Plant Mol Biol Rep (2012) 30:235–241
DOI 10.1007/s11105-011-0318-1
Functional Analysis of the Promoter of a Female-Specific
Cucumber CsACS1G Gene
Tao Wu & Zhiwei Qin & Zhuo Feng & Xiuyan Zhou &
Ming Xin & Yalin Du
Published online: 24 May 2011
# Springer-Verlag 2011
Abstract The 5′ fragment (1,678 bp) of the cucumber
female-specific CsACS1G gene was transcriptionally fused
to the green fluorescent protein (GFP) gene and GUS gene
and functionally analyzed for important regulatory regions
controlling gene expression in onion epidermal cells or
stably transformed Arabidopsis plants. Progressive up-
stream deletion analyses of the promoter showed that the
cis-elements needed for cucumber female-specific expres-
sion might be located in the region from −535 to −402 bp.
Furthermore, deletion analysis also revealed that the region
from −117 to −1 bp is sufficient to induce transcription of
CsACS1/1G. In addition, there might be repressor elements of
cucumber female-specific expression in the region upstream
of −535 bp. These findings indicate that a 1,678 bp fragment
of the cucumber female-specific CsACS1G promoter contains
specific transcription regulatory elements and provide clues
about the roles of CsACS1G in cucumber sex determination.
Further analyses of these elements will help to elucidate the
molecular mechanisms regulating the expression of the
CsACS1G gene during sex determination in cucumber.
Keywords CsACS1G . Cucumber . Promoter .
Sex determination
Abbreviations
ACC 1-Aminocyclopropane-1-carboxylate
ACS ACC synthase
ARR1 Nuclear response regulator 1
AuxRE Auxin responsive elements
T. Wu : Z. Qin (*) : Z. Feng : X. Zhou : M. Xin : Y. Du
Horticultural Department, Northeast Agricultural University,
59 Mucai Road,
Harbin 150030, China
e-mail: qzw303@126.com
CaMV Cauliflower mosaic virus
GA Gibberellic acid
GFP Green fluorescent protein
NSHB Non-symbiotic hemoglobin-2
Introduction
Cucumber is a monoecious plant that serves as a model for the
study of floral sex determination (Malepszy and Niemirowicz-
Szczytt 1991). At the early stages of development, the
cucumber floral primordia are initially bisexual, containing
primodia of both anthers and pistils, and sex determination
occurs following the selective arrest of the development of
either the staminate or the pistillate primodia (Bai et al.
2004). Gynoecy in cucumber is controlled by the Female (F)
locus that can be modified by other sex-determining genes,
environmental conditions, and plant hormones (Pierce and
Wehner 1990; Jin et al. 2011). Most of the molecular studies
in cucumber have targeted the role of ethylene in sex
determination, the genes involved in ethylene biosynthesis
and perception, as well as some ethylene-induced genes,
have been found to be involved in sex determination
(Yamasaki et al. 2000; Ando and Sakai 2002; Saito et al.
2007), specifically the role of the key regulatory enzyme of
ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate
(ACC) synthase (ACS) (Trebitsh et al. 1997; Mibus and
Tatlioglu 2004; Knopf and Trebitsh 2006; Saito et al. 2007;
Shiber et al. 2008; Boualem et al. 2009; Li et al. 2009).
Monoecious (ff) cucumber possesses a single CsACS1 gene,
while gynoecious (FF) plants possess an additional female-
specific copy, denoted as CsACS1G, which is mapped to the
cucumber F locus. A perfect correlation (100%) was found
between female phenotypes possessing at least one dominant
236
F allele and the presence of CsACS1G (Trebitsh et al. 1997).
Shiber et al. (2008) revealed that CsACS1G is indeed the F
locus and that one of its activities is to repress stamen
development in gynoecious floral buds. Expression analyses
indicated CsACS1G is expressed in stamen primordia of
gynoecious floral buds and that its expression is induced by
auxin and repressed by gibberellic acid (GA). The cucumber
female-specific CsACS1G gene is the result of a relatively
recent gene duplication and recombination, between CsACS1
and a branched-chain amino acid transaminase gene. The
CsACS1G and CsACS1 genes are identical duplicated genes
except for the distal promoter region that is unique to each
gene. Transient expression assay revealed that the proximal
promoter (−402/−1) is sufficient to induce transcription of
CsACS1/1G (Shiber et al. 2008). Therefore, any differential
expression between the duplicated genes is likely to originate
from unique regulatory elements (induction or repression)
residing in the distal promoter of the duplicated genes.
