International Journal of Food Microbiology 146 (2011) 31–37

Contents lists available at ScienceDirect

International Journal of Food Microbiology

foo d m ic ro

Bacterial and fungal diversity in the traditional Chinese liquor fermentation process
Xiao-Ran Li a, En-Bo Ma b, Liang-Zhen Yan b, Han Meng a, Xiao-Wei Du c,
Sheng-Wan Zhang b, Zhe-Xue Quan a,⁎
a
Department of Microbiology and Microbial Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China
b
Research Institute of Applied Biology, Shanxi University, Taiyuan 030006, China
c
Shanxi Xinghuacun Fenjiu Distillery Co. Ltd., Fenyang 032205, China

a r t i c l e in f o
abstract
Article history:
Received 25 August 2010 This study endeavored to investigate the variability of bacteria and fungi present during the fermentation
Received in revised form 6 December 2010 process of the light-fragranced distilled liquor known as Fen liquor. To accomplish this, we used a
Accepted 24 January 2011 combination of clone libraries of 16S rRNA genes, bar-coded pyrosequencing of the internal transcribed
spacer region 1 (ITS1), and quantitative real-time PCR (qPCR). Fifteen families of bacteria and six families of
Keywords: fungi were detected. More than 91% of 16S rRNA gene sequences could be assigned to the family
Fen liquor Lactobacillaceae, which were then classified to eight different operational taxonomic units (OTUs), based on
Fermentation process a 3% cut-off. The most abundant OTU which contributed to 51% of the total 16S rRNA gene sequences was
Microbial community
affiliated with Lactobacillus acetotolerans and had a significantly similar variation trend with the chemical
Lactobacillaceae
constituents detected. Sixty percent of the fungal ITS1 region sequences were af filiated with the family
Saccharomycetaceae
qPCR Saccharomyce- taceae. The most abundant OTU was very similar to Issatchenkia orientalis, which displayed
notable similarities with respect to the change trends in both ethanol and organic acid contents. The
sequences of the second most abundant OTU were closest to Saccharomyces cerevisiae, an important species
in the process of ethanol production. Furthermore, about one fourth of the ITS1 region sequences belonged to
the family Saccharomycopsidaceae. Conversely, very few sequences could be grouped together with
filamentous fungi. The results of qPCR showed that the content of bacteria was increased while that of fungi
was more stable in the fermentation process. It is very important to simultaneously investigate bacterial and
fungal variations in food-fermentation processes.
© 2011 Elsevier B.V. All rights reserved.

1. Introduction
to be used to produce liquor. A mixture of broomcorn and water
(1:1.1) was steamed for 30–40 min and mixed with 10% volume of
Fermentation is an ancient, well-known technique that uses
starters. In one batch, earthernware jars (depth of 1.1 m and volume
microorganisms to process and preserve food. Solid-state fermentation
of 0.4 m3) filled with 138 kg of grains were placed underground. The
developed from starter cultures is a defining characteristic of many
starters contained microbes and the enzymes such as amylase for
types of Chinese liquor. Fen liquor, which has a long history spanning
the fermentation, and the broomcorn provided nourishment in the
approximately 1500 years, is one of the most renowned “light-
form of starch, amino acid, cellulose, etc. as substrates of
fragrance” liquors in China. It was made internationally famous in
fermentation. In an effort to keep temperatures relatively controlled,
1915, when Fen liquor won a gold medal at the Panama Pacific
several grass cushions are used to cover the tops of the jars.
International Exposition. Many types of Chinese liquor, ranging from
Normally, the fermentation period lasts for 28 days; subsequently,
expensive brands to homemade brews, are created using traditional
the fermented grains are distilled and the liquid is collected. The
methods; one of the most popular of these methods involves utilizing
most essential component of the alcohol fermentation process is
starter cultures, which consist of crude combinations of microorgan-
ethanol. Different micro-ingredient composi- tions will yield various
isms, in the fermentation processes of grains in solid form. The starter
aromas and tastes. Despite the low concentra- tions of these
for Fen liquor is made from a mixture of barley and peas (6:4), which
components, they have an enormous effect on the quality and flavor
are stirred together with the addition of water (40%). After quenching,
of the final, distilled product.
this mixture is cultivated. Following a complex production and drying
During the starter part of production, no known
process, which lasts from three to six months, the starters are then
microorganisms are intentionally added to the fermentation
ready
process of liquor. Very little is known about these microbes, despite
the fact that the subject has been studied by microbiologists for
some time (Han et al., 2009; Shi et al., 2009). Traditional
⁎ Corresponding author. Tel.: +86 21 6564 3334; fax: +86 21 5566 4332.
E-mail address: quanzx@fudan.edu.cn (Z.-X. Quan).
microbiological methods used to detect food-related
microorganisms, such as cell cultures and colony counting, are of
limited value for exploring the variation and structure

