Article

Symbiont-regulated serotonin biosynthesis

modulates tick feeding activity
Graphical abstract Authors
Zhengwei Zhong, Ting Zhong,
Yeqing Peng, Xiaofeng Zhou,
Zhiqian Wang, Huiru Tang,
Jingwen Wang

Correspondence
jingwenwang@fudan.edu.cn

In brief
Zhong et al. determine that the natural
symbiont Coxiella promotes feeding
behavior and blood intake of the Asian
longhorned tick, Haemaphysalis
longicornis. Mechanistically, Coxiella-
derived chorismate serves as a
tryptophan precursor that stimulates the
biosynthesis of serotonin (5-HT), which
plays a key role in influencing tick feeding
activity.

Highlights
d A reduction in the abundance of the symbiont Coxiella
impairs blood intake in ticks

d Diminished Coxiella abundance reduces serotonin

biosynthesis within the tick

d Serotonin is pivotal in regulating tick feeding activity

d Coxiella-derived chorismate, a tryptophan precursor,

promotes serotonin biosynthesis

Zhong et al., 2021, Cell Host & Microbe 29, 1–13

October 13, 2021 ª 2021 Elsevier Inc.
https://doi.org/10.1016/j.chom.2021.08.011 ll
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll

Article
Symbiont-regulated serotonin biosynthesis
modulates tick feeding activity
Zhengwei Zhong,1,2 Ting Zhong,1,2 Yeqing Peng,1,3 Xiaofeng Zhou,4 Zhiqian Wang,1,2 Huiru Tang,1,3
and Jingwen Wang1,2,5,*
1State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai 200438, P. R. China
2Ministry of Education Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai 200438, P.
R. China
3Zhongshan Hospital and School of Life Sciences, Human Phenome Institute, Metabonomics and Systems Biology Laboratory at Shanghai

International Centre for Molecular Phenomics, Fudan University, Shanghai 200438, P. R. China
4Human Phenome Institute, Fudan University, Shanghai 200433, P. R. China
5Lead contact

*Correspondence: jingwenwang@fudan.edu.cn
https://doi.org/10.1016/j.chom.2021.08.011

SUMMARY

Ticks are obligate hematophagous arthropods. Blood feeding ensures that ticks obtain nutrients essential for
their survival, development, and reproduction while providing routes for pathogen transmission. However,
the effectors that determine tick feeding activities remain poorly understood. Here, we demonstrate that
reduced abundance of the symbiont Coxiella (CHI) in Haemaphysalis longicornis decreases blood intake.
Providing tetracycline-treated ticks with the CHI-derived tryptophan precursor chorismate, tryptophan, or
5-hydroxytryptamine (5-HT; serotonin) restores the feeding defect. Mechanistically, CHI-derived chorismate
increases tick 5-HT biosynthesis by stimulating the expression of aromatic amino acid decarboxylase
(AAAD), which catalyzes the decarboxylation of 5-hydroxytryptophan (5-HTP) to 5-HT. The increased level
of 5-HT in the synganglion and midgut promotes tick feeding. Inhibition of CHI chorismate biosynthesis by
treating the colonized tick with the herbicide glyphosate suppresses blood-feeding behavior. Taken
together, our results demonstrate an important function of the endosymbiont Coxiella in the regulation of
tick 5-HT biosynthesis and feeding.

INTRODUCTION Ticks host a variety of symbionts. The common symbionts found

Ticks are obligate blood feeders and vectors of numerous path-
ogens. In ixodid ticks, each stage (larvae, nymphs, and females)
requires a single blood meal before molting or oviposition (Coons
and Rothschild, 2008). Unlike other hematophagous arthropods
that feed for minutes, ixodid ticks spend days to weeks on their
hosts, ingesting blood equal to 100 times more than their body
mass (Estrada-Peña, 2015; Pavela et al., 2016). To ensure
feeding success, ticks have developed multiple strategies to
evade host defenses and facilitate blood intake (Simo
et al.,
2017). Saliva contains hundreds of bioactive molecules with
vasodilator, anticoagulant, and immunosuppressive activity
that ensure their unnoticed and long-term attachment to the


host skin and facilitate blood flow (Simo et al., 2017). Midgut,
the primary tissue for blood storage and digestion, contains
various molecules that are involved in antihemostatics, proteol-
ysis, detoxification, and nutrient assimilation (Alim et al., 2009;
Feng and Cheng, 2020; Galay et al., 2015; Schwarz et al.,
2012). In addition, temperature, host species, tick density, and
age also affect their feeding activity (Jones et al., 2015; Pollock
et al., 2015). Thus, tick blood feeding is very complicated pro-
cess, and our understanding of its regulation is still limited.
in different tick species are the bacteria belonging to Coxiella,
Rickettsia, and Francisella genera (Binetruy et al., 2020; de la
Fuente et al., 2008; Duron et al., 2017; Machado-Ferreira et al.,
2016; Narasimhan et al., 2021; Rio et al., 2016).These microbes
are vital in tick development and reproduction due to their capacity
to provide B vitamins and cofactors that are scarce in mammalian
blood (Duron et al., 2018; Gerhart et al., 2016; Gottlieb et al., 2015;
Hunter et al., 2015; Olivieri et al., 2019; Rio et al., 2016; Smith et al.,
2015; Tsementzi et al., 2018). They also rely on ticks for providing
the nutrients necessary for their growth (Bonnet et al., 2017; Rio
et al., 2016; Wernegreen, 2012). The nutritional provision capability
and growth dependence of ticks suggest that these symbionts
might be involved in the regulation of energy balance in ticks. A
few reports have shown that symbionts play a role in regulating
ticks feeding activity. Diminished Coxiella sp. by antibiotics treat-
ment significantly compromises blood intake in Rhipicephalus
sanguineus, Rhipicephalus microplus, and Haemaphysalis longi-
cornis (Ben-Yosef et al., 2020; Guizzo et al., 2017; Zhang et al.,
2017). Ornithodoros moubata nymphs, of which the obligate mutu-
alist, Francisella, is reduced by antibiotic treatment, stop feeding
(Duron et al., 2018). However, a mechanistic understanding of
the symbionts linked to tick feeding activity is still lacking.

Cell Host & Microbe 29, 1–13, October 13, 2021 ª 2021 Elsevier Inc. 1
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011
ll
In this study, we observed that the bacterial symbiont
Coxiella (hereafter CHl) regulated the feeding activity of the
Asian longhorned tick Haemaphysalis longicornis, which is the
vector of a wide spectrum of human and zoonotic pathogens
(Heath, 2016; Rainey et al., 2018; Talactac et al., 2018; Zhuang
et al., 2018). This regulation may be observed because CHI
affected 5-hydroxytryptamine (5-HT, serotonin) biosynthesis.
CHI-derived chorismate promoted tick 5-HT production by up-
regulating the expression of the aromatic amino acid decarbox-
ylase (AAAD), mediating catabolic synthesis of 5-HT from
5-HTP. The homeostasis of 5-HT in the synganglion and midgut
determined tick blood intake. Nymphs treated with glyphosate,
one of the most widely used herbicides, which inhibits the
biosynthesis of chorismate, exhibited reduced blood intake,
suggesting that targeting the tick symbiont-specific chorismate
biosynthetic pathway might serve as an alternative approach
for tick control.
RESULTS
Coxiella sp. promotes tick blood feeding
CHl is the major symbiont in H. longicornis (Wang et al.,
2018). To investigate its role in tick physiology, we treated
nymphal ticks with increasing amounts of tetracycline (Fig-
ure S1A). Injection of 0.2 mg/nymph tetracycline significantly
reduced the abundance of CHI 2 and 4 days post treatment
(Figure 1A), but without influencing the total microbiota in
nymphs (Figure 1B). This result suggests that other bacteria
might survive and outcompete CHI in the presence of tetracy-
cline and CHI might play a role in controlling other commensal
bacteria. Unexpectedly, tetracycline treatment blocked the
attachment of most ticks. The attached ones ingested signif-
icantly reduced amounts of blood compared with untreated
and saline-treated nymphs (Figure 1C). We next measured
CHI levels of nymphs at different feeding stages, including
4 days ( 4 D), 2 days ( 2 D), 0 day (0 D) prior to feeding,
feeding for 1 day (1 D), feeding until partially engorged (PD),
and fully engorged (FE). We present our data as absolute
CHI numbers normalized to tick actin levels to better gain in-
formation on symbiotic proliferation. Interestingly, CHI was
kept at a steady level during the whole feeding process (Fig-
ure S1B), suggesting a tight regulation of CHI in ticks. We also
observed that there were always a few nymphs that didn’t
attach. To investigate whether CHI influences tick feeding,
we collected nymphs after 4 days of feeding when most of
the nymphs were replete, and examined individual CHIs level.
As expected, those failed to attach had extremely low levels
of CHI (Figure S1C). The amount of blood that ticks ingested
was positively correlated with the abundance of CHI (Fig-
ure S1D). These results suggest that Coxiella sp. plays a
role in initiating blood feeding in H. longicornis.
To examine whether the reduction of Coxiella leads to inhibi-
tion of tick feeding, we treated nymphal H. longicornis with a
cocktail of antibiotics containing penicillin, streptomycin, and
gentamicin (PSG). PSG treatment did not influence the number
of CHI, but it significantly decreased the total microbiota load
(Figures 1D and 1E). These ticks ingested similar amounts of
blood as controls (Figure 1F), confirming the specific role played
by CHI in controlling tick feeding.
2 Cell Host & Microbe 29, 1–13, October 13, 2021
Article
CHI-regulated tryptophan metabolism affects blood
feeding
To understand how CHI influences tick-feeding activity, we
compared gene expression profiles between H. longicornis
nymphs treated with and without tetracycline by RNA
sequencing. The reduction in Coxiella led to global changes in
gene expression, with 9,713 genes being differentially regulated
(Figure 2A; Table S1). Among the top 20 pathways enriched with
the downregulated genes in tetracycline-treated nymphs, six
were involved in amino-acid metabolism, namely, the tyrosine,
tryptophan, phenylalanine, histidine, glycine/serine/threonine,
and arginine/proline metabolic pathways, suggesting that CHl
plays a role in regulating tick amino-acid metabolism (Figure 2B).
We next analyzed the CHI amino-acid metabolic pathways using
the published genome sequence of Coxiella from Amblyomma
americanum as a reference (Smith et al., 2015). Notably, we
found a complete shikimate pathway for chorismate biosyn-
thesis in this bacterium (Figure 2C). Chorismate is the precursor
of aromatic amino acids, including tryptophan, phenylalanine,
and tyrosine (Herrmann and Weaver, 1999). It is possible
that the reduced number of Coxiella in tetracycline-treated
H. longicornis leads to diminished chorismate biosynthesis
which, in turn, decreases the levels of downstream aromatic
acids and changes tick feeding activity.
To test this hypothesis, we supplemented tetracycline treat-
ment with different dosages of chorismate (Figure 3A) and
observed that the addition of 40 ng/nymph chorismate restored
the blood intake of the ticks without influencing the CHI numbers
in these ticks (Figures 3A and S2A). Next, we examined whether
the influence of chorismate on feeding occurs through down-
stream aromatic amino acids. As phenylalanine can be
converted to tyrosine, we supplemented ticks with two essential
aromatic amino acids, tryptophan (Trp) and phenylalanine (Phe).
The addition of the mixture of Trp and Phe significantly increased
blood intake in tetracycline-treated ticks compared with nonsup-
plemented ticks (Figure 3B), but had no influence on feeding in
normal ticks (Figure S2B). Next, we supplemented Trp and Phe
individually and found that only Trp promoted tick feeding
when CHI was reduced (Figure 3C).
In mammals, most tryptophan is metabolized through the
kynurenine pathway, while a small portion, approximately 1%,
is metabolized through the 5-HT pathway (Stone et al., 2013).
We next analyzed the influence of the Trp downstream metabo-
lites kynurenine and 5-HT, which belong to the kynurenine and
5-HT pathways, respectively, on tick feeding. Supplementation
of 5-HT but not kynurenine to tetracycline-treated nymphs
successfully increased blood intake compared with the tetracy-
cline-treated only ones (Figures 3D and S2C). Again, 5-HT sup-
plementation in normal ticks didn’t change their feeding activity
(Figure S2D). In keeping with this result, the serotonergic syn-
apse pathway was enriched with the downregulated genes
when CHI was reduced based on our transcriptome analysis
(Figure 2B). Next, we examined the influence of CHI on 5-HT
biosynthesis and found that diminished CHI significantly
decreased serotonin levels compared with controls (Figure 3E).
Taken together, these results suggest that CHI-derived choris-
mate, Trp, and the downstream metabolite 5-HT are responsible
for modulating tick feeding activity. CHI might be responsible for
regulating 5-HT production.
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 1. Reduction of CHI in nymphs suppresses tick blood intake

(A and B) Fold change of CHI (A) and total microbiota (B) in the 0.9% NaCl (CT)- and tetracycline (TET)-treated groups at 2 days (upper panel) and 4 days (lower
panel) post-injection. The dose of TET utilized was 200 ng/nymph. The copy number of CHI genus-specific 16S rRNA was normalized to that of tick actin. Fold
change of CHI abundance in TET group was normalized to that in controls. Dots represent individual ticks; n = 7–11; horizontal lines represent the mean.
(C) Engorgement weights of untreated normal nymphs (N) and nymphs treated with 0.9% NaCl (CT) and tetracycline (TET). Dots represent individual ticks;
n = 26–35; horizontal lines represent the median.
(D and E) Fold change of CHI (D) and total microbiota (E) in nymphs treated with 0.9% NaCl (CT) and a cocktail of penicillin, streptomycin, and gentamicin (PSG) at
2 days (upper panel) and 4 days (lower panel) post-injection. The copy number of universal 16S rRNA was normalized to the copy number of tick actin. Fold
change of total microbiota abundance in PSG group was normalized to that in controls. Dots represent individual ticks; n = 9–10; horizontal lines represent
the mean.
(F) Engorgement weights of untreated (N), CT-, and PSG-treated nymphs. Dots represent individual ticks; n = 28–39; horizontal lines represent the median.
Significance was determined by Student’s t test in (A), (B), (D), and (E) and by ANOVA with Dunn’s tests in (C) and (F). The results of one of the two independent
experiments are shown. *p < 0.05, ***p < 0.001, ****p < 0.0001. See also Figure S1.

5-HT regulates tick feeding activity
To validate the involvement of 5-HT in regulating tick feeding ac-
tivity, we inhibited the biosynthesis of 5-HT. Tryptophan hydroxy-
lase (TPH), which converts Trp to 5-hydroxytryptophan (5-HTP), is
the rate-limiting enzyme of 5-HT biosynthesis (Gershon and Tack,
2007; Heredia et al., 2013). We first suppressed the activity of TPH
by knocking down the expression of Tph by microinjection of a
Tph-specific double-stranded RNA (dsRNA) (Figures 4A and
S3A). We also treated ticks with the TPH antagonist a-methyl-
DL-tryptophan (AMTP) and inhibitor para-chlorophenylalanine
(PCPA). Both approaches significantly suppressed tick blood
intake (Figures 4B, 4C, and S3B). 5-HT affects 5-HT receptors
to initiate a variety of signaling pathways in vertebrates and inver-
tebrates (Hoyer et al., 2002; Tierney, 2001). Three 5-HT recep-
tors—5-HT1, 5-HT2, and 5-HT3—were identified from our tran-
scriptome data (Figure S3C). To determine whether blocking the

Cell Host & Microbe 29, 1–13, October 13, 2021 3

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 2. Tetracycline treatment induces profound changes in tick transcriptome

(A) Volcano plot of differentially expressed genes in nymphs treated with tetracycline (TET) versus controls (CT). Red dots indicate significantly upregulated
genes, and green dots indicate significantly downregulated genes in tetracycline-treated (TET) nymphs.
(B) Scatterplot showing KEGG enriched pathways of downregulated genes in tetracycline-treated (TET) nymphs. The pathways associated with amino acid
metabolism are shown in red.
(C) Overview of the CHI shikimate pathway (orange) and tick tryptophan metabolic pathway (blue).
See also Table S1.

recognition of 5-HT receptors affects tick feeding, we next specif-
ically knocked down the most highly expressed 5-HT2 (Figures
4D, S3D, and S3E). Knocking down 5-HT2 significantly decreased
the amount of blood that ticks ingested compared with the con-
trols (Figure 4E). Similarly, treating nymphal H. longicornis with
the 5-HT receptor antagonist ketanserin tartrate (KT) inhibited
blood feeding (Figure 4F) (Gatellier et al., 2004; Tierney, 2001).
Taken together, these data confirm that 5-HT plays an important
role in influencing the blood intake of nymphal H. longicornis.
CHI-derived chorismate directly regulates 5-HT
biosynthesis
Chorismate is the precursor of tryptophan (Stone et al., 2013).
However, genes mediating the conversion from chorismate to

4 Cell Host & Microbe 29, 1–13, October 13, 2021

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 3. CHI alters tick feeding activity by influencing Trp metabolism

(A) Engorgement weights of nymphs treated with TET and TET supplemented with chorismate (CA). The doses of CA used were 2 ng/nymph (left two panels) and
40 ng/nymph (right two panels). Dots represent individual ticks; n = 28–37; horizontal lines represent the median.
(B) Engorgement weights of nymphs treated with TET and TET supplemented with a mixture of tryptophan and phenylalanine (AA). Controls (CT) were injected
with 0.9% NaCl. The doses of each amino acid used were 8 ng/tick, 40 ng/tick, and 200 ng/tick. Dots represent individual ticks; n = 30–36; horizontal lines
represent the median.
(C) Engorgement weights of nymphs treated with TET and TET supplemented with tryptophan (TET+Trp) and phenylalanine (TET+Phe). The doses of Trp and Phe
were 200 ng/tick. Dots represent individual ticks; n = 22–23; horizontal lines represent the median.
(D) Engorgement weights of nymphs treated with TET and TET supplemented with 5-HT (TET+5-HT). The dose of 5-HT used was 200 ng/tick. Dots represent
individual ticks; n = 31–36; horizontal lines represent the median.
(E) The levels of 5-HT in tetracycline (TET)- and 0.9% NaCl (CT)-treated nymphs were determined by a serotonin ELISA kit. Dots represent 50 ticks each; n = 7–8;
horizontal lines represent the mean. Significance was determined by Mann-Whitney tests in (A) and (D), by ANOVA with Dunn’s tests in (B) and (C), and by
Student’s t test in (E). The results from one of the two independent experiments are shown in (A)–(E). **p < 0.01, ****p < 0.0001. See also Figure S2.

tryptophan are absent in the Coxiella sp. genome and the
H. longicornis genome (Gulia-Nuss et al., 2016; Jia et al., 2020;
Smith et al., 2015). Given that chorismate, Trp and 5-HT all
rescued the feeding defect of tetracycline-treated nymphs and
that 5-HT is essential in regulating blood intake, we hypothesized
that chorismate might promote 5-HT production by modulating
the 5-HT biosynthetic pathway instead of increasing the synthe-
sis of tryptophan (Figure 5A). First, we analyzed whether choris-
mate influences 5-HT production by regulating the activity of
TPH, the rate-limiting enzyme of 5-HT biosynthesis. Trp and cho-
rismate were administered to ticks treated with the TPH antago-
nist AMTP, and 5-HT levels were examined 2 days after treat-
ment. As expected, inhibition of TPH blocked the capability of
nymphs to synthesize 5-HT even when Trp was supplemented
exogenously. However, the addition of chorismate rescued
5-HT production in these ticks (Figure 5B). Accordingly, the
amount of blood that these ticks ingested was restored to
control levels (Figure 5C). This result indicates that the choris-
mate-mediated elevation of 5-HT does not occur through regu-
lation of TPH.