Transgenic technology is an important tool for the
improvement of agronomic traits in a wide variety of crop
species through the stable expression of foreign genes, and
this usually necessitates the use of promoters to drive
transgene expression exclusively in targeted tissues (Coelho
et al. 2010; Singer et al. 2010; Bhullar et al. 2011). Studying
differential patterns of promoter activity based on stable
transformation systems and transient expression assay of
reporter genes in bombarded plant tissue slices has served as
efficient means of predicting the activity of a gene promoter
(George and Parida 2010; Kato et al. 2010; Ramli and
Abdullah 2010; Yang et al. 2011). Until recently, several
putative cis-acting DNA elements have been identified in the
upstream sequence and 5′ UTR of functional genes (Singer
et al. 2010; El-Shehawi et al. 2011; Saha et al. 2011).
In order to determine how the duplicated genes (CsACS1/
1 G) are regulated and thus how the sex determination of
cucumber is integrated, the promoter regions of the
duplicated genes have been analyzed for the presence of
cis-regulatory sequences controlling transcription. Compara-
tive computerized promoter analysis between the promoters
of the duplicated genes suggested the presence of both
similar and unique putative cis-acting regulatory elements in
the two promoters. The proximal promoter that is identical in
both genes, as well as the distal promoter that is unique to
each gene contains elements for repression of GA response.
On the other hand, auxin responsive elements (AuxRE) are
present in the proximal promoter and in the distal promoter
of CsACS1G (Mibus and Tatlioglu 2004; Rimon Knopf and
Trebitsh 2006). The proximal promoter and the distal
promoter of CsACS1G contain AuxRE while GA response
and repression elements are present in the proximal and
distal promoters of both genes. Computer analysis of the
1 kb region upstream of the transcription initiation site
revealed several putative cis-acting regulatory elements that
Plant Mol Biol Rep (2012) 30:235–241
can potentially confer the responsiveness of CsACS1G to
developmental and hormonal factors and thereby control
female sex determination in cucumber. It is also noteworthy
that the distal promoter of CsACS1G contains a CArG
domain that can bind MADS-domain transcription factors. In
gynoecious plants, at the sex determination stage CsACS1G
is expressed in the stamen primordia. Thus, CsACS1G may
be regulated by a homeotic gene, such as CUM1, leading to
repression of stamen primordia at the critical developmental
stage (Kater et al. 2001; Bai et al. 2004). Although there are
some comparative computerized promoter analyses between
the promoters of the duplicated genes as mentioned above,
there is no experimental evidence about this.
In order to address the above questions, in this study, we
have set out to dissect and analyze the promoter region of
CsACS1G to further understand the control of female-
specific transcription. We have used the microprojectile-
mediated transient expression assay in onion epidermal cell
and stably transformation in Arabidopsis plants. For the
transient and stably expression assay, 5′ promoter deletions
of CsACS1G were constructed in vitro and fused to the
coding region of the GFP and GUS gene. The ability of
these truncated 5′ promoter regions to drive the expression
of the GFP and GUS gene was monitored after they were
introduced into onion epidermal cell with the particle gun
and stably transformed Arabidopsis plants. We have
localized essential control elements of the CsACS1G
promoter in a region between −535 and −402 bp. Results
from the previous and current studies suggest that the
sequence between −535 and −402 bp may be important for
the cucumber F gene activation.
Materials and Methods
Plant Material and Growth Conditions
A cucumber (Cucumis sativus L.) gynoecious cultivar
“D0420” was used in this study. Seeds were obtained from
the Northeast Agricultural University and were germinated
and grown in plastic pots containing a mixture of peat and
vermiculite (1:1, v/v). Plants were grown in a growth chamber
under a 16/8 h photoperiod at 25°C (day) and 18°C (night).
PCR Cloning of the CsACS1G Promoter Region
Total genomic DNA was extracted from leaf tissue as
described by Chetelat et al. (1995). The CsACS1G promoter
region was amplified with the forward (5′-TCATCCACTGC
CACAAGTCGTT-3′) and reverse (5′-GATGCCGTTGG
GATTAGAAGTC-3′) primes, which were designed according
to the sequence of ACS1G (GenBank accession No.
DQ839406). The PCR products were purified and cloned
Plant Mol Biol Rep (2012) 30:235–241
into pGEM-T Easy Vector (Promega, USA) followed by
sequencing. The sequence was then compared by the BLAST
program.
