International Journal of Biological Macromolecules 163 (2020) 1498–1517

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

journal homepage: http://www.elsevier.com/locate/ijbiomac

Review

Purification, physicochemical properties, and statistical optimization of

fibrinolytic enzymes especially from fermented foods: A
comprehensive review
Ali Muhammed Moula Ali a, Sri Charan Bindu Bavisetty b,⁎
a
Department of Food Science and Technology, Faculty of Food-Industry, King Mongkut's Institute of Technology Ladkrabang, Bangkok 10520, Thailand
b
Department of Fermentation Technology, Faculty of Food-Industry, King Mongkut's Institute of Technology Ladkrabang, Bangkok 10520, Thailand

a r t i c l e i n f o a b s t r a c t

Article history: Fibrinolytic enzymes are proteases responsible for cleavage of fibrin mesh in thrombus clots, which are the pri-
Received 27 June 2020 mary causative agents in cardiovascular diseases. Developing safe, effective and cheap thrombolytic agents are
Received in revised form 27 July 2020 important for prevention and cure of thrombosis. Although a wide variety of sources have been discovered for
Accepted 29 July 2020
fibrinolytic enzymes, only few of them have been employed in clinical and therapeutic applications due to the
Available online 8 August 2020
drawbacks such as high cost of production, low stability of enzyme or therapeutic side effects. However, the dis-
Keywords:
covery of new fibrinolytic enzymes requires complex purification stages and characterization, which gives an in-
Fibrinolytic enzyme sight into their diverse modes of action. Post-discovery, approaches such as a) statistical optimization for
Enzyme purification fermentative bioprocessing and b) genetic engineering are advantageous in providing economic viability by find-
Physiochemical properties ing simple and cost-effective medium, strain development with sufficient nutrient supplements for stable and
Statistical optimization high-level production of recombinant enzyme. This review provides a comprehensive understanding of different
Fermentation sources, purification techniques, production through genetic engineering approaches and statistical optimization
of fermentation parameters as proteases have a wide variety of industrial and biotechnological applications mak-
ing 60% of total enzyme market worldwide. New strategies targeting increased enzyme yields, non-denaturing
environments, improved stability, enzyme activity and strain improvement have been discussed.
© 2020 Elsevier B.V. All rights reserved.

Contents

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1499
2. Mechanism of blood coagulation and fibrinogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1499
3. Mechanism of action of fibrinolytic enzymes: fibrinolysis and thrombolysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1500
4. Fibrinolytic enzymes classification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1500
5. Fibrinolytic enzyme sources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1501
6. Purification of fibrinolytic enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1501
7. Biochemical characterization of fibrinolytic enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1506
7.1. Physiochemical properties of fibrinolytic enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1506
7.1.1. Molecular weight and effect of pH, temperature, inhibitors and ions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1506
7.1.2. Fibrinogenolytic, fibrinolytic and plasminogen activation activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1506
7.2. Amidolytic and kinetic properties of fibrinolytic enzyme . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1508
8. Production of fibrinolytic enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1508
8.1. Biotechnological approaches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1508
8.2. Fermentation approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
8.2.1. Optimization of temperature . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
8.2.2. pH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
8.2.3. Substrate selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
8.2.4. Nutrients . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512

⁎ Corresponding author.
E-mail address: sricharanbindu.ba@kmitl.ac.th (S.C.B. Bavisetty).

https://doi.org/10.1016/j.ijbiomac.2020.07.303
0141-8130/© 2020 Elsevier B.V. All rights reserved.
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1499

8.2.5. Rpm and other factors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512

8.2.6. Statistical optimization of media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
9. Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
9.1. Clinical . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
9.1.1. Streptokinase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
9.1.2. Staphylokinase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1512
9.1.3. Nattokinase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1513
9.1.4. Serrapeptase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1513
9.1.5. Surfactants and antimicrobial properties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1513
10. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1513
Funding details . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1514
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1514

1. Introduction various industrially important enzymes by providing a non-denaturing

Fibrinolytic enzymes belong to the class of hydrolases acting on pep-
tidases (EC 3.4). These proteases aid in the dissolution of blood clots
(thrombi), hence maintaining uniform flow in blood vessels. Thrombi
are the key causative agents for myocardial infection, deep venous
thrombosis (DVT) and a group of cardiovascular diseases (CVDs),
mainly associated with heart and blood vessels [1,2]. According to the
World Health Organization (WHO), in 2016 alone, CVDs were impli-
cated in 17.9 million deaths worldwide [3]. Concurrently, under homeo-
static conditions, these fibrin clots get hydrolyzed by fibrinolytic
enzymes (thrombin and plasmin) to ensure proper blood flow [4]. How-
ever, the imbalance caused by some disorders could result in failure to
dissolve clots, leading to thrombosis progression [5].
Over the years, anticoagulants, e.g. warfarin, dabigatran, apixaban, or
rivaroxaban, have been used to dissolve blood clots [6,7]. However,
apart from high cost of production these drugs have proven side effects
like adverse bleeding, gastrointestinal discomfort, esophagitis or esoph-
ageal injury, myocardial infraction, liver injury, hypersensitivity reac-
tions, leukocytoclastic vasculitis and hair loss [8–10]. Alternatively,
fibrinolytic enzyme activators, for example urokinase, streptokinase,
and tissue plasminogen activators have been used to treat thrombosis
[11,12]. However, all these treatments have been reported to lead to
fatal complications like bleeding in patients especially suffering from in-
tracerebral hemorrhage [13–15]. As a consequence of these undesired
side effects, a demand for alternative sources of fibrinolytic enzymes is
on the rise. Currently, thrombolytic therapy, by administering fibrino-
lytic enzymes, has led to successful outcomes, due to their successful
dissolution of blood clots and maintenance of uniform blood flow [16].
Thus, fibrinolytic enzymes have become important in thrombolysis
therapy.
As potential sources of fibrinolytic enzymes, several fermented
foods, microorganisms, algae, insects, plants, snakes, and earthworms
have been studied and their production, purification and characteriza-
tion reported [17–19]. With sights on commercial production of fibrino-
lytic enzymes, microbial sources from fermented food have gained
special importance due to beneficial properties, such as high substrate
specificity, low production cost, and ubiquitous nature [20–22]. Besides,
proteases from microorganisms have been guaranteed for their minimal
side effects in the patients, especially those with inborn disadvantages
[21]. Thus, pharmaceutical industries and research in drug screening
programs have targeted novel microbial sources for fibrinolytic enzyme
production [15,23]. However, discovery of new fibrinolytic enzymes
needs to go through combinations of complex purification steps like
precipitation, membrane filtration, dialysis, ion-exchange, hydrophobic
interaction, gel permeation and affinity chromatography. Multistep pu-
rification process poses disadvantages like time consumiption, low
product quality, extensive prefiltration, membrane fowling, need for
lower temperatures, protein aggregation etc. However, aqueous two-
phase system (ATPS), three-phase partitioning (TPP) has been reported
as an effective alternative method for concentration and purification of
environment, enhanced enzyme activity and yield comparable to chro-
matographic techniques. Along with all the above advantages, they also
provide suitability for industrial scale production with sustainable ap-
proach [24–27].
Economic viability is one of the foremost requirements for fibrino-
lytic enzymes to be commercially available. Therefore, several re-
searchers have used biotechnological interventions, including gene
cloning, overexpression of the fibrinolytic enzyme encoding gene and
mutations [28–32]. On the other hand, several research groups used
bioprocessing through fermentation as a crucial means for boosting fi-
brinolytic enzyme yield [33–36]. In addition, statistical optimization of
fermentation has been implemented on a large number of variables
[20,37,38]. In parallel, several researchers have worked on sustainable
development by using agro-industrial wastes and residues as substrates
to improve yield and the process economics [18,20,37,39].
For every fibrinolytic enzyme produced, there is a distinctive spot-
light thrown on its structure and mechanism of action, which is associ-
ated with its unique physiochemical properties and kinetic parameters.
This article reviews purification techniques, physicochemical parame-
ters and kinetic studies of fibrinolytic enzymes from different sources.
Further, the upscaling strategies for fibrinolytic enzyme production
through biotechnological interventions and statistical optimization via
fermentation, have also been reviewed, which could provide critical in-
formation to assist research in this field as well as benefit pharmaceuti-
cal and clinical sectors.
2. Mechanism of blood coagulation and fibrinogenesis
Prior to understanding types and characteristic properties of fibrino-
lytic enzymes from various edible sources, it is necessary to understand
the underlying mechanism of thrombosis and fibrinolysis. As shown in
Fig. 1, blood coagulation is an intricate process with three different cas-
cade pathways: intrinsic, extrinsic, and common [40]. The intrinsic
pathway is triggered by the exposure of endothelial collagen, which ac-
tivates various factors, including factor I (fibrinogen), II (prothrombin),
IX (Christmas factor), X (Stuart-Prower factor), XI (plasma thrombo-
plastin), and XII (Hageman factor). The pathway begins with the cleav-
age of factor XII (inactive serine protease) and finally forms Xa
(Thrombinase). At this point, the intrinsic pathway ends. In contrast,
the extrinsic pathway is much shorter and includes factors such as I, II,
VII (stable factor), and X. It begins with the activation of VIIa, in turn ac-
tivating Xa. Beyond this point, both intrinsic and extrinsic pathways
lead to the formation of a fibrin mesh via a common pathway, which
consists of I, II, V, VIII, and X factors. In the common pathway, tenase ac-
tivates X (prothrombinase) to Xa. After activating Xa, tenase facilitates
the activation of factor II (prothrombin) to IIa (thrombin). Factor IIa fi-
nally activates fibrinogen (I) to fibrin (Ia). This step is termed
“fibrinogenesis.” Parallelly, the platelets adhere to the damaged blood
vessel, causing the release of factor III (Fig. 1). The resulting fibrin
1500 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

COAGULATION CASCADE FIBRINOLYSIS MECHANISM

Intrinsic pathway Extrinsic pathway Indirect fibrinolyc acon Direct fibrinolyc acon
Surface contact Tissue damage
(Plasminogen acvaon)
XII XIIa
Plasmin like enzymes
TF VIIa VII t PA PAI 1 u PA PAI 2 Naokinase
XI XIIa Lumbrokinase

TF VIIa t PA u PA
IX IXa

Direct fibrin degradaon

Plasminogen Plasminogen
X Xa X
VII, Ca2+,Lipids t PA u PA

Common pathway V
Ca2+
Lipids Plasminogen binds to circulang clots
a2 Anplasmin
Prothrombin (II) Thrombin (IIa) a2 Macroglobulin

Thrombus clot Plasmin

Fibrinogen (I)

Fibrin (Ia)

Fibrin mesh Fibrin degradaon Fibrin degradaon

products (FDP) products (FDP)
Homeostasis

Fig. 1. Coagulation and fibrinolytic cascades The figure represents a delicate homeostatic balance between blood coagulation and fibrinolysis maintained in physiological conditions. The
coagulation cascade consists of intrinsic and extrinsic pathways which leads to the formation of thrombus clots as a physiological response to injury or tissue damage. However,
development of thrombi as a result of diseased conditions like CVDs is counteracted by the fibrinolysis mechanism of the body. t-PA (tissue plasminogen activators) and u-PA
(urokinase plasminogen activators) are two of the naturally occurring indirect type fibrinolytic enzymes which bind to any potential circulating clots and break them down to FDP
(fibrin degradation products). However, direct type of fibrinolytic action is observed exclusively in enzyme isolated form non-physiological sources like microbial (nattokinase,
streptokinase, etc.) which have the ability to directly degrade thrombus to FDP (fibrin degradation products).

mesh wraps up around the adhered platelets resulting in a thrombus
clot or “thrombosis” [41].
3. Mechanism of action of fibrinolytic enzymes: fibrinolysis and
thrombolysis
Thrombolysis refers to the dissolution of thrombi (fibrin mesh
around adhered platelets). Whereas fibrinolysis is the degradation of fi-
brin mesh, in and around a blood clot. As illustrated in Fig. 1, fibrinolysis
or breakdown of fibrin can occur in two different ways: a) indirect fibri-
nolysis controlled by plasmin activation, and b) direct fibrinolysis
caused by plasmin like enzymes [42]. Generally, indirect fibrinolysis is
a physiological response, where plasmin is activated in the presence of
plasminogen, which is, in turn, activated by tissue plasminogen activa-
tor (tPA) or urokinase-type plasminogen activator (uPA). Alternatively,
plasminogen activators, for example, streptokinase (identified from
several bacterial sources) follow a similar process of indirect fibrinolysis
[12]. The binding of tPA or uPA in the presence of Kallikrein and factor
XII drives the cleavage process. Ultimately, plasmin hydrolyses fibrin
to the soluble fibrin degradation products (FDP) (Fig. 1) [43]. On the
other hand, direct fibrinolysis includes plasmin like enzymes, e.g.
nattokinase and lumbrokinase, which can degrade fibrin mesh directly,
thereby dissolving thrombi completely [44].
4. Fibrinolytic enzymes classification
Based on the mechanism of action, fibrinolytic enzymes have been
classified into three types: a) serine protease, b) metalloprotease and
c) serine metalloprotease. Table 4 shows the up to date information
on various fibrinolytic enzymes classified into these three groups.
Fibrinolytic enzymes, belonging to serine protease group, are endopep-
tidases, that are known to cleave peptide bonds in proteins, where ser-
ine is the nucleophilic amino acid at the enzyme active site [45].
fibrinolytic enzymes, in the serine proteases group, show both direct
and indirect fibrinolytic activity. These proteases have been studied
for their characteristics, and the serine proteases like plasmin, trypsin,
and brinase are known to dissolve thrombin by direct hydrolysis [46].
Phenyl methyl sulfonyl fluoride (PMSF), a serine protease inhibitor, is
commonly employed in most studies related to the identification of fi-
brinolytic enzymes belonging to the serine protease group [47]. Fibrino-
lytic therapy, using serine protease under direct fibrinolytic activity
pose a risk of toxicity and dissolution of the fibrin clots, required to
maintain homeostasis [48–50]. Nevertheless, indirect serine proteases
such as tPA and uPA are the only Food and Drug Administration ap-
proved indirect type serine protease [51]. Though the indirect type of
serine proteases are reported to be safer modes of treatment than direct
ones, they still pose a risk of side effects, such as hemorrhage and re-
occlusion [18,52]. In addition, few indirect types of serine proteases
have been identified and characterized from various sources, including
xylarinase [53], starase [54,55], subtilisin FS33 and TPase [56]. Table 5
provides information on various sources of plasminogen activators
under indirect fibrinolytic mechanism. In addition to these some of
the direct serine proteases e.g. AprEBS2 [28], DFE27 [29], AprEJS2 [30]
and AprE34 [57] have also been identified.
The fibrinolytic enzymes in the second class, i.e. metalloproteases,
require divalent metal ions, e.g. Zn2+, Mg2+, Ca2+, Hg2+ or Co2+ for
their activity [28–30]. Few literatures suggest the activation of these
metalloproteases by metal ions, e.g. Na+, K+ and Ca2+ [58,59]. Many
papers report the effect of metal ions on crude protease extracts from
various sources, but very few authors have isolated pure forms of
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1501

metalloproteases fibrinolytic enzymes, e.g. CMase [60], PoFE [61], FVP-I
[62], AMMP [63], BKII (Bacillokinase II) [64] and TSMEP I [65].
The third fibrinolytic enzyme category is the class of serine
metalloproteases, which have properties of both serine proteases and
metalloproteases [19,66,67]. Some of the examples of serine
metalloproteases include M179 [68], CFR15 [67], AprE176 [68].
These enzymes are further classified into four groups, based on the
fibrinolytic enzyme specificity:
a) 1st generation thrombolytic agents: streptokinase and urokinase
(non-specific) [69,70].
b) 2nd generation: recombinant tissue tPA (specific), saruplase [71,72]
or prourokinase (non-specific) [73,74], Anistreplase [75], Alteplase
[76].
c) 3rd generation: tenecteplase (tnk-tPA), reteplase, monteplase,
lanoteplase, pamiteplase, and staphylokinase (specific) [77].
d) 4th generation: plasminogen activator inhibitors (PAIs) (non-spe-
cific), e.g. desmoteplase [78,79].
To date, various drugs acting as anticoagulants and fibrinolytic
agents via different mechanisms and treatment processes have under-
gone clinical trials, and since the late 1970s, several fibrinolytic en-
zymes, approved by the FDA, are listed Table 1.
bacteria [85]. Microbial origin fibrinolytic enzymes have gained consid-
erable importance due to their high specificity [17], low-cost production
[17], relatively high quantitative production of in mass culture [83], and
feasibility of genetic manipulation through biotechnological approaches
[19,23]. – all keys to the commercial value of fibrinolytic enzymes [86].
fibrinolytic enzymes with diverse biochemical characteristics have been
documented from many fermented foods around the world, e.g.
Cheonggukjang, Doenjang, Douche, Dosa, Gembus, jeotgals, kishk,
Natto, etc. [28,67,68,87–89] Many probiotic lactic acid bacteria (LAB)
have been found in fermented food reported to possess high proteolytic
activity [90]. In particular, fermented foods with strong fibrinolytic ac-
tivity have been reported to contain Bacillus sp. as the major fermenting
microorganisms. Also, Other organisms (bacteria and fungi), e.g.
Armillariella mella, Staphylococcus sp., Stenotrophomonas sp. and Strepto-
myces sp. in fermented foods have been reported with fibrinolytic prop-
erties [63,91–93]. Table 2 lists known fibrinolytic enzymes and their
sources.
Some unfermented foods, as well as nonfood sources, have been
documented to contain microorganisms producing fibrinolytic en-
zymes, see Table 2. However, we have refrained from reviewing non-
food sources.
6. Purification of fibrinolytic enzymes

5. Fibrinolytic enzyme sources The main objective of purifying enzymes is to render them
contaminant-free, increase stability, and shelf life [94,95]. In addition,
Fibrinolytic enzymes are found widely in nature and many have enzyme purification is very crucial to elucidate the structural conforma-
been identified, including several non-food sources, e.g. snake venoms, tion as well as to study the biochemical properties such as kinetic and
earthworms, plants and algae have been reported for their fibrinolytic thermodynamic parameters, which can only be conducted in its pure
properties [20,80–82]. However, the primary concern of fibrinolytic form [96]. Most importantly, fibrinolytic enzymes are required in their
proteases from these sources is low specificity towards fibrin [17]. An- pure forms to design the formulations for industrial and clinical applica-
other disadvantage is the low intestinal absorption rates or degradation tions [97]. Therefore, based on the application and source of production,
by alimentary tract enzymes, when administered orally [83]. Further, the purification process of fibrinolytic agents varies among different
numerous reports suggest that, though these proteases have a role in sources, as mentioned in Table 3. Presently, researchers have primarily
the fibrinogenolytic activity, they have also induce fibrinogenesis by ad- focused on the purification of fibrinolytic enzymes from fermented
versely altering hemostasis [83]. Most of the fibrinolytic enzymes stud- foods isolates as they provide the opportunity for large scale production
ied from the non-food or unconventional sources have failed to exhibit through industrial fermentation or upscaling through biotechnological
the expected results, as they showed major limitations. approaches [39,98]. Fibrinolytic enzymes from microbial sources have
On the contrary, fibrinolytic enzymes from food sources have pro- been identified as extracellular proteases produced at the end of the ex-
vided a different prospective, especially the ones from fermented ponential phase of growth [55,91,99]. Purification of fibrinolytic en-
foods that deal beyond the role of dietary essential [84]. This health- zymes has been performed either form (a) microbial cells separated
promoting effect has been correlated to the effect of microorganisms from the culture broth of the fermenting media or (b) culture broths
in fermented foods that have proven to be the potential sources of fibri- of the transformed bacterial cells which have been cloned with a desir-
nolytic enzymes. Majority of the studies have focused on the microbial able fibrinolytic enzyme producing gene and have been engineered to
production of fibrinolytic enzymes isolated from traditionally overexpress the enzyme [58,100].
fermented foods as they are believed to be rich in protease producing The bacterial cell-free extracts were either concentrated by varying
percentages of ammonium sulfate, ethanol or acetone precipitation, ul-
trafiltration, ultracentrifugation, and dialysis, all in combinations or in-
Table 1 dividually [91,93,101,102]. Ammonium sulfate precipitation has been
FDA approved thrombolytic agents [51]. commonly used in the majority of the studies to obtain the crude form
Protease Manufacturer Brand name Year of of enzyme, followed by several stages of chromatographic separation
approval [87,98,103–105] . The various chromatographic techniques include,
u-PA Abbott Labs. Abbokinase® 1978 anion exchange, cation exchange, gel filtration, affinity column chroma-
t-PA (Alteplase) Genentech, Inc. Activase®, 1987 tography, fast protein liquid chromatography (FPLC), hydrophobic in-
t-PA (Alteplase) Genentech, Inc. Cathflo 1996 teraction chromatography, high performance liquid chromatography
t-PA (Alteplase) Genentech, Inc. Activase® 2002 (HPLC) and chromatofocussing [15,29,106]. However complex down-
Boehringer Mannheim
Reteplase
GmbH
Retavase®, Rapilysin 1996 stream purification processing lead to several disadvantages such as
TNK-tPA Genentech, Inc TNKase™, Metalyse® 2000 loss in the native protein structure by aggregation leading to low prod-
1990, uct quality and enzyme activity, time consuming, and unsustainable. In
FIX Pfizer BeneFIX®
1997 this regard aqueous two-phase systems (ATPS) (poly-ethylene glycol
Novo Nordisk NovoSeven®,
FVIIa 1999 4000/8000 and sodium sulfate), AOT (sodium di [2-ethylhexyl]
Pharmaceuticals Inc. NovoSeven® RT
Topical thrombin in sulfosuccinate)/isooctane reverse micelles system and three phase
GenTrac THROMBIN-JMI 2006
bandages partitioning (combination of ammonium sulfate and t-butanol for pro-
Thrombin ZymoGenetics, Inc. Recothrom® 2008 tein precipitation from crude extracts) have provided certain advan-
Drotrecogin alfa, tages over the conventional techniques [26,107]. ATPS was used for
Activated protein C, Eli Lilly and Company 2001
Xigris®
the purification of fibrinolytic enzymes from B. subtilis DC-2 and
1502 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

Table 2
Sources of fibrinolytic enzymes.

Source Bacterial/Fungal strain Enzyme Reference

Jotgal Korean traditional fermented food from Gonjaengijot (pickled opossum

- JP-I and JP-II [98]
shrimp)
NatTK, NatOC, NatWT,
Indonesian traditional fermented foods - [178]
and DFEG169A
Soil isolates from dumpsites in Noida, India Bacillus cereus RSA1 - [132]
China General Microbiological Culture Collection Center (CGMCC number 2577) Cordyceps militaris CmFE [100]
Marine bacterium from beaches of northern districts of Kerala, India. Serratia rubidaea KUAS001 - [179]
Jeotgal from sea squirt (munggae), a traditional Korean fermented seafood Bacillus velezensis BS2 AprEBS2 [28]
Douche a Chinese traditional fermented black soya bean food Bacillus amyloliquefaciens Jxnuwx-1 - [87]
Sea mud Bacillus subtilis WR350 - [39]
Indian rice (Xanthomonas oryzae IND3) Bacillus subtilis HQS-3 - [20]
Mutant of B. subtilis HQS-3 isolated form sea mud Bacillus subtilis D21–8 - [34]
Isolates from soil collected from Godavari and Ganges rivers, India Stenotrophomonas maltophilia Gd2 - [144]
Isolates from desert soils of Tharparkar, Pakistan Bacillus tequilensis ZMS-2 - [145]
Douche a traditional fermented soybean food Bacillus subtilis DC27 DFE27 [29]
- Mucor subtilissimus UCP 1262 - [15]
Isolates from marine brown tube sponges Agelas conifera Streptomyces radiopugnans VITSD8 - [93]
Marine isolate Serratia marcescens subsp. sakuensis (KU296189.1) - [66]
Jeotgals from salted saeu (small shrimp), and fermented Korean seafoods Bacillus subtilis JS2 AprEJS2 [30]
Isolates from soil collected from Zhuhai City, China Bacillus tequilensis - [112]
Marine isolate Serratia marcescens subsp. sakuensis - [66]
Dosa batter, a fermented Indian food Bacillus amyloliquefaciens MCC2606 CFR15 [67]
Bovine milk Streptococcus agalactiae EBL-31 Streptokinase [38]
University of Texas Austin Chlorella vulgaris - [19]
Doenjang, traditional Korean fermented soy food Bacillus amyloliquefaciens RSB34 AprE34 [57]
Soil isolates Bacillus sp. IND12 - [149]
Garbage dump soil Serratia sp. KG-2-1 - [58]
Stem of Catharanthus roseus collected from rainforest of Western Ghats, India Xylaria curta Xylarinase [53]
Edible mushroom Cordyceps militaris - [180]
Edible mushroom Pleurotus ferulae [106]
Soil in Caatinga (Pernambuco, Brazil) Mucor subtilissimus UCP - [181]
Soil isolates from Caatinga, PE-Brazil Mucor subtilissimus UCP 1262 - [26]
Indonesian soybean-based fermented food Stenotrophomonas sp. - [92]
Marine actinomycete Streptomyces violaceus VITYGM - [182]
Bacillopeptidase F
Soil isolate, Wuhan, China Bacillus subtilis LZW [138]
(Bpr)
Vietnamese traditional fermented soybean paste products Bacillus amyloliquefaciens - [183]
Fermented rice Bacillus cereus IND5 - [33]
Marine isolates Serratia. marcescens RSPB11 Serralysin [37]
Distillery isolate from daqu, fermentative agent used in Chinese liquor and
Rhizopus microsporus var. tuberosus - [116]
vinegar
Marine isolate Shewanella sp. IND20 - [110]
- Cordyceps militaris - [120]
Bacillus subtilis 14714, Bacillus subtilis 14715, Bacillus
Pigeon pea Nattokinase [184]
subtilis 14716, and Bacillus subtilis 14718
- Bacillus subtilis - [185]
Cheonggukjang, Korean fermented soy food Bacillus subtilis HK176 AprE176 [68]
Cheonggukjang, Korean fermented soy food Bacillus subtilis HK176 M179 [68]
Microbial Type Culture Collection and Gene bank, Chandigarh, India Bacillus sphaericus MTCC 3672 - [86]
Kimchi, fermented Korean food Bacillus subtilis ZA400 BsfA [107]
Fish scales Pseudoalteromonas sp. IND11 - [150]
Rice Bacillus cereus IND1 - [147]
Cooked Indian rice Paenibacillus sp. IND8. - [186]
China General Microbiological Culture Collection Center (CGMCC) Pleurotus ostreatus - [123]
Natto, fermented Japanese soya food Bacillus subtilis RJAS19 Nattokinase [187]
Kishk, a traditional Egyptian food Lactobacillus plantarum KSK-II KSK-II [18]
United States Department of Agri-culture (NRRL) Bacillus natto NRRL-3666 - [25]
Coastal area of Wando, Republic of Korea Asterina pectinifera Starase [54]
Soil samples from slaughterhouses, dairy, domestic garbage and compost Bacillus subtilis I-2 - [121]
Microbial Type Culture Collection and Gene bank, Chandigarh, India Bacillus sphaericus MTCC 3672 - [188]
Gembus, Indonesian fermented soybean cake Bacillus pumilus 2. g - [88]
Soil samples from slaughterhouses, dairy, domestic garbage and compost Bacillus subtilis I-2 [121]
Douche, Chinese traditional fermented food Strain XY-1 DFE [189]
Soybean residue Bacillus subtilis GXA-28 - [151]
Collection of Microorganisms, Department of Antibiotics at the Federal
Bacillus sp. UFPEDA 485 - [59]
University of Pernambuco
Cheonggukjang, Korean fermented soy food Bacillus amyloliquefaciens CB1 AprECB1 [128]
Korean Mushroom Company (Suwon, Republic of Korea) Hericium erinaceum Herinase [190]
Douche, Chinese traditional fermented soya bean food Bacillus subtilis LD-8547 DFE [191]
Chickpeas - Nattokinase [35]
Marine water sample Streptomyces venezuelae Thrombinase, [115]
Marine isolate western seacoast of Maharashtra (India) Bacillus subtilis ICTF-1 - [111]
Persian Type Culture Collection, Iran Bacillus subtilis PTCC 1023 Subtilisin [31]
Fermented red bean Bacillus subtilis - [192]
Chinese fermented soybean paste. Bacillus amyloliquefaciens LSSE-62 - [193]
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1503

Table 2 (continued)

Source Bacterial/Fungal strain Enzyme Reference

Culture Collection of DNA Bank of Mushrooms (CCDMB, IUM01135), Incheon,

Paecilomyces tenuipes PTEFP [102]
Republic of Korea
Meju, traditional Korean fermented soy product Bacillus amyloliquefaciens MJ5–41 AprE5–41 [101]
MACS Collection of Microorganisms, Pune India Streptomyces sp. MCMB-379 - [146]
Korean Agricultural Culture Collection (KACC), Suwon, Korea Schizophyllum commune Mushrokinase (MsK) [124]
Hampyoung Mushroom Co., Korea Pleurotus eryngii - [194]
- Fusarium sp. CPCC 480097 - [89]
Natto, fermented Japanese soya food Bacillus subtilis natto B-12 B-12 Nattokinase [156]
Cheonggukjang, a traditional Korean fermented soy food Bacillus amyloliquefancies CH51 AprE51 [195]
Korean salt-fermented Anchovy-jeot Staphylococcus sp. strain AJ AJ [91]
Department of Industrial Crop Production and Processing, Iksan National
Perenniporia fraxinea - [196]
College, Iksan, Republic of Korea
Asian fermented shrimp paste Bacillus sp. nov. SK006 - [129]
Bacillus genetic stock center, Ohio, US (strain no. 1A752, B. subtilis) Bacillus subtilis Nattokinase [197]
Medicinal mushroom farms locating at different regions of China, including
Cordyceps militaris CMase [60]
Shanghai, Jiangsu, Anhui, Zhenjiang and Huibei provinces
Douche, Chinese traditional fermented food Bacillus subtilis DC-2 - [24]
Coelomic fluid of polychaete Nereis virens coast of Qinhuangdao Prefecture,
Nereis (Neanthes) virens (Sars) N-V protease [118]
China
Tempeh is a traditional Indonesian soybean-fermented food Fusarium sp. BLB FP [198]
Department of Industrial Crop Production and Processing, Iksan National
Pleurotus ostreatus PoFE [61]
College, Iksan, Republic of Korea
Department of Industrial Crop Production and Processing, Iksan National
Flammulina velutipes FVP-I [62]
College, Iksan, Republic of Korea
Chinese herbal medicine Cordyceps sinensis CSP [130]
Cheonggukjang, Traditional Korean food Bacillus subtilis CH-3 AprE2 [199]
bpKJ-31
Jeotgal, traditional Korean fermented seafood Bacillus licheniformis KJ-31 [200]
bacillopeptidase F
t lumbrokinase
Isolates form earthworm - [201]
(rPI239)
Culture collection of Vector Control Research Centre (VCRC) Bacillus sphaericus - [131]
Ba-bao Douchi, traditional soybean-fermented food in China Bacillus subtilis DC33 Subtilisin FS33 [55]
Korean Agricultural Culture Collection (KACC), Suwon, Korea Fomitella fraxinea FFP1 and FFP2 [202]
Tempeh, Indonesian fermented soybean Bacillus subtilis TP-6 TPase [56]
American Type Culture Collection (ATCC), USA Cordyceps militaris - [203]
Korean Agricultural Culture Collection (KACC), Suwon, Korea, Armillaria mellea AMMP [63]
Fermented shrimp paste - - [114]
Japanese traditional fermented soybean (Natto) Bacillus firmus NA-1 p - [36]
Douchi, traditional Chinese soybean fermented food Bacillus amyloliquefaciens DC-4 Subtilisin DFE [204]
Soil isolates in Korea Bacillus subtilis BKII Bacillokinase II [64]
Douchi, traditional Chinese soybean-fermented food Bacillus amyloliquefaciens DC-4 subtilisin DFE [205]
Korean traditional soybean paste Bacillus sp.KDO-13 - [125]
Isolates from Mt. Sorak in Korea Tricholoma saponaceum TSMEP I [65]
Marine isolate from coast of Hiroshima Prefecture, Japan Codium divaricatum CDP [82]
Taiwan soil isolates Mutant of Bacillus subtilis IMR-NK1 Nattokinase [206]
Doen-Jang, Traditional Korean fermented food Bacillus sp. DJ-4 Subtilin DJ-4 [207]
Isolates from Mt. Chiak in Korea Armillariella mella - [208]
Chungkook-Jang, traditional Korean fermented-soybean sauce Bacillus sp. strain CK 11–4 CK [113]
skipjack Shiokara, Japanese traditional salt-fermented food - Katsuwokinase (KK) [117]
Vegetable cheese natto - Nattokinase [209]

M. subtilissimus UCP 1262 and Gliricidia sepium seeds [24–27]. ATPS is
formed by two mutually immiscible phases that are generated by
mixing phase-forming components above a threshold concentration.
ATPS is also suitable for large scale production because polyethylene
glycol (PEG), which is often used in one of its phases, has favorable
physical and chemical properties. PEG is a “polydispersed” polymer
that, due to its Gaussian distribution of chain lengths and molecules,
can react with a variety of functional groups located at the terminal
ends of biopolymers such as proteins [108]. In addition, PEGylation,
i.e., PEG binding to drugs, therapeutic proteins or vesicles, improves
their solubility in water and organic solvents, increases its biocompati-
bility and makes the scale-up easier, hence favoring the large-scale de-
velopment of drugs [15]. Additional advantageous features of PEG are
a) the presence of electron-donating hydroxyl groups, b) ability to inter-
act with hydrophobic compounds through hydrogen bonds, c) absence
of odor, d) no irritating action, e) neutrality, f) low toxicity in vivo,
g) quick drug release, h) preservation of extracted biomolecules activity,
i) biodegradability, and j) approval by the FDA. Although there are sev-
eral salts able to form two phases with PEG, phosphates allow for higher
biomolecule partition coefficients and have greater affinity for the bot-
tom phase compared to other salts such as NaCl and Na2SO4, thus creat-
ing a negative electric potential in this phase that forces the partition of
biomolecules to the top phase [109]. On the other hand, as reported by
Garg and Thorat [25] three phase partitioning (TPP) uses a combination
of ammonium sulphate and t-butanol to precipitate proteins from crude
extracts. t-butanol binds to the precipitated proteins, thereby increasing
their buoyancy and causing the precipitates to float above the denser
aqueous salt layer. Under the optimum conditions of pH, temperature,
ammonium sulphate and t-butanol concentrations protein can be selec-
tively precipitated at the inter-face of the organic and aqueous phases.
Kosmotropy, salting out, co-solvent precipitation, isoionic precipitation,
osmolytic electro-static forces, conformation tightening and protein hy-
dration shifts, all contribute to the protein precipitation at the interface
[27].
1504 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

Table 3
Purification methods used in various studies on fibrinolytic enzymes.

Source Enzyme Purification methods Specific Reference

activity
(U mg
−1
)

Jotgal Korean traditional fermented food

Ethanol precipitation (75%), Bio-GEL P-100 gel filtration, DEAE-cellulose ion-exchange
from Gonjaengijot (pickled opossum JP-I 7245 [98]
chromatography
shrimp)
Jotgal Korean traditional fermented food
Ethanol precipitation (75%), Bio-GEL P-100 gel filtration, DEAE-cellulose ion-exchange
from Gonjaengijot (pickled opossum JP-II 2394 [98]
chromatography
shrimp)
Bacillus cereus RSA1 - Ethanol precipitation (50%), Sephadex-G75 gel filtration chromatography, 29 [132]
Bacillus velezensis BS2 AprEBS2 affinity chromatography: HiTrap IMAC FF column 131⁎ [28]
Ammonium sulfate precipitation (65%) DEAE-Sepharose FF anion exchange column
Bacillus amyloliquefaciens Jxnuwx-1 - chromatography and gel filtration chromatography on Superdex 75 column, AKTA 274 1240 [87]
Explorer 100 FPLC system
UNOsphere Q ion-exchange column chromatography, Sephadex G-75 gel filtration
Bacillus subtilis DC27 DFE27 11,274 [29]
chromatography, and HPLC
Mucor subtilissimus UCP 1262 - DEAE-Sephadex A50 ion exchange chromatography - [15]
Ammonium sulfate fractionation (0–85%), affinity and ion-exchange chromatography,
Streptomyces radiopugnans VITSD8 - 3891 [93]
gel filtration chromatography (Sepharose CL-6B column)
Bacillus subtilis JS2 AprEJS2 column chromatography using HiTrap IMAC FF column - [30]
combination of salting out, ion-exchange chromatography (Q HP column), and size
Bacillus tequilensis - 2374 [112]
exclusion chromatography (Sephacryl-100 column)
Ammonium sulfate precipitation (40%), dialysis followed by fast protein liquid
Serratia marcescens subsp. sakuensis - 1033 [66]
chromatography (Enrich SEC 650 column)
Ammonium sulfate precipitation, ion-exchange, and gel filtration chromatography
Bacillus amyloliquefaciens MCC2606 CFR15 584 [67]
(Sephadex G-75 matrix).
Bacillus amyloliquefaciens RSB34 AprE34 Column chromatography HiTrap IMAC FF column) 83⁎ [57]
Ammonium sulfate precipitation (75%) and ion-exchange chromatography
Serratia sp. KG-2-1 - 493 [58]
(DEAE-Sephadex column).
Ammonium sulfate precipitation, dialysis, ultrafiltration, medium pressure liquid
Xylaria curta Xylarinase 9 [53]
chromatography (Sephacryl S-300)
Ammonium sulphate precipitation (30%), ion exchange and gel filtration
Cordyceps militaris - 1467 [180]
chromatography (CM Sepharose FF (2.6 × 20 cm) column).
Ion exchange chromatography (CM-cellulose column, DEAE-sepharose CL6B 100
Pleurotus ferulae - column), dialysis, gel filtration chromatography (a Sephadex G-20 column), FPLC (HiPrep 1253 [106]
26/10 column)
Aqueous two-phase systems (peg/sulfate) polyethylene glycol (peg)/sodium sulfate
Mucor Subtilissimus UCP 1262 - - [26]
aqueous two-phase systems
Ammonium sulfate precipitation, dialysis and gel permeation chromatography
Streptomyces violaceus VITYGM - 1437 [182]
(Sephadex G-50 column)
Bacillopeptidase 2+
Bacillus subtilis LZW Affinity chromatography (Ni -charged chelating Sepharose Fast Flow resin) - [138]
F (Bpr)
Ammonium sulfate precipitation (70%), ion-exchange chromatography (DEAE cellulose
Bacillus cereus IND5 - 364a [33]
column) and casein-agarose affinity chromatography
Ammonium sulfate precipitation (30%), dialysis, ion-exchange chromatography (DEAE
Rhizopus microsporus var. tuberosus - 1645.2 [116]
Sepharose® column), and gel filtration chromatography (Sephadex G-75).
Ammonium sulfate precipitation (70% saturation), dialyzed, gel filtration
Shewanella sp. IND20. - 960 [110]
chromatography (Sephadex G75)
Ammonium sulphate precipitation (0–20%), gel filtration chromatography (sephadex
Cordyceps militaris - 1682 [120]
G75), ion exchange chromatography (CM-Sepharose FF column)
Bacillus subtilis HK176 AprE176 Ni-NTA column chromatography 217 [68]
Bacillus subtilis HK176 M179 480 [68]
polyethylene glycol PEG concentration, Ni-NTA chromatography purification, and
Bacillus subtilis ZA400 BsfA 4.5 [107]
Amicon concentration
Ammonium sulfate precipitation (30–70%), ion-exchange chromatography (DEAE
Bacillus cereus IND1 - cellulose column), gel filtration chromatography (SephadexG-75), and casein-agarose 960 [147]
affinity chromatography
Combination of freeze-thaw treatment, ammonium sulfate precipitation (0–20%),
Pleurotus ostreatus - hydrophobic interaction, and gel filtration chromatography (Octyl-Sepharose FF column, 1200 [123]
Phenyl Sepharose HP column)
Ammonium sulfate precipitation (40–60%), dialysis, ion-exchange chromatography (CM
Bacillus subtilis RJAS19 Nattokinase - [187]
Sepharose column)
Fractional precipitation with 60% acetone, gel filtration chromatography (Sephadex G-75
Lactobacillus plantarum KSK-II KSK-II - [18]
FF column), and anion-exchange chromatography (DEAE-Cellulose)
Three-phase partitioning (combination of ammonium sulfate (0–20%) and t-butanol to
Bacillus natto NRRL-3666 - 136 [25]
precipitate protein from crude extracts)
Ion exchange chromatography (DEAE-sepharose CL6B column), gel filtration
Asterina pectinifera Starase chromatography (Sepharose CL4B column), FPLC (Mono 162 [54]
Q HR 5/5 column)
Ammonium sulfate precipitation, ion-exchange chromatography (DEAE Sephadex
Bacillus subtilis I-2 - 136 [121]
chromatography)
Ammonium sulfate precipitation (80%), ion-exchange chromatography (CM-Sephadex
Bacillus pumilus 2.g - column), and hydrophobic interaction chromatography (Phenyl Sepharose 6 Fast Flow 1442 [88]
resin)
Bacillus amyloliquefaciens CB1 AprECB1 Ammonium sulfate precipitation (80%), hydrophobic interaction chromatography 1584 [128]
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1505

Table 3 (continued)

Source Enzyme Purification methods Specific Reference

activity
(U mg
−1
)

(Phenyl Sepharose 6 Fast Flow), ion-exchange chromatography (DEAE-Sephadex A-50)

CM-cellulose column, DEAE-cellulose column, Sephadex G-75 column, fast protein liquid
Hericium erinaceum Herinase 221 [190]
chromatography (FPLC) using a HiLoad 16/60 Superdex 75 column,
Bacillus subtilis LD-8547 DFE salt-out technique, dialysis and gel filtration chromatography (Sephadex G-100) 21,750# [191]
Ammonium sulfate precipitation, dialysis, ion-exchange chromatography (UnoQ
Bacillus subtilis ICTF-1 - 3420# [111]
Sepharose column)
Bacillus subtilis PTCC 1023 Subtilisin Ni-NTA affinity column chromatography 4500 [31]
Ammonium sulfate precipitation (50–70%), gel filtration chromatography (Sephacryl
Bacillus subtilis - 6284 [192]
S-200HR) and PBE 94 chromatofocussing
Ammonium sulfate precipitation (80%), dialysis, column chromatography
Bacillus amyloliquefaciens MJ5–41 AprE5–41 104 [101]
(CM-Sephadex, Phenyl Sepharose 6FF, and Sephadex G-75)
Streptomyces sp. MCMB-379 - Column chromatography (UNOsphere Anion-Q column, Mono Q column), dialysis 106 [146]
Ethanol precipitation, ion-exchange chromatography (CM-cellulose column,
DEAE-Sepharose CL-6B column), gel filtration chromatography (Sephadex G-75 column),
Paecilomyces tenuipes PTEFP 1432 [102]
ion-exchange chromatography (POROS 20 HQ ion
exchange column)
Ammonium sulfate precipitation (80%), ion-exchange column chromatography
Mushrokinase
Schizophyllum commune (DEAE-Sephadex A-50) and gel filtration chromatography (Sephadex G-75 and Sephadex 40 [124]
(MsK)
G-50 column)
Ammonium sulfate precipitation (20–80%), ion-exchange chromatography
Pleurotus eryngii - (DEAE-Sepharose Fast Flow column), desalting (PD-10 column), gel filtration (Sephacryl 53 [194]
S-300 HR column), FPLC (Sephacryl S-300 HR column)
Ammonium sulfate precipitation (40–60%), Column chromatography (Mono-Q column),
Fusarium sp. CPCC 480097 - - [89]
gel filtration chromatography (Superdex 75 column)
Ammonium sulfate precipitation (30–80%), dialysis, gel filtration chromatography
B-12
Bacillus subtilis natto B-12 (Sephadex G-75 column) ultrafiltration, hydrophobic interaction chromatography 5316 [156]
Nattokinase
(Phenyl-Sepharose 6 Fast Flow column)
Ammonium sulfate precipitation (80%), ion exchange (CM-Sephadex), hydrophobic
Bacillus amyloliquefancies CH51 AprE51 342 [195]
interaction chromatography (Phenyl Sepharose 6 Fast Flow column)
Ultrafiltration with the PM-10 membrane, dialysis, column chromatography
Staphylococcus sp. strain AJ AJ 72 [91]
(DEAE-cellulose), gel filtration (TSK gel filtration column)
Ethanol precipitation, ion exchange (CM-cellulose column, DEAE–Sepharose CL6B
Perenniporia fraxinea - column), gel filtration (Sephadex G-75 column), FPLC (HiLoad 16/60 Superdex 75 900 [196]
column)
Dialysis, ion exchange (DEAE-Sepharose Cl 6B FF column), gel filtration (Superdex 75
Bacillus sp. nov. SK006 - 11 [129]
(10/300 GL) gel filtration column)
Ammonium sulfate precipitation (30–80%), dialysis, gel filtration chromatography
Cordyceps militaris CMase 2 [60]
(Superdex 75column)
Anion-exchange chromatography (DEAE-Sepharose FF column), ultracentrifugation,
dialysis, cation-exchange chromatography (CM Sepharose FF column), gel permeation
Nereis (Neanthes) virens (Sars) N-V protease 116,280 [118]
chromatography (Sephacryl S-200 HR column), gel permeation chromatography
(Sephadex G-25 Super-fine column)
Ammonium sulfate precipitation (80%), ultrafiltration, ion-exchange (DEAE-sepharose FF
Fomitella fraxinea FFP1 and FFP2 62 [202]
column), gel filtration (Superdex 200 HR column), FPLC (MonoQ column)
Ethanol precipitation, ion-exchange chromatography (CM cellulose) and anion exchange
Flammulina velutipes FVP-I chromatography (DEAE Sephadex A-50 column), gel filtration chromatography 144 [62]
(Sephadex G-75 column)
Anion exchange chromatography (DEAE-Sepharose Fast Flow column), gel filtration
Cordyceps sinensis CSP 5910 [130]
chromatography (GF-250 column), dialysis, HPLC
Ammonium sulfate precipitation (75%), anion-exchange chromatography
Bacillus licheniformis KJ-31 bpKJ-31 (DEAE-Sepharose FF column) and gel filtration chromatography (HiPrep 16/60 Sephacryl 243 [200]
S-200 HR column)
Ion exchange chromatography (Q Sepharose column) followed by gel filtration
Bacillus sphaericus - 4258 [131]
chromatography (Sephacryl S-300)
Ammonium sulfate precipitation (30–65%), hydrophobic interaction chromatography
Bacillus subtilis DC33 Subtilisin FS33 (Phenyl Sepharose 6 FF column), anion exchange chromatography (DEAE-Sepharose FF 15,495 [55]
column), and gel filtration (Sephadex G-50 column)
Bacillus natto NLSSE Nattokinase AOT (sodium di [2-ethylhexyl] sulfosuccinate)/isooctane reverse micelles system - [210]
Ammonium sulfate precipitation (40–70%), hydrophobic interaction chromatography
Bacillus subtilis TP-6 TPase, 1197 [56]
(octyl Sepharose) and ion exchange (SP Sepharose)
Ethanol precipitation, ion-exchange chromatography (DEAE Sephadex A-50 column), gel
Cordyceps militaris - filtration chromatography (Sephadex G-75 column), and FPLC (HiLoad 16/60 Superdex 633 [203]
75 column)
Ethanol precipitation, ion-exchange chromatography (CM-cellulose column), gel
Armillaria mellea AMMP 1098 [63]
filtration (Sephadex G-75 column)
Filtration, dialysis, gel filtration (Superdex 75HR column), ultrafiltration, reversed-phase
Fermented shrimp paste - 26 [114]
chromatography (Sephasil Protein C4)
Anion exchange chromatography (DEAE-Sephadex A-50 column), gel filtration
Bacillus subtilis BKII chromatography (Sephadex G-50 column, superdex 75 HR column), ammonium sulfate - [64]
precipitation (85%),
Ammonium sulfate precipitation (30–60%), ion-exchange chromatography
Bacillus amyloliquefaciens DC-4 subtilisin DFE 4664 [205]
(CM-Sepharose FF ion exchange column), dialysis, ion-exchange chromatography

(continued on next page)

1506 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

Table 3 (continued)

Source Enzyme Purification methods Specific Reference

activity
(U mg
−1
)

(DEAE-Sepharose FF ion exchange column), gel filtration (Sephadex G-50 column)

Ammonium sulfate precipitation, Polyethylene glycol concentration, ion-exchange
Bacillus sp.KDO-13 - 931 [125]
chromatography (DEAE cellulose column) gel filtration (Sephadex G 100)
Tricholoma saponaceum TSMEP 1 DEAE-cellulose column, FPLC (Mono S column), dialysis 43 [65]
Ammonium sulfate precipitation (40–80%), gel filtration chromatography (Sephacryl
Mutant of Bacillus subtilis IMR-NK1 Nattokinase 4400 [206]
S-100 HR), ion exchanger column chromatography (PBE 94 Polybuffer exchange column)
Ammonium sulfate precipitation (40 and 70%), dialysis, ion exchange chromatography
Codium divaricatum CDP (DEAE-Sephadex A-25 column, Mono Q column) FPLC, gel filtration (Superdex 6 [82]
200HR10/30 Column), ion exchange chromatography (Mono Q PC 1.6/5 column)
Ultrafiltration, ion-exchange chromatography (DEAE Sepharose CL-B6) and gel filtration
Bacillus sp. DJ-4 Subtilin DJ-4 - [207]
(Toyopearl HW-55F)
Ammonium sulfate precipitation (30–80%), dialysis, ion-exchange chromatography
Armillariella mella - 17 [208]
(DEAE-Sepharose), gel filtration (Sephadex G-150 column), FPLC (Mono Q column)
Dialysis, Acetone precipitation, CM-cellulose, gel filtration chromatography (Toyo-pearl
Bacillus sp. strain CK 11–4 CK 143 [113]
HW 55)
Ammonium sulfate precipitation (25%), hydrophobic interaction chromatography
Vegetable cheese natto Nattokinase (Butyl-Tyopearl column), ion-exchange chromatography (CM-Toyopearl column) and - [209]
gel filtration (Sephadex G-50 column)
Skipjack Shiokara, a Japanese traditional Dialysis, ion exchange column (DEAE cellulose column, DEAE-Toyopearl column), gel
katsuwokinase - [117]
salt-fermented food filtration chromatography (Cellulofine GCL-2000), HPLC (Mono Q column)
⁎ = mU μL−1, # = U mL−1, a = U g−1.

Specific activity was documented as the unit of measurement for the
purified enzyme. A detailed illustration on all the purification methods
used and their respective specific activities obtained for fibrinolytic en-
zymes in various studies has been illustrated in Table 3.
7. Biochemical characterization of fibrinolytic enzymes
7.1. Physiochemical properties of fibrinolytic enzymes
7.1.1. Molecular weight and effect of pH, temperature, inhibitors and ions
Table 4 presents a detailed overview of all the important physio-
chemical properties of fibrinolytic enzymes, including molecular mass
(kDa), pH, and temperature. In addition, some papers have focused on
the influence of charged ions, as well as some inhibitors, to decipher
the catalytic mechanism of new fibrinolytic enzymes. The molecular
weight of fibrinolytic enzymes varied significantly, though the variation
was not dependent on the source, from which the enzyme was isolated:
molecular weights of purified fibrinolytic enzymes spanned from as low
as 14 kDa to as high as 97 kDa [26,102,110]. However, the average mo-
lecular weight reported was from 27 to 29 kDa [28,87]. Most fibrinolytic
enzymes were highly active at neutral or near to alkaline pH, i.e. from 6
to 7 and 8 to 9 [29,30,107,111]. However, some studies have reported
exceptional optimal enzymatic activity at very acidic or basic conditions.
Crude enzymes from Bacillus tequilensis, CFR15-protease, from
B. amyloliquefaciens MCC2606 and CK protease at Bacillus sp. strain CK
11–4 showed optimal activity at pH 10.5 and KSK protease from Lacto-
bacillus plantarum KSK-II exhibited optimal pH 10 [18,67,112,113]. In
contrast, optimal enzyme activity has been noted at acidic pH: Staphylo-
coccus sp. strain AJ at pH 2.5 to 3 [91], and an enzyme purified from
fermented shrimp paste at pH 3 to 7 [114]. The average optimal temper-
ature ranged from 30 to 50 °C [93,106,112]. The highest and the lowest
optimal temperature recorded was 70 °C (CK protease from Bacillus sp.
strain CK 11–4) [113] and the lowest at 20 °C (S. venezuelae and FVP-I
protease from Flammulina velutipes) [62,115].
Fibrinolytic enzyme activity in the presence of charged ions and inhib-
itors is listed in Table 4. The activity mainly depended on the different
classes of fibrinolytic enzymes, i.e. serine protease, metalloprotease, and
serine metalloprotease. Ions play an important role in biological activity
by acting as co-factors. A wide range of monovalent and divalent ions,
e.g. as Na+, K+, Ag+, Fe3+, Zn2+, Mn2+, Ba2+, Ca2+, Cu2+, Mg2+, Mn2+,
Hg2+, Co2+, Ni2+, Cd2+, Sn2+, Ti2+, etc. have been used [28,58,112]. The
literature survey revealed no particular pattern of specificity towards
charged ions. However, Ca2+ and Mg2+ influenced the activity of most-
fibrinolytic enzymes, irrespective of source or class [59,68,116]. On the
other hand, inactivation by inhibitors was more specific with respect to
the enzyme classes, with some exceptions for a few enzymes. Serine pro-
tease inhibitors, e.g. PMSF, soybean trypsin inhibitor (SBTI), Tosyl-L-lysyl-
chloromethane hydrochloride (TLCK), Tosyl phenylalanyl chloromethyl
ketone (TPCK), pepstatin a, apoprotein, diisopropyl fluorophosphate
(DFP), β-mercaptoethanol, sodium dodecyl sulfate (SDS),
N-bromosuccinimide, N-ethyl-5-phenylisoxazolium-3′-sulfate (NBS),
Diethyl Pyrocarbonate (DEPC), diisopropyl Xuorophosphate,
phosphoramidon have been commonly used in many studies
[66,101,117–121]. PMSF was the most commonly used serine protease in-
hibitor; it is known to sulphonate the essential serine residue in the active
site of a protease, resulting in a total loss of enzyme activity [57,122]. FEs,
inhibited by EDTA and EGTA, the metal chelators, are characterized as
metalloproteases, and are activated in the presence of metal ions, but
strongly inhibited by metal chelating agents [53,123,124]. In addition to
metal chelators, a few metalloproteases have also been reported to be
inhibited by some metal and nonmetal ions, e.g. Zn2+, Ca2+, Cu2+,
Mg2+, Hg2+ and Al3+ [18,58,124,125]. The third fibrinolytic enzyme
group is the class of “serine metalloproteases”, which can be inhibited
by both serine protease inhibitors and metalloprotease inhibitors [19,87].
7.1.2. Fibrinogenolytic, fibrinolytic and plasminogen activation activity
The efficacy of fibrinolytic enzymes isolated from various sources
have been determined for: a) direct hydrolysis of fibrinogen and/or fi-
brin, and b) indirect hydrolysis by activating plasminogen into plasmin.
Generally, fibrinogen consists of three polypeptide chains, the Aα, Bβ,
and γ chains. Further, cleavage of fibrinopeptides A and B leads to the
generation of fibrin protofibrils consisting of α, β, and γ chains, which
subsequently polymerizes to form fibrin [126]. Hydrolysis of fibrinogen
can preferentially occur at three possible sites- Aα, Bβ, and γ chains, in-
dividually or simultaneously [87]. A similar hydrolysis mechanism of fi-
brin has been reported at the α, β, and γ chains [54].
Fibrinogenolytic activity was generally tested using the fibrin plate
assay wherein fibrinogen was incubated with purified fibrinolytic en-
zyme and observed for their cleavage patterns on SDS PAGE [91]. On
the other hand, fibrinolytic activity is assessed using the fibrinolytic
assay wherein purified fibrinolytic enzyme was mixed with a pre-
incubated reaction between human fibrin and human thrombin. Post
incubation, the aliquots of reactants were assessed for cleavage patterns
using SDS PAGE [120]. The plasminogen activity was determined by the
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1507

Table 4
Physiochemical properties of fibrinolytic enzymes.

Source Enzyme Mass pH Temp. Activator/co-factor (metal Inhibitor Class Reference

(kDa) Opt. Opt. ions)
(°C)

Jotgal Korean traditional

JP I 36 8.1 50 - Cu2+, EDTA Metalloprotease [98]
fermented food
Jotgal Korean traditional +2 +2 +2 2+ 3+
JP II 36 9.9 45 Ca , Mg , Mn Cu , Fe , EDTA Metalloprotease [98]
fermented food
Mn2+, Zn2+, and Cu2+
, DTT
Bacillus cereus RSA1 - 40 8 50 DFP Serine protease [132]
and β-mercaptoethanol
Fe3+, Zn2+, K+, Co2+, PMSF,
Bacillus velezensis BS2 - 27 8 37 Mg+2, Ca+2, Mn+2 Serine protease [28]
EDTA, SDS
Bacillus amyloliquefaciens Serine
- 29 7.6 41 - Fe3+, Fe2+, PMSF, EDTA, SBTI [87]
Jxnuwx-1 metalloprotease
Bacillus subtilis DC27 DFE27 29 7 45 - PMSF Serine protease [29]
Streptomyces radiopugnans
- 35 7 33 - - - [93]
VITSD8
Bacillus subtilis JS2 AprEJS2 27 8 40 K+, Mn2+, Mg2+, Zn2+ PMSF, EDTA, EGTA Serine protease [30]
K+, Na+, Mg2+, Mn2+, Cu2+, Zn2+, Fe3+,
Bacillus tequilensis - 27 10.5 45 Serine protease [112]
Ca 2+, and Ba2+ , PMSF, EDTA β-mercaptoethanol
Serratia marcescens subsp. 2+ 2+ + Serine
- 43 7 55 Mn , Mg , Zn2 PMSF, EDTA [66]
sakuensis metalloprotease
Bacillus amyloliquefaciens 2+ Serine
CFR15 32 10.5 45 Mn PMSF, EDTA [67]
MCC2606 metalloprotease
Serine
Chlorella vulgaris - 45 Fe2+ PMSF, EDTA [19]
metalloprotease
2+ 2+ + 2+ 2+
Bacillus amyloliquefaciens RSB34 AprE34 27 8 40 Mg , Zn , K , Mn Fe , PMSF Serine protease [57]
Na+, K+, Ba2+, Cu2+, Mn2+
Serratia sp. KG-2-1 - 52 8 40 Ca2+, Fe3+ Metalloprotease [58]
Hg2+
Xylaria curta Xylarinase 33 8 35 Ca2+ Fe2+, Zn2+ EDTA and EGTA Metalloprotease [53]
Cordyceps militaris - 28 7.2 37 Mn2+, Ca2+, Fe3+, Fe2+ SBTI, Cu2+, Zn2+, Co2+ Serine protease [180]
Pleurotus ferulae - 20 4,5,8 50 - EGTA, EDTA, Cu2+, Mg2+ Metalloprotease [106]
M. subtilissimus UCP 1262 - 97 - 37 Ca2+, Mn2+ Mg2+ PMSF, Cu2+, Cu2+, Co2+ Serine protease [26]
Bacillus cereus IND5 - 47 8 50 - [33]
Rhizopus microsporus var.
- 24.5 7 37 Na+, Ca2+, Mg2+, Mn2+ Zn2+ Cu2+ - [116]
tuberosus
Shewanella sp. IND20 - 55.5 8 50 Ca2+ and Mg2+ - - [110]
Cordyceps militaris - 32 7.4 37 Fe2+, PMSF, aprotinin, pep statin Serine protease [120]
Bacillus subtilis - 28 Serine protease [185]
serine
Bacillus subtilis HK176 AprE176 27 8 40 Ca2+ Cu2+, Mn2+, and Zn2+ [68]
metalloprotease
Bacillus subtilis ZA400 bsfA, 28.4 6 30–37 - Cu2+, Zn2+, SDS, EDTA - [107]
Bacillus cereus IND1 - 29.5 8 60 - - - [147]
Pleurotus ostreatus - 18 7.4 45 Ca2+, Mg2+, Zn2+ EDTA Metalloprotease [123]
Lactobacillus plantarum KSK-II KSK-II 43.6 10 50 Fe2+ EDTA Metalloprotease [18]
Bacillus natto NRRL-3666 - - 8 37 Cu2+, Mg2+, Zn2+ Mn2+, EDTA Serine protease [25]
Starase 48 8. 50 - PMSF and APMSF Serine protease [54]
42, 48 Mg2+, Zn2+, Co2+, Ca2+, Mn2+ Serine
Bacillus subtilis I-2 - 8 50 [121]
60 Cu2+, EGTA, EDTA, apoprotein metalloprotease
Bacillus pumilus 2.g - 20 7 >60 Mg2+, Ca2+ PMSF, SDS, EDTA Serine protease [88]
Bacillus sp. UFPEDA 485 - - 7–8.5 37 Ca2+, Mg2+, Fe2+, K+ EDTA Metalloprotease [59]
PMSF, EDTA, EGTA, K+, Mg2+, Serine
Bacillus amyloliquefaciens CB1 AprECB1 28 6 40 Ca2+ [128]
Mn2+, Zn2+, Cu2+ metalloprotease
Hericium erinaceum Herinase 51 7 30 Ca2+, Mg2+, Mn2+ Cu2+, Fe2+, Zn2+ EDTA, EGTA metalloprotease [190]
Streptomyces venezuelae AprECB1 - 7 20–60 - - - [115]
Bacillus subtilis ICTF-1 - 28 9 50 Ca2+ Zn2+, Fe3+, Hg2+ and PMSF. Serine protease [111]
Bacillus subtilis PTCC 1023 Subtilisin 38 - - Serine protease [31]
Bacillus subtilis 29.93 9 60 Ca2+ PMSF, NBS, DEPC, WRK Serine protease [192]
PMSF, Pep stain A, Mn2+, Zn2+,
Bacillus amyloliquefaciens MJ5–41 AprE5–4 27 7 45 Ca2+ Serine protease [101]
Co2+, Cu2+
Paecilomyces tenuipes PTEFP 14 5 35 Ca2+ PMSF, Zn2+ Serine protease [102]
Mushrokinase 2+ 2+
Schizophyllum commune 27 4–6 40 Zn EDTA, Hg Metalloprotease [124]
(MsK)
Pleurotus eryngii - 14 5 40 - PMSF Serine protease [194]
Fusarium sp. CPCC 480097 - 28 - - - - - [89]
B-12
Bacillus subtilis natto B-12 29 8 40 Zn2+ Fe3+ Al3+ Serine protease [156]
Nattokinase
Bacillus amyloliquefancies CH51 AprE51 27 6 45 K+ Ca2+ Mg2+ Co2+, Mn2+, Cu2+, PMSF Serine protease [195]
Di-isopropyl Xuorophosphate,
Staphylococcus sp. strain AJ AJ 26 2.5–3.0 85 - Serine protease [91]
Fe2+
2+ 2+ 3+ 2+ Serine
Pereniporia fraxinea. - 42 6 35–40 Mn Cu , Fe , Zn , EDTA [196]
metalloprotease
PMSF, EDTA, PCMB, Cu2+, Ca2+,
Bacillus sp. nov. SK006 - 43–46 7.2 30 Serine protease [129]
Fe3+, Hg2+
Cordyceps militaris CMase 27.3 6 25 Mg2+, Fe3+ EDTA, Cu2+ Metalloprotease [60]
Nereis (Neanthes) virens (Sars) N-V 29 7.8 45 DFP, PMSF, TLCK Serine protease [118]

(continued on next page)

1508 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

Table 4 (continued)

Source Enzyme Mass pH Temp. Activator/co-factor (metal Inhibitor Class Reference

(kDa) Opt. Opt. ions)
(°C)

PoFE PoFE 32 6.5 35 Ca2+, Mg2+, Zn2+ EDTA Metalloprotease [61]

Flammulina velutipes FVP-I 37 6 20–30 Mn2+Mg2+ Cu2+, Fe3+, EDTA, EGTA Metalloprotease [62]
PMSF, Cu2+, Mn2+, Ca2+, Mg2+,
Cordyceps sinensis CSP 31 7 40 Serine protease [130]
Ba2+, Cd2+, Co2+, Ni2+
Bacillus subtilis CH3–5 AprE2 29 - - - - - [199]
Jeotgal traditional Korean
bpKJ-31 37 9 40 - PMSF Serine protease [200]
fermented seafood
Bacillus sphaericus - 18.6 - - - - - [131]
PMSF, SBTI, Cu2+, Fe2+, Sn2+,
Bacillus subtilis DC33 Subtilisin FS33 30 8 55 Serine protease [55]
Ag+, Ti2+ Fe3+, Zn2+
Fomitella fraxinea FFP 1 32 10 40 Co2+, Zn2+ PMSF, aprotinin, Serine protease [202]
Fomitella fraxinea FFP 2 42 5 40 Cu2+, Ni2+, Hg2+ EDTA, 1,10-phenanthroline Metalloprotease [202]
Bacillus subtilis TP-6 TPase 27.5 7 50 Ca2+, Fe2+ PMSF, EDTA, β-mercaptoethanol Serine protease [56]
Cordyceps militaris - 52 7.4 37 Ca2+, Mg2+ PMSF, APMSF Cu2+, Co2+, Serine protease [203]
Armillaria mellea AMMP 21 6 33 Ca2+, Mg2+ Cu2+, Co2+, EDTA Metalloprotease [63]
Fermented shrimp paste - 18 3–7 30–40 EDTA, Cu2+ Metalloprotease [114]
Bacillus amyloliquefaciens DC-4 Subtilisin DFE 28 - - - PMSF Serine protease [204]
Bacillus subtilis BKII Co2+, Mg2+, Zn2+ EDTA, phosphoramidon Metalloprotease [64]
PMSF, Benzamidine
Bacillus amyloliquefaciens DC-4 subtilisin DFE 28 9 48 hydrochloride, Leupeptin, Pep Serine protease [205]
statin A
Al3+, Hg2+, EDTA,
Bacillus sp.KDO-13 - 44 8 50 Co2+, Ni2+ Metalloprotease [125]
O-phenanthroline
2+ 2+ 2+ 2+
Tricholoma saponaceum TSMEP 1 - 18.1 7.5–9 55 Mg , Fe , Zn , Co , EDTA, 1,10-phenanthroline, Hg2+ Metalloprotease [65]
Tricholoma saponaceum TSMEP 2 17.9 7.5–9 55 Mg2+, Fe2+, Zn2+, Co2+, EDTA, 1,10-phenanthroline, Hg2+ Metalloprotease [65]
Mutant of Bacillus subtilis
Nattokinase 31.5 7.8 55 - PMSF, NBS Serine protease [206]
IMR-NK1
Codium divaricatum CDP 31 9 - - DFP, PMSF, Serine protease [82]
Bacillus sp. DJ-4 Subtilin DJ-4 29 - - - PMSF, Cu2+, Zn2+, Serine protease [207]
Armillariella mella - 18.5 7 55 Mg2+, Zn2+, Co2+ EDTA, Hg2+ Metalloprotease [208]
Bacillus sp. strain CK 11–4 CK 28 10.5 70 - PMSF Serine protease [113]
Skipjack “Shiokara,” a Japanese Katsuwokinase
35 1–10 37 DFP, SBTI, BPTI, aprotinin [117]
traditional salt fermented food (KK)
Vegetable cheese natto Nattokinase, 28 6–12 30–40 - PMSF TPCK Serine protease [209]

(APMSF) p-Amidinophenyl) methanesulfonyl fluoride, (BPTI) Bovine pancreatic trypsin inhibitor, (DEPC) Diethyl pyrocarbonate, (DEPC) Diethyl pyrocarbonate, (DFP) Diisopropyl fluo-
rophosphate, (EDTA) Ethylenediaminetetraacetic acid, (EGTA) Ethylene glycol-bis (β-aminoethyl ether)-N, N, N′, N′-tetraacetic acid, (NBS) N-bromosuccinimide, N-ethyl-5-

zone of lysis for plasminogen rich and plasminogen free plates [127].
The presence of a lytic circle would indicate that the enzyme could act
indirectly by converting plasminogen to plasmin. An enzyme exhibited
strong fibrinolytic activity - in both plasminogen rich and plasminogen
free plates indicated that it possessed dual functions of either direct hy-
drolysis of fibrin clots or indirect hydrolysis by activation of plasmino-
gen, e.g. such as streptokinase, urokinase, and t-PA [53]. The activity of
various fibrinolytic enzymes reported in terms of fibrinogenolytic, fibri-
nolytic, and plasminogen activation is set out in Table 5. Most of the fi-
brinolytic enzymes exhibited strong Aα fibrinolytic activity, followed by
Bβ and γ chains fibrinolysis. However, fibrinolytic enzymes isolated
from B. subtilis JS2, B. amyloliquefaciens CB1 and Staphylococcus sp. strain
AJ exhibited no γ-chain lysis [30,128]. Bacillus sp. nov. SK006 was the
only microorganism that produced fibrinolytic enzyme with strong Bβ
fibrinolytic activity [129].
7.2. Amidolytic and kinetic properties of fibrinolytic enzyme
Amidolytic activity was assessed to understand enzyme cleavage
mechanisms. The amidolytic property of isolated fibrinolytic enzymes
was determined by using various synthetic chromogenic substrates
(shown in Table 1). Fibrinolytic enzyme specificity for substrates was
manifested in color development, was measured spectrophotometrically
at specific wavelengths. Some of the chromogenic substrates reported
are - N-succinyl-ala-ala-pro-phe-p-nitroanilide, MeO-Suc-Arg-Pro-Tyr-
pNA (substrate for serine proteases like subtilin and chymotrypsin), N-
Benzoyl-Phe-Val-Arg-pNA, H-D-Phe-Pip-Arg-pNA (substrate for trypsin
and thrombin), N-Benzoyl-Pro-Phe-Arg p-NA, N-(p-Tosyl)-Gly-Pro-Lys-
pNA D-Val-Leu-Lys-pNA (substrate for plasmin) [28,87], D-Val-leu-Arg-
pNA (substrate for kallikrein), and pyro-Glu-Gly-Arg- pNA (substrate for
urokinase) [29,64,68,82,128]. The majority of the characterized enzyme
manifested a substrate specificity towards N-succinyl-ala-ala-pro-phe-p-
nitroanilide, categorizing them as serine proteases as they were bestowed
with substrate specificity towards the serine proteases - subtilin and chy-
motrypsin [28,30,87] However, protease DFE27 isolated from B. subtilis
DC27 exhibited a unique substrate specificity towards D-Val-Leu-Lys-
pNA, showing that DFE27 can function as a tPA, as this substrate is specific
for plasmin [29]. In addition, FE the specificity was also tested against nat-
ural substrates, e.g. like fibrin, casein, gelatin, hemoglobin, keratin, bovine
serum albumin, globulin, fibrinogen, fibrin, collagen, azoalbumin and
morpholinopropane sulphonic acid [18,66,98,130–132]. Fibrin was con-
sidered as a reference standard with 100% activity.
Fibrinolytic enzyme kinetics were measured in various reaction con-
ditions, using both synthetic and natural substrates. The assay was con-
ducted by mixing purified enzyme with standard quantities of substates
in a suitable buffer and incubated at the optimal temperature for the en-
zyme [53,68]. The kinetic constants, Km, and Vmax, were determined at
different substrate concentrations, using the Lineweaver and Burk
method [133]. Generally, Vmax value were converted to Kcat, using the
formula: Kcat = Vmax /[enzyme]. Table 6 lists the kinetics of several iso-
lated fibrinolytic enzymes.
8. Production of fibrinolytic enzymes
8.1. Biotechnological approaches
Large scale production of microbial fibrinolytic enzymes has always
been of great significance, especially for therapeutic applications.
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1509

Table 5
Fibrinolytic, fibrinogenolytic and plasminogen activation activity of various proteases.

Source Enzyme Reference Mode of References

action

Bacillus velezensis BS2 AprEBS2 Strong α-fibrinogenase, moderate β-fibrinogenase, and mild some γ-fibrinogenase activity Direct [28]
Bacillus
Both fibrinogen and fibrinolytic activity with the highest degrading activity towards the Aα-chains, followed by Direct and
amyloliquefaciens - [87]
Bβ chains and γ chains. indirect
Jxnuwx-1
Bacillus subtilis JS2 AprEJS2 Strong α-fibrinogenase degradation followed by moderate β-fibrinogenase but no γ-fibrinogenase activity Direct [30]
Bacillus
amyloliquefaciens CFR15 Strong β-fibrinogenase activity Direct [67]
MCC2606
Bacillus
amyloliquefaciens AprE34 Strong α-fibrinogenase degradation followed by moderate β-fibrinogenase but no γ-fibrinogenase activity Direct [57]
RSB34
Direct and
Xylaria curta Xylarinase Cleavage of Aα and Bβ chains of fibrin(ogen) and has no effect on γ chain [53]
indirect
Direct and
Cordyceps militaris - Strong α-fibrinogenase degradation followed by β and γ chains [180]
indirect
Direct and
Pleurotus ferulae - Complete Aα and Bβ fibrinogenolytic action followed by partial γ chain hydrolysis [106]
indirect
Direct and
Cordyceps militaris - α-chains more efficiently than β- and γ-chains [120]
indirect
Bacillus subtilis ZA400 BsfA Higher activity to break down the γ-bond and γ- γ bond in the fibrin Direct [107]
Direct and
Pleurotus ostreatus - Cleaving the α and β chains of fibrinogen followed by the γ chains [123]
indirect
Direct and
Asterina pectinifera Starase Strong cleavage of all the three chains (α, β, γ) of fibrinogen [54]
indirect
Bacillus
amyloliquefaciens AprECB1 Strong Aα and Bβ fibrinolytic ability but no effect on γ-chain Direct [128]
CB1
Strong α fibrinogenase activity followed by slower γ-chain fibrinogenase activity but no activity on the β chains Direct and
Hericium erinaceum Herinase [190]
of fibrin and fibrinogen indirect
Bacillus
amyloliquefaciens AprE5–41 Degraded Aα and Bβ chains but not the γ-chain of fibrinogen Direct [101]
MJ5–41
Paecilomyces tenuipes PTEFP Rapid Aα fibrinogenase activity but no Bβ or γ chain fibrinogenase activity Direct [102]
Pleurotus eryngii - Hydrolysis of Aα chain fibrinogenolytic activity followed by Bβ chain Direct [194]
Staphylococcus sp.
AJ Strong Aα fibrinogenolytic ability but no effect on Bβ and γ-chain Direct [91]
strain AJ
Perenniporia fraxinea - Strong α-fibrinogenase degradation followed by β and γ chains Direct [196]
Bacillus sp. nov. Direct and
- Strong Bβ fibrinolytic ability followed by weak γ-chain cleavage but no Aα fibrinolytic ability [129]
SK006 indirect
Nereis (Neanthes) Hydrolysis of Aa-chain of fibrinogen with high efficiency, and the Bb- and g-chains (Aa > Bb > g) with a lower
N-V Direct [118]
virens (Sars) efficiency
Pleurotus ostreatus PoFE Preferential digestion of Aα chain over Bβ and γ-chain Direct [61]
Flammulina velutipes FVP-I Strong Aα and Bβ fibrinolytic ability but mild γ-chain lysis Direct [62]
Cordyceps sinensis CSP Aα chain of fibrinogen and the α-chain of fibrin Direct [130]
Bacillus licheniformis
bpKJ-31 Strong Aα and fibrin (ogen) lytic activity Direct [200]
KJ-31
Subtilisin Direct and
Bacillus subtilis DC33 Strong Aα and Bβ fibrinogen lytic activity [55]
FS33 indirect
FFP 1, FFP
Fomitella fraxinea Preferential digestion of Aα and Bβ chains over γ chains Direct [202]
2
Direct and
Bacillus subtilis TP-6 TPase Strong Aα and Bβ fibrinogenolytic activity [56]
indirect
Rapidly hydrolyzed the fibrin α-chain, followed by the γ-γ chains. It also hydrolyzed the β-chain, but more
Cordyceps militaris - Direct [203]
slowly Aα, bβ, and γ chains of fibrinogen were also cleaved very rapidly
Armillaria mellea AMMP Strong Aα chain fibrinogenolytic activity followed by Bβ and γ chains Direct [63]
Tricholoma
TSMEP I Equal digestion of Aα and Bβ chains of fibrinogen but no γ chains hydrolysis Direct [65]
saponaceum
Codium divaricatum CDP Strong Aα chain fibrinogenolytic activity but weak Bβ, and γ chains fibrinogenolytic activity Direct [82]
Armillariella mella - Equal Aα, Bβ chain fibrinogenolysis Direct [208]

Bacterial and fungal enzymes are most commonly produced in an in-
dustrial scale, through recombinant technology [134]. Biotechnological
approaches have played a significant role in enhanced production by
overexpression of novel enzymes for economic viability and sustainabil-
ity. In addition, modern molecular techniques also provided a wide
range of opportunities for discovering new microbial enzymes as well
as improving their catalytic properties [135]. The application of biotech-
nological tools has been primarily focused on: a) higher production
yields and b) strain improvement for fibrinolytic activity in the starter
culture.
Subtilisins are high commercial value enzymes, making them excel-
lent models to study the physicochemical, pharmacological and clinical
properties of these proteins, and they have been used as models in pro-
tein engineering and studies of protein folding machinery, mediated by
chaperones [136,137]. Such studies require large quantities of the pro-
tein, which can be achieved by cloning, overexpression, and purification
in order to rely on an indefinite recombinant source for further analysis
[28,31]. Though fibrinolytic enzymes possess a wide range of applica-
tions, the ones targetting medical applications, e.g. the treatment of
thrombosis and CVDs requires improved activity and stability. An
1510 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517

Table 6
Kinetic properties of fibrinolytic enzymes.

Source Enzyme Substrate specificity Vmax Km Kcat Kcat/Km Reference

Jotgal Korean traditional

JP I Fibrin 176.57 U mL−1 0.43 mM - - [98]
fermented food
Jotgal Korean traditional
JP I Fibrin 149.73 μM min −1 0.69 mM - - [98]
fermented food
Bacillus cereus RSA1 - Fibrin 52.39 μg mL−1 min−1 1.093 mg mL−1 - - [132]
Bacillus velezensis BS2 AprEBS2 N-Succ-Ala-Ala-Pro-Phe-pNA 39.68 μM min−1 0.15 mM 18.14 s−1 1.25 × 105 s−1 M−1 [28]
Bacillus amyloliquefaciens
- N-Succ-Ala-Ala-Pro-Phe-pNA 6 μM−1 min−1 L−1 0.36 mM - - [87]
Jxnuwx-1
Bacillus subtilis DC27 DFE27 D-Val-Leu-Lys-pNA - - - - [29]
Bacillus subtilis JS2 AprEJS2 N-Succ-Ala-Ala-Pro-Phe-pNA 16.71 μM L−1 min−1 0.09 mM 7.66 s−1 8.51 × 104 s−1 M−1 [30]
Serratia marcescens subsp.
- fibrin 158.73 U mL−1 0.66 mg mL−1 12.21 min−1 18.32 mL mg−1 min−1 [66]
sakuensis
Bacillus amyloliquefaciens 5.68 × 104
AprE34 N-Succ-Ala-Ala-Pro-Phe-pNA 16.551 μM min−1 0.131 mM 7.44 s−1 [57]
RSB34 s−1 M−1
Xylaria curta Xylarinase azocasein 0.13 μM min−1 0.326 mM - - [53]
Pleurotus ferulae - pyro-Glu-Arg-pNA - - - - [106]
Bacillus subtilis HK176 AprE176 N-Succ-Ala-Ala-Pro-Phe-pNA - 453 mM 122.8 s−1 281.7 s mM−1 [68]
Bacillus subtilis HK176 M179 N-Succ-Ala-Ala-Pro-Phe-pNA - 537 mM 151 s−1 283 s mM−1 [68]
Lactobacillus plantarum
KSK-II N-Succ-Ala-Ala-Pro-Phe-pNA 6.4 μM mg−1 min−1 0.4 mM 28 s−1 - [18]
KSK-II
−1
Bacillus natto NRRL-3666 - N-Succ-Ala-Ala-Pro-Phe-pNA 1250 nM min 3.5 mM - - [25]
Asterina pectinifera Starase H-D-Val-Leu-Lys-pNA 6.8 mM min−1 mg−1 1.37 mM - - [54]
Bacillus subtilis I-2 - - - - - - [121]
Bacillus pumilus 2.g - N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [88]
B.amyloliquefaciens CB1 AprECB1 N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [128]
Hericium erinaceum Herinase H-D-Ile-Pro- Arg-PNA 26.7 U mL−1 4.7 mg mL−1 - - [190]
Bacillus subtilis LD-8547 DFE N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [191]
Bacillus subtilis ICTF-1 - N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [111]
Bacillus subtilis PTCC 1023 Subtilisin H-D-Val-Leu-Lys-pNA - - - - [31]
Bacillus subtilis - N-Succ-Ala-Ala-Pro-Phe-pNA 79.4 μM min−1 0.59 mM - - [192]
B. amyloliquefaciens
AprE5–41 N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [101]
MJ5–41
Mushrokinase (MsK)
MsK H-D-Val-Leu-Lys-pNA - - - - [124]
Schizophyllum commune
Pleurotus eryngii - tosyl-Gly-Pro-Lys-p-nitroanilide 53.5 U mL−1 0.18 mM - - [194]
Staphylococcus sp. strain AJ AJ - - 0.38 mM 19.73 s−1 - [91]
MeO-Suc-Arg-
Perenniporia fraxinea - - - - - [196]
Pro-Tyr-pNA.HCl
6.4 ×
Bacillus sp. nov. K006 - N-Succ-Ala-Ala-Pro-Phe-pNA - 0.45 mM 5.2 × 104 s M−1 [129]
104 s−1 M−1
Flammulina velutipes FVP-I MeO-Suc-Arg-Pro-Tyr-pNA.HCl - - - - [62]
MeO-Suc-Arg-
Pleurotus ostreatus PoFE - - - - [61]
Pro-Tyr-pNA.HCl
Cordyceps sinensis CSP Casein - - - - [130]
Bacillus licheniformis KJ-31 bpKJ-31 N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [200]
Bacillus subtilis DC33 Subtilisin FS33 N-Succ-Ala-Ala-Pro-Phe-pNA - 0.21 mM 37.04 s−1 1.76 × 105 s mM−1 [55]
Bacillus subtilis DC33 Subtilisin FS33 V7127 (D-Val-Leu-Lys-pNA) - 7.41 mM 1.4 s−1 1.89 × 104 s M−1 [55]
Bacillus subtilis DC33 Subtilisin FS33 P7021 (D-Phe-Pip-Arg-pNA) - 47.7 mM 0.12 s−1 2.52 s mM−1 [55]
Fomitella fraxinea FFP 1 N-Succ-Ala-Ala-Pro-Phe-pNA 39.68 U mL−1 0.213 mM - - [202]
Bacillus subtilis TP-6 TPase, N-Succ-Ala-Ala-Pro-Phe-pNA 145 μM mg−1 min−1 0.259 mM 25.71 s−1 9.9 × 104 s M−1 [56]
Cordyceps militaris - MeO-Suc-Arg-Pro-Tyr-pNA - - - - [203]
Armillaria mellea AMMP MeO-Suc-Arg-Pro-Tyr-pNA - - - - [63]
Fermented shrimp paste - Fibrinogen - - - - [114]
Bacillus subtilis BKII H-D-Phe-Pip-Arg-pNA - - - - [64]
Bacillus amyloliquefaciens
subtilisin DFE N-Succ-Ala-Ala-Pro-Phe-pNA - - - - [205]
DC-4
Bacillus sp.KDO-13 - Fibrin 249 U mL‐−1 3.2 mg mL−1 - - [125]
Tricholoma saponaceum TSMEP 1 Lys-pNA, D-Phe-Pip-Arg-pNA - - - [65]
Mutant of Bacillus subtilis
Nattokinase N-Succ-Ala-Ala-Pro-Phe-pNA - 0.34 mM 21.08 s−1 6.2 × 104 s M−1 [206]
IMR-NK1
Armillariella mella - H-D-Phe-Pip-Arg-pNA - - - - [208]
Bacillus sp. strain CK 11–4 CK H-D-Val-Leu-Lys-pNA - - - - [113]
Katsuwokinase
Katsuwokinase (KK) pyro-Giu-Gly-Arg-pNA [117]
(KK)
Vegetable cheese natto Nattokinase N-Succ-Ala-Ala-Pro-Phe-pNA - - 17.85 s−1 0.48 × 102 s mM−1 [209]

error-prone PCR was conducted on the aprE176 to construct mutants,
with improved fibrinolytic activities [68]. Meng, Dai, Xu, Zhao, Liang,
Wang, Tang and Tang [138] studied the mechanistic action of proteins
expressed as a result of bacillopeptidase F gene cloning. They particu-
larly deciphered the proteins catalytic mechanisms and the activity of
the C terminal end in maintaining the enzyme activity. Nattokinase is
also a widely studied fibrinolytic enzyme, in terms of biotechnological
approach. Nattokinase has an advantage of minimal side effects when
administered orally in clinical practices [139–141]. Therefore, sustain-
able approaches like cloning, overexpression, and/or mutations using
the E. coli expression system have been exploited for nattokinase pro-
duction [107,142,143].
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1511

One of the challenges faced during traditional fermented food prep-
aration is: time consumption, high salinity leading to slow fermentation
and, finally, quality control. Therefore biotechnological approaches have
been exploited to construct engineered strains with improved fibrino-
lytic activity to be used as starter cultures for fermented foods
[28,101,128]. Strain have been improved through mutagenesis and ran-
dom screening of the mutants. Random mutagenesis is conducted to in-
duce mutations in selected strains by UV, ethidium bromide, and ethyl
methyl sulfonate. Naveena, Gopinath, Sakthiselvan and Partha [115] im-
proved S. venezuelae strains by inducing mutations through UV,
ethidium bromide and ethyl methyl sulfonate. The mutants were se-
lected based on the highest thrombinase activity with enhanced
halotolerant and thermotolerant properties compared to their wild
counterparts. The mutant forms also showed higher specific growth
rates and higher tolerance to initial lactose concentrations.
A combination of biotechnological approaches, along with culture
media optimization, also has also been successfully used for enhanced
fibrinolytic enzyme yields [34,57]. A detailed representation of signifi-
cant parameters used for cloning and expression systems are listed in
Table 7.

Table 7
Cloning and expression parameters used for fibrinolytic enzymes production.

Bacterial strain Gene Primer Cloning Host Cloning Expression Expression References
vector host vector

F (5´-AATAACGCGGATCCTTTGCTGTCCCTTCCGTCGCCAC -3´
BamHI site underlined) E. coli JM109 pET-28a
Cordyceps militaris CmFE GS115 pPIC9K [100]
R (5′- TATACCGCTCGAGCAGGCCAGTCGTGCTCTTGAT and BL21 (+)
GAAG-3´ XhoI site underlined)
CH51-F (5′- AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
BamHI site underlined) B. subtilis E. coli BL21
Bacillus velezensis BS2 aprEBS2 pHY300PLK pETBS2 [28]
CH51-R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, WB600 (DE3)
EcoRI site underlined)
CH51-F (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
BamHI site underlined) and B. subtilis E. coli BL21
Bacillus subtilis JS2 aprEJS2 pHY300PLK pHYJS2 [30]
CH51-R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, WB600 (DE3)
EcoRI site underlined)
CH51-F (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
Bacillus amyloliquefaciens BamHI site underlined) E. coli BL21 pET26b
aprE34 E. coli DH5α pGEM-T [57]
RSB34 CH51-R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, (DE3) (+)
EcoRI site underlined)
51F (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
M179 mutants of Bacillus BamHI site underlined) E. coli BL21 pET26b
aprE176 E. coli DH5α pHY300PLK [68]
subtilis HK176 51R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, (DE3) (+)
EcoRI site underlined)
ZA400-F (5′- GGATCCGATGAGAAGCAAAAAATTGTGGAT-3′,
BamHI site underlined) pGEM-T E. coli BL21 pET26b
Bacillus subtilis ZA400 bsfA E. coli DH5α [107]
ZA400-R (5’-CTCGAGTTGTGCAGCTGCTTGTACG-3′, XhoI site Easy (DE3) pLysS (+)
underlined)
CH51-F (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
Bacillus amyloliquefaciens BamHI site underlined) B. subtilis
aprECB1 E. coli DH5 α pHY300PLK pHY300PLK [128]
CB1 CH51-R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, WB600
EcoRI site underlined)
F (5’-CCGCTCGAGATGAGAAGCAAAAAATTGTGG-3′, XhoI site
Subtilin underlined) E. coli BL21 E. coli
Bacillus subtilis PTCC 1023 pET-15b pET-15b [31]
gene R (5’-CGCGGATCCTTATTGTGCAGCTGCTTGTAC-3′) BamHI (DE3) BL21 (DE3)
site underlined)
Bacillus amyloliquefaciens aprF (5’-CCGTGAGAGGCAAAAAGGTATGGATCA-3′)
- E. coli DH5α pUC19 - - [193]
LSSE-62 aprR (5’-ATTTACTGAGCTGCCGCCTGTACGTTG-3′)
51F, (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
Bacillus amyloliquefaciens BamHI site underlined) B. subtilis
aprE5–41 E. coli DH5α pHY300PLK pHY300PLK [101]
MJ5–41 51R, (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, WB600
EcoRI site underlined)
CH51-F (5’-AGGATCCCAAGAGAGCGATTGCGGCTGTGTAC-3′,
Bacillus amyloliquefancies BamHI site underlined) pGEM-T B. subtilis
aprE51 E. coli DH5α pHY300PLK [195]
CH51 CH51-R (5’-AGAATTCTTCAGAGGGAGCCACCCGTCGATCA-3′, Easy WB600
EcoRI site underlined)
F-(5’-GGAATTCCATATGGTAATATTACCTAATAATAATAGA
Staphylococcus sp. strain C-3′, NdeI site underlined) pGEM-T
AJ - - - [91]
AJ R-(5′- CCGCTCGAGTTACTGAATATTTATATCAGGTATA-3′, Easy
XhoI site underlined)
FP- (5’-GGCGACTTTCCCTTCATCGTGAGCAT-3′) RP-(5’-TCAC pT7 Blue
Fusarium sp. BLB FP - - - [198]
CCTGGCAAGAGTCCTTGCCACC-3′) T-vector
FP-(5’-GCGAATTCGCCGCATCTGTGTCTTTG-3′, EcoRI site
underlined) B. subtilis
pGEM-T
Bacillus subtilis CH-3 aprE2 RP-(5′- E. coli DH5α ISW1214 and pHY300PLK [199]
Easy
GCGAATTCGAGAACAGAGAAGCCGCT-3’ EcoRI site WB600
underlined)
F-[5′-GTGAGA(A/G)GCAAAAA(A/G)(G/T)T(A/G)TGGATC
pGEM-T
Bacillus subtilis TP-6 TPase AG-3′] E. coli DH5a E. coli M15 pQE30 [56]
Easy
5′-[A(A/T)TGTGC(A/T)GCTGCTTGTACGTTGA T(C/T)]
Bacillus amyloliquefaciens P1, 5’-TCACAGCTTTTCTCGGTC-3’ B. subtilis
DFE E. coli JM109 pGEM-T pSUGV4 [204]
DC-4 P2, 5’-TGATCCGATTACGAATGC-3′ WB600
Primer 1: 5’-GCGCAGTCCGTGCCTTAC-3′,
Bacillus amyloliquefaciens
DFE Primer 2: 5’-TTACTGAGCTGCCGCCTGT- E. coli JM109 pGEM-T - - [205]
DC-4
AC-3′
1512 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517
8.2. Fermentation approach
One of the major hindrances for the commercial application of mi-
crobial enzymes is its high production cost. As discussed earlier, bio-
technological approaches successfully cope up with this. Also,
fermentation approaches for example: a) selection of ideal strains,
b) alternative sustainable and economical sources for fermentation
media and c) optimization of fermentation conditions - nutrition (car-
bon, nitrogen and metal ion source), temperature, pH, time, etc. - have
also been studied for their role in reducing production costs.
The significant variables for optimal fibrinolytic enzyme production
by fermentation are discussed below:
8.2.1. Optimization of temperature
Microorganisms have diverse physiological and nutritional needs.
Therefore, optimization of the nutritional and physical conditions is
mandatory for production of fibrinolytic enzymes by fermentation.
Temperature is one of the important variables. The most strains used
for fermentation have an optimum temperature from 30 to 40 °C
[34,86,144]. However, a few thermophilic bacteria exhibit higher opti-
mal temperatures, for example, B. tequilensis ZMS-2 at 60 °C [145],
S. megasporus SD5 MCMB-379 at 55 °C [146], B. cereus IND1 at 60 °C
[147], and Shewanella sp. IND20 at 50 °C [110].
8.2.2. pH
An optimal medium pH helps in maintaining homeostasis of electric
charges in the membranes and proteins in the medium, by regulating
the proton pumps and transporting nutrients across the membrane
[144]. A decrease in enzyme yield has been attributed to improper
structure formation, cleavage of disulfide bonds, protein aggregation,
deamination, etc. as a result of improper homeostasis [148]. The optimal
pH of most enzymes studied for fermentation ranged from neutral to
slightly alkaline. pH played a significant role in several isolated fibrino-
lytic enzymes, for example, Khursade, Galande, Shiva Krishna and
Prakasham [144] and Taneja, Bajaj, Kumar and Dilbaghi [58] reported
a maximal fibrinolytic enzyme activity at 901 U mL−1 and
250.41 U mL−1 respectively at pH 8 and a sharp decrease on either
side of this point. However, Khan, Shafique, Nawaz, Jabeen and Naz
[145] reported maximal enzyme activity (506 U mL−1) of fibrinolytic
enzyme ZMS-2 at pH 8 and a minimal decrease yield at higher pH.
This quality is particularly favored due to its stability in the industrial
setup.
8.2.3. Substrate selection
Several agro-industrial residues and wastes have been used for fer-
mentation to generate an an eco-friendly and sustainable approach for
fibrinolytic enzyme production. These residues claim to be cost-
effective and reduce environmental pollution through waste use, as
they are rich sources of nitrogen and carbon. Agro-industrial wastes, in-
cluding corn steep powder, cow dung, cuttlefish waste, soybean meal,
wheat bran, banana peel, tapioca peel, rice bran, green gram husk, soy-
bean residue, monosodium glutamate waste liquor, soybean flour, soy-
bean hydrolysate, soybean grits and chickpeas, have been used as
substrates [20,33,35,36,39,59,147,149–152].
8.2.4. Nutrients
Nutrients required for fermentation include nitrogen, carbon sub-
strates and minerals [20,34,39]. Fermentative microorganisms prefer
to breakdown complex nitrogen sources, rather than simple inorganic
nitrogen sources. s is possible, since bacteria are equipped with prote-
ases that can break down complex nitrogen sources [39]. On the other
hand, these microorganisms cannot break down complex carbon
sources, due to weak proteases for carbon metabolism. However, nutri-
ents (primarily carbon) or substrates, at concentrations above optimal,
repress enzyme production [153]. This is attributed to carbon catabolite
repression (CCR) in high carbon concentrations.
As noted in Section 4, fibrinolytic enzymes, in the metalloproteases
class, require metal ions as cofactors for growth and metabolism. On
the other hand, other fermentation microorganism growth ceases in
the presence of specific metal ions in the medium. The inhibitory effect
of metal ions is attributed to attachment at the enzyme sulfhydryl
groups, cleavage of disulfide bonds or replacement of an initially pres-
ent metal ion, hence rendering them inactive [28,112].
8.2.5. Rpm and other factors
Fibrinolytic enzyme producing bacteria grown in agitated conditions
show increased enzyme production, due to the homogenous distribu-
tion of nutrients and oxygen [146]. However, very high agitation rates
(>150 rpm) decreased the fibrinolytic enzyme yield from S. commune
BL23 [154]. In contrast, an immobilized starter culture increased yield,
compared to free cells, as microbial immobilization protects the cultures
from harsh external conditions [155]. Very low or very high volumes
and media age were also found to decrease yields, due to either insuffi-
cient availability or dilution of nutrients. Wang, Du, Zheng, Kong, Zu and
Feng [156] reported maximal fibrinolytic enzyme activity with 100 mL
medium for nattokinase production from Pseudomonas sp. TKU015
than 50, 150, or 200 mL of media.
8.2.6. Statistical optimization of media
Optimizing the standard media composition is necessary for maxi-
mizing production yields and economic viability. Traditionally media
optimization has been conducted by changing one variable (time, tem-
perature, media concentration, pH, inoculum level, etc.) at a time while
keeping all the others constant. Traditional methods are not only time
consuming due to large number of experiments but can also lead to in-
correct results. Such limitations can be reduced by applying a statistical
approach, e.g. response surface methodology, Taguchi orthogonal array
design or fractional factorial design. Statistical methods confer reliabil-
ity, help in determining an optimum nutrient composition, understand-
ing the interaction between parameters, hence saving time and energy.
Table 8 lists recent publications, on several bacterial strains, in which a
statistical approach was used for media optimization and the resulting
improved fibrinolytic enzyme activity.
9. Applications
9.1. Clinical
Formation of thrombus is the leading cause for CVDs, and fibrin is
the main component of thrombus, which can be degraded by plasmin-
ogen activators. The high cost of plasminogen activators like urokinase
has prompted researchers to search for economical, sustainable, and
safer sources of fibrinolytic enzymes. Fibrinolytic enzymes isolated
from food-grade microorganisms serve as a better alternative to plas-
minogen activators. Some of the fibrinolytic enzymes tested for their
potential in thrombolytic therapy, and other health-promoting proper-
ties have been mentioned below:
9.1.1. Streptokinase
Several studies have been conducted on the fibrinolytic potential of
streptokinase [70,115,157]. However, this enzyme was found to exhibit
in vivo immunogenic activity, which was speculated to be solved by de-
veloping recombinant forms with diminished immunogenic potential
[158]. In this regard, another independent study showed that mutants
with deleted C terminal end (42 amino acids) exhibited decreased im-
munogenic activity, which proved its potential as a promising thrombo-
lytic agent [157].
9.1.2. Staphylokinase
Staphylokinase, a fibrinolytic enzyme produced form staphylococci
was expected to possess promising potential as a thrombolytic agent.
However, due to its short half-life in plasma and production of high
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517 1513

Table 8
Statistical methods used for optimal production of fibrinolytic enzymes through fermentation.

Bacterial strains used Statistical methods used Enzyme activity (UmL−1) Reference

Serratia rubidaea KUAS001 OFAT 394.9 [179]

Bacillus cereus RSA1 Plackett–Burman design, RSM, CCD 30.75 [132]
Bacillus subtilis WR350 L9 (34) orthogonal design, an orthogonal array of four factors with three levels 5865 [39]
Xanthomonas oryzae IND3 RSM, CCD 2296* [20]
Bacillus subtilis D21–8 RSM 3129 [34]
Stenotrophomonas maltophilia Gd2 OFAT 1795 [144]
Stenotrophomonas maltophilia Gd2 Plackett-Burman media designing 3411 [144]
Streptococcus agalactiae EBL-31 RSM, CCRD 147.08 [38]
Bacillus sp. IND12 RSM 4143* [149]
Serratia sp. KG-2-1 RSM, CCD 250.41 [58]
Xylaria curta OVAT 9.22 [53]
Bacillus cereus IND5 OVAT and RSM, CCD 364.5* [33]
Serratia marcescens RSPB11 Plackett -Burman design and RSM, CCD 23,910 [37]
Shewanella sp. IND20 OFAT, e 25 factorial design, RSM, CCD 2751 [110]
Bacillus cereus IND1 Two-level full-factorial design, RSM, CCD 3699 [147]
Pseudoalteromonas sp. IND11 Two-level full-factorial design, RSM, CCD 1573 [150]
Paenibacillus sp. IND8 25 full factorial design (first-order model), CCD 4418 [186]
strain XY-1 Plackett-Burman and RSM, BBD 21.33 [189]
Bacillus sp. UFPEDA 485 23 experimental design 835 [59]
Bacillus subtilis RSM, CCRD 3194.25 [197]
Bacillus subtilis DC-2 RSM, CCRD 1165.58 [24]
Bacillus subtilis Plackett-Burman and RSM, BBD 77,400 [152]

BBD: Box-Behnken design, CCD: Central composite design, CCRD: Central composite rotatable design, OFAT: One factor at a time, OVAT: one variable at a time approach, RSM: Response
surface methodology.
* Ug−1.

levels of anti-staphylokinase antibodies like IgG, this enzyme couldn't
get approved past clinical trials [159].
9.1.3. Nattokinase
Currently, Nattokinase is one of the many fibrinolytic enzymes
which is considered to be a safe, effective, economical for the treatment
of CVDs [160–162]. Both animal [119,163,164] and human
[139,141,165] trials have proved that nattokinase could effectively dis-
solve blood clots by acting as a blood thinner. This enzyme was found
to be more efficient than plasmin and elastase [119]. Nattokinase has
been reported to exhibit a protective effect on both arterial thrombosis
mediated by oxidative injury and venal thrombosis induced by inflam-
mation [166]. Both nattokinase and lumbrokinase were reported to pos-
sess gastrointestinal stability and can be absorbed in the distal ends of
the gastrointestinal tract [167]. Nattokinase is commercially available
in countries like Japan, Korea, Canada, Europe, and the United States
as a food supplement [168]. Apart from thrombolytic effects,
nattokinase has also proven to exhibit protective effect against hyper-
tension, Alzheimer's disease and atherosclerosis [163,169–173]. Com-
prehensive safety data, acquired form Good Laboratory Practice (GLP)
compliant studies reported in 2016, proved that neither clastogenic
nor mutagenic activity was observed after nattokinase treatment
[141]. The recommended daily dosage for nattokinase consumption is
two capsules (100 mg of nattokinase/capsule) [168].
9.1.4. Serrapeptase
Serrapeptase isolated form bacterium Serratia sp. E-15 found on
Bombyx mori was reported to exhibit potent anti-inflammatory effects
apart from fibrinolytic effects [18,169,174]. In another independent
study, researchers found that Serrapeptidase, along with other anti-
inflammatory drugs, could potentially reduce the swelling of the pros-
tate glands in patients suffering from amicrobial prostato-vesiculitis (a
non-infectious prostate inflammation) [175].
9.1.5. Surfactants and antimicrobial properties
Fibrinolytic enzymes like KSK-II from L. plantarum was reported
to exhibited unspecific hydrolysis, which is a major disadvantage to
be used in clinical therapy. However, this enzyme exhibited
excellent stability and compatibility with detergents such as Persil,
X-tra®, and Ariel®, which proved their potency as a bloodstain re-
mover from cotton fabrics [18]. Another unique characteristic of
KSK-II is its ability to inhibit pathogens like S. aureus, B. cereus, P.
aeruginosa, P. vulgaris, E. coli, and soil-borne fungus like Rhizoctonia
solani [176,177]. Therefore, these properties of KSK-II can be applied
in the clinical and food sectors.
10. Conclusion
Fibrinolytic enzymes have been isolated and characterized from di-
verse sources from food and non-food. Microbial origin fibrinolytic en-
zymes especially from traditionally fermented foods such as Jotgal,
Gonjaengijot, Natto, Douche, Tempeh, Doen-Jang, etc. were found to be
more potent when compared to that of non-food sources. Microbial or-
igin fibrinolytic enzymes have gained significant interest in clinical sec-
tors, especially the ones produced by Bacillus sp. due to their highly
specific and substantial fibrinolytic activity. Most of the proteases
exhibiting fibrinolytic activity have been isolated, purified and charac-
terized to study their molecular weight, and the effect of pH, tempera-
ture, charged ions and inhibitors on their physicochemical and kinetic
properties. Among all, fibrinolytic enzymes, including nattokinase, sub-
tilisin, streptokinase, staphylokinase, and serrapeptase, have proven
their potential in pharmaceutical and industrial set up. Considering
the efficiency, economic viability, and largescale production of fibrino-
lytic enzymes, biotechnologies approaches with modern molecular
techniques as well as statistical optimization strategies for fermenta-
tion, have provided an enormous scope for commercialization. Suffi-
cient quantities of enzymes production can enable further studies
such as site-directed mutagenesis experiments, protein engineering,
substrate specificity, stability, safety, plasma half-life, etc. Besides,
concerning sustainable production, various agro-industrial residues
have been claimed to be cost-effective substrates for fibrinolytic en-
zymes production. In addition to fibrinolytic activity, fibrinolytic en-
zymes have been reported to possess many other applications such as
blood pressure regulators, antibacterial, additives in detergent etc.
However, the mechanism behind unconventional application is still
unclear.
1514 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517
Funding details
This work has been self-funded.
Declaration of competing interest
The authors declare no conflict of interest.
References
[1] D. Mozaffarian, E.J. Benjamin, A.S. Go, D.K. Arnett, M.J. Blaha, M. Cushman, S. De
Ferranti, J.-P. Després, H.J. Fullerton, V.J. Howard, Executive summary: heart dis-
ease and stroke statistics—2015 update: a report from the American Heart Associ-
ation, Circulation 131 (4) (2015) 434–441.
[2] J. Seo, T.A. Al-Hilal, J.-G. Jee, Y.-L. Kim, H.-J. Kim, B.-H. Lee, S. Kim, I.-S. Kim, A
targeted ferritin-microplasmin based thrombolytic nanocage selectively dissolves
blood clots, Nanomed-Nanotechnol 14 (3) (2018) 633–642.
[3] WHO, Cardiovascular diseases (CVDs), 2017.
[4] J.C. Chapin, K.A. Hajjar, Fibrinolysis and the control of blood coagulation, Blood Rev.
29 (1) (2015) 17–24.
[5] D. Collen, H.R. Lijnen, Tissue-type plasminogen activator: a historical perspective
and personal account, J. Thromb. Haemost. 2 (4) (2004) 541–546.
[6] G. Adeboyeje, G. Sylwestrzak, J.J. Barron, J. White, A. Rosenberg, J. Abarca, G.
Crawford, R. Redberg, Major bleeding risk during anticoagulation with warfarin,
dabigatran, apixaban, or rivaroxaban in patients with nonvalvular atrial fibrilla-
tion, J. Manag. Care Spec. Pharm. 23 (9) (2017) 968–978.
[7] M.V.S. Andrade, L.A.P. Andrade, A.F. Bispo, L.d.A. Freitas, M.Q.S. Andrade, G.S.
Feitosa, G.S. Feitosa-Filho, Evaluation of the bleeding intensity of patients
anticoagulated with warfarin or dabigatran undergoing dental procedures, Arq.
Bras. Cardiol. 111 (3) (2018) 394–399.
[8] M. Pirmohamed, Warfarin: almost 60 years old and still causing problems, Br. J.
Clin. Pharmacol. 62 (5) (2006) 509.
[9] S. Lin, Y. Wang, L. Zhang, W. Guan, Dabigatran must be used carefully: literature re-
view and recommendations for management of adverse events, Drug design, de-
velopment and therapy 13 (2019) 1527.
[10] E.C. Christopoulou, T.D. Filippatos, M.S. Elisaf, Non-hemorrhage-related adverse ef-
fects of rivaroxaban, archives of medical sciences, Atherosclerotic diseases 2
(2017) e108.
[11] J.-H. Choi, K. Sapkota, S.-E. Park, S. Kim, S.-J. Kim, Thrombolytic, anticoagulant and
antiplatelet activities of codiase, a bi-functional fibrinolytic enzyme from Codium
fragile, Biochimie 95 (6) (2013) 1266–1277.
[12] G.A.I. The, Angiographic Investigators, The effects of tissue plasminogen activator,
streptokinase, or both on coronary-artery patency, ventricular function, and sur-
vival after acute myocardial infarction, N. Engl. J. Med. 329 (1993) 1615–1622.
[13] J.R. Gonzalez, M.G. Cortina, A.R. Campello, A.O. Santiago, J.H. Rocamora, E.M. Olivas,
Hemorragia cerebral en pacientes en tratamiento con anticoagulantes orales, Rev.
Neurol. 40 (1) (2005) 19–22.
[14] G. Zapata-Wainberg, S. Quintas, A.X.-C. Rico, L.B. Fernández, J.M. Vallejo, J.G.
Culleré, M.d.M.F. Guerrero, J. Egido, J.G. Sánchez, A.M. Domeño, Prognostic factors
and analysis of mortality due to brain haemorrhages associated with vitamin K an-
tagonist oral anticoagulants. Results from the TAC registry, Neurología 33 (7)
(2018) 419–426.
[15] M.M. da Silva, T.A. Rocha, D.F. de Moura, C.A. Chagas, F.C.A. de Aguiar Júnior, N.P. da
Silva Santos, R.V. Da Silva Sobral, J.M. do Nascimento, A.C. Lima Leite, L. Pastrana, R.
Costa, T.P. Nascimento, A.L.F. Porto, Effect of acute exposure in swiss mice (Mus
musculus) to a fibrinolytic protease produced by Mucor subtilissimus UCP 1262:
an histomorphometric, genotoxic and cytological approach, Regul. Toxicol.
Pharmacol. 103 (2019) 282–291.
[16] A. Krishnamurthy, P.D. Belur, S.B. Subramanya, Methods available to assess thera-
peutic potential of fibrinolytic enzymes of microbial origin: a review, J. Anal. Sci.
Tchnol. 9 (1) (2018) 10–21.
[17] Y. Peng, X. Yang, Y. Zhang, Microbial fibrinolytic enzymes: an overview of source,
production, properties, and thrombolytic activity in vivo, Appl. Microbiol.
Biotechnol. 69 (2) (2005) 126–132.
[18] E. Kotb, Purification and partial characterization of a chymotrypsin-like serine fi-
brinolytic enzyme from Bacillus amyloliquefaciens FCF-11 using corn husk as a
novel substrate, World J. Microbiol. Biotechnol. 30 (7) (2014) 2071–2080.
[19] P.E.d.C. e Silva, R.C. de Barros, W.W.C. Albuquerque, R.M.P. Brandão, R.P. Bezerra,
A.L.F. Porto, In vitro thrombolytic activity of a purified fibrinolytic enzyme from
Chlorella vulgaris, J. Chromatogr. 1092 (2018) 524–529.
[20] P. Vijayaraghavan, M.V. Arasu, R. Anantha Rajan, N.A. Al-Dhabi, Enhanced produc-
tion of fibrinolytic enzyme by a new Xanthomonas oryzae IND3 using low-cost cul-
ture medium by response surface methodology, Saudi Jounal of Biological Sciences
26 (2) (2019) 217–224.
[21] S. Singh, B.K. Bajaj, Potential application spectrum of microbial proteases for clean
and green industrial production, Energ. Ecol. Environ 2 (6) (2017) 370–386.
[22] V.G. Nielsen, J.K. Kirklin, W.L. Holman, B.L. Steenwyk, Clot lifespan model analysis
of the effects of warfarin on thrombus growth and fibrinolysis: role of contact pro-
tein and tissue factor initiation, ASAIO J. 55 (1) (2009) 33–40.
[23] D. Cai, C. Zhu, S. Chen, Microbial production of nattokinase: current progress, chal-
lenge and prospect, world, J. Microbiol. Biotechnol. 33 (5) (2017) 84–91.
[24] K. Onesmus, O.K. Ashipala, Q. He, Optimization of fibrinolytic enzyme production
by Bacillus subtilis DC-2 in aqueous two-phase system (poly-ethylene glycol 4000
and sodium sulfate), Bioresour. Technol. 99 (10) (2008) 4112–4119.
[25] R. Garg, B.N. Thorat, Nattokinase purification by three phase partitioning and im-
pact of t-butanol on freeze drying, Sep. Purif. Technol. 131 (2014) 19–26.
[26] T.P. Nascimento, A.E. Sales, C.S. Porto, R.M. Brandão, G.M. de Campos-Takaki, J.A.
Teixeira, T.S. Porto, A.L. Porto, A. Converti, Purification of a fibrinolytic protease
from Mucor subtilissimus UCP 1262 by aqueous two-phase systems (PEG/sulfate),
J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 1025 (2016) 16–24.
[27] A.V. da Silva, J.M. do Nascimento, C.H. Rodrigues, D.C.S. Nascimento, R.M.P.B. Costa,
D.d.A.V. Marques, A.C.L. Leite, M.d.V.B. Figueiredo, L. Pastrana, A. