archives of oral biology 56 (2011) 359–366

available at www.sciencedirect.com

journal homepage: http://www.elsevier.com/locate/aob

Biological toxicity of acid electrolyzed functional water: Effect

of oral administration on mouse digestive tract and changes
in body weight

Chiharu Morita a, Tetsuya Nishida b,c,*, Koichi Ito b,c

a
Nihon University Graduate School of Dentistry, Tokyo, Japan
b
Department of Periodontology, Nihon University School of Dentistry, Tokyo, Japan
c
Division of Advanced Dental Treatment, Dental Research Center, Nihon University School of Dentistry, Tokyo, Japan

article info abstract

Article history: Objective: Acid electrolyzed functional water has been used in a variety of ways because of
Accepted 22 October 2010 its antiseptic action. In the present study, we investigated both the systemic and gastroin-
testinal effects of ingesting acid electrolyzed functional water, from the perspective of its
Keywords: use in mouthwash.
Acid electrolyzed functional water Materials and methods: Seventeen mice (three weeks old) were used in the experiment. Three
Biological toxicity of the mice (three-week-old group) were euthanized before having been given solid food,
Mouse whilst the remaining 14 were divided into two groups, one given free access to acid
electrolyzed functional water as drinking water (test group) and the other given free access
to tap water as drinking water (control group). Changes in body weight, visual inspections of
the oral cavity, histopathological tests, and measurements of surface enamel roughness and
observations of enamel morphology were recorded after eight weeks.
Results: The results showed no significant difference in changes in body weight between the
test and control groups. No abnormal findings or measurements were observed for the test
group in terms of visual inspections of the oral cavity, histopathological tests, or measure-
ments of surface enamel roughness. In terms of enamel morphology, attrition was seen in
the test group.
Conclusions: These findings suggest that the use of acid electrolyzed functional water has no
systemic effect and is safe for use in mouthwash.
# 2010 Elsevier Ltd. All rights reserved.

1. Introduction using mechanical plaque control methods, such as brushing,

Plaque control is a vital aspect of the prevention and treatment
of the two major dental disorders, tooth decay and periodontal
disease, and can be divided into two types, mechanical and
chemical.1 However, plaque is difficult to remove completely
scaling, and root planing.2,3 Moreover, mechanical plaque
control is often difficult after periodontal surgery.
Chemical plaque control includes antibiotics, antiseptics,
and enzyme preparations, with chlorhexidine solution and
phenol formulations being of confirmed effectiveness in