Construction of Vectors and Bombardment
With the cloned genomic region as a template, a 1,678-
bp fragment upstream of the transcription start site of
CsACS1G gene and its 5′ deletion derivatives were
generated by PCR with eight forward primers (pF1: 5′-
CGGAGCTCATCCTGGTAAGAGGTCATC-3′; pF2: 5′-
CGGAGCTCTACAAATTCCCACCAGTTA-3′; pF3: 5′-
CGGAGCTCATACTAGTTGCTAAATAGATCC-3′; pF4:
5′-CGGAGCTCATATCTAGGCTGCCACTG-3′; pF5: 5′-
CGGAGCTCTCATTGATATGCAACTTAGC-3′; pF6: 5′-
CGGAGCTC TATGTTTTCCCCTAACA-3′; pF7: 5′-
CGGAGCTCATCAAACCATACCTGC-3′; pF8: 5′-
CGGAGCTCTAACCAAATCCCAGACCC-3′; the intro-
duced SacI sites are underlined) and one reverse primer
(pR1: 5′-CGCGGATCCTTGAGTTGGAGAGGTGTTC-3′,
the introduced BamHI site is underlined). The amplified
fragments were, respectively, inserted into the pGII vector
(Clontech, USA) as a SacI–BamHI fragment at the
corresponding restriction sites in place of the cauliflower
mosaic virus (CaMV) 35S promoter region, resulting in a
series of pGII-CsACS1G::GFP vectors. The eight expression
vectors were named P1047 (−1047/−1), P905 (−905/−1),
P773 (−773/−1), P631 (−631/−1), P535 (−535/−1), P402
(−402/−1), P311 (−311/−1), and P117 (−117/−1), respectively.
Ligation reactions were carried out using T4 DNA ligase
(Promega, USA), and the inserts were verified by sequencing
analysis. The confirmed constructs were used to test
promoter activities in onion epidermal cells. Additionally, a
pGII vector with the GFP gene controlled by the CaMV 35S
promoter was used as a positive control. The final construct
and the control were transiently expressed in onion epider-
mal cells using a particle gun-mediated system (PDS-1000/
He; Bio-Rad). The bombarded cells were held in the dark at
25°C for 24 h followed by GFP imaging using confocal
microscopy (Carl Zeiss; LSM 510 Meta) as described (Guo
et al. 2003). Each experiment was repeated three times, on
different days, and with freshly prepared new batches of
reagents and onion epidermal cells. Each independent
experiment consisted of three replicates of onion epidermal
cells each. All repeated experiments gave consistent results.
The reported data are means of the obtained results from a
representative experiment.
Stable Transformation of Arabidopsis thaliana Plants
With the cloned genomic region as a template, the 535 bp
(−535/−1), 402 bp (−402/−1), and 311 bp (−311/−1) fragment
upstream of the transcription start site of CsACS1G gene were
237
generated by PCR with three forward primers (P1: 5′-
CGAAGCTTTCATTGATATGCAACTTAGC-3′; P2: 5′-
CGAAGCTT TATGTTTTCCCCTAACA-3′; P3: 5′-
CGAAGCTTATCAAACCATACCTGC-3′; the introduced
Hind III sites are underlined) and one reverse primer
(R1: 5′-CGCGGATCCTTGAGTTGGAGAGGTGTTC-3′,
the introduced BamHI site is underlined). The amplified
fragments were, respectively, inserted into the pBI121 vector
as a Hind III–BamHI fragment at the corresponding
restriction sites in place of the CaMV 35S promoter region,
resulting in three pBI-CsACS1G::GUS vectors. The three
expression vectors were named P′535 (−535/−1), P′402
(−402/−1), and P′311 (−311/−1), respectively. The three
constructs and pBI 121 vector were then transformed into A.
thaliana (Col-0) using the floral dip method (Bechtold et al.
1993). Transformed plants were selected on MS plates
supplemented with kanamycin containing 100 mg l−1 cefo-
taxime in 4% (w/v) top agar. The T2 populations of A.
thaliana were harvested and analyzed for quantification of
GUS activity. Plant tissues were ground into a fine powder
using liquid nitrogen with a mortar and pestle and suspended in
GUS extraction buffer (50 mM sodium phosphate pH 7.0;
0.1% Triton X-100; 10 mM 2-mercaptoethanol; 10 mM 1,2-
diaminocyclohexane-N,N,N,N-tetra-acetic acid; and 0.1%
sodium lauryl sarcosine). The supernatant was collected after
centrifugation at 12,000×g for 10 min at 4°C. Fluorometric
quantification of GUS activity was performed using 4-
methylumbelliferyl-β-D-glucuronide substrate (Jefferson et
al. 1987). The content of total proteins was determined using
the Bradford method (Bradford 1976). The GUS activity is
expressed as pmol of 4-methylumbelliferone per mg protein
per minute.