0168-1605/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2011.01.030
 X.-R. Li et al. / International Journal of Food Microbiology 146 (2011) 31–37
3
of microbial communities. Moreover, isolation media may be
the summer of 2008; the fermented grains were collected from the
suitable for only some types of microbes, as strains of microbes
center of the jar on days 1, 3, 5, 7, 9, 11, 15, 21, 28, and 40.
cannot be accurately discriminated based on appearance. Molecular
biology techniques provide precise insight into microbial diversity
2.2. Chemical and physical properties of samples
and a rapid, high-resolution description of microbial communities
by targeting ribosomal genes (Amann and Ludwig, 2000). The
The chemical and physical properties of such samples have been
high- throughput pyrosequencing technique produces a very large
published in other Chinese-language papers (Cao et al., 2010, in
number of reads in a run of many different samples using bar-
press); therefore, we have summarized those results in Fig. 1. The
coded primer sets (Miller et al., 2009), but the length of each read is
organic acid components were extracted from the fermentation
much shorter than sequences from the dideoxy chain termination
samples using ultrasonification after being dipped in ethanol. Other
sequencing method. To analyze the diversity within microbial
components (alcohols, organic acids, esters, aldehydes, etc.) were
communities, many studies have used 16S and 18S rRNA genes.
measured using GC-MS after being directly distilled. The pHs were
However, the 18S rRNA gene might not be useful to discern
measured using a pH meter electrode (Cao et al., 2010, in press).
microbes in the fermentation process, as this region is conserved in
The temperatures of sampling sites were measured using a
many fungi. Therefore, we used the internal transcribed spacer
thermometer.
(ITS) region to analyze fungal diversity, as it is more hypervariable
than the 18S rRNA gene (Martin and Rygiewicz, 2005). The ITS
2.3. DNA extraction and quantitation
region is composed of ITS1 (between 18S rRNA and the 5.8S rRNA
genes) and ITS2 regions (between the 5.8S rRNA and the 28S rRNA
Samples were stored at −20 °C prior to DNA extraction. Before
genes) (White et al., 1990); this study chose to use the ITS1 region,
extraction, the samples were washed in ddH 2O twice to remove the
in accordance with the sequence length of the pyrosequencing
effects of substances such as ethanol. Total DNA was extracted from
method (Buee et al., 2009).
0.2 g of each sample, as previously described (Schmidt et al., 1991),
In this study, the diversity of bacterial and fungal communities
with slight modification. Briefly, samples were simultaneously
in the fermentation process was detected using molecular methods.
treated with lysozyme (1 mg/ml) and lyticase (0.16 mg/ml). Then,
To check if the 28 days was the best fermentation time, the
samples were treated with SDS (1%) and CTAB (1%). Bead beating
fermentation process was extended to 40 days in this experimental
for 5 min and three liquid nitrogen freeze/thaw cycles were also
batch. Bacterial diversity was analyzed using the 16S rRNA gene
performed to ensure the homogeneity of lysed cell samples The
clone library and sequencing. Fungal diversity was analyzed using
concentration of extracted DNA was determined using a NanoDrop
the ITS1 region via pyrosequencing. Quantitative real-time PCR
3300 (Thermo Fisher, USA).
(qPCR) helped us compare the quantity of bacteria and fungi
during the fermentation process. To the best of our knowledge, this
2.4. Bacterial 16S rRNA gene clone library construction and sequencing
is the first report to reveal the fungal diversity within the food-
fermentation process by using the pyrosequencing. Simultaneous
The 16S rRNA gene primers and the annealing temperatures
investigation of bacterial and fungal diversity in the food-
used in this study are included in Table 1. In all PCR amplifications,
fermentation process is very important.
reactions were performed with pfu DNA MasterMix (TIANGEN, China)
with a total volume of 50 μl and 15 ng DNA added as template. The
PCR programs consisted of an initial 5-min denaturation at 95 °C,
2. Materials and methods
followed by 30 cycles of denaturation at 94 °C for 1 min, annealing
at 56 °C for 1 min, with an extension at 72 °C for 1.5 min; and a final
2.1. Sampling
elongation step of 10 min at 72 °C. To eliminate heteroduplexes, the
amplified reaction was diluted 10-fold into a fresh reaction mixture
In one fermentation batch, samples were got from randomly
of the same composition; this was cycled five times using the
selected jars, and the sampled jars were subsequently eliminated from
parameters specified above (Thompson et al., 2002). The PCR
the study. The fermentation samples were obtained over the course of
40 days in

32 ethanol/50
8
other alcohols
30 acids
esters
aldehydes
28 pH
temperature 6
content (mg/ g sample)