Cell Host & Microbe 29, 1–13, October 13, 2021 5

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 4. Inhibition of 5-HT biosynthesis and signaling suppresses tick feeding

(A) Silencing efficiency of TPH in nymphal H. longicornis. The expression level of TPH was normalized to actin. The relative expression level of TPH in dsTPH was
normalized to the gene expression in dsGFP controls. Dots represent 3 ticks each; n = 7; horizontal lines represent the mean.
(B) Engorgement weights of nymphs treated with dsGFP and dsTPH. Dots represent individual ticks; n = 20–29; horizontal lines represent the median.
(C) Engorgement weights of nymphs treated with AMTP at amounts of 2 nmol, 20 nmol, and 200 nmol. Controls (CT) were injected with 0.9% NaCl. Dots represent
individual ticks; n = 29–30; horizontal lines represent the median.
(D) Silencing efficiency of 5HT2 in nymphs. The expression level of 5HT2 was normalized to actin. The relative expression level of 5HT2 in ds5HT2 nymphs was
normalized to the gene expression in dsGFP controls. Dots represent 3 ticks each; n = 7–9; horizontal lines represent the mean.
(E) Engorgement weights of nymphs treated with dsGFP and ds5HT2. Dots represent individual ticks; n = 26–29; horizontal lines represent the median.
(F) Engorgement weights of nymphs treated with ketanserin tartrate (KT). Controls (CT) were injected with 0.9% NaCl. The dose of KT used was 200 ng/nymph.
Dots represent individual ticks; n = 28–34; horizontal lines represent the median.
Significance was determined by Student’s t test in (A) and (D), by the Mann-Whitney test in (B), (E), and (F), and by ANOVA with Dunn’s tests in (C). The results from
one of the two independent experiments are shown in (A)–(F). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S3.

In addition to TPH, AAAD is responsible for the conversion
from 5-HTP to 5-HT (Figure 5A) (El-Merahbi et al., 2015). CHI
reduction significantly downregulated the expression of the
two AAAD genes, AAAD1 and AAAD2, but did not influence
the expression of TPH based on our transcriptome and qPCR
analyses (Figures 5D–5F; Table S1). Re-administration of choris-
mate successfully restored the expression of the two AAADs to
control levels (Figures 5E and 5F). However, the addition of tryp-
tophan failed to affect the expression of AAAD genes (Figures
S4A–S4C). Next, we analyzed whether chorismate influences
5-HT levels by regulating AAAD activity. When AAAD was in-
hibited by 3-hydroxybenzyl hydrozine (NSD-1015) (Miñano
et al., 1990), chorismate supplementation lost its capacity to
stimulate 5-HT biosynthesis (Figures 5G and S4D) and failed to
promote feeding (Figure 5H). As AAAD is also responsible for
the biosynthesis of phenylethylamine and dopamine, we next ac-
cessed the impact of these two biogenic amines on tick blood
intake (Zhu and Juorio, 1995). Administration of phenylethyl-
amine and dopamine to tetracycline-treated ticks failed to
restore their feeding activities (Figures S4E and S4F). Thus, these
results indicate that chorismate promotes 5-HT biosynthesis by
directly upregulating AAAD expression.
5-HT in the midgut and synganglion regulates blood
intake
In mammals, there are two major pools of 5-HT: central 5-HT,
synthesized in the brainstem, and peripheral 5-HT, produced in
the gut (Agus et al., 2018; Yabut et al., 2019). To determine the

6 Cell Host & Microbe 29, 1–13, October 13, 2021

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 5. CHI-derived chorismate induces 5-HT biosynthesis by modulating AAAD expression

(A) Overview of tick 5-HT biosynthetic pathway. AMTP, a-methyl-DL-tryptophan; NSD, 3-hydroxybenzyl hydrazine.
(B) Influence of tryptophan (Trp) and chorismate (CA) administration on 5-HT levels in unfed ticks, in which TPH was inhibited by AMTP. AMTP- and 0.9% NaCl
(CT)-treated nymphs were used as controls. Dots represent 50 ticks each; n = 5; horizontal lines represent the mean.
(C) Engorgement weights of nymphs treated with AMTP supplemented with tryptophan (AMTP+Trp) and chorismate (AMTP+CA). AMTP- and 0.9% NaCl (CT)-
treated ticks were used as controls. Dots represent individual ticks; n = 30–35; horizontal lines represent the median.
(D–F) Influence of chorismate on the expression levels of genes involved in 5-HT biosynthesis in unfed ticks. The expression levels of TPH (D), AAAD1 (E), and
AAAD2 (F) were normalized to actin. The relative expression level of each gene in ticks treated with tetracycline (TET) and tetracycline supplemented with
chorismate (TET+CA) was normalized to the gene expression in controls (CT). Dots represents 3 ticks each; n = 7–10; horizontal lines represent the mean.
(G) Influence of chorismate (CA) administration on 5-HT levels in unfed ticks, in which AAAD was inhibited by 3-hydroxybenzyl hydrazine (NSD+CA). NSD- and
0.9% NaCl (CT)-treated nymphs were used as controls. The dose of NSD used was 200 nmol/nymph. Dots represent 50 ticks each; n = 5; horizontal lines
represent the mean.
(H) Engorgement weights of ticks treated with 0.9% NaCl (CT), 3-hydroxybenzyl hydrazine (NSD), and NSD supplemented with chorismate (NSD+CA). Dots
represent individual ticks; n = 25–37; horizontal lines represent the median.
Significance was determined by ANOVA with Tukey tests in (B), (D), (E), (F), and (G) and by ANOVA with Dunn’s tests in (C) and (H). The results from one of the two
independent experiments are shown. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S4.

tissue tropism of 5-HT in H. longicornis, we turned to adults for
5-HT immunohistochemistry analyses due to the difficulties in
dissecting unfed nymphs. Injection of tetracycline similarly
reduced the abundance of CHI, especially in Malpighian tubules
(Figures 6A and S5A–S5C), and suppressed blood intake in
adults (Figure 6B). We next analyzed the influence of CHI on
Trp metabolism by LC-MS. In normal adults, chorismate levels
were comparable among unfed, partially engorged, and FE
adults with a moderate but not significant decrease in FE ticks
(Figure S5D). Blood ingestion led to a significant increase of
Trp in partially engorged ticks. The levels of 5-HT were
elevated significantly during the entire blood-feeding process

Cell Host & Microbe 29, 1–13, October 13, 2021 7

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Figure 6. Chorismate influences 5-HT levels in adult synganglion and midgut

(A) Fold change of CHI at 2 days post tetracycline (TET) injection. The dose of TET used was 3 mg/adult. The copy number of CHI genus-specific 16S rRNA was
normalized to that of tick actin. Fold change of CHI abundance in TET group was normalized to that in controls. Dots represent individual ticks; n = 9–10; horizontal
lines represent the mean.
(legend continued on next page)
8 Cell Host & Microbe 29, 1–13, October 13, 2021
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

(Figure S5D). Tetracycline treatment reduced the levels of cho-
rismate and 5-HT significantly, while increasing tryptophan
moderately, confirming that CHl does not stimulate 5-HT synthe-
sis by promoting tryptophan production (Figures 6C–6E).
To examine which pool of 5-HT was affected by CHl, we
compared 5-HT staining in multiple tissues, including the central
nervous system (synganglion), midgut, salivary glands, ovaries,
and Malpighian tubules, between tetracycline-treated adults
and controls (Figure 6G). Unexpectedly, the fluorescent signals
of 5-HT in the ovaries and Malpighian tubules, where CHI re-
sides, were comparable between tetracycline-treated and con-
trol adults (Figure 6G) (Wang et al., 2018). However, 5-HT was
reduced in the midgut and synganglion of TET adults compared
with the controls (Figure 6G). In combination with our finding that
tetracycline treatment diminished CHI preferentially in Malpi-
ghian tubules, these results indicate that a reduction in CHl in
Malpighian tubules decreases 5-HT in the midgut and central
nervous system.
Given that CHI is barely detected in the midgut and syngan-
glion in H. longicornis (Wang et al., 2018), we hypothesized
that CHI regulates 5-HT synthesis in these two tissues by
releasing chorismate into the hemolymph. Next, we adminis-
tered chorismate intrathoracically into tetracycline-treated
adults and examined the fluorescent signals of 5-HT in the five
tissues. As expected, supplementation with chorismate restored
5-HT levels in both the synganglion and midgut (Figure 6G).
Accordingly, these ticks engorged increasing amounts of blood
compared with tetracycline-treated adults (Figure 6F). Consis-
tently, AMTP treatment decreased 5-HT levels in both midgut
and synganglion, while administration of CA restored 5-HT levels
in both tissues (Figure S5E). These results suggest that CHI
remotely controls 5-HT biosynthesis in both the synganglion
and midgut by secreting chorismate in the hemolymph. In turn,
5-HT in the midgut and synganglion regulates the blood
ingestion of H. longicornis.
As the shikimate pathway is present only in bacteria and not in
ticks (Herrmann and Weaver, 1999), we hypothesized that specif-
ically inhibiting the biosynthesis of chorismate might suppress tick
blood intake. Glyphosate (phosphonomethyl glycine) is one of the
most widely used herbicides that inhibits 5-enolpyruvylshikimate-
3-phosphate synthase (EPSPS) required for the biosynthesis of
chorismate (Duke, 2018). We subsequently treated nymphs with
glyphosate by microinjection and surface spaying and examined
the feeding activities of these ticks. As expected, both ap-
proaches effectively inhibited tick blood intake (Figures 6H and
6I). These results demonstrated a functional role for CHI-derived
chorismate in promoting tick central and peripheral 5-HT biosyn-
thesis that influences tick blood feeding activity.
DISCUSSION
Obligate bloodsucking arthropods rely on endosymbionts to pro-
vide nutrients that are lacking in blood (Rio et al., 2016). Coxiella,
the most common maternally transmitted endosymbiont, is
known for its capability to provide B vitamins and cofactors to
ticks and is essential for tick development, fecundity, and meta-
bolism (Duron et al., 2017; Guizzo et al., 2017; Smith et al.,
2015; Zhang et al., 2017; Zhong et al., 2007). In this study, we
demonstrated a previously unknown function of Coxiella in
H. longicornis (CHl) in regulating tick blood feeding by influencing
5-HT biosynthesis. Coxiella-derived chorismate, the precursor of
tryptophan, stimulates the expression of AAAD, thereby promot-
ing the biosynthesis of 5-HT. The homeostasis of 5-HT in the
synganglion and midgut determines tick feeding activity.
Haemaphysalis longicornis, the vector of a wide spectrum of
human and zoonotic pathogens, originated in eastern Asia and
has spread to Oceania and North America (Chen et al., 2010;
Heath, 2016; Raghavan et al., 2019). A single parthenogenic
female can produce hundreds of offspring once introduced
into suitable habitats (Malik et al., 2019). Animal blood, as the
exclusive nutrient resource for H. longicornis, plays a pivotal
role in affecting its development and reproduction (Diehl et al.,
1982). The endosymbiont CHI mainly resides in the Malpighian
tubules and ovaries intracellularly (Bonnet et al., 2017; Wang
et al., 2018). Its abundance is relatively stable throughout
the whole feeding process as shown in this study and in
Haemaphysalis tibetensis (Wang et al., 2017). During a long
coevolution with ticks, the genome of this microbe has been
highly reduced but retains the genes coding for major B vitamins
and their cofactors (Smith et al., 2015). The mutualistic symbiosis
of this microbe with ticks ensures the survival of both organisms.
The nutritional provision function of symbionts is well known in
a variety of arthropods; however, little is known regarding the
manipulation of arthropod appetite by microbiota. One report
shows that the commensal bacteria Acetobacter pomorum
and lactobacilli in Drosophila modulate nutrient-specific appe-
tites through an unknown mechanism (Leitão-Gonçalves et al.,
2017). Another report shows that the dysbiosed Ixodes scaplaris
larvae ingest increased amounts of blood, suggesting a potential
role for altered gut microbiota in manipulating tick feeding