Results and Discussion
A CsACS1G promoter region was isolated as described in
Materials and Methods, the resulting 1,678 bp fragment,
upstream of the CsACS1G gene, was sequenced and
designated as pCsACS1G (Fig. 1). The GenBank BLAST
results showed that pCsACS1G has 99.05% nucleotide
similarity to the promoter of CsACS1G (GenBank acces-
sion No. DQ839406). A promoter motif search was carried
out to define putative cis-elements in the pCsACS1G
sequence using the software programs PLACE (http://www.
dna.affrc.go.jp/htdocs/PLACE/) and PlantCARE (http://bio
informatics.psb.ugent.be/webtools/plantcare/html/). A num-
ber of potential regulatory motifs corresponding to known
cis-elements of eukaryotic genes were found (Fig. 1). A
TATA box was found at the positions −44 to −35 bp
upstream of the transcription start site, whereas a CAAT box
was observed at positions −133 to −130 bp (Fig. 1); these
boxes function as basal promoter elements for transcription.
238 Plant Mol Biol Rep (2012) 30:235–241

Fig. 1 Nucleotide sequence of TCATCCACTGCCACAAGTCGTTCCTCGACCTGACACTCATTCAAATCAGTGCCCACTTC

the pCsACS1G promoter region.
The putative transcription start
site is designated as +1 and
indicated by an arrow. The
putative TATA box and CAAT
box are shown in bold. The
forward and reverse primers are
underlined. ABRE elements are
underlined and shaded; GARE
and GARC elements are boxed
and shaded. Putative light
regulation-related elements are
in italics
TCTCGTCTTTTTATCACAATCCATTATTTTACCAAGACAAACAAATAATATTCCTTACGC
AGGTATTTAAACAACGTACAAAAGAGAGAACCAACTCAATCACATTTTCGACTTACAA
AACATTTGTAAATATGTTGAGATGAGATCAAATCTAAATATAGGAAATTAAATTTGAAAG
TAGTTTTTTTTTAGTACACCCAAGTGAACACCACAATTAATCTCATAAGAGAAATTCTA
AGATATAAAATCCTGGTAAGAGGTCATCTTGATTGAACTCATTCTCTTCAACTCTTTTAT
CAATCCTATAGATATTTAGAATTTGACCATTAGACCAACTCAAAATGGTTTATACCTTTA
AAAGTTGACAGTGTATAACAACTTTAATATTACAAATTCCCACCAGTTAATAGTATTTCTT
TTAATACCGTCCAAAGCTAAATTGTCAGCAAGCATGCATTTTATTGACAACTAGACCAA
CCTAAGATGTTTCCTCTAAAAATATTTCAGAAATTATTATACAATACTAGTTGCTAAATA
GATCCATTTTACAAATAATACGAGTAAGCTTCACAAATGGTTTTTATTACATGCATTATAT
GGACATTTTAAGTGATCTAATAAGACAATTATTTGACCCTATTACGAAAAAGACAATGT
CAAAGATATCTAGGCTGCCACTGGAGCATGCCCTCACTGAACAAAATCAAACTGGCCTA
TTTTCCTTTCTTTTTTTGTTTTTCATTAAAATAATCACTCCTTCATTGATATGCAACTTAG
CAAAATATATAAGTACTAGATAAGAAAACCCAAATCAAGAGAAGCAACGACAAAAACA
CGGCGGGTTTAAGTATTTAACTACTTCGGACGGGCATAGTTATGAGCAACATTAATTATG
TTTTCCCCTAACAAATTAACCCCCAAATCATTAACATTTTTCATCATCCCATTCATTTTGT
TTCATAATCCCATTTCATCTTCCAATATCAAACCATAACCTGCCTCTGGTCGGAGGACA
CTTTCCATAAATAATTCCTCAAATCATCACTGTTTATCAACCCCCTTAATTAATTAATTAAT
ATCAAACACACTCTCTATATTATCTCTACAATCTAAATAATATACCTATATATATATATATTT
GTCTCTTATTTTAATTAGACCAATTAAATTAATCTATAACCAAATCCCAGACCCCACAT
GTGGTCAAAAGTTTTTGTTGTCACCATCTACGTGGCCTATGGATTTTGTCCTATAAATA
CCACCCTATGTTTGCTGAACACCTCTCCAACTCAAACATTCGAAGAACTATCTACCATA
TTCCAACCAATACAAACCACCTCTTTTCTCTCTCTCTATTTCTATTTCTCAACATTTCTCT
CAATCTCATAATCTTTTGTACCTATATACCTCACCTCAACGTTAATCTTAATCTTAAAATC
ATCAGATTCTTCTTCCATCCATCCCTTGGCTAGCTTATTAGCAGCACAACCGAAGAAAA
AATGAAGATGCTTTCCACAAAAGCCACGTGCAATTCCCACGGTCAAGATTCCTCCTACT
TCTTAGGATGGGAAGCTTATGAGAAGAACCCCTTTGATGAGACTTCTAATCCCAACGGC
ATC

Furthermore, regulatory elements with homology to those
identified in hormones or light-responsive (regulation) genes
were found in the pCsACS1G region such as ABREs, AuxRE,
GARE (GARC), and light-responsive (regulation) elements
(Fig. 1). The ABREs, which sharing a (C/T)ACGTGGC
consensus sequence are found to be present in numerous