* Corresponding author at: 1-8-3 Kanda-Surugadai, Chiyoda-ku, Tokyo 101-8310, Japan. Tel.: +81 3 3219 8107; fax: +81 3 3219 8349.
E-mail address: nishida@dent.nihon-u.ac.jp (T. Nishida).
0003–9969/$ – see front matter # 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.archoralbio.2010.10.016
360 archives of oral biology 56 (2011) 359–366
suppressing plaque formation.4–7 The use of chlorhexidine
solution in cleaning body cavities is prohibited in Japan,8
however, and research is underway on alternative formula-
tions.9–12
A variety of studies have been carried out on acid
electrolyzed functional water as one form of chemical plaque
control.13–18 Studies have addressed the effects of this water in
suppressing plaque formation by means of its actions as an
antiseptic and in deactivating viruses, as well as its use in
other dental materials. There have also been a few studies on
the safety of acid electrolyzed functional water.19–21
The effect of electrolyzed functional water in mouthwash for
the treatment and prevention of periodontal disease is not
limited to the localized effect in the oral cavity. More
specifically, the effect on the gastrointestinal tract, including
the oesophagus, and the systemic effect of ingesting this type of
mouthwash must also be demonstrated. The aim of the present
study was to demonstrate the effect of ingesting acid electro-
lyzed functional water on the gastrointestinal tract, periodontal
soft tissue, tooth morphology and body weight of mice.
2. Materials and methods
2.1. Test sample
The acid electrolyzed functional water used as the test sample
was prepared using an electrolysis apparatus (Miura Denshi Co.
Ltd., Akita, Japan). The chemical nature of the acid electrolyzed
functional water was as follows: pH, 2.7; oxidation–reduction
potential (ORP), 1100 mV; free effective chlorine concentra-
tion, 20–60 ppm. The tap water used as the control sample had a
pH 7.5 of and a chlorine concentration of 0.5 ppm.
2.2. Mice
Experimental animals comprised 17 male C57BL/6NJcl mice
(three weeks old; body weight: 9–11 g) obtained immediately
post-weaning from CLEA Japan, Inc. (Tokyo, Japan).
Of these animals, 14 mice were kept in preparatory housing
for one week prior to the start of experiments to confirm that
they were in good health. The remaining three mice were
euthanized before having been administered solid food.
Mice were divided into two experimental groups. A test
group was given free access to acid electrolyzed functional
water as drinking water, and a control group was given free
access to tap water as drinking water.
Mice were housed in individual cages in an animal facility
at a constant temperature of 23  2 8C, humidity 55  5%, and
under a 12-h light/dark cycle. Free access to solid food and the
assigned drinking water was provided. All experimental
procedures were approved by the Animal Experimentation
Committee of Nihon University School of Dentistry.
2.3. Administration method
Preliminary experiments before the start of the present
experiment confirmed that mice would drink acid electrolyzed
functional water. Thus, the method of administration used in
this experiment was free access, with 200 ml provided as a
sufficient amount of drinking water for one mouse for three
days, and replaced with a new supply every three days.
2.4. Observation and evaluation method
2.4.1. General conditions
The general conditions of the mice were evaluated weekly in
terms of condition of coat, condition of faeces, body weight,
and overall visual findings.
2.4.2. Histological evaluation
After the experimental periods, the animals were euthanized
by anaesthetic overdose, changes in body weight, visual
inspections of the oral cavity, histopathological tests, and
measurements of surface enamel roughness and observations
of morphology were recorded. Tissue samples were collected
from seven sites from each animal (teeth, tongue, oesophagus,
stomach, jejunum, cecum, and colon). Periodontal soft tissue
and digestive organs were soaked overnight in 4% parafor-
maldehyde at 4 8C and fixed. 22 Twenty sections were
randomly cut from the samples collected at each site, and a
total of 140 sections were examined per animal. After fixation,
specimens were decalcified and embedded in paraffin.
Sections (5 mm) were cut and stained with haematoxylin
and eosin, and subsequently observed under an optical
microscope to check for the presence or absence of inflam-
mation or other abnormal findings.
2.4.3. TNF-a expression
Total RNA was extracted from the intestinal tissues by using
the RNeasy Mini Kit (Qiagen, Tokyo, Japan). First-strand DNA
was synthesized as follows. One microgram of total RNA was
mixed with 4 ml of 5 reaction buffer, 4 ml of dNTPs, 0.5 ml of
RNase inhibitor, and 0.5 ml of M-MLV reverse transcriptase.
The reaction mixture was incubated at 42 8C for 90 min. The
reaction was stopped by incubating the sample at 95 8C for
2 min. The primers used in this study are listed in Table 1.
Since TNF-a is known to be up-regulated in DSS-induced
experimental colitis, we extracted total RNA from DSS mice
and it used as a positive control.
2.4.4. Mucosal thickness
Tissue sections of the gastrointestinal tract (tongue, oesopha-
gus, stomach, jejunum, cecum, and colon) were prepared, and
thickness of the internal mucosa was examined.
Specifically, three arbitrary sites of tissue sections taken
from seven mice in each of the control and test groups were
measured and the mean thickness was calculated.
2.4.5. Tooth enamel surface roughness
Immediately post-weaning, a laser microscope was used to
measure the surface roughness of molars in the control and
Table 1 – PCR primer.
Gene Sequences
TNF-oc Forward primer GCGACGTGGAACTGGCAGAAG G
Reverse primer GTACAACCCATCG G CTG G CA
 archives of oral biology 56 (2011) 359–366 361

35 2.4.8. Periodontal tissue

30 Soft tissue sections were prepared along a line joining the
mesial cusp tip and the apex of the first right-hand molar.
Body Weight (g)

25

20

15
control
3. Results
10 test
5 3.1. General conditions

0
0 1 2 3 4 5 6 7 8 No significant differences were observed in change in body
Days weight after eight weeks between the control and test groups
(Fig. 1). Visual findings also showed no abnormal findings,
Fig. 1 – Changes in body weight after eight weeks. There
such as inflammatory symptoms (Fig. 2). No abnormal findings
was no significant difference between the control and test
in morphology and colour of internal organs and other tissues
groups.
were present on visual observation as sections were being
prepared.