26
temperature

24
pH

4
22

20
2
18

16

14 0
1 3 5 7 9 11 15 21 28 40
days

Fig. 1. Changes in both major and minor components, pH and temperature found within the fermentation process of Fen liquor (Cao et al., 2010, in press). The content of ethanol
is 50 times “ethanol/50” and “other alcohols” signifies other types of alcohols except ethanol. The organic acid components were extracted from the fermentation samples using
ultrasonification after being dipped in ethanol. Other components (alcohols, organic acids, esters, aldehydes, etc.) were measured using GC-MS after being directly distilled (Cao
et al., 2010, in press).
Table 1
Primers and a probe used in conventional PCR and qPCR.
Target Primer
Bacterial 16S rRNA gene for 27f
clone library construction 1492r
519fb
Bacterial 16S rRNA gene for qPCR c 1369f
1492r
1389f d
Fungal ITS1 regione NSI1
58A2r
a
Ta, annealing temperature.
b
Primer used for sequencing of the 16S rRNA gene.
c
Bacterial 16S rRNA gene qPCR was performed using Real-time PCR MasterMix (TOYOBO, Japan).
d
Probe used in the qPCR.
e
The primer set of NSI1 and 58A2r was used in both the PCR for pyrosequencing and qPCR. qPCR of the fungal ITS1 region was performed using SYBR Premix Ex TaqTM
(TaKaRa, Japan).
products were analyzed on a 1% (wt/vol) agarose gel and purified
using a Qiaquick Gel Extraction Kit (QIAGEN, Germany). The
concentrations of gel productions were determined by using a
NanoDrop 3300. PCR products were ligated into a pMD18-T vector
(TaKaRa, Japan) and transformed into Escherichia coli TG1 competent
cells, following the manufacturer's instructions. The clones were
grown in Luria-Bertani medium plates that were supplemented with
ampicillin (100 μg/ml). Clones were then randomly selected for
sequencing using the primer 519f (Table 1). The nearly full-length
16S rRNA gene of each OTU was sequenced using the primer set in the
pMD18-T vector. Sequences of the 16S rRNA gene were checked for
chimeric artifacts via the Mallard program, version 1.02 (Ashelford
et al., 2006). The full-length 16S rRNA gene sequences were
assembled using the Seqman software version 5.01 (DNASTAR, USA).
2.5. Fungal ITS1 region pyrosequencing
The ITS1 region primers and annealing temperatures used in
this study are included in Table 1. The protocols for PCR
amplification, purification and quantification were similar to that of
the 16S rRNA gene. To obtain the similar numbers of sequences
from each sample, an equivalent amount of each purified PCR
product was mixed for sequencing using Genome Sequencer 20
System (Roche, Switzerland). All pyrosequencing sequences were
extracted by each sample's specified bar-code. Sequences shorter
than 150 bp were excluded.
2.6. qPCR
The copy numbers of the bacterial 16S rRNA gene and the ITS1
region of the fungi were determined in each sample with qPCR. The
primers used in qPCR are shown in Table 1. The PCR protocol for
the 16S rRNA gene was as follows: an initial denaturation at 95 °C
for 10 s, then 40 cycles at 95 °C for 15 s, followed by annealing at 56
°C for 1 min. The PCR protocol for the ITS1 region was as follows:
an initial denaturation at 95 °C for 5 min, then 30 cycles at 94 °C
for 30 s, followed by annealing at 53 °C for 30 s, and an extension
at 72 °C for 45 s. The specificity of the amplification was determined
by a melting curve analysis and gel electrophores. Cycle thresholds
were deter- mined via comparison with standard curves
constructed using E. coli strain B (Sigma, USA) for the 16S rRNA
gene of total bacteria and Saccharomyces cerevisiae for the ITS1
region of total fungi. The relative copy number of two replicates of
each sample was evaluated for each target organism.
2.7. Classification analysis
All the 16S rRNA gene sequences were assigned with the RDP
16S rRNA gene database (i.e., sequences longer than 1200 bp) using
local
Sequence (5′–3′) Ta (°C)a Reference
AGRGTTTGATYVTGGCTCAG 56 Isenbarger et al. (2008)
TACGGHTACCTTGTTACGACTT
CAGCAGCCGCGGTAATAC Lane (1991)
CGGTGAATACGTTCYCGG 56 Suzuki et al. (2000)
GGWTACCTTGTTACGACTT
CTTGTACACACCGCCCGTC
GATTGAATGGCTTAGTGAGG 53 Martin and Rygiewicz (2005)
CTGCGTTCTTCATCGAT
BLAST. All the ITS1 region sequences were assigned with the NCBI
GenBank database (i.e., all 18S and ITS sequences with taxonomic
annotations) using local BLAST. The taxonomic annotations of the
sequences were determined according to the BLAST results and the
online analysis tool EzTaxon (Chun et al., 2007) for the 16S rRNA gene
sequences of the family Lactobacillaceae. The operational taxonomic
units (OTUs) of the 16S rRNA gene sequences were determined by a
3% cut-off. The ITS1 region sequences with similar taxonomic
annotations in the species level were regarded as an OTU. The
coverage percentages were determined using the rarefaction estima-
tor in the Mothur program v.1.11.0 (Schloss et al., 2009) and by using
aRarefaction software v1.3 (http://www.uga.edu/strata/software/
Software.html).
2.8. Phylogenetic analysis
In order to determine the phylogenetic position of the full-length
16S rRNA genes, our samples were compared with available database
sequences via a BLAST search; related sequences were obtained from
GenBank. Phylogenetic trees were constructed via MEGA version 3.0
(Kumar et al., 2004) with the neighbor joining method (Saito and Nei,
1987).
2.9. Nucleotide sequence accession numbers
The sequences of each OTU in this study are available in Genbank
under the accession numbers HM754418 to HM754425 (the 16S rRNA
gene sequences of the bacteria) and HM754426 to HM754432 (the
ITS1 region sequences of the fungi).
3. Results
3.1. Analysis of OTU richness
The estimated OTU numbers (according to the rarefaction method)
were generated to allow for 3% sequence dissimilarities of the bacterial
16S rRNA gene sequences or different taxonomic annotations of the
fungal ITS1 region (Fig. 2). The bacterial richness decreased during the
fermentation process and became minimal by day 15. The fungal
richness, however, was relatively stable during the fermentation process.
3.2. Diversity of bacteria
An examination of 548 clones of 16S rRNA gene sequences (the
sequence number was 55± 4) indicated that the phyla participating
in the fermentation process were restricted to Firmicutes,
Proteobacteria, Actinobacteria, and Bacteroidetes. All sequences
could be grouped to approximately 15 families; four families with
sequences numbering more than 1% are shown in Fig. 3a. On day 1,
sequences belonging to the
30
 family Lactobacillaceae constituted about 50% of all the bacteria
25
present, and this percentage increased to 77% by day 3. After that,
number of estimated OTU