ABA and/or stress-regulated genes (Choi et al. 2000), while
the AuxRE have been identified functionally in natural auxin-
responsive promoters of primary/early genes (such as
PS-IAA4/5, GH3, and SAUR15A), each of these promoters
is rapidly and specifically activated in response to biologi-
cally active auxins (Qi et al. 2002). The GARE and GARC
were reported to be necessary and sufficient for GA
responsiveness (Gubler and Jacobsen 1992). In addition, the
light-responsive (regulation) elements are associated with
light-responsive or light-induced promoter regions (Hudson

Fig. 2 Structure of GFP fusion CsACS1G promoter GFP

constructs
-1047 ~ -1
-905 ~ -1
-773 ~ -1
-631 ~ -1
-535 ~ -1
-402 ~ -1
-311 ~ -1
-117 ~ -1
Plant Mol Biol Rep (2012) 30:235–241 239

Fig. 3 Onion epidermal cells transiently transformed with different constructs. a P535; b P631; c P773; d P905; e P1047; f P311; g P402; h P117;
i pGII

and Quail 2003). Several putative elements including MYB epidermal cells containing P535 compared to other pro-
and WRKY are also present in the promoter region. The MYB moters, and P1047 was the lowest, while there were less
were reported to function as transcriptional activators in changes comparing the onion epidermal cells harboring P631,
abscisic acid signaling in Arabidopsis (Abe et al. 2003), P773, and P905 constructs. This suggests that there might be
while WRKY was reported to be a transcriptional repressor of repressor elements in the region upstream of −535 bp (Fig. 3).
the GA signaling pathway in rice (Zhang et al. 2004). Furthermore, GFP activities were higher in onion epidermal
Additionally, the promoter region also contains several cells containing P535 compared to P311, and GFP activities
potential motifs with homology to inducible regulatory of P535 was comparable to that of pGII vector containing
elements such as the W-box. The W-box was reported to be 35S promoter (Fig. 3).
involved in sugar stress response in barley (Sun et al. 2003). Due to the reason that GFP is an excellent qualitative
Taken together, sequence analysis of pCsACS1G promoter marker for promoter expression, it is not easily used in
region suggests that it contains a number of elements that are quantitative assays of heterologous expression. The experi-
potentially important in controlling gene expression and that ments that have been completed above are appropriate as
the CsACS1G gene may be subjected to complex regulations testing transient expression of genetic constructs in onion
including hormone and light induction.
In order to localize promoter regions important for the
transcriptional control of the CsACS1G gene, the full-length
promoter (P1678) and a series of its 5′-truncated fragments
(P1047, P905, P773, P631, P535, P402, P311, and P117)
were fused to the GFP reporter gene (Fig. 2). First, we
compared the GFP activities in onion epidermal cells
containing P402, P311, and P117, which are in the identical
proximal promoter region of CsACS1/1G. The results showed
that all the three promoters could induce transcription of
CsACS1/1G, and GFP activities were highest in onion
epidermal cells containing P311, followed by P402 and
P117 (Fig. 3). This suggests that P117 is sufficient to induce
transcription of CsACS1/1G. Also, there might be repressor
elements in the region between −402 and −311 bp and
enhancer elements in the region between −311 and −117 bp.