(B) Engorgement weights of adults treated with 0.9% NaCl (CT) and tetracycline (TET). Dots represent individual ticks (n = 20).
(C–E) Levels of chorismate (C), tryptophan (D), and 5-HT (E) in adults treated with 0.9% NaCl (CT) and tetracycline (TET). Dots represent 18 ticks each, n = 6;
horizontal lines represent the mean.
(F) Engorgement weights of adults treated with 0.9% NaCl (CT) or tetracycline supplemented with (TET+CA) or without chorismate (TET). The dose of CA used
was 300 ng/adult. Dots represent individual ticks; n = 23–25; horizontal lines represent the median.
(G) Tissue localization of 5-HT (green) in adults treated with 0.9% NaCl (CT), tetracycline (TET), and tetracycline supplemented with chorismate (TET+CA). SYN,
synganglion; MG, midgut; SG, salivary glands; OV, ovaries; MT, Malpighian tubules. Nuclei were stained with DAPI (blue). Arrows denote 5-HT. Images are
representative of 10 adults. Scale bars, 25 mm.
(H) Engorgement weights of nymphs injected with different amounts of glyphosate (PMG). The doses used were 2, 20, and 200 ng/nymph. Dots represent in-
dividual ticks; n = 28–36; horizontal lines represent the median.
(I) Engorgement weights of nymphs exposed to 10 mg/mL glyphosate (PMG) by surface spray. Dots represent individual ticks; n = 42–44; horizontal lines
represent the median.
Significance was determined by Student’s t test in (A), (C), (D) and (E); by Mann-Whitney test in (B) and (I); and by ANOVA with Dunn’s tests in (F) and (H). The
results from one of two independent experiments are shown in (A), (B), and (F–I). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S5.

Cell Host & Microbe 29, 1–13, October 13, 2021 9

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011
ll
activity (Narasimhan et al., 2014). We show that CHI controls tick
blood intake by regulating 5-HT production. The CHI genome en-
codes the complete shikimate pathway for chorismate biosyn-
thesis, which bacteria rely on for de novo synthesis of aromatic
compounds (Jia et al., 2020; Mir et al., 2015; Parthasarathy
et al., 2018). The tick genome encodes a pathway for tryptophan
metabolism (Gulia-Nuss et al., 2016; Jia et al., 2020). However,
genes encoding the transformation from chorismate to trypto-
phan are absent in both CHI and H. longicornis genomes (Jia
et al., 2020; Smith et al., 2015). Although we demonstrated that
CHI regulates 5-HT levels, it is unlikely that CHI stimulates
5-HT biosynthesis by directly promoting tryptophan production.
We next demonstrated that CHI-derived chorismate increases
5-HT production by stimulating AAAD expression instead of
TPH. In addition, AAAD activity is also influenced by 5-HTP
because exogenous administration of Trp to ticks with reduced
chorismate (TET treatment) restores blood feeding. Hence, 5-
HT biosynthesis is coordinately regulated by two branches, the
tick host through the serotonin pathway and the CHI by influ-
encing AAAD activity. However, we also show that tetracy-
cline-treated adults with accumulated Trp still fail to ingest
blood. It is possible that the accumulation of endogenous Trp
is moderate and is still below the threshold for stimulating
AAAD function. Consistent with our observations, mouse 5-HT
is also regulated by gut microbiota (Reigstad et al., 2015; Yano
et al., 2015). In mice, gut microbiota-derived compounds, such
as short-chain fatty acids and secondary bile acids, promote
mouse 5-HT biosynthesis by stimulating TPH expression (Reig-
stad et al., 2015; Yano et al., 2015). Therefore, the modulation
of 5-HT biosynthesis by the microbiota is conserved in mammals
and ticks, but the underlying mechanisms in these species are
different.
Serotonin is a pleiotropic bioamine regulating diverse physio-
logical processes in mammals, including behavior, emotion,
appetite, immunity, and metabolism (El-Merahbi et al., 2015;
Lesch et al., 2012; Marston et al., 2011; Martin et al., 2017;
Oury and Karsenty, 2011). There are two major pools of 5-HT:
central 5-HT synthesized in the brainstem and peripheral 5-HT
produced in the gut. Different pools of 5-HT play distinct roles
in the regulation of mammalian physiology (Terry and Margolis,
2017). We show that 5-HT in synganglion and midgut prior to
feeding plays a vital role in determining tick feeding activity,
especially feeding initiation. In keeping with our findings, 5-HT
has been reported to promote feeding in multiple hematopha-
gous invertebrates (Tecott, 2007). For example, in kissing
bugs, Rhodnium prolixus, 5-HT functions as a neurotransmitter
and a neurohormone orchestrating diverse feeding-related
events, including saliva secretion, cuticle softening, and diuresis,
to ensure successful blood gorging (Tecott, 2007). In leeches, 5-
HT treatment induces host approaching and biting (Lent, 1985;
Lent and Dickinson, 1984). In Aedes aegypti and Aedes triseria-
tus, depleting 5-HT extends the probing period and reduces
blood-feeding success (Novak et al., 1995; Novak and Rowley,
1994). However, in some other insects, 5-HT even suppresses
food intake (Falibene et al., 2012; French et al., 2014). Although
5-HT is essential in all species, it might evolve to have different
effects on host physiology. How the central and peripheral
signaling pathways regulate tick blood intake remains elusive,
and additional studies are needed to address this question.
10 Cell Host & Microbe 29, 1–13, October 13, 2021
Article
Animal blood also contains plenty of 5-HT, and the role of in-
gested 5-HT on tick physiology remains unclear. It would be
interesting to investigate whether and how ingested 5-HT influ-
ences tick blood intake and digestion, nutrient metabolism,
reproduction, and nervous system in the future. In addition to
synganglion and midgut, 5-HT is present in other tissues
including salivary glands, Malpighian tubules, and ovaries. We
show that tetracycline treatment preferentially reduces the abun-
dance of CHI in Malpighian tubules, but does not influence 5-HT
level in the same tissue. It is possible that 5-HT in this tissue is
synthesized mainly through a tick biosynthetic pathway. In addi-
tion, developing germ-free ticks would be critical to understand
the role of CHI on local 5-HT synthesis. The biosynthesis and
function of 5-HT in these tissues remain to be investigated. In
this study, we show that nymphs treated with the widely utilized
herbicide glyphosate exhibit significantly reduced blood intake
(Duke, 2018). This result indicates that targeting the symbiont-
specific shikimate pathway might be a promising means of
controlling ticks.
In summary, our findings provide mechanistic insights into the
regulation of symbiont Coxiella on tick feeding activity and
describe a key contribution of symbionts to the tick metabolism.
Concerning the increased incidence of tickborne diseases and
the resistance and safety issues of current acaricides (Adenubi
et al., 2018), manipulating symbiont metabolism might be an
attractive option for controlling ticks and other disease-transmit-
ting vectors.
Limitations of the study
Our work highlights the contribution of CHI to regulate tick
feeding activity. As genetically manipulated ticks have not
been generated successfully so far (Nuss et al., 2021), our study
primary relies on the approaches including drug treatments and
dsRNA-based RNA interference to investigate the influence of
5-HT on tick feeding activity. Developing mutations or tissue-
specific mutations of targeted genes would be important for us
to understand the roles of 5-HT on ticks. In addition, our exper-
imental approaches mainly rely on antibiotic treatment to reduce
microbiota. Generating germ-free ticks will be critical to investi-
gate the role of microbiota on tick feeding. Due to the unique tick
feeding behavior and limitation of artificial feeding system, devel-
oping germ-free ticks remains to be a big challenge (Narasimhan
et al., 2021). This model needs to be further explored in the
future.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d RESOURCE AVAILABILITY
B Lead contact
B Materials availability
B Data and code availability
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Tick maintenance
d METHOD DETAILS
B Antibiotic treatment
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article
B Quantification of microbiota Ben-Yosef, M., Rot, A., Mahagna, M., Kapri, E., Behar, A., and Gottlieb, Y.
B Phylogenetic analysis of 5-HT receptors (2020). Coxiella-like endosymbiont of Rhipicephalus sanguineus is required
B Transcriptome analysis for physiological processes During ontogeny. Front. Microbiol. 11, 493.