almost all the 16S rRNA gene sequences could be assigned to

20 Lactobacillaceae.
Upon extraction for further analysis, it was determined that a
total of 501 sequences related to Lactobacillaceae from day 1 to day
15
40 were assigned to eight different OTUs, based on a 3% cut-off
(OTU containing sequences less than 2% were excluded). The
10 nearly full- length 16S rRNA gene of each OTU was sequenced and
used to construct the phylogenetic tree (Fig. 4). The most abundant
OTU was FGL8. In Fig. 4, the OTU FGL8 was not detected at the
5
beginning of the fermentation process until day 7. Subsequently,
this OTU became the major group among the bacteria (more than
0 80% in samples from day 9 and 28). The variation trend of the OTU
1 3 5 7 9 11 15 21 28 40 FGL8 was similar to the trends of most chemical components
days (except the aldehydes) (Fig. 1). All sequences of OTU FGL7 were
found on days 1 and 3. The OTUs FGL2, FGL4, FGL5, and FGL6
Fig. 2. Estimated OTU numbers, according to the rarefaction method, depending on were mostly detected from day 3 to day 7, and the peak of
OTUs identified with a 3% cut-off (in bacteria) or the same taxonomic annotations (in
sequences belonging to these OTUs was found on day
fungi).
5. The OTU FGL1 was only detected from day 1 to day 5, with a
maximum level on day 3. When compared with the variations of
chemical components (Fig. 1), only the trend for aldehydes was
similar to the five OTUs mentioned above.

a LactobacillaceaeBacillaceae 3.3. Diversity of fungi

StreptococcaceaeStaphylococcaceae
100
For our purposes, sequences with same taxonomic annotation
were classified to an OTU in the fungal community composition
analysis. In this study, six families and one genus were detected in
80
percentage of sequences

60

40

20

0
1 3 5 7 9 11 15 21 28 40
days

b Saccharomycetaceae
Dipodascaceae
Saccharomycopsidaceae
Saccharomycodaceae
Candida

100

80
percentage of sequences

60

40

20

0
1 3 7 9 11 15 21 28 40
5
days

Fig. 3. Relative abundance of bacterial and fungal families in samples during the
fermentation process. Fig. 4. a. Phylogenetic tree of the bacterial OTUs in the family Lactobacillaceae. b. The
abundance of OTUs in the family Lactobacillaceae during the fermentation process.
Table 2
List of Saccharomycetaceae OTUs and the closest taxonomic annotations.

OTU Coveragea Closest taxonomic annotations Related GenBank sequence Identity

FGS1 18S (p), ITS1 (p) Saccharomycetaceae sp. LM250 EF060581 100%
FGS2 ITS1 (p), 5.8S (p) Saccharomyces bulderi AY046172 96%
FGS3 18S (p), ITS1 (c), 5.8S (p) Pichia anomala AY251638 99%
FGS4 ITS1 (p), 5.8S (p) Saccharomyces castellii D89604 98%
FGS5 18S (p), ITS1 (c), 5.8S (p) Saccharomyces cerevisiae Z73326 99%
FGS6 ITS1 (p), 5.8S (p) Torulaspora delbrueckii D89605 99%
FGS7b 18S (p), ITS1 (c), 5.8S (p) Issatchenkia orientalis AB160862 99%
FM199965
a
Coverage mean values for which parts of the 18S rRNA gene, ITS region and the 5.8S rRNA gene are contained by the pyrosequencing sequences. The (p) is partial sequence and
(c) means complete sequence.
b
The sequences of the OTU FGS7 could be assigned to Issatchenkia orientalis because the 18S rRNA gene sequences were similar to AB160862, and the ITS1 region and 5.8S rRNA
gene sequences were similar to FM199965.

