mobility of the glycoprotein (Gl, G2).
4202 BENMANSOUR ET AL.
Other Specificities (3)
-0
Minor Site a (6)
FIG. 5. Relative importance of the antigenic sites of the rabies
virus glycoprotein. The respective number of MAbs isolated in this
laboratory delineating each antigenic site is indicated in parenthe-
ses.
recognized by several MAbs isolated in separate fusions or
in different laboratories should be called minor antigenic
sites. Our group of six MAbs therefore defines minor anti-
genic site a. Other regions of the protein are identified by a
single MAb: this is the case for what were previously called
antigenic sites I, IV, V, and VI. They should be called
epitopes unless an exchange of MAbs and escape mutants
between laboratories demonstrates that two or more of the
epitopes overlap. If so, they will constitute a new minor
antigenic site.
The relative importance of each of the antigenic sites does
not seem to depend on the strain of virus or on the particular
animal examined. For instance, the predominance of sites II
and III has been observed in several fusions made with
various strains of rabies virus at the Wistar Institute, at the
Pasteur Institute and in our laboratory. It would be interest-
ing to see whether the situation is different in mice of other
haplotypes or in other species.
It is quite possible that MAbs defining minor sites and rare
epitopes are in fact raised against degraded forms of the
glycoprotein. This assumption is supported by our finding
that most of them bind to the glycoprotein in Western blots,
provided that 2-3-mercaptoethanol is omitted (if not, only
lDl binds to the protein). This property is shared by only a
few MAbs specific for sites II or III, since six of them (of 30
tested) recognized the protein in immunoblots in the absence
of reducing agent. Surprisingly, these MAbs did not react
with SDS-treated but nonreduced protein in an ELISA. This
discrepancy is probably due to partial renaturation of the
glycoprotein during electrotransfer, which is facilitated by
the preservation of disulfide bridges. Alternatively, this lack
of recognition may be explained by an added structural
distortion to antigen coated on plastic wells. It is well known
that antibodies directed against native proteins and therefore
against structures with biological significance generally bind
to complex conformational epitopes (for a review see refer-
ence 17). Our finding that only one neutralizing MAb among
266 binds to the completely unfolded form of the glycopro-
tein agrees with this.
Although antigenic site III appears to be continuous
regarding the short linear stretch of amino acids that are
affected in antigenic mutants selected with site III-specific
MAbs, not one MAb among the 64 that delineate it was able
to bind to the unfolded protein. This could indicate that
J. VIROL.
those amino acids are part of a loop at the surface of the
protein. In this case, the critical role of arginine 333 for
neurovirulence is a strong indication that this loop could be
directly implicated in the recognition of neuronal receptors.
Alternatively, site III-specific MAbs could bind to another
region of the protein, which would be dramatically modified
by mutations occurring between amino acids 330 and 338. A
possible mechanism for selection of this type of remote
antigenic variation was recently described for foot-and-
mouth disease virus (18).
Six MAbs were found to delineate a new antigenic site
(minor site a), possibly located around positions 342 and 343
of the glycoprotein. If this location is relevant, then the fact
that site III-specific mutants were all neutralized by MAbs
specific for minor site a, and vice versa, despite the proxim-
ity of the mutations selected with both groups of MAbs, may
Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest
be a consequence of the presence of a proline residue at
position 340. The presence of this amino acid is often
associated with a bending of the polypeptide chains. It would
be interesting to see whether the mutant which has a
substitution at amino acid 357 and was initially classified as
site III specific (26) is neutralized by these MAbs.
Failure to select antigenic mutants with MAbs 52C4 or
7D2 may indicate an incomplete cloning of the hybridomas,
leading to mixed populations of neutralizing antibodies.
Alternatively, it is possible that escape mutants are lethal.
Thus, the possibility that these MAbs are directed toward
critical regions of the protein cannot be excluded. Identifi-
cation of such regions will require the development of new
techniques.
ACKNOWLEDGMENTS
The excellent technical assistance of J. Bdn6jean is gratefully
acknowledged.
This work was supported by the Centre National de la Recherche
Scientifique (UPR A.2431).
REFERENCES
1. Bunschoten, H., M. Gore, I. J. T. M. Claassen, F. G. C. M.
Uytdehaag, B. Dietzschold, W. H. Wunner, and A. D. M. E.
Osterhaus. 1989. Characterization of a new virus-neutralizing
epitope that denotes a sequential determinant on the rabies virus
glycoprotein. J. Gen. Virol. 70:291-298.
2. Bussereau, F., A. Flamand, and D. Pese-Part. 1982. Reproduc-
ible plaquing system for rabies virus in CER cells. J. Virol.
Methods 4:277-282.
3. Celis, E., R. W. Miller, T. J. Wiktor, B. Dietzschold, and H.
Koprowski. 1986. Isolation and characterization of human T cell
lines and clones reactive to rabies virus: antigen specificity and
production of interferon-y. J. Immunol. 136:692-697.
4. Celis, E., D. Ou, B. Dietzschold, and H. Koprowski. 1988.
Recognition of rabies and rabies-related viruses by T cells
derived from human vaccine recipients. J. Virol. 62:3128-3134.
5. Coulon, P., P. Rollin, M. Aubert, and A. Flamand. 1982.
Molecular basis of rabies virus virulence. I. Selection of aviru-
lent mutants of the CVS strain with anti-G monoclonal antibod-
ies. J. Gen. Virol. 61:97-100.
