9 Science

Quarter 1-Module 5
Non-Mendelian Patterns of
Inheritance
S9LT-Id-29
Direction: Read the story below.

Mom vs. Dad: What Did I Inherit?

By. Gellie C. Mawal

Teacher Sofia wanted her students to engage them as they study the
concept of chromosomal basis of inheritance and the concept of DNA.
Their school had a facility called THE GENETICS LAB. She’ll take a tour
for her students to fully understand their lessons.

Teacher : Students, before you enter the Genetics Lab, I have here few reminders
to make things organize . First, do not touch anything inside for
your safety. Second, observe silence inside. You may raise your hand
to ask questions if you want. And lastly, please listen to what I’m going to
discuss about the inheritance and DNA. Are you ready?

Students: Yes, teacher. We are ready.

Teacher: Let’s get inside!

As they enter their first destination, the students saw an image of threads.

Leo: Teacher, what’s that?

Teacher: Yes, Leo. This is the image of our chromosomes.

Leo: Ma’am, what is a chromosome?

Teacher: Chromosome is a thread like structure of nucleic acids and protein found
in the nucleus of a cell, which carries genetic information in the form of
genes. And that gene dictates what trait you will inherit from your parents.
Leo: Wow, very interesting. How many chromosomes do we have?
Humans have 46 chromosomes in each cell. There are 23 pairs for both
Teacher: male and female. The 22 pairs are called somatic chromosomes or autoso-
mal. They appear in pair in body cells. And the 23rd pair is called the sex
chromosomes. In males, the sex chromosome is XY and the female has
identical XX chromosomes.
So, teacher, the last pair of chromosomes will dictate on what will be our
Gina:
gender?
Yes, you are right. During sexual activity, the sperm carries either a Y or X
Teacher: chromosomes. And the egg always carries an X chromosome. So if an egg
is fertilized by a sperm with Y chromosome, the offspring is male and the
sex chromosome is XY, while if an egg is fertilized by a sperm carrying an X
chromosome, the offspring will be a female, with a sex chromosome of XX.
Oh, interesting.

6
Teacher: A gene is a unit of heredity which is transferred from a parent to offspring
and determines the characteristic or trait of the offspring. To help you in un-
derstanding the genes, let’s go to our next destination. Follow me class.
Class, what can you see in the picture?
Teacher:
Ma’am, this is a picture of Dingdong Dantes, Marian Rivera and their
Leo:
child Zia
Teacher: Now, look at Zia, their offspring. What do you think are some traits that Zia
inherited from her parents? Yes, Elena.
Elena: I think Zia inherit the eyes and the color of skin to her mother, while the
lips and shape of face from her father.
Very good, Elena. Genes are something that you inherit from your parents
Teacher:
like the eyes, height, and shape of face, skin color, and many more. Now,
can you tell something that you inherit from your parents?
Ma’am, I got my shape of face from my father, which is oval
shaped
Angella: Ma’am they always say my eyes, curly hair and my skin color are traits
that I inherited from my mother.
Gina: Ma’am my height which is tall and my nose are from my father.
Very good. Now you already know what a gene is. Later, we will find out
Teacher:
what makes up our genes. But before that, I want you to look at the next
image, I will show you. What have you noticed from these images?
Angella: Ma’am, this is a person with hairy ears. Did he inherit it from his parents?
Teacher: Yes, Angella. There are what you called sex related inheritance, namely:
sex- limited traits, sex-influenced trait and sex-linked trait. Let’s discuss first
the sex-linked genes. Genes located in the X chromosomes are called X-
linked gene and genes located in the Y chromosomes are called Y-linked
gene. An example of Y-linked trait is hypertrichosis pinnae auris, a genetic
disorder that causes hairy ears. Remember the sex chromosomes of male
and female? What are the sex chromosomes of a girl?
Angella: XX chromosomes Ma’am.
Teacher: And how about the male?
Gina: XY Chromosomes, Ma’am.
Teacher: Very good. Now who among a male or a female can inherit a hairy ear in
humans?
Lea:
A male Ma’am, because a hairy ears trait is located in the Y chromosomes
that only males have.
Teacher: Very good, Leo. Since the trait is found in Y chromosomes, then only males
could have the trait. A father who has the condition will pass it on to all his
sons, and they, in turn, will pass it on to their own sons.
Lea: Oh, we’re lucky we are female so we will not inherit this trait. But Ma’am is
there some sex-linked genes that can be passed not only to male, but also
with the female?
Yes, Lea. There is an example of X-linked trait called hemophilia. A person
Teacher: suffering from hemophilia could die from loss of blood from a small wound
because the blood either clots very slowly or does not clot at all. And it can
be passed from either male or female because remember that male and
female has both an X chromosome. Did you anderstand?
Yes, Ma’am.