1436 sequences (the sequences number was 144 ± 63),

including:
Saccharomycetaceae (60%), Saccharomycopsidaceae (29%), Candida
(7%), Saccharomycodaceae (2%), Dipodascaceae (1%),
Trichocomaceae (b 1%), and Pleosporaceae (b 1%). Less than 1% of all
the sequences could be assigned to filamentous fungi, such as
Aspergillus oryzae, which has known associations with food
fermentation. Fig. 3b shows the relative content of five major taxa
related to more than 1% sequences. At the beginning of the
fermentation process, 55% of the sequences belonged to the family
Saccharomycetaceae; this amount increased to more than 80% until
day 28, but decreased to 50% by day
40. Conversely, the percentage of sequences belonging to the family
Saccharomycopsidaceae increased from 38% on day 1 to 50% on
day 3, and then decreased during the mid-anaphase of the
fermentation process. From day 1 to day 28, less than 10% of
sequences belonged to the genus Candida, but the percentage
increased to 25% on day 40.
Sequences belonging to the family Saccharomycetaceae were
extracted and analyzed. A total of 863 sequences were used to
classify seven different OTUs based on the same taxonomic
annotations via the local BLAST results (Table 2, Fig. 5). The most
abundant sequences were in the OTU FGS7. When compared with
the variations of chemical components, the trend of the OTU
FGS7was similar with those of most of the chemical components.
Remarkably, the change of the OTU FGS7 was hysteretic with the
variation of acids but with perfect concordance. The percentage of
the OTU FGS5 increased from days 1 to 5, and most of the chemical
components increased in this period. The sequence number of
OTU FGS1 increased during days 1 to 3 and days 11 to 21, without
notable correlation to any chemical components detected. The
variation of the OTU FGS3 during days 7 to 21 was similar to the
changes of alcohol (except ethanol) content. The percentages of
other OTUs were low and did not show notable correlation with any
3.4. Quantitative analysis of bacteria and fungi
The copy number of the bacterial 16S rRNA genes and fungal
ITS1 region was determined using qPCR (Fig. 6). The copy number
of the 16S rRNA genes began to increase at the start of the
fermentation process (day 1) and peaked on day 5. This value then
decreased slightly until day 11. However, on day 15, it increased.
After day 21, the 16S copy number continued to increase until day
40. The curve of fungal ITS1 region copy numbers was stable until
day 15 and then the copy number decreased slightly.
4. Discussion
The microbial variations in several types of food, such as kimchi
(Chang et al., 2008), traditional fermented mustard (Chao et al.,
2009), and Vietnamese alcohol starter (Thanh et al., 2008), have
recently been examined by using rRNA gene sequence analysis. In
the few research studies about the Chinese liquor fermentation
process (Wang et al., 2008a, 2008b; Zhang et al., 2005, 2007), the
authors usually focus on only a limited number of isolated samples
and neglect to pay attention to microbial diversity variation during
the entire fermentation process. This study provides a systematic
analysis of bacterial and fungal diversity and the correlation
between chemical properties and the bacterial and fungal OTUs
during the fermentation process of one of the most famous Chinese
Fen liquors.
In this study, the bacterial community diversity became lower
during the Fen liquor fermentation process. When the fermentation
began, the contents of several chemicals increased, making the
habitat suitable for few types of bacteria. The microbes present
only in the
10
the logarithm of copy numbers per g samples

chemical components detected.