B Nutrient administration
B Antagonist and inhibitor treatment
B Gene knockdown
B RT-qPCR
B 5-HT quantification by ELISA
B LC-MS analysis
B Immunohistochemistry
B Statistical analysis
SUPPLEMENTAL INFORMATION
Supplemental information can be found online at https://doi.org/10.1016/j.
chom.2021.08.011.
ACKNOWLEDGMENTS
We thank Dr. Jingying Gou from Fudan University for experimental advice. This
work was supported by National Natural Science Foundation of China
(U1902211 and 31822051), the Research Fund of the State Key Laboratory
of Genetic Engineering, and 111 Project (B13016), Fudan University, to J.W.
AUTHOR CONTRIBUTIONS
Conceptualization, Z.Z. and J.W.; methodology, Z.Z., T.Z., Y.P., X.Z., Z.W.,
H.T., and J.W.; investigation, Z.Z., Y.P., X.Z., T.Z., Z.W., H.T., and J.W.; formal
analysis, Z.Z. and J.W.; writing – original draft, Z.Z. and J.W.; writing – review &
editing, Z.Z., H.T., and J.W.; visualization, Z.Z. and J.W.; funding acquisition,
J.W.; resources, J.W.; supervision, J.W.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: February 9, 2021
Revised: July 22, 2021
Accepted: August 20, 2021
Published: September 14, 2021
REFERENCES
Adenubi, O.T., McGaw, L.J., Eloff, J.N., and Naidoo, V. (2018). In vitro bioas-
says used in evaluating plant extracts for tick repellent and acaricidal proper-
ties: a critical review. Vet. Parasitol. 254, 160–171.
Agus, A., Planchais, J., and Sokol, H. (2018). Gut microbiota regulation of tryp-
tophan metabolism in health and disease. Cell Host Microbe 23, 716–724.
Alim, M.A., Tsuji, N., Miyoshi, T., Islam, M.K., Hatta, T., and Fujisaki, K. (2009).
Legumains from the hard tick Haemaphysalis longicornis play modulatory roles
in blood feeding and gut cellular remodelling and impact on embryogenesis.
Int. J. Parasitol. 39, 97–107.
Anstey, M.L., Rogers, S.M., Ott, S.R., Burrows, M., and Simpson, S.J. (2009).
Serotonin mediates behavioral gregarization underlying swarm formation in
desert locusts. Science 323, 627–630.
Armougom, F., Bittar, F., Stremler, N., Rolain, J.M., Robert, C., Dubus, J.C.,
Sarles, J., Raoult, D., and La Scola, B. (2009). Microbial diversity in the sputum
of a cystic fibrosis patient studied with 16S rDNA pyrosequencing. Eur. J. Clin.
Microbiol. Infect. Dis. 28, 1151–1154.
Attardo, G.M., Lohs, C., Heddi, A., Alam, U.H., Yildirim, S., and Aksoy, S.
(2008). Analysis of milk gland structure and function in Glossina morsitans:
milk protein production, symbiont populations and fecundity. J. Insect
Physiol. 54, 1236–1242.
Binetruy, F., Buysse, M., Lejarre, Q., Barosi, R., Villa, M., Rahola, N., Paupy, C.,
Ayala, D., and Duron, O. (2020). Microbial community structure reveals insta-
bility of nutritional symbiosis during the evolutionary radiation of Amblyomma
ticks. Mol. Ecol. 29, 1016–1029.
Bonnet, S.I., Binetruy, F., Hernández-Jarguı́n, A.M., and Duron, O. (2017). The
tick microbiome: why non-pathogenic microorganisms matter in tick biology
and pathogen transmission. Front. Cell. Infect. Microbiol. 7, 236.
Chen, Z., Yang, X., Bu, F., Yang, X., Yang, X., and Liu, J. (2010). Ticks (acari:
ixodoidea: Argasidae, Ixodidae) of China. Exp. Appl. Acarol. 51, 393–404.
Coons, L.B., and Rothschild, M. (2008). Ticks (Acari: Ixodida). In Encyclopedia
of Entomology (Springer), pp. 3775–3801.
de la Fuente, J., Estrada-Pena, A., Venzal, J.M., Kocan, K.M., and Sonenshine,
D.E. (2008). Overview: ticks as vectors of pathogens that cause disease in hu-
mans and animals. Front. Biosci. 13, 6938–6946.
Diehl, P.A., Aeschlimann, A., and Obenchain, F.D. (1982). Chapter 9.Tick
reproduction: oogenesis and oviposition. In Physiology of Ticks (Elsevier),
pp. 277–350.
Duke, S.O. (2018). The history and current status of glyphosate. Pest Manag.
Sci. 74, 1027–1034.
€l, V., Cremaschi, J., McCoy, K.D., Arnathau, C.,
Duron, O., Binetruy, F., Noe
Plantard, O., Goolsby, J., Pérez de León, A.A., Heylen, D.J.A., et al. (2017).
Evolutionary changes in symbiont community structure in ticks. Mol. Ecol.
26, 2905–2921.
€l, V., Buysse, M., Binetruy, F., Lancelot, R., Loire, E.,
Duron, O., Morel, O., Noe
Ménard, C., Bouchez, O., Vavre, F., and Vial, L. (2018). Tick-bacteria mutu-
alism depends on B vitamin synthesis pathways. Curr. Biol. 28, 1896–1902.e5.
El-Merahbi, R., Löffler, M., Mayer, A., and Sumara, G. (2015). The roles of pe-
ripheral serotonin in metabolic homeostasis. FEBS Lett 589, 1728–1734.
Estrada-Peña, A. (2015). Ticks as vectors: taxonomy, biology and ecology.
Revue scientifique et technique. Rev. Sci. Tech. 34, 53–65.
Falibene, A., Rössler, W., and Josens, R. (2012). Serotonin depresses feeding
behaviour in ants. J. Insect Physiol. 58, 7–17.
Feng, L.L., and Cheng, T.Y. (2020). A survey of proteins in midgut contents of
the tick, Haemaphysalis flava, by proteome and transcriptome analysis. Exp.
Appl. Acarol. 80, 269–287.
French, A.S., Simcock, K.L., Rolke, D., Gartside, S.E., Blenau, W., and Wright,
G.A. (2014). The role of serotonin in feeding and gut contractions in the honey-
bee. J. Insect Physiol. 61, 8–15.
Galay, R.L., Umemiya-Shirafuji, R., Mochizuki, M., Fujisaki, K., and Tanaka, T.
(2015). Iron metabolism in hard ticks (Acari: Ixodidae): the antidote to their
toxic diet. Parasitol. Int. 64, 182–189.
Gatellier, L., Nagao, T., and Kanzaki, R. (2004). Serotonin modifies the sensi-
tivity of the male silkmoth to pheromone. J. Exp. Biol. 207, 2487–2496.
Gerhart, J.G., Moses, A.S., and Raghavan, R. (2016). A Francisella-like endo-
symbiont in the Gulf Coast tick evolved from a mammalian pathogen. Sci. Rep.
6, 33670.
Gershon, M.D., and Tack, J. (2007). The serotonin signaling system: from basic
understanding to drug development for functional GI disorders.
Gastroenterology 132, 397–414.
Gottlieb, Y., Lalzar, I., and Klasson, L. (2015). Distinctive genome reduction
rates revealed by genomic analyses of two coxiella-like endosymbionts in
ticks. Genome Biol. Evol. 7, 1779–1796.
Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I.,
Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., et al. (2011). Full-length
transcriptome assembly from RNA-Seq data without a reference genome.
Nat. Biotechnol. 29, 644–652.
Guizzo, M.G., Parizi, L.F., Nunes, R.D., Schama, R., Albano, R.M., Tirloni, L.,
Oldiges, D.P., Vieira, R.P., Oliveira, W.H.C., Leite, M.S., et al. (2017). A
Coxiella mutualist symbiont is essential to the development of Rhipicephalus
microplus. Sci. Rep. 7, 17554.