Then, GFP activities in onion epidermal cells containing
Fig. 4 GUS activity assay in transgenic A. thaliana plants (T2
P1047, P905, P773, P631, and P535, which are in the
generation). Mean values are expressed in pmol MU per mg protein
specific distal promoter region of CsACS1G were compared. per min with data from three independent lines. Error bars indicate SE
The results showed that GFP activities were highest in onion values
240
epidermal cells prior to spending time and money on more
powerful experiments involving stable transformation of intact
plants makes good sense. To get a much more mature study
that examines expression of these genetic constructs in flower
tissues of stably transformed transgenic plants, expression of
some important promoter constructs (P′535, P′402, and P′311)
in flower tissues of stably transformed Arabidopsis plants had
then been done. The results showed that the GUS activity were
highest in flower tissues containing P′535, followed by P′311
and P′402 (Fig. 4), which is consistent with the transient
expression results. Therefore, the elements needed for female-
specific expression might be located in this 133 bp fragment
(–535/−402). Further sequencing analysis found that there
was a nuclear response regulator 1 (ARR1) and an I-box in
this region. ARR1 is a response regulator (N=G/A/C/T;
AGATT), which was found in the promoter of rice non-
symbiotic hemoglobin-2 (NSHB) gene (Ross et al. 2004);
Cytokinins are sensed by histidine protein kinase receptors
(CRE1, AHK2, and AHK3) that transmit signals via histidine
phosphotransfer proteins to ARRs to activate or repress
transcription. Deletion and site-directed mutational analyses
of a predicted ARR1-binding cis-element in the OsNSHB2
promoter confirmed its functionality in cytokinin response.
Co-expression studies of promoter::GUS fusions with the
transcription factor ARR1 (D’Agostino et al. 2000) upregu-
lated the OsNSHB2 promoter in the absence of cytokinin. The
I-box motif, 5′-GGATGAGATAAGA-3′, or its shorter version
5′-GATAAG-3′, has been found in the promoters of a large
number of RBCS genes (Giuliano et al. 1988). A related motif
(the GATA box) is present in the promoters of the light-
regulated chlorophyll a/b binding protein (CAB) genes of
different species (Gidoni et al. 1989) and has been shown to
be involved in the activation of an Arabidopsis CAB gene by
light and by the circadian clock (Anderson and Kay 1995). I-
box and GATA binding factors have been identified in
nuclear extracts from tobacco and tomato leaves and
cotyledons (Borello et al. 1993; Manzara et al. 1991). The
I-box has therefore been suggested to be involved in light-
regulated and/or leaf-specific gene expression of photosyn-
thetic genes (Manzara et al. 1991). Rose et al. (1999) reported
the identification of a novl protein (LeMYBI) that binds
specifically to the I-box and activates transcription in yeast
and plants. LeMYBI is the first isolated I-box binding protein
and is a member of a noves class of myb-like proteins which
is found exclusively in plants.
In conclusion, the present work using GFP and GUS
expression assay indicated that a 1678-bp fragment up-
stream of CsACS1G coding sequence confers a high level
of GFP expression in onion epidermal cells. The results
demonstrated the elements needed for cucumber female-
specific expression might be located in the 133 bp fragment
(−535/−402). Also, P117 (−117/−1) is sufficient to induce
transcription of CsACS1/1G. What is more, there might be
Plant Mol Biol Rep (2012) 30:235–241
repressor elements of cucumber female-specific expression
in the region upstream of −535 bp. The results of this study
provided a useful foundation to understand the biological
roles of this female-specific CsACS1G gene in cucumber
floral development. To demonstrate the contribution of the
various identified elements in the promoter to female-
specific, further study by loss of function analysis is needed
including deletions analysis, linker scanning, and/or point
mutations.
Acknowledgements We thank Dr Jian-yong Li (Shanghai Institute
of Plant Physiology and Ecology; Cornell University) and Dr Ai-hong
Zhang (Zhejiang University) for providing pGII and pBI121 vector,
and their helping with Arabidopsis transformation experiments. This
work was supported by Foundation for Technological Innovation
Research Team in University of Heilongjiang Province of China
(2009td07), the Special Grade of the Financial Support from China
Postdoctoral Science Foundation (201003411); the Heilongjiang
Postdoctoral Special Sustentation Fund (2009), the Special Fund for
Scientific and Technological Innovative Talents in Harbin
(2011RFQXN044), and Scientific Research Foundation for Doctor,
Northeast Agricultural University (2009RC10).
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K
(2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB)
function as transcriptional activators in abscisic acid signaling.
Plant Cell 15:63–78
Anderson SL, Kay SA (1995) Functional dissection of circadian
clock- and phytochrome-regulated transcription of the Arabidop-
sis CAB2 gene. Proc Natl Acad Sci USA 92:1500–1504
Ando S, Sakai S (2002) Isolation of an ethylene-responsive gene
(ERAF16) for a putative methyltransferase and correlation of
ERAF16 gene expression with female flower formation in
cucumber plants (Cucumis sativus). Physiol Plant 116:213–222
Bai S, Peng Y, Cui J, Gu H, Xu L, Li Y, Xu Z, Bai S (2004)
Developmental analyses reveal early arrests of the spore-bearing
parts of reproductive organs in unisexual flowers of cucumber
(Cucumis sativus L.). Planta 220:230–240
Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium-
mediated gene transfer by infiltration of adult Arabidopsis
thaliana plants. Comptes Rendus de l’Académie des Sciences
316:1194–1199
Bhullar S, Datta S, Burma PK (2011) Delayed trans-inactivation of
synthetic domain a 35S promoters by “Tobacco 271 Locus” due
to reduced sequence homology. Plant Mol Biol Rep 29:1–11
Borello U, Ceccarelli E, Giuliano G (1993) Constitutive, light-
responsive and circadian clock-responsive factors compete for
the different I box elements in plant light-regulated promotes.
Plant J 4:611–619
Boualem A, Troadec C, Kovalski I, Sari MA, Perl-Treves R,
Bendahmane A (2009) A conserved ethylene biosynthesis
enzyme leads to andromonoecy in two Cucumis species. PLoS
ONE 4:e6144
Bradford MM (1976) A rapid and sensitive method for the
quantification of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 72:248–254
Chetelat RT, Verna JW, Bennett AB (1995) Introgression into tomato
(Lycopersicon esculentum) of the L. chmielewskii sucrose
Plant Mol Biol Rep (2012) 30:235–241
accumulation gene (sucr) controlling fruit sugar composition.
Theor Appl Genet 91:327–333
Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-
responsive element binding factors. J Biol Chem 275:1723–10
Coelho GTCP, Carneiro NP, Karthikeyan AS, Raghothama KG,
Schaffert RE, Brandão RL, Paiva LV, Souza IRP, Alves VM,
Imolesi A, Carvalho CHS, Carneiro AA (2010) A phosphate
transporter promoter from Arabidopsis thaliana AtPHT1;4 gene
drives preferential gene expression in transgenic maize roots
under phosphorus starvation. Plant Mol Biol Rep 28:717–723
D’Agostino IB, Deruere J, Kieber JJ (2000) Characterization of the
response of the Arabidopsis response regulator gene family to
cytokinin. Plant Physiol 124:1706–1717
El-Shehawi AM, Elseehy MM, Hedgcoth C (2011) Isolation and
sequence analysis of wheat tissue-specific cDNAs by differential
display. Plant Mol Biol Rep 29:135–148
George S, Parida A (2010) Characterization of an oxidative stress
inducible nonspecific lipid transfer protein coding cDNA and its
promoter from drought tolerant plant Prosopis juliflora. Plant
Mol Biol Rep 28:32–40
Gidoni D, Brosio P, Bond-Cutter D, Bedbrook J, Dunsmuir P (1989)
Novel cis-acting elements in Petunia Cab gene promoters. Mol
Gen Genet 215:337–344
Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA,
Cashmore AR (1988) An evolutionarily conserved protein
binding sequence upstream of a plant light-regulated gene. Proc
Natl Acad Sci USA 85:7089–7093
Gubler F, Jacobsen JV (1992) Gibberellin-responsive elements in the
promoter of a barley high-pl a-amylase gene. Plant Cell 4:1435–
1441
Guo F, Young J, Crawford N (2003) The nitrate transporter AtNRT1.1
(CHL1) functions in stomatal opening and contributes to drought
susceptibility in Arabidopsis. Plant Cell 15:107–117
Hudson ME, Quail PH (2003) Identification of promoter motifs
involved in the network of phytochrome A-regulated gene
expression by combined analysis of genomic sequence and
microarray data. Plant Physiol 133:1605–1616
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-
glucuronidase as a sensitive and versatile gene fusion marker in
higher plants. EMBO J 6:3901–3907
Jin X, Qin Z, Tao W, Zhou XY (2011) Identification of ethylene-
responsive genes in ethrel-treated shoot apices of cucumber by
suppression subtractive hybridization. Plant Mol Biol Rep.