2 16S rRNA gene ITS region

0
1 3 5 7 9 11 15 21 28 40
days

Fig. 5. The abundance of OTUs in the family Saccharomycetaceae during the

fermentation process. Fig. 6. The change in copy numbers of the bacterial 16S rRNA gene and fungal ITS1
region during the fermentation process.
beginning of the fermentation process might have existed in the
The sequences associated with the family Saccharomycetaceae
starter, but could not last long during the fermentation process.
could be divided into seven OTUs, according to the GenBank
However, the richness of fungi was more stable during the
taxonomic annotations. The most abundant sequences were in the
fermentation process, indicating that these types of fungi involved
OTU FGS7. When compared with the GenBank database, this group
in liquor fermentation might be adaptable to changes in the
aligned with an uncultured compost fungus clone from full-scale
fermentation environment.
facilities (Hultman et al., 2008), perfectly matched with the assembled
Fig. 3 showed the major families present during the
contig with the 18S rRNA gene sequence (AB160862) and the ITS1
fermentation process. Those detected at day 1 were similar to those
region and 5.8S rRNA gene sequences (FM199965) (Daniel et al.,
in the starters (data not shown).The bacteria in the fermentation
2009) of cultured Issatchenkia orientalis. In previous studies,
process were almost exclusively from the family Lactobacillaceae
I. orientalis was found to serve the functions of organic acid
after day 1, indicating that the family Lactobacillaceae was the only
degradation during wine fermentation (Hong et al., 2010), and was
bacterial contributor to the fermentation. The sequence length
also detected in cheese fermentation samples (Seiler and Busse,
obtained from pyrosequencing was less than 300 base-pair (bp)
1990), cocoa bean heap fermentation samples (Daniel et al., 2009),
(produced by Genome Sequencer 20 System) in this study; this
and coffee fermentation samples (Masoud et al., 2004). The
result may be due to a lack of resolution between different species
relationship of the OTU FGS7 and the variations of chemical
of the family Lactobacillaceae. Therefore, clone libraries were
components could be explained if the OTU FGS7 could produce
constructed and a dideoxy chain termination sequencing method
many types of chemical components, such as ethanol, and could
was used to analyze the bacterial diversity in the fermentation
degrade the organic acid produced by S. cerevisiae (Schwartz and
process. About 700 bp of the randomly selected clones and a nearly
Radler, 1988) and Lactobacillaceae. Furthermore, the percentage
full-length assembled sequence of the 16S rRNA gene in each OTU
of this OTU on day 1 was relatively high, and most of the fungal
of the family Lactobacillaceae were determined. In bacteria, the
sequences could be associated with this OTU in the starter samples
most abundant OTU FGL8 was similar to Lactobacillus
(data not shown). The OTU FGS5 was closest to S. cerevisiae, which
acetotolerans (AB303841), which was detected in a fermented rice
could produce fuel ethanol from lignocellulose (Zaldivar et al.,
bran sample (Nakayama et al., 2007). On day 9, the sequence
2001) and many types of carbohydrates (Kotter and Ciriacy, 1993;
number content, as well as most of the chemical components,
Pronk et al., 1996). The OTU FGS5 may produce many types of
reached their zenith, indicating that the OTU FGL8 might be the
chemical components during the prophase of the fermentation
most important of all the bacteria, and that day 9 might be an
process. The OTU FGS1 was similar to an uncultured marine
important point during the fermentation process. Furthermore, the
fungus. The sequences of the OTU FGS3 were closely related to
organic acids increased from day 1 to day 7 making the
Pichia anomala, which was detected in plain yogurt fermentation
environment unsuitable to other bacteria in the family Lactoba-
and has the capability of fermenting galactose (Giudici et al., 1996).
cillaceae. The OTU FGL7 was more than 99% similar to L.
The recognized sequences belonging to filamentous fungi, such
delbrueckii (AY050172), which colonizes vegetable fermentation
as the family Trichocomaceae, which was thought to play an
(Germond et al., 2003) and this OTU existing in day 1 and day 3
important role in the food-fermentation process, were extremely
indicating that this OTU was present in the starters. The sequences
few in this study. The effect of DNA extraction could be disregarded
of OTU FGL6 were assigned to L. brevis (AF515220), which was
because more than one-third of sequences could be assigned to the
previously detected in a paddy rice silage sample (Ennahar et al.,
family Trichocomaceae and 5% of sequences belonged to the genus
2003). These five OTUs might be correlated with the production of
Aspergillus in other samples using the same DNA extraction
aldehydes according to the similar change trends at the beginning
method (data not shown). This result might indicate that the major
of the fermentation process.
active microbes during the liquor fermentation were the families
The diversity of fungal communities during the fermentation
Saccharomycetaceae and Lactobacillaceae. Another possible
process was determined using the pyrosequencing method with an
explanation was that the filamentous fungi grew and waned
independent bar-code of each sample. Using a reference database of
expeditiously during days 1 to 3 without detection by the
public sequences to define OTU for pyrosequencing datasets was
sequencing method.
suggested in previous studies (Dethlefsen et al., 2008; Sogin et al.,
During the fermentation process, organic acid content
2006). The sequences with the same taxonomic annotation were
continually increased while the pH decreased from day 1 to day 7.
assigned OTU when analyzing fungal community composition in this
During this period, the fermentation temperature increased rapidly
study. More than 90% of the ITS1 region sequences can be divided into
due to the release of energy from the fermentation of ethanol (Fig.
three groups while only the family Saccharomycetaceae dominated in
1). Accord- ingly, the copy number of the 16S rRNA gene also
the starters (data not shown).
increased from day 1 to day 5 (Fig. 3). In contrast, the reduction of
In previous studies, the genus Candida was detected in a ewe's
the ITS1 region copy number after day 15 might be because of the
dairy sample (Cosentino et al., 2001) and used as the starter for
continuous increased organic acids and decreased temperature due
alcoholic fermentation processes (N'Guessan et al., 2010).
to the low activity of fermentation of ethanol.
However, the percentage of the sequences belonging to the genus
To investigate if a 28 day fermentation time was optimal, the
Candida was low and kept steady during the 28-day fermentation
fermentation was extended to 40 days. Comparisons of the major
process without any particular species occurring regularly. The
bacterial and fungal OTUs at day 21, day 28, and day 40 were
variety of the genus Candida did not show any notable correlations
performed in Figs. 4 and 5. Similar results were obtained at day 21
with the change trends of the chemical components in Fig. 1. This
and day 28, while day 40 showed larger differences. Analysis of the
result indicates that the genus Candida might not be important in
chemical and physical properties revealed that only the ester
the Fen liquor fermentation process.
content increased between day 21 and day 40. These results
Almost all sequences belonging to the family
indicated that the fermentation time could be abbreviated which
Saccharomycopsidaceae could be assigned to Saccharomycopsis
could enhance the efficiency of Fen liquor production.
fibuligera, which has the ability to ferment cellulosic alcohol (Jeon
In this study, the diversity of bacterial and fungal communities
et al., 2009) and to degrade starch (Valachova and Horvathova,
was studied using a clone library and the pyrosequencing method.
2007). This yeast also secretes a large amount of amylases, acid
Usually, only several types of bacteria and fungi were the major
proteases and β-glucosidase, which have potential applications in the
microbes contributing to the liquor fermentation process. Our
fermentation industry (Chi et al., 2009). This yeast might play an
results showed that the combined action of more different bacterial
important role in the mid-prophase and correlate with the production
and fungal species contributed the fermentation process of Fen
of ethanol in the Fen liquor fermentation process.
liquor during
different periods. This study provided evidence that the addition of
one or more bacterial and fungal species could improve the quality of
liquor in traditional or industrial yeast strain fermentations. Further-
more, knowledge of the bacterial and fungal species contributing to
the fermentation process during different time periods might be
useful to control liquor production systems and improve liquor
quality. On the other hand, the bacterial and fungal species potentially
tampered with the quality of Fen liquor should receive more attention
and further studies. Further studies about a more-detailed examina-
tion of correlation between the chemical and physical properties and
the major microbes as well as the hypothetic types of bacteria and
fungi contributing to the fermentation process are necessary.
Acknowledgements
This work was supported by the Project of Scientific and Techno-
logical Innovation in Shanxi Province (2007101016) and Returned
Overseas Scholar Research Project of Shanxi Province (200902).
References
Amann, R., Ludwig, W., 2000. Ribosomal RNA-targeted nucleic acid probes for studies in
microbial ecology. FEMS Microbiology Reviews 24, 555–565.
Ashelford, K.E., Chuzhanova, N.A., Fry, J.C., Jones, A.J., Weightman, A.J., 2006. New
screening software shows that most recent large 16S rRNA gene clone libraries
contain chimeras. Applied and Environmental Microbiology 72, 5734–5741.
Buee, M., Reich, M., Murat, C., Morin, E., Nilsson, R.H., Uroz, S., Martin, F., 2009. 454
pyrosequencing analyses of forest soils reveal an unexpectedly high fungal
diversity. New Phytologist 184, 449–456.
Cao, Y.G., Hu, Y.G., Ma, Y.H., Du, X.W., Ma, E.B., Quan, Z.X., Zhang, S.W., 2010.
Variation of
aromatic components in solid phase fermented grains during fermentation of Fen
liquor. Food Science 31, 367–371 (Chinese).
Cao, Y.G., Ma, L., Du, X.W., Zhang, S.W., in press. Variation of organic acids in solid
phase fermented grains during fermentation of Fen liquor. Food Science
(Chinese).
Chang, H.W., Kim, K.H., Nam, Y.D., Roh, S.W., Kim, M.S., Jeon, C.O., Oh, H.M., Bae, J.W.,
2008. Analysis of yeast and archaeal population dynamics in kimchi using
denaturing gradient gel electrophoresis. International Journal of Food
Microbiology 126, 159–166.
Chao, S.H., Wu, R.J., Watanabe, K., Tsai, Y.C., 2009. Diversity of lactic acid bacteria in
suan-tsai and fu-tsai, traditional fermented mustard products of Taiwan.
International Journal of Food Microbiology 135, 203–210.
Chi, Z.M., Chi, Z., Liu, G.L., Wang, F., Ju, L., Zhang, T., 2009. Saccharomycopsis fibuligera
and its applications in biotechnology. Biotechnology Advances 27, 423–431.
Chun, J., Lee, J.-H., Jung, Y., Kim, M., Kim, S., Kim, B.K., Lim, Y.W., 2007. EzTaxon: a web-
based tool for the identification of prokaryotes based on 16S ribosomal RNA gene
sequences. International Journal of Systematic and Evolutionary Microbiology 57, 2259 –
2261.
Cosentino, S., Fadda, M.E., Deplano, M., Mulargia, A.F., Palmas, F., 2001. Yeasts associated
with Sardinian ewe's dairy products. International Journal of Food Microbiology 69, 53–58.
Daniel, H.M., Vrancken, G., Takrama, J.F., Camu, N., De Vos, P., De Vuyst, L., 2009. Yeast
diversity of Ghanaian cocoa bean heap fermentations. FEMS Yeast Research 9,
774–783.
Dethlefsen, L., Huse, S., Sogin, M.L., Relman, D.A., 2008. The pervasive effects of an
antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing.
PLoS Biology 6, 2383–2400.
Ennahar, S., Cai, Y.M., Fujita, Y., 2003. Phylogenetic diversity of lactic acid bacteria
associated with paddy rice silage as determined by 16S ribosomal DNA analysis.
Applied and Environmental Microbiology 69, 444–451.
Germond, J.E., Lapierre, L., Delley, M., Mollet, B., Felis, G.E., Dellaglio, F., 2003.
Evolution of the bacterial species Lactobacillus delbrueckii: a partial genomic study
with reflections on prokaryotic species concept. Molecular Biology and Evolution 20,
93–104.
Giudici, P., Masini, G., Caggia, C., 1996. The role of galactose fermenting yeast in plain
yogurt spoilage. Annali Di Microbiologia Ed Enzimologia 46, 11–19.
Han, S., Lei, Z.H., Li, Q., Lu, L.H., Zhao, L.Q., 2009. Study on the cultured microbial