6. Coulon, P., P. E. Rollin, and A. Flamand. 1983. Molecular basis
of rabies virus virulence. II. Identification of a site on the CVS
glycoprotein associated with virulence. J. Gen. Virol. 64:693-
696.
7. Cox, J. H., B. Dietzschold, and L. G. Schneider. 1977. Rabies
virus glycoprotein. II. Biological and serological characteriza-
tion. Infect. Immun. 16:754-759.
8. Dietzschold, B., M. Gore, P. Casali, Y. Ueki, C. E. Rupprecht,
A. L. Notkins, and H. Koprowski. 1990. Biological characteri-
zation of human monoclonal antibodies to rabies virus. J. Virol.
64:3087-3090.
9. Dietzschold, B., M. Gore, D. Marchadier, H.-S. Niu, H. M.
VOL. 65, 1991
Bunschoten, L. Otvos, Jr., W. H. Wunner, H. C. J. Ertl,
A. D. M. E. Osterhaus, and H. Koprowski. 1990. Structural and
immunological characterization of a linear virus-neutralizing
epitope of the rabies virus glycoprotein and its possible use in a
synthetic vaccine. J. Virol. 64:3804-3809.
10. Dietzschold, B., W. H. Wunner, T. J. Wiktor, A. D. Lopes, M.
Lafon, C. L. Smith, and H. Koprowski. 1983. Characterization
of an antigenic determinant of the glycoprotein that correlates
with pathogenicity of rabies virus. Proc. Natl. Acad. Sci. USA
80:70-74.
11. Flamand, A., T. J. Wiktor, and H. Koprowski. 1980. Use of
hybridoma monoclonal antibodies in the detection of antigenic
differences between rabies and rabies-related virus proteins. II.
The glycoprotein. J. Gen. Virol. 48:105-109.
12. Kohler, G., and C. Milstein. 1975. Continuous cultures of fused
cells secreting antibody of predefined specificity. Nature (Lon-
don) 256:495-497.
13. Laemmli, U. K. 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature (London)
227:680-685.
14. Lafon, M., L. Edelman, J. P. Bouvet, M. Lafage, and E.
Monchatre. 1990. Human monoclonal antibodies specific for the
rabies virus glycoprotein and N protein. J. Gen. Virol. 71:1689-
1696.
15. Lafon, M., J. Ideler, and W. H. Wunner. 1991. Investigation of
the antigenic structure of rabies virus glycoprotein by monoclo-
nal antibodies. Dev. Biol. Stand. 57:219-225.
16. Lafon, M., T. J. Wiktor, and R. I. Macfarian. 1983. Antigenic
sites on the CVS rabies virus glycoprotein: analysis with mono-
clonal antibodies. J. Gen. Virol. 64:843-851.
17. Laver, W. G., G. M. Air, R. G. Webster, and S. J. Smith-Gill.
1990. Epitopes on protein antigens: misconceptions and reali-
ties. Cell 61:553-556.
18. Parry, N., G. Fox, D. Rowlands, F. Brown, E. Fry, R. Acharya,
ANTIGENICITY OF RABIES VIRUS GLYCOPROTEIN 4203
D. Logan, and D. Stuart. 1990. Structural and serological
evidence for a novel mechanism of antigenic variation in foot-
and-mouth disease virus. Nature (London) 347:569-572.
19. Prehaud, C., P. Coulon, A. Diallo, C. Martinet-Edelist, and A.
Flamand. 1989. Characterization of a new temperature-sensitive
and avirulent mutant of the rabies virus. J. Gen. Virol. 70:133-
143.
20. Prehaud, C., P. Coulon, F. Lafay, C. Thiers, and A. Flamand.
1988. Antigenic site II of the rabies virus glycoprotein: structure
and role in viral virulence. J. Virol. 62:1-7.
21. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular
cloning: a laboratory manual. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
22. Seif, I., P. Coulon, P. E. Rollin, and A. Flamand. 1985. Rabies
virulence: effect on pathogenicity and sequence characteriza-
tion of rabies virus mutations affecting antigenic site III of the
glycoprotein. J. Virol. 53:926-934.
Downloaded from http://jvi.asm.org/ on March 1, 2021 by guest
23. Wiktor, T. J., E. Gyorgy, H. D. Schlumberger, F. Sokol, and H.
Koprowski. 1973. Antigenic properties of rabies virus compo-
nents. J. Immunol. 110:269-276.
24. Wiktor, T. J., and H. Koprowski. 1978. Monoclonal antibodies
against rabies virus produced by somatic cell hybridization:
detection of antigenic variants. Proc. Natl. Acad. Sci. USA
75:3839-3842.
25. Wunner, W. H. Personal communication.
26. Wunner, W. H., and B. Dietzschold. 1987. Rabies virus infec-
tion: genetic mutations and the impact on viral pathogenicity
and immunity, p. 103-124. In J. M. Cruse and R. E. Lewis, Jr.
(ed.), Contributions to microbiology and immunology. Karger,
Basel.
27. Wunner, W. H., B. Dietzschold, C. L. Smith, M. Lafon, and E.
Golub. 1985. Antigenic variants of CVS rabies virus with altered
glycosylation sites. Virology 140:1-12.