Cell Host & Microbe 29, 1–13, October 13, 2021 11

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011
ll
Gulia-Nuss, M., Nuss, A.B., Meyer, J.M., Sonenshine, D.E., Roe, R.M.,
Waterhouse, R.M., Sattelle, D.B., de la Fuente, J., Ribeiro, J.M., Megy, K.,
et al. (2016). Genomic insights into the Ixodes scapularis tick vector of Lyme
disease. Nat. Commun. 7, 10507.
Heath, A. (2016). Biology, ecology and distribution of the tick, Haemaphysalis
longicornis Neumann (Acari: Ixodidae) in New Zealand. N. Z. Vet. J. 64, 10–20.
Heredia, D.J., Gershon, M.D., Koh, S.D., Corrigan, R.D., Okamoto, T., and
Smith, T.K. (2013). Important role of mucosal serotonin in colonic propulsion
and peristaltic reflexes: in vitro analyses in mice lacking tryptophan hydroxy-
lase 1. J. Physiol. 591, 5939–5957.
Herrmann, K.M., and Weaver, L.M. (1999). The shikimate pathway. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 50, 473–503.
Holmes, D.S., and Bonner, J. (1973). Preparation, molecular weight, base
composition, and secondary structure of giant nuclear ribonucleic acid.
Biochemistry 12, 2330–2338.
Hoyer, D., Hannon, J.P., and Martin, G.R. (2002). Molecular, pharmacological
and functional diversity of 5-HT receptors. Pharmacol. Biochem. Behav. 71,
533–554.
Hunter, D.J., Torkelson, J.L., Bodnar, J., Mortazavi, B., Laurent, T., Deason, J.,
Thephavongsa, K., and Zhong, J. (2015). The Rickettsia endosymbiont of
Ixodes pacificus contains all the genes of de novo folate biosynthesis. PLoS
One 10, e0144552.
Jia, N., Wang, J., Shi, W., Du, L., Sun, Y., Zhan, W., Jiang, J.F., Wang, Q.,
Zhang, B., Ji, P., et al. (2020). Large-scale comparative analyses of tick ge-
nomes elucidate their genetic diversity and vector capacities. Cell 182,
1328–1340.e13.
Jones, C.R., Brunner, J.L., Scoles, G.A., and Owen, J.P. (2015). Factors
affecting larval tick feeding success: host, density and time. Parasit. Vectors
8, 340.
Kanehisa, M., Araki, M., Goto, S., Hattori, M., Hirakawa, M., Itoh, M.,
Katayama, T., Kawashima, S., Okuda, S., Tokimatsu, T., and Yamanishi, Y.
(2008). KEGG for linking genomes to life and the environment. Nucleic Acids
Res 36, D480–D484.
Kocan, K.M., Blouin, E., and de la Fuente, J. (2011). RNA interference in ticks.
J. Vis. Exp. 47, 2474.
Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X:
Molecular evolutionary genetics analysis across computing platforms. Mol.
Biol. Evol. 35, 1547–1549.
Lalzar, I., Harrus, S., Mumcuoglu, K.Y., and Gottlieb, Y. (2012). Composition
and seasonal variation of Rhipicephalus turanicus and Rhipicephalus sangui-
neus bacterial communities. Appl. Environ. Microbiol. 78, 4110–4116.
Leitão-Gonçalves, R., Carvalho-Santos, Z., Francisco, A.P., Fioreze, G.T.,
Anjos, M., Baltazar, C., Elias, A.P., Itskov, P.M., Piper, M.D.W., and Ribeiro,
C. (2017). Commensal bacteria and essential amino acids control food choice
behavior and reproduction. PLoS Biol 15, e2000862.
Lent, C.M. (1985). Serotonergic modulation of the feeding behavior of the me-
dicinal leech. Brain Res. Bull. 14, 643–655.
Lent, C.M., and Dickinson, M.H. (1984). Retzius cells retain functional mem-
brane properties following ’ablation’ by the neurotoxin 5,7-DHT. Brain Res.
300, 167–171.
Lesch, K.P., Araragi, N., Waider, J., van den Hove, D., and Gutknecht, L.
(2012). Targeting brain serotonin synthesis: insights into neurodevelopmental
disorders with long-term outcomes related to negative emotionality, aggres-
sion and antisocial behaviour. Philos. Trans. R. Soc. Lond. B Biol. Sci. 367,
2426–2443.
Li, P., He, S., Tang, T., Qian, K., Ni, H., and Cao, Y. (2012). Evaluation of the
efficacy of glyphosate plus urea phosphate in the greenhouse and the field.
Pest Manag. Sci. 68, 170–177.
€ller, K., Wang, H., Yang, T., Wang, Q., Peng, X., Wang,
Liu, Y., Li, Y., Hua, X., Mu
M., Pang, Y., et al. (2018). Glyphosate application increased catabolic activity
of gram-negative bacteria but impaired soil fungal community. Environ. Sci.
Pollut. Res. Int. 25, 14762–14772.
12 Cell Host & Microbe 29, 1–13, October 13, 2021
Article
Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression
data using real-time quantitative PCR and the 2- DDCT method. Methods
25, 402–408.
Machado-Ferreira, E., Vizzoni, V.F., Balsemão-Pires, E., Moerbeck, L.,
Gazeta, G.S., Piesman, J., Voloch, C.M., and Soares, C.A. (2016). Coxiella
symbionts are widespread into hard ticks. Parasitol. Res. 115, 4691–4699.
Malik, M.I., Nawaz, M., Wang, Y., Zhang, H., Cao, J., Zhou, Y., Hassan, I.A.,
Islam, M.N., Anwar, M.N., and Zhou, J. (2019). Localized expression and inhi-
bition effect of miR-184 on blood digestion and oviposition in Haemaphysalis
longicornis (Acari: Ixodidae). Parasit. Vectors 12, 500.
Mao, X., Cai, T., Olyarchuk, J.G., and Wei, L. (2005). Automated genome anno-
tation and pathway identification using the KEGG Orthology (KO) as a
controlled vocabulary. Bioinformatics 21, 3787–3793.
Marston, O.J., Garfield, A.S., and Heisler, L.K. (2011). Role of central serotonin
and melanocortin systems in the control of energy balance. Eur. J. Pharmacol.
660, 70–79.
Martin, A.M., Young, R.L., Leong, L., Rogers, G.B., Spencer, N.J., Jessup,
C.F., and Keating, D.J. (2017). The diverse metabolic roles of peripheral sero-
tonin. Endocrinology 158, 1049–1063.
Miñano, F.J., McMillen, B.A., and Myers, R.D. (1990). Central action of an in-
hibitor of brain dopa-decarboxylase, NSD-1015, on cyanamide-induced
alcohol drinking in rats. Pharmacol. Biochem. Behav. 35, 465–468.
Mir, R., Jallu, S., and Singh, T.P. (2015). The shikimate pathway: review of
amino acid sequence, function and three-dimensional structures of the en-
zymes. Crit. Rev. Microbiol. 41, 172–189.
Narasimhan, S., Rajeevan, N., Liu, L., Zhao, Y.O., Heisig, J., Pan, J., Eppler-
Epstein, R., Deponte, K., Fish, D., and Fikrig, E. (2014). Gut microbiota of the
tick vector Ixodes scapularis modulate colonization of the Lyme disease spiro-
chete. Cell Host Microbe 15, 58–71.
Narasimhan, S., Swei, A., Abouneameh, S., Pal, U., Pedra, J.H.F., and Fikrig,
E. (2021). Grappling with the tick microbiome. Trends Parasitol. 37, 722–733.
Novak, M.G., Ribeiro, J.M., and Hildebrand, J.G. (1995). 5-Hydroxytryptamine
in the salivary glands of adult female Aedes aegypti and its role in regulation of
salivation. J. Exp. Biol. 198, 167–174.
Novak, M.G., and Rowley, W.A. (1994). Serotonin depletion affects blood-
feeding but not host-seeking ability in Aedes triseriatus (Diptera: Culicidae).
J. Med. Entomol. 31, 600–606.
Nuss, A., Sharma, A., and Gulia-Nuss, M. (2021). Genetic manipulation of ticks:
a paradigm shift in tick and tick-borne diseases research. Front. Cell. Infect.
Microbiol. 11, 678037.
Olivieri, E., Epis, S., Castelli, M., Varotto Boccazzi, I., Romeo, C., Desirò, A.,
Bazzocchi, C., Bandi, C., and Sassera, D. (2019). Tissue tropism and meta-
bolic pathways of Midichloria mitochondrii suggest tissue-specific functions
in the symbiosis with Ixodes ricinus. Ticks Tick. Borne Dis. 10, 1070–1077.
Oury, F., and Karsenty, G. (2011). Towards a serotonin-dependent leptin road-
map in the brain. Trends Endocrinol. Metab. 22, 382–387.
Parthasarathy, A., Cross, P.J., Dobson, R.C.J., Adams, L.E., Savka, M.A., and
Hudson, A.O. (2018). A three-ring circus: metabolism of the three proteogenic
aromatic amino acids and their role in the health of plants and animals. Front.
Mol. Biosci. 5, 29.
Pavela, R., Canale, A., Mehlhorn, H., and Benelli, G. (2016). Application of
ethnobotanical repellents and acaricides in prevention, control and manage-
ment of livestock ticks: a review. Res. Vet. Sci. 109, 1–9.
Pollock, N.B., Gawne, E., and Taylor, E.N. (2015). Effects of temperature on
feeding duration, success, and efficiency of larval western black-legged ticks
(Acari: Ixodidae) on western fence lizards. Exp. Appl. Acarol. 67, 299–307.
Raghavan, R.K., Barker, S.C., Cobos, M.E., Barker, D., Teo, E.J.M., Foley,
D.H., Nakao, R., Lawrence, K., Heath, A.C.G., and Peterson, A.T. (2019).
Potential spatial distribution of the newly introduced long-horned tick,
Haemaphysalis longicornis in North America. Sci. Rep. 9, 498.
Rainey, T., Occi, J.L., Robbins, R.G., and Egizi, A. (2018). Discovery of
Haemaphysalis longicornis (Ixodida: Ixodidae) parasitizing a sheep in New
Jersey, United States. J. Med. Entomol. 55, 757–759.
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011
Article
Reigstad, C.S., Salmonson, C.E., Rainey, J.F., 3rd, Szurszewski, J.H., Linden,
D.R., Sonnenburg, J.L., Farrugia, G., and Kashyap, P.C. (2015). Gut microbes
promote colonic serotonin production through an effect of short-chain fatty
acids on enterochromaffin cells. FASEB J. 29, 1395–1403.
Rio, R.V.M., Attardo, G.M., and Weiss, B.L. (2016). Grandeur alliances: symbi-
ont metabolic integration and obligate arthropod hematophagy. Trends
Parasitol 32, 739–749.
Schwarz, A., Valdés, J.J., and Kotsyfakis, M. (2012). The role of cystatins in tick
physiology and blood feeding. Ticks Tick Borne Dis. 3, 117–127.
Shih, D.F., Hsiao, C.D., Min, M.Y., Lai, W.S., Yang, C.W., Lee, W.T., and Lee,
S.J. (2013). Aromatic L-amino acid decarboxylase (AADC) is crucial for brain
development and motor functions. PLoS One 8, e71741.