7
Teacher: Another sex related inheritance is the sex-limited traits. These traits are au-
tosomal, which means they are not found on the X and Y chromosomes.
This is expressed in one gender only. For example is lactation in cattle.
Both male and female cattle a gene pair for lactation. But lactation is ex-
pressed only in females, but never in males.
Lea: Teacher, why is lactation only happens in female and never in male?
Teacher: The gene for lactation is dominant over the nonlactating gene. Have you
noticed that in female cattle, if at least one gene pair is for lactation, the fe-
male produces milk? In male cattle it does not matter if they possess one or
two genes for lactation. They never produce milk. Did you understand?
Students: Yes, Ma’am.
Teacher: Now let’s move to the last sex related inheritance which is called the sex
influenced trait. Look at this image class. What have you noticed?
Angella: This person have no hair. Is he born with no hair at all?
Teacher: Very good. This is the image of a bald person. Again this trait is autosomal.
The behaviors of the product of this genes are highly influenced by the hor-
mone testosterone. All humans have testosterone, but males have much
higher levels of this hormone. Its like a dominant allelle for males and re-
cessive allele for females.
Angella: So teacher, males has more risk of becoming bald than us females?
Teacher: Yes, Angella. Is there any questions about the sex-related inheritance?
Students: None, Ma’am.
Teacher: Now, let’s proceed to our next topic which is the DNA. Is there anyone who
knows what is DNA?
Leo:
DNA stands for Deoxyribonucleic Acid.
Teacher: Very good, Leo. On our previous discussions, we discussed that chromo-
somes make up our genes and genes determine what you look like. Now
look at this image that is made of colorful beads. Are they beautiful?
Gina: Yes, Ma’am. This looks like a twisted ladder.
Teacher: This is the DNA. Chromosomes are made up of long strands of DNA. And
yes, the shape of DNA is like a twisted ladder and is called the double helix.
Scientists have found out that DNA consists of long strands of nucleotides.
Each nucleotide contains pentose sugar called deoxyribose, a phosphate
group and the four compounds called the nitrogenous bases. The four ba-
ses are adenine (A), thymine(T), cytosine (C)and guanine (G). Remember
that the inside ladder in the DNA are the bases. And the percentage of ade-
nine is always equal to the percentage of thymine. While the percentage of
guanine is equal to the percentage of cytosine. Just as you in the model of
the DNA, the yellow color represents adenine and its pair is always the blue
color which is the thymine. And the red color which represents the guanine
is always paired with cystosine with a green color. These codes in the DNA
determines the size and shape of protein it builds. And this makes up the
genes that determine what you look like. Is there any question?
None, Ma’am.
Students: Tomorrow we will be having a quiz to know if you really learn
Teacher: something. Goodbye class.
Goodbye teacher. Thank you so much for teaching us.

8
 Notes to the Teacher
The activities in this module are arranged from simple to complex to help the
learner gradually master the desired learning competency. Give him/her the
needed support or guidance so that he/she will be able to perform the tasks to
prepare him/her later on in describing the chromosomal basis of inheritance and
identifying components of the DNA abrupt changes in the environment.