community and the metabolism regulation during the brewing process of the Fen
liquor. Food and Fermentation Industries 35, 9–13.
Hong, S.K., Lee, H.J., Park, H.J., Hong, Y.A., Rhee, I.K., Lee, W.H., Choi, S.W., Lee, O.S., Park,
H.D.,
2010. Degradation of malic acid in wine by immobilized Issatchenkia orientalis cells
with oriental oak charcoal and alginate. Letters in Applied Microbiology 50, 522–529.
Hultman, J., Ritari, J., Romantschuk, M., Paulin, L., Auvinen, P., 2008. Universal
ligation- detection-reaction microarray applied for compost microbes. BMC Microbiology
8,
e237.
Isenbarger, T.A., Finney, M., Rios-Velazquez, C., Handelsman, J., Ruvkun, G., 2008.
Miniprimer PCR, a new lens for viewing the microbial world. Applied and
Environmental Microbiology 74, 840–849.
Jeon, E., Hyeon, J.E., Eun, L.S., Park, B.S., Kim, S.W., Lee, J., Han, S.O., 2009. Cellulosic
alcoholic fermentation using recombinant Saccharomyces cerevisiae engineered for
the production of Clostridium cellulovorans endoglucanase and Saccharomycopsis
fibuligera beta-glucosidase. FEMS Microbiology Letters 301, 130–136.
Kotter, P., Ciriacy, M., 1993. Xylose fermentation by Saccharomyces-Cerevisiae. Applied
Microbiology and Biotechnology 38, 776–783.
Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: an integrated software for molecular
evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics
5, 150–163.
Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stackebrandt, E., Goodfellow, M.
(Eds.), Nucleic acids techniques in bacterial systematics. John Wiley & Sons, New
York, pp. 115–175.
Martin, K.J., Rygiewicz, P.T., 2005. Fungal-specific PCR primers developed for analysis of
the ITS region of environmental DNA extracts. BMC Microbiology 5, 1–28.
Masoud, W., Cesar, L.B., Jespersen, L., Jakobsen, M., 2004. Yeast involved in
fermentation of Coffea arabica in East Africa determined by genotyping and by
direct denaturating gradient gel electrophoresis. Yeast 21, 549–556.
Miller, S.R., Strong, A.L., Jones, K.L., Ungerer, M.C., 2009. Bar-coded
pyrosequencing reveals shared bacterial community properties along the
temperature gradients of two alkaline hot springs in Yellowstone National Park.
Applied and Environmental Microbiology 75, 4565–4572.
Nakayama, J., Hoshiko, H., Fukuda, M., Tanaka, H., Sakamoto, N., Tanaka, S., Ohue, K.,
Sakai, K., Sonomoto, K., 2007. Molecular monitoring of bacterial community
structure in long-aged nukadoko: pickling bed of fermented rice bran dominated
by slow-growing lactobacilli. Journal of Bioscience and Bioengineering 104, 481–
489.
N'Guessan, F.K., N'Dri, D.Y., Camara, F., Dje, M.K., 2010. Saccharomyces cerevisiae and
Candida tropicalis as starter cultures for the alcoholic fermentation of tchapalo, a
traditional sorghum beer. World Journal of Microbiology & Biotechnology 26, 693–
699.
Pronk, J.T., Steensma, H.Y., van Dijken, J.P., 1996. Pyruvate metabolism in
Saccharomyces cerevisiae. Yeast 12, 1607–1633.
Saito, N., Nei, M., 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406–425.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,
Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B.,
Thallinger, G.G., Van Horn, D.J., Weber, C.F., 2009. Introducing mothur: open-
source, platform-independent, community-supported software for describing and
comparing microbial communities. Applied and Environmental Microbiology 75,
7537–7541.
Schmidt, T.M., DeLong, E.F., Pace, N.R., 1991. Analysis of a marine picoplankton
community by 16S rRNA gene cloning and sequencing. Journal of Bacteriology
173, 4371–4378.
Schwartz, H., Radler, F., 1988. Formation of L(−)malate by Saccharomyces cerevisiae
during fermentation. Applied Microbiology and Biotechnology 27, 553–560.
Seiler, H., Busse, M., 1990. The yeasts of cheese brines. International Journal of Food
Microbiology 11, 289–304.
Shi, J.H., Xiao, Y.P., Li, X.R., Ma, E.B., Du, X.W., Quan, Z.X., 2009. Analyses of microbial
consortia in the starter of Fen liquor. Letters in Applied Microbiology 48, 478–485.
Sogin, M.L., Morrison, H.G., Huber, J.A., Mark Welch, D., Huse, S.M., Neal, P.R., Arrieta,
J. M., Herndl, G.J., 2006. Microbial diversity in the deep sea and the underexplored
“rare biosphere”. Proceedings of the National Academy of Sciences of the United
States of America 103, 12115–12120.
Suzuki, M.T., Taylor, L.T., DeLong, E.F., 2000. Quantitative analysis of small-subunit
rRNA genes in mixed microbial populations via 5′-nuclease assays. Applied
Environ- mental Microbiology 66, 4605–4614.
Thanh, V.N., Mai, L.T., Tuan, D.A., 2008. Microbial diversity of traditional Vietnamese
alcohol fermentation starters (banh men) as determined by PCR-mediated DGGE.
International Journal of Food Microbiology 128, 268–273.
Thompson, J.R., Marcelino, L.A., Polz, M.F., 2002. Heteroduplexes in mixed-template
amplifications: formation, consequence and elimination by ‘reconditioning PCR’.
Nucleic Acids Research 30, 2083–2088.
Valachova, K., Horvathova, V., 2007. Starch degradation by glucoamylase Glm from
Saccharomycopsis fibuligera IFO 0111 in the presence and absence of a commercial
pullulanase. Chemistry & Biodiversity 4, 874–880.
Wang, C.L., Shi, D.J., Gong, G.L., 2008a. Microorganisms in Daqu: a starter culture of
Chinese Maotai-flavor liquor. World Journal of Microbiology & Biotechnology 24,
2183–2190.
Wang, H.Y., Zhang, X.J., Zhao, L.P., Xu, Y., 2008b. Analysis and comparison of the
bacterial community in fermented grains during the fermentation for two
different styles of Chinese liquor. Journal of Industrial Microbiology &
Biotechnology 35, 603–609.
White, T.J., Bruns, T., Lee, S., Taylor, J.W., 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,
Sninsky, J.J., White, T.J. (Eds.), In PCR protocols: a guide to methods and
applications. Academic Press, New York, pp. 315–322.
Zaldivar, J., Nielsen, J., Olsson, L., 2001. Fuel ethanol production from lignocellulose: a
challenge for metabolic engineering and process integration. Applied Microbiology
and Biotechnology 56, 17–34.
Zhang, W.X., Qiao, Z.W., Shigematsu, T., Tang, Y.Q., Hu, C., Morimura, S., Kida, K.,
2005. Analysis of the bacterial community in Zaopei during production of Chinese
Luzhou-flavor liquor. Journal of the Institute of Brewing 111, 215–222.
Zhang, W.X., Qiao, Z.W., Tang, Y.Q., Hu, C., Sun, Q., Morimura, S., Kida, K., 2007.
Analysis of the fungal community in Zaopei during the production of Chinese
Luzhou- flavour liquor. Journal of the Institute of Brewing 113, 21–27.