namics of the Tibetan tick Haemaphysalis tibetensis (Acari: Ixodidae). Parasit.
Simo, L., Kazimirova, M., Richardson, J., and Bonnet, S.I. (2017). The essential
role of tick salivary glands and saliva in tick feeding and pathogen transmis-
sion. Front. Cell. Infect. Microbiol. 7, 281.
Smith, T.A., Driscoll, T., Gillespie, J.J., and Raghavan, R. (2015). A Coxiella-like
endosymbiont is a potential vitamin source for the Lone Star tick. Genome Biol.
Evol. 7, 831–838.
Song, X., Wang, M., Dong, L., Zhu, H., and Wang, J. (2018). PGRP-LD medi-
ates A. stephensi vector competency by regulating homeostasis of micro-
biota-induced peritrophic matrix synthesis. PLoS Pathog. 14, e1006899.
Stone, T.W., Stoy, N., and Darlington, L.G. (2013). An expanding range of tar-
gets for kynurenine metabolites of tryptophan. Trends Pharmacol. Sci. 34,
136–143.
Talactac, M.R., Yoshii, K., Hernandez, E.P., Kusakisako, K., Galay, R.L.,
Fujisaki, K., Mochizuki, M., and Tanaka, T. (2018). Vector competence of
Haemaphysalis longicornis ticks for a Japanese isolate of the Thogoto virus.
Sci. Rep. 8, 9300.
Tecott, L.H. (2007). Serotonin and the orchestration of energy balance. Cell
Metab. 6, 352–361.
Terry, N., and Margolis, K.G. (2017). Serotonergic mechanisms regulating the
GI tract: experimental evidence and therapeutic relevance. Handb. Exp.
Pharmacol. 239, 319–342.
Tierney, A.J. (2001). Structure and function of invertebrate 5-HT receptors: a
review. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 128, 791–804.
ll
Tsementzi, D., Castro Gordillo, J., Mahagna, M., Gottlieb, Y., and
Konstantinidis, K.T. (2018). Comparison of closely related, uncultivated
Coxiella tick endosymbiont population genomes reveals clues about the
mechanisms of symbiosis. Environ. Microbiol. 20, 1751–1764.
Wang, L., Feng, Z., Wang, X., Wang, X., and Zhang, X. (2010). DEGseq: an R
package for identifying differentially expressed genes from RNA-seq data.
Bioinformatics 26, 136–138.
Wang, M., Zhu, D., Dai, J., Zhong, Z., Zhang, Y., and Wang, J. (2018). Tissue
localization and variation of major symbionts in Haemaphysalis longicornis,
Rhipicephalus haemaphysaloides, and Dermacentor silvarum in China. Appl.
Environ. Microbiol. 84.
Wang, R., Li, N., Liu, J., Li, T., Liu, M., Yu, Z., and Liu, J. (2017). Symbiont dy-
Vectors 10, 259.
Wernegreen, J.J. (2012). Endosymbiosis. Curr. Biol. 22, R555–R561.
Wickham, H. (2016). Ggplot2: Elegant Graphics for Data Analysis (Springer-
Verlag).
Yabut, J.M., Crane, J.D., Green, A.E., Keating, D.J., Khan, W.I., and Steinberg,
G.R. (2019). Emerging roles for serotonin in regulating metabolism: new impli-
cations for an ancient molecule. Endocr. Rev. 40, 1092–1107.
Yano, J.M., Yu, K., Donaldson, G.P., Shastri, G.G., Ann, P., Ma, L., Nagler,
C.R., Ismagilov, R.F., Mazmanian, S.K., and Hsiao, E.Y. (2015). Indigenous
bacteria from the gut microbiota regulate host serotonin biosynthesis. Cell
161, 264–276.
Zhang, C.M., Li, N.X., Zhang, T.T., Qiu, Z.X., Li, Y., Li, L.W., and Liu, J.Z. (2017).
Endosymbiont CLS-HI plays a role in reproduction and development of
Haemaphysalis longicornis. Exp. Appl. Acarol. 73, 429–438.
Zhong, J., Jasinskas, A., and Barbour, A.G. (2007). Antibiotic treatment of the
tick vector Amblyomma americanum reduced reproductive fitness. PLoS One
2, e405.
Zhu, M.Y., and Juorio, A.V. (1995). Aromatic L-amino acid decarboxylase: bio-
logical characterization and functional role. Gen. Pharmacol. 26, 681–696.
Zhuang, L., Du, J., Cui, X.M., Li, H., Tang, F., Zhang, P.H., Hu, J.G., Tong, Y.G.,
Feng, Z.C., and Liu, W. (2018). Identification of tick-borne pathogen diversity
by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China.
Infect. Dis. Poverty 7, 45.
Cell Host & Microbe 29, 1–13, October 13, 2021 13
 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-serotonin antibodies Abcam Cat#ab66047; RRID:AB_1142794
DyLight488-conjugated secondary donkey-anti-goat IgG Abcam Cat#ab96931;
RRID:AB_10680169
Bacterial and virus strains
Coxiella sp. This paper N/A
Chemicals, peptides, and recombinant proteins
Penicillin-streptomycin Thermo Fisher Cat#15070063
Gentamicin Sigma Cat#G1914
Tetracycline hydrochloride Sangon Cat#A100422
Trizol Sigma Cat#93289
DNA Extraction Reagent Solarbio Cat#P1012
Chorismic acid barium salt Sigma Cat#C1259
Serotonin Aladdin Cat#S111161
Tryptophan Sinopharm Cat#62023034
Phenylalanine Sinopharm Cat#62034734
Kynurenine Sigma Cat#K8625
Phenethylamine Sigma Cat#P2126
Dopamine Sigma Cat#H8502
Ketanserin tartrate Sigma Cat#S006
a-Methyl-DL-tryptophan Sigma Cat#M8377
PCPA Sigma Cat#C6506
NSD-1015 Sigma Cat#54880
Glyphosate Sigma Cat#45521
Critical commercial assays
MEGAscript T7 High Yield Transcripti-on kit Thermo Fisher Cat#AMB13345
SYBR Green qPCR Master Mix Bimake Cat#B21702
5X All-In-One MasterMix Abm Cat#G492
Serotonin ELISA Kit Biovison Cat#E4294-100
Deposited data
RNA-seq data This paper SRA:PRJNA693137
Experimental models: Organisms/strains
Haemaphysalis longicornis This paper N/A
Mouse: BALB/c Jsj-lab N/A
Oligonucleotides
Primers for qPCR: See Table S2 Tsingke N/A
dsTPH-F, GCTCTGAACTTGACGCTGACCA Tsingke N/A
dsTPH-R, GATGCCAAACTCCACTGTGAACCA Tsingke N/A
ds5HT2-F, AAGGAGGAGGACTGGCTGGAA Tsingke N/A
ds5HT2-R, GGCTCGGCTATGTCAACTCTATGC Tsingke N/A
Software and algorithms
LightCycler 96 SW 1.1 Roche https://lifescience.roche.com/global_en/
campaigns/LC96/index.html
GraphPad Prism 8 GraphPad https://www.graphpad.com/scientific-software/prism/
MEGA X MEGA https://www.megasoftware.net/
R R https://www.r-project.org/

e1 Cell Host & Microbe 29, 1–13.e1–e4, October 13, 2021

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

RESOURCE AVAILABILITY

Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Jingwen
Wang (jingwenwang@fudan.edu.cn).

Materials availability
This study did not generate new unique reagents.

Data and code availability

The published article includes all datasets generated or analyzed during this study.
The raw RNA-Seq sequencing data were uploaded to the National Center for Biotechnology Information’s Sequence Read Archive
(SRA: PRJNA693137).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Tick maintenance
H. longicornis originally collected from Yunnan Province were maintained at the insectary of Fudan University, Shanghai. Ticks were
maintained in a 12/12-hr light/dark photoperiod at 22-25  C and 85% relative humidity. Each stage of H. longicornis was fed on Balb/c
mice until full engorged. Manipulation of animals were carried out in accordance with the guidelines for animal care and use of Fudan
University and were permitted by animal care and use committee, Fudan University (Fudan IACUC 201802158S).

METHOD DETAILS

Antibiotic treatment
Tetracycline stock solution (20 mg/ml) (tetracycline HCl, Sangon Biotech, China) was prepared in 0.9% NaCl. Nymphal H. longicornis
was microinjected intrathoracically with 0.1 mg, 0.2 mg, and 0.5 mg/nymph tetracycline or 10 nl of antibiotic (PSG) solution containing
1000 U/ml penicillin, 1 mg/ml streptomycin and 1 mg/ml gentamicin (Sigma-Aldrich, USA) using Nanoinject III (Drummond Scientific
Company, USA). For adults, 1 mg, 2 mg, 3 mg and 5 mg/adult tetracycline were used for microinjection. Age-matched 0.9% NaCl-in-
jected nymphs and adults were used as controls. Tetracycline 0.2 mg/nymph and 3 mg/adult were used in most of the study unless
otherwise indicated.

Quantification of microbiota
Nymphal H. longicornis was collected two and four days after antibiotic treatment. Adult ticks were collected two days after antibiotic
treatment. The whole adult and different tissues of adult including midgut, ovaries, and Malpighian tubules were dissected. Tissues
from five individual adults were pooled for one biological replicate. To analyze the temporal proliferation pattern of CHI during blood
feeding, nymphs were collected four days, two days, zero days prior to, and one day, two to three days (partially engorged) and three
to five days (fully engorged) post attachment. To analyze the correlation between CHI abundance and engorgement weights, indi-
vidual nymphs were collected after four days of feeding when most of the ticks were replete. Ticks were weighed individually. Total
DNA was extracted using the Homes-Bonner method (Holmes and Bonner, 1973). Total bacterial density was quantified by universal
bacterial 16S rRNA primers (Lalzar et al., 2012). CHI density was quantified using genus-specific 16S rRNA primers (Armougom et al.,
2009). Real-time PCR was performed by a Roche LightCycler 96 Real Time PCR Detection System using SYBR Green qPCR Master
Mix (Biomake, China). The H. longicornis actin gene was used as reference (Wang et al., 2018). Primers were listed in Table S2.