Non-Mendelian Patterns of Inheritance

What is It

Chromosome is a threadlike structure of nucleic acids and protein found in the nucleus of a cell,
which carries genetic information in the form of genes. Humans have 46 chromosomes.
The twenty-two pairs are calles somatic chromosomes or autsomal. The twenty third pair are the
sex chromosomes. Females have XX sex chromosomes and males have XY sex chromosomes.

There are three related sex inheritance, namely sex linked genes, sex limited traits and sex
influenced traits.
Sex-linked genes are genes located in the sex chromosomes. Genes located in the X chromo-
somes are called X-linked gene and genes located in the Y chromosomes are called Y-linked
gene. An example of Y-linked trait is hypertrichosis pinnae auris, a genetic disorder that causes
hairy ears.
An example of X-linked trait is hemophilia. A person suffering from hemophilia could die from loss of
blood from a small wound because the blood either clots very slowly or does not clot at all. Another
example of X-linked trait is color blindness. Notice that for a female to become colorblind, she must
be homozygous (XC XC) for the color-blind genes. The trait is, therefore, recessive in females. If a
female has only one X chromosome with the allele for color blindness, she becomes normal but can
pass on the trait to her offspring. She is therefore a carrier of the trait. Since males have only one X
chromosome, the gene for color blindness when present in the male, will always be expressed be-
cause it does not have an allele to hide or prevent its expression. Thus, the male will be color- blind.
This is the reason why color blindness is more common in males than in females.

Hypertrichosis Pinnae Auris Hemophilia

9
 Table 1. Genotypes and Phenotypes of Colorblindness in Humans

GENOTYPE PHENOTYPE

XX Normal female

XXC Normal female, carrier of the gene

XCXC Color-blind female

XY Normal male

XCY Color-blind male

Sex-limited traits are autosomal, which means they are not found on the X and Y
chromosomes. This is expressed in one gender only. For example is lactation in cattle.
Both male and female cattle a gene pair for lactation. But lactation is expressed only in
females, but never in males.
Sex- Influenced traits is autosomal. The behaviors of the product of this genes are highly
influenced by the hormone testosterone. All humans have testosterone, but males have
much higher levels of this hormone. Its like a dominant allelle for males and recessive
allele for females.

Pattern Baldness

10
 Table 2. Expression of Pattern Baldness in Human

MALE GENOTYPES MALE GENOTYPES

XBYB Male bald
XBY Male bald
XY Male nonbald
FEMALE GENOTYPES FEMALE GENOTYPES
XBXB Female bald
XBX Female nonbald
XX Female nonbald

DNA stands for Deoxyribonucleic acid. DNA is the genetic material that makes up our
chromosomes and stores our genetic information. The shape of DNA is like a twisted
ladder and is called the double helix. Scientists have found out that DNA consists of long
strands of nucleotides. Each nucleotide contains pentose sugar called deoxyribose, a
phosphate group and the four compounds called the nitrogenous bases. And the four
bases are adenine (A), thymine (T), cytosine (C)and guanine (G). Remember that the
inside ladder in the DNA are the bases. And the percentage of adenine is always equal
to the percentage of thymine.

Deoxyribose sugar

11
Independent Activity 1
Direction: Complete each statement.

1. Humans have ______ chromosomes in each cell.

2. There are _____ pairs of chromosomes for both males and females.
3. The 22 pairs are ____________ chromosomes while ___ rd pair is consists of sex
chromosomes.
4. Female has a genotype of ______ while ________ has a genotype of XY.
5. The four nitrogenous bases are ________________, _________________,
______________________ and ___________________.
6. Genes located on the X-chromosomes are called ___________________ while
genes located on the Y-chromosomes are called _______________________.
7. Examples of X-linked genes are ___________________
8. Sex-limited and sex-influenced traits are found in ________________ chromosomes
9. DNA is composed of a __________________, ____________________ and
________________________
10. Adenine pairs with _________________ while guanine pairs with
_________________.
11. The shape of DNA is ________________ __________________

Independent Assessment 1

Direction: Complete the sequence of chromosomal basis of inheritance.

Genes DNA
Chromosomes Cell

12
Independent Activity 2

Indicate the phenotype of the following persons. Refer your answers to the alleles below.

X-normal Xc-Color-blind

Genotype Phenotype
XX 1._____________________

XY 2._____________________

XcXc 3._____________________

XXc 4._____________________

XcY 5._____________________

Independent Assessment 2

Give the meaning of the following words based on what you’ve learned.

1. Genes –

2. DNA –

3. Chromosomes –

4. Hemophilia –

5. Sex-related inheritance –

Independent Activity 3
Direction: Write the complementary sequence of the following nucleotides in the DNA.

GCGCTGTGACACCCAATGCCATT

_________________________________________________

13
Independent Assessment 3
Multiple Choice. Encircle the letter of the correct answer.

1. What is an abnormal condition characterized by the inability to identify color

differences?

a. hypertrichosis pinnae auris c. pattern baldness

b. hemophilia d.color blindness

2. _______ is an inherited blood disorder that impairs blood clotting process, which pre-
vent excessive blood loss when blood vessels are injured.

a. hypertrichosis pinnae auris c. pattern baldness

b. hemophilia d.color blindness

3. The base pair of Guanine is called _________.

a. Cytosine b. Adenine c. Thymine d. Phosphate

4. What will be the sex of a child produced when an egg is fertilized by a sperm that has Y
chromosome?

a. Boy b. Girl c. Both d. None

5. The factors of heredity is _______.

a. Variation b. Genetics c. Genes d. Chromosomes

I have learned that chromosomes are ____________________________________________________

There are three kinds of sex-related inheritance, namely

__________________________________,
______________________, ________________________________

I have learned that DNA is composed of _________________________,

____________________, ___________________

That the four nitrogenous bases are _________, ______________, ______________,

________________.

14
As a learner, I should practice making my own model of DNA. Using colored paper of your
desired color, make a model of DNA and paste it inside the box.

1. What are the components of DNA?

a. deoxyribose sugar c. nitrogenous base

b. phosphate group d. all of the above

2. . The base pair of Adenine

a. Cytosine b. Guanine c. Thymine d. Phosphate

3. The genetic material that are passed on from one generation to the next to ensure continuity
of life

a. RNA b. DNA c. Thymine d. Cytosine

15
4. Humans have _________ chromosomes in each cell

a. 44 b. 45 c. 46 d. 47

5. Are expressed in both sexes but more frequently in one sex than in the other.

a.Sex-influenced traits c. Sex-limited traits

b.Sex-limited trait d. Sex-linked traits

6. Traits that are controlled by the genes located on the same sex chromosomes

a.Sex-influenced traits c. Sex-limited traits

b.Sex-limited traitd d. Sex-linked traits

7. Are reproductive cells that unite during sexul reproduction to form a new cell called a zygote.

a. Autosomes c. Genes

b. Chromosomes d. Gamete

8. the sex chromosomes of female

a. X b. Y c. XX d. XY

9. A genetic disorder in humans that causes hairy ears

a. hypertrichosis pinnae auris c. Pattern baldness

b. hemophilia d. lactation

10. What is an example of a sex-limited trait?

a. hyperrrichosis pinnae auris c. Pattern baldness

b. hemophilia d. lactation

11. Are the genes located in the x chromosomes

a. Y-linked gene c. YY-linked gene

b. X- linked gene d. XX- linked gene

12. The base pair of guanine is ________

a. Cytosine b. Guanine c. Thymine d. Phosphat

13-15. Draw and label the structure of the nucleotide.

16
Crossword Puzzle

Across Down

1. Deoxyribose Nucleic Acid 2. Another term for body chromosomes.

3. Male hormone 4. Base pair of Thymine

6. Organism has Y-chromosome 5. Different form of gene

8. basic unit of heredity 7. Physical traits of the organism

17