doi:10.1007/s11105-011-0304-7
Kater MM, Franken J, Carney KJ, Colombo L, Angenent GC (2001)
Sex determination in the monoecious species cucumber is
confined to specific floral whorls. Plant Cell 13:481–493
Kato H, Xie G, Sato Y, Imai R (2010) Isolation of anther-specific gene
promoters suitable for transgene expression in rice. Plant Mol
Biol Rep 28:381–387
Knopf RR, Trebitsh T (2006) The female-specific Cs-ACS1G gene of
cucumber. A case of gene duplication and recombination
between the non-sex-specific 1-Aminocyclopropane-1-Carboxyl-
ate synthase gene and a branched-chain amino acid transaminase
gene. Plant Cell Physiol 47:1217–1228
Li Z, Huang S, Liu S, Pan J, Zhang Z, Tao Q, Shi Q, Jia Z, Zhang W,
Chen H, Si L, Zhu L, Cai R (2009) Molecular isolation of the M
gene suggests that a conserved-residue conversion induces the
formation of bisexual flowers in cucumber plants. Genetics
182:1381–1385
241
Malepszy S, Niemirowicz-Szczytt K (1991) Sex determination in
cucumber (Cucumis sativus) as a model system for molecular
biology. Plant Sci 80:39–47
Manzara T, Carrasco P, Gruissem W (1991) Developmental and
organ-specific changes in promoter DNA-protein interactions in
the tomato rbcS gene family. Plant Cell 3:1305–1316
Mibus H, Tatlioglu T (2004) Molecular characterization and isolation
of the F/f gene for femaleness in cucumber (Cucumis sativus L.).
Theor Appl Genet 109:1669–1676
Pierce LK, Wehner TC (1990) Review of genes and linkage groups in
cucumber. HortScience 25:605–615
Qi M, Huang M, Chen F (2002) Isolation of transcription factors
binding auxin response elements using a yeast one-hybrid
system. Sci China (Series C) 45:177–185
Ramli Z, Abdullah SNA (2010) Functional characterization of the oil
palm type 3 metallothionein-like gene (MT3-B) promoter. Plant
Mol Biol Rep 28:531–541
Rose A, Meier I, Wienand U (1999) The tomato I-box binding factor
LeMYBI is a member of a novel class of Myb-like proteins. Plant
J 20:641–652
Ross EJH, Stone JM, Elowsky CG, Arredondo-Peter R, Klucas RV,
Sarath G (2004) Activation of the oryza sativa non-symbiotic
haemoglobin-2 promoter by the cytokinin-regulated transcripton
factor, ARR1. J Exp Bot 55:1721–1731
Saha D, Kumar V, Bhat SR, Srinivasan R (2011) Characterization of
upstream sequences of the LOJ gene leads to identification of a novel
enhancer element conferring lateral organ junction-specific expres-
sion in Arabidopsis thaliana. Plant Mol Biol Rep 29:265–277
Saito S, Fujii N, Miyazawa Y, Yamasaki S, Matsuura S, Mizusawa H,
Fujita Y, Takahashi H (2007) Correlation between development
of female flower buds and expression of the CS-ACS2 gene in
cucumber plants. J Exp Bot 58:2897–2907
Shiber A, Gaur RK, Rimon-Knopf R, Zelcer A, Trebitsh T (2008) The
origin and mode of function of the Female locus in cucumber.
Cucurbitaceae 2008:263–272
Singer SD, Hily J, Liu Z (2010) A 1-kb bacteriophage lambda
fragment functions as an insulator to effectively block enhancer-
promoter interactions in Arabidopsis thaliana. Plant Mol Biol
Rep 28:69–76
Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, Jansson C
(2003) A novel WRKY transcription factor, SUSIBA2, partic-
ipates in sugar signaling in barley by binding to the sugar-
responsive elements of the iso1 promoter. Plant Cell 15:2076–
2092
Trebitsh T, Staub JE, O’Neill SD (1997) Identification of a 1-
aminocyclopropane-1-carboxylic acid synthase gene linked to the
Female (F) locus that enhances female sex expression in
cucumber. Plant Physiol 113:987–995
Yamasaki S, Fujii N, Takahashi H (2000) The ethylene-regulated
expression of CS-ETR2 and CS-ERS genes in cucumber plants
and their possible involvement with sex expression in flowers.
Plant Cell Physiol 41:608–616
Yang Y, Singer S, Liu Z (2011) Petunia AGAMOUS enhancer-derived
chimeric promoters specify a carpel-, stamen- and petal-specific
expression pattern sufficient for engineering male and female
sterility in tobacco. Plant Mol Biol Rep 29:162–170
Zhang ZL, Xie Z, Zou X, Casaretto J, Ho TH, Shen QJ (2004) A rice
WRKY gene encodes a transcriptional repressor of the gibberel-
lin signaling pathway in aleurone cells. Plant Physiol 134:1500–
1513