3.2. Histological evaluation of the digestive system

test groups of mice. The measurement site was 50 mm from
the mesial cusp of the first right-hand molar. Both the control and test groups exhibited normal gastroin-
Measurements were performed five times per mouse and testinal tracts (tongue, oesophagus, stomach, jejunum, ce-
the mean value was used as surface roughness. cum, and colon), and no inflammation or other abnormal
findings were observed (Figs. 3 and 4).
2.4.6. Statistical analysis
Differences between means of treatments were analysed 3.3. TNF-a expression
statistically using the Kruskal Wallis H-test.
Compared to the positive control, TNF-a expression was lower
2.4.7. Tooth shapes for scanning electron microscopy in both the control and test groups. Moreover, no difference in
The specimens were then dehydrated in a graded series of TNF-a expression was observed in the control and test groups
aqueous ethanol (50%, 70%, 85%, 95% and 100% ethanol) for (Fig. 5).
10 min at each concentration. After immersion in isoamyl
acetate, the specimens were critical-point dried with a critical-
point dryer using liquid CO2. They were mounted on scanning
electron microscope stubs with silver paint and coated with
gold in a sputter coater. Specimens for surface observation
were examined for the morphology and developmental
condition of plaque deposits and photographed at two sites;
the centre and 1 mm from the centre in every direction at 50
and 100 magnification with a scanning electron microscope
(JSC-T100, Nihon Denshi K.K., Tokyo, Japan).

Fig. 2 – Findings of visual inspections of the oral cavity of Fig. 3 – Gastrointestinal sites resected as samples. (A)
mice after eight weeks. No inflammation or other oesophagus, (B) stomach, (C) jejunum, (D) cecum, and (E)
abnormal findings were observed. colon.
362 archives of oral biology 56 (2011) 359–366

Fig. 4 – Histological observations of the digestive tract of mice after eight weeks. (A) Control-group tongue. (B) Test-group
tongue. (C) Control-group oesophagus. (D) Test-group oesophagus. (E) Control-group stomach. (F) Test-group stomach. (G)
Control-group jejunum. (H) Test-group jejunum. (I) Control-group cecum. (J) Test-group cecum. (K) Control-group colon. (L)
Test-group colon. All histological observations were normal in both the control and test groups. No inflammation or other
abnormal findings were observed.
 archives of oral biology 56 (2011) 359–366
Fig. 5 – Compared to the positive control, TNF-a expression
was lower in both the control and test groups. TNF-a
expression did not differ between the control and test
groups.
3.4. Mucosal thickness
Mucosal thickness did not significantly differ between the
control and test groups (Table 2).
3.5. Tooth enamel surface roughness
A comparison of roughness at a point 50 mm from the incisal
edge of the mesial cusp of the first molar showed no significant
differences between any combination of the control, test, and
three-week-old groups (Fig. 6).
3.6. Statistical analysis
Differences between means of treatments were analysed
statistically using the Kruskal Wallis H-test. Statistical
significance was accepted at a p-value of 0.05.
3.7. Tooth shapes
There was almost no difference in molar morphology between
both the control and test groups and the three-week-old
group, with scanning electron microscope images (50) of the
three-week-old group confirming that the third molar had not
erupted. Attrition was seen in molars of three out of seven
mice in the test group compared to the others. No attrition was
seen in the control group (Fig. 7).
3.8. Periodontal tissue
Soft tissue sections produced by thin slices along a line joining
the mesial cusp tip and the apex of the first molar are shown in
Fig. 8. No abnormal findings such as neutrophil infiltration were
present in the marginal gingiva and junctional epithelium.
4. Discussion
It is difficult to completely remove plaque using mechanical
plaque control methods, such as brushing, scaling, and root
Table 2 – Mean mucosal thickness in control and test groups.
Tongue Oesophagus
Test groups (mm) 0.18 (0.24) 0.05 (0.12)
Control groups (mm) 0.17 (0.20) 0.05 (0.08)
363
Fig. 6 – We compared enamel surface roughness at a point
50 mm from the mesial cusp of the first molar. No
significant differences were observed between the control
and test groups.
planning. Moreover, mechanical plaque control is often
difficult after periodontal surgery. Accordingly, the use of
chemical plaque control alongside mechanical methods is
important for the thorough control of plaque. A variety of
studies have been conducted on acid electrolyzed functional
water as one form of chemical plaque control.13–18 As a result,
its safety and antiseptic action have been demonstrated in a
number of reports.
The present study was performed to demonstrate the
safety of acid electrolyzed functional water from the perspec-
tive of its use in mouthwash. With regard to its safety, in
addition to the localized effect in the oral cavity, its effect on
the gastrointestinal tract, including the oesophagus, and its
systemic effect must also be demonstrated. We therefore
provided mice with access to acid electrolyzed functional
water as drinking water for eight weeks and investigated its
effect on periodontal soft tissues, tooth morphology, the
digestive tract, and body weight.
The tap water used in this study had a pH of 7.5 and a
chlorine concentration of 0.5 ppm. With respect to the amount
of water ingested by mice, preliminary experiments confirmed
that mice drank sufficient water irrespective of whether it was
tap water or acid electrolyzed functional water. During the
experimental period, mice drank either tap water or acid
electrolyzed functional water, and food intake was identical
between the two experimental groups. Mouse coat condition,
faeces condition, and body weight curves exhibited no
particular abnormalities, and no harmful action was observed
Stomach Jejunum Cecum Colon
0.44 (1.41) 0.19 (0.45) 0.15 (0.11) 0.34 (0.10)
0.5 (1.37) 0.26 (0.54) 0.15 (0.05) 0.25 (0.11)
364 archives of oral biology 56 (2011) 359–366
Fig. 7 – We used a scanning electron microscope to observe tooth morphology. There was almost no difference between the
control, test, and three-week-old groups.
during general observations over the course of the experi-
ment.
With respect to the tongue, epidermal hyperplasia caused
by cell proliferation was not present in either the control or
test groups and normal histology was observed, with no
abnormal findings.
In experiments on rats by Mori et al.21 rib-like undulating
formations in the epithelial surface of the tongue caused by
local thickening of nonkeratinized epithelium, together with
thickening of the epithelial squamous cell layer, were
observed after ingesting electrolyzed strong acid aqueous
solution. However, we did not observe any such findings in the
present experiments.
Similarly, no abnormal findings were present in the
oesophagus. The gastric mucosa constantly secretes gastric
fluid together with mucilage to protect the mucosa, and
disruption of this protective mechanism can lead to erosion or
the development of ulcers. Gastric histology was normal in
both the control and test groups, with no inflammatory cell
infiltration, erosion, ulcers, or other abnormalities.
Inflammatory cell infiltration, ulcerative lesions, atrophy,
and hyperplasia are also seen if damage occurs to the jejunum,
but histology was normal in both the control and test groups,
with no abnormal findings. As with the jejunum, damage to
the cecum and colon can result in inflammatory cell
infiltration, ulcerative lesions, atrophy, and hyperplasia, but
histology was normal in both the control and test groups, with
no abnormal findings.
Because tissue TNF-a expression tends to correlate with
the degree of inflammation, it is often used to evaluate
inflammation. One study has reported increases in TNF-a
expression in experimentally induced colitis.23 Thus, in the
present study, colitis was experimentally induced in DSS mice,
which were used as a positive control. Compared to the
positive control, TNF-a expression was lower in both the
control and test groups. Moreover, TNF-a expression did not
 archives of oral biology 56 (2011) 359–366
Fig. 8 – Thin buccolingual soft tissue sections prepared along a line joining the mesial cusp tip and the apex of the first molar
of mice. P: pulp; D: dentine. No abnormal findings, such as neutrophil infiltration, were observed in the marginal gingiva
and junctional epithelium.
differ between the control and test groups, indicating that the
degree of inflammation in the gastrointestinal tract of both
groups was similar. No signs of inflammation specific to the
test group were found.
Joel et al. examined mucosal thickness as a parameter to
evaluate the effects of drinking antiseptic mouthwash on the
stomach.24 We also measured mucosal thickness in the
present study, and no significant difference was found
between the control and test groups. Thus, there were no
signs of inflammation in the test group.
Studies of the effect of strong acid electrolyzed water on
enamel using extracted human teeth have suggested that
although the risk of decalcification of the enamel surface by
strong acid electrolyzed water is small, decalcification is
observed at low levels, and that patients must therefore
receive a sufficient explanation of the method of use and
undergo regular inspections if such electrolyzed water is to be
used over a long period of time.25 In our experiments,
however, there were no significant differences in enamel
roughness between any combination of the control, test, and
three-week-old groups, showing that acid electrolyzed func-
tional water does not have an effect on structural changes in
the enamel surface. This is conjectured to result from the
buffering action of saliva raising the pH of the acid electro-
lyzed functional water and weakening the effect of its acidity,
as well as restoration of the enamel surface by means of
recalcification of teeth.
365
Observation of tooth morphology from scanning electron
microscope images showed almost no differences in molar
morphology between both the control and test groups and the
three-week-old group. Attrition in molars compared to others
was observed in three out of seven mice in the test group. A
previous histological study26,27 investigated the effect of water
containing a lactic acid bacteria beverage (LABB) on rat teeth.
According to this report, examination of rat mandibular
molars following continuous access to drinking water contain-
ing LABB showed marked attrition of the occlusal surface
owing to odontronecrotic action and occlusal function.
Attrition was also observed in some of the test group mice
in our experiment, but it is unclear whether or not decalcifi-
cation due to low pH occurred by the same decalcification
mechanism as that seen for water containing lactic acid
bacteria.
No abnormal findings were observed in the histology of
periodontal soft tissue. Although acid electrolyzed functional
water contains chlorine, this is rapidly consumed by saliva
and proteins, meaning it had no harmful effect on periodontal
soft tissue in the present study.
5. Conclusion
Drinking acid electrolyzed functional water had no effect on
mouse growth in terms of changes in body weight, and no
366 archives of oral biology 56 (2011) 359–366
abnormal findings were observed on visual or histological
inspections of the gastrointestinal tract. This suggests that
acid electrolyzed functional water has no systemic effects and
is safe when used in mouthwash, but as its causative relation
with attrition is unclear, more detailed studies are required.
Acknowledgments
We would like to thank Hiroyasu Koizumi for his technical
advice with this study.
Funding: None declared.
Conflict of interests: None declared.
Ethical approval: Animal Experimentation Committee of
Nihon University School of Dentistry, Japan (protocol number
AP09D025).
references
1. Bössmann K. Plaque and plaque control. Oralprophylaxe
1988;10(1):18–27.
2. Massler M, Rosenberg HM, Carter W, Schour I. Gingivitis in
young adult males: lack of effectiveness of a permissive
program of toothbrushing. J Periodontol 1957;28:111–24.
3. Lindhe J, Koch G. The effect of supervised oral hygiene on
the gingivae of children. J Periodontal Res 1967;2(3):215–20.
4. Davies RM, Jensen SB, Schiott CR, Löe H. The effect of topical
application of chlorhexidine on the bacterial colonization of
the teeth and gingiva. J Periodontal Res 1970;5(2):96–101.
5. Rolla G, Löe H, Schiott CR. Retention of chlorhexidine in the
human oral cavity. Arch Oral Biol 1971;16(9):1109–16.
6. Neiders ME, Weiss L. The effects of chlorhexidine treatment
on the electrokinetic characteristics of enamel and cell
adhesion to human enamel in vitro. Arch Oral Biol
1972;17(6):949–60.
7. Gordon JM, Lamster IB, Seiger MC. Efficacy of listerine
antiseptic in inhibiting the development of plaque and
gingivitis. J Clin Periodontol 1985;12(8):697–704.
8. Okano M, Nomura M, Hata S. Anaphylactic symptoms due
to chlorhexidine gluconate. Arch Dermatol 1989;125(1):50–2.
9. Tanaka K. The inhibitory effect of several oral rinses on
plaque formation: a scanning electron microscopic study.
Nippon Shishubyo Gakkai Kaishi 1988;30(2):383–98.
10. Tinanoff N, Hock J, Camosci D, Helldén L. Effect of stannous
fluoride mouthrinse on dental plaque formation. J Clin
Periodontol 1980;7:232–41.
11. Yoshinuma N, Otogoto J, Fujikawa K, Sano H, Ito K, Murai S.
Plaque inhibiting effect of Viadent1 and chlorhexidine.
Nippon Shishubyo Gakkai Kaishi 1986;28(1):235–43.
12. Ito K, Arai N, Sugano N, Tomura S, Kaneko K, Murai S. Effect
of topically-applied fluorides on plaque formation on
radicular dentin. Nippon Shishubyo Gakkai Kaishi
1990;32(2):642–51.
13. Nishida T, Eda M, Shimada K, Yamada K, Ito K, Murai S.
Effects of acid electrolysis water on plaque formation.
Nippon Shishubyo Gakkai Kaishi 1993;35(4):692–7.
14. Shimada K, Moriya Y, Igarashi T, Uchiyama T, Ito K, Hayashi
K, et al. Bactericidal effects of 2 kinds of oxidized water with
different chlorine concentrations. Nippon Shishubyo Gakkai
Kaishi 1996;38(3):306–10.
15. Ito K, Nishida T, Murai S. Inhibitory effects of acid water
prepared by an electrolysis apparatus on early plaque
formation on specimens of dentine. J Clin Periodontol
1996;23:471–6.
16. Horiba N, Hiratsuka K, Onoe T, Yoshida T, Suzuki K,
Matsumoto T, et al. Bactericidal effect of electrolyzed
neutral water on bacteria isolated from infected root canals.
Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1999;87(1):83–
7.
17. Sakurai Y, Ogoshi K, Okubo T, Kaku M, Kobayashi I. Strongly
acidic electrolyzed water: valuable disinfectant of
endoscopes. Digestive Endoscopy 2002;14(2):61–6.
18. Marutani Y, Matuzaki T, Kanaishi A, Tukasaki H, Nutahara
M, Shiba A, et al. Fundamental study on application of acidic
electrolyzed water to alginete impression. J Jap Soc Oral Funct
Water 2007;8:36–7.
19. Takeyoshi M, Iida K, Mizuguchi R, Nakayama T, Arai K, Sato
M, et al. Primary eye irritation and 5-days cumulative skin
irritation studies of superoxidized water in rabbits.
Pharmacometrics 1994;48:173–7.
20. Okuda R, Kashiwada T. Sankadenisuino Q&A. 11th ed. Tokyo:
Dentaldaiyamondosya; 1995. pp. 50–51.
21. Mori Y, Komatsu S, Hata Y. Toxicity of electrolyzed strong
acid aqueous solution: subacute toxicity test and effect on
oral tissue in rats. Odontology 1997;84(4):619–26.
22. Nishihara R, Sugano N, Takano M, Shimada T, Tanaka H,
Oka S, et al. The effect of Porphyromonas gingivalis infection
on cytokine levels in type 2 diabetic mice. J Periodont Res
2009;44:305–10.
23. Huang TC, Tsai SS, Liu LF, Liu YL, Liu HJ, Chuang KP. Effect
of Arctium lappa L. in the dextran sulfate sodium colitis
mouse model. World J Gastroenterol 2010;16(33):4193–9.
24. Petersson J, Carlstrom M, Schreiber O, phillipson M,
Christoffersson G, Jägare A, et al. Gastrotective and blood
pressure lowering effects of dietary nitrate are abolished by
an antiseptic mouthwash. Free Radic Biol Med
2009;46(8):1068–75.
25. Nishida T, Otogoto J, Ito K, Takigawa T, Onose H, Murai S.
The effect of acid electrolysis water on human enamel
surface. Nippon Shishubyo Gakkai Kaishi 1995;37(1):127–33.
26. Kodaka T, Ishida I, Higashi S. Histological study on effects of
lactobacillus drinks to human teeth V: changes in labial
enamel surfaces of rat molars caused by the drinks. Dental
Med Res 1984;3(2):227–33.
27. Restarski JS, Gortner Jr RA, McCay CM. A method for
measuring the effects of acid beverages on the teeth of
small laboratory animals. Science 1945;102:404–5.