Phylogenetic analysis of 5-HT receptors

To analyze the phylogenetic relationship of the putative 5-HT receptors of H. longicornis with those of other arthropods, we aligned 16
5-HT receptor sequences from different arthropods using Muscle in MEGA X with default settings (Kumar et al., 2018). The resulting
alignments were employed for neighbor-joining phylogenetic reconstructions using MEGA X software. Next, the sequences were
concatenated to single multiple sequence alignment for phylogenetic analysis. The phylogenetic relationships were constructed us-
ing the Poisson model method for the protein sequences in MEGA X with 2,000 bootstrap replicates. The sequences of 5-HT recep-
tors used for phylogenetic analysis were 5-HT receptors of Drosophila melanogaster, Dm5HT1A (GeneBank: NP_001356890.1),
DM5HT1B (GeneBank: NP_001163201.2), DM5HT2A (GeneBank: NP_524223.2), DM5HT2B (GeneBank: NP_001287238.1),
DM5HT7 (GeneBank: NP_001263131.1), 5-HT receptor of Aedes aegypti, Aa5HT1A (GeneBank: AAEL008360), Aa5HT1B (Gene-
Bank: AAEL017272), Aa5HT2A (GeneBank: AAEL019804), Aa5HT2B (GeneBank: AAEL019805), Aa5HT7 (GeneBank:
AAEL027242), and 5-HT receptors of Ixodes scapularis Ix5HT2B (VectorBase: XP_002405023.2), IX5HT1-1 (VectorBase:
XP_029835105.1), and IX5HT1-2 (VectorBase: XP_029835164.1).

Cell Host & Microbe 29, 1–13.e1–e4, October 13, 2021 e2

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

Transcriptome analysis
Two days after tetracycline treatment, nymphs were collected and divided into three biological replicates with 13 ticks in each group.
Total RNA was extracted using TRIzol Reagent according the manufacturer’s instructions (Thermo Fisher, China) and sent to
Novogene (Beijing, China) for library construction and sequencing using Illumina HiSeqTM. Transcriptome assembly was accom-
plished using Trinity (Grabherr et al., 2011). Gene function was annotated based on the following databases: Nr (NCBI nonredundant
protein sequences); Nt (NCBI nonredundant nucleotide sequences); Pfam (Protein family); KOG/COG (Clusters of Orthologous
Groups of proteins); Swiss-Prot (a manually annotated and reviewed protein sequence database); KO (KEGG Ortholog database);
and GO (Gene Ontology). Differential expression analysis was performed using the DESeq R package (Wang et al., 2010). Genes
with an adjusted P-value < 0.05 and fold change > 2 were considered to be significantly differentially expressed genes. The statistical
enrichment of differentially expressed genes in KEGG pathways (http://www.genome.jp/kegg/) was analyzed using KOBAS (Kane-
hisa et al., 2008; Mao et al., 2005).

Nutrient administration
Chorismate stock solution (chorismic acid barium salt, Sigma-Aldrich, USA) 2 mg/ml, tryptophan (Sinopharm, China) 10 mg/ml,
phenylalanine (Sinopharm, China) 10 mg/ml, serotonin hydrochloride (Aladdin, China) 10 mg/ml, kynurenine 10 mg/ml (Sigma-Al-
drich, USA), phenethylamine 10 mg/ml (Sigma-Aldrich, USA), dopamine 10 mg/ml (Sigma-Aldrich, USA) were dissolved in 10 mg/
ml tetracycline solution or 0.9% NaCl solution. Nymphs were injected intrathoracically with 20 nl nutrient solution and subsequently
allowed to feed on mice 24 hr later. Nymphs were collected 2 days post injection for gene expression analysis. Individual adults were
injected with 150 nl solution containing 20 mg/ml TET and 2 mg/ml chorismate and allowed to feed on mice 24 hr post injection.
Tetracycline- and 0.9% NaCl-treated ticks were used as controls.

Antagonist and inhibitor treatment

The 5-HT receptor antagonist ketanserin tartrate (Sigma-Aldrich, USA) 10 mg/ml, TPH antagonist AMTP (a-Methyl-DL-tryptophan)
(Sigma-Aldrich, USA) 10 mM, TPH inhibitor PCPA (para-chlorophenylalanine) (Sigma-Aldrich, USA) 10 mM, AAAD inhibitor NSD-
1015 (3-hydroxybenzylhydrazine dihydrochloride) (Sigma-Aldrich, USA) 10 mM, and 5-enolpyruvylshikimate-3-phosphate synthase
(EPSPS) enzyme inhibitor Glyphosate (Sigma-Aldrich, USA) 10 mg/ml were dissolved in 0.9% NaCl (Anstey et al., 2009; Gatellier
et al., 2004; Shih et al., 2013). Individual nymphs and adults were injected with 20 nl and 150 nl antagonist solution, respectively,
followed by feeding on mice 24 hr later. Saline injected ticks were used as controls. For coadministration of antagonist and nutrients,
nymphs were injected with 20 nl solution containing 10 mM AMTP mixed with 10 mg/ml tryptophan or 2 mg/ml chorismate, or 20 nl
solution containing 10 mM NSD-1015 supplemented with 2 mg/ml chorismate. Adults were injected with 150 nl solution containing
10 mM AMTP mixed with 2 mg/ml chorismate. For the glyphosate spraying experiment, 10 mg/ml glyphosate was dissolved in H2O (Li
et al., 2012; Liu et al., 2018). Glyphosate solution was sprayed on approximately 40 nymphs in a small plastic bottle once a day for
three consecutive days. After spraying, the ticks were placed in a wet box in a 37 C incubator. Sterile water sprayed ticks were used
as controls.

Gene knockdown
The cDNA clones of TPH and 5-HT2 were obtained using the primers listed in key resources table. Double stranded RNA was
synthesized using the MEGAscript T7 High Yield Transcription kit (Thermo Fisher, USA) as previously described (Song et al.,
2018). Unfed nymphal H. longicornis were injected with 10 nl dsRNA (1.5 mg/ml) in the lower right quadrant of the ventral surface
of the exoskeleton of ticks (Kocan et al., 2011). After 24 hr of rest in a humid chamber at room temperature, ticks were allowed to
feed on mice. To examine the gene silencing efficiency, whole ticks and different tissues including midguts, salivary glands and
carcass were collected 36 hr after attachment.

RT-qPCR
Three pooled nymphs, tissues including salivary glands, midgut and carcass pooled from 5 nymphs and individual adults were used
as one biological replicate for RNA extraction. Total RNA was extracted using TRIzol Reagent according the manufacturer’s in-
structions (Thermo Fisher, China) and reverse transcribed using 5XAll-in-One MasterMix (with AccuRT Genomic DNA Removal
Kit) (ABM, China). Real-time PCR was performed using a Roche LightCycler 96 Real Time PCR Detection System with SYBR Green
qPCR Master Mix (Biomake, China). H. longicornis actin was used as reference. Primers used were listed in Table S2. The data were
processed and analyzed with LightCycler 96 software. Relative quantitation results were normalized to the reference gene using the
2–DDCt method (Livak and Schmittgen, 2001). Gene expression of the dsRNA-treated group was normalized to that of the controls.

5-HT quantification by ELISA

Serotonin levels in nymphs were measured using a serotonin ELISA kit (Biovision, USA) according to the manufacturer’s instructions.
In brief, nymphs were collected 2 days after treatment. Fifty nymphs were pooled for one biological sample. Each sample was
homogenized in sample dilution buffer, and the supernatant was subjected to 5-HT quantification.

e3 Cell Host & Microbe 29, 1–13.e1–e4, October 13, 2021

 Please cite this article in press as: Zhong et al., Symbiont-regulated serotonin biosynthesis modulates tick feeding activity, Cell Host & Microbe (2021),
https://doi.org/10.1016/j.chom.2021.08.011

ll
Article

LC-MS analysis
Eighteen unfed adult H. longicornis two days after treatment were pooled for one biological replicate. Six biological replicates of each
treatment were used for LC-MS analysis. To examine the metabolites during feeding, unfed, partially engorged and full engorged
ticks were collected for LC-MS analysis. Metabolite extraction and LC-MS/MS analysis were performed by APExBIO Technology
LLC, China.

Immunohistochemistry
Synganglion, midgut, ovaries, salivary glands, and Malpighian tubules were dissected from adults two days after treatments and
fixed in 4% paraformaldehyde for two days. Paraffin sections of midgut, salivary glands, ovaries and Malpighian tubules (5 mm)
were prepared as described (Attardo et al., 2008). Whole mount staining was performed on synganglion. Briefly, the whole
synganglion tissue and the slides were blocked with 3% bovine serum albumin (BSA, Sigma-Aldrich, USA) in PBS for 2 hr at
room temperature followed by incubation with primary anti-serotonin antibodies (Abcam, UK) (1:600) in 3% BSA at 4  C overnight.
and DyLight488-conjugated secondary donkey-anti-goat IgG (Abcam, UK) in the dark (1:100) in PBS for 1 hr. Slides were stained
with 4’,6’-diamidino-2-phenylindole (DAPI) (Solarbio, China) and mounted using FluoromountTM Aqueous Mounting Medium
(Sigma-Aldrich, USA). Images were acquired using a Nikon positive laser scanning confocal microscope (Nikon, Germany).

Statistical analysis
Calculations and graphs were made using GraphPad Prism (v 8.0). The specific test and replicates for each analysis are indicated
in the corresponding figure legends. Unless otherwise indicated, statistical analysis was performed using Student’s t tests or
Mann–Whitney tests for two groups depending on the data distribution and ANOVA for three or more groups. The statistical analysis
of transcriptome data was described in the corresponding methods. Statistical significance was defined by P < 0.05. For Pearson
correlation analysis in individual nymphs, R package ggplot2 (Wickham, 2016) was used to draw the scatter point plot, and the
regression line was added by function geom_smooth in ggplot2.

Cell Host & Microbe 29, 1–13.e1–e4, October 13, 2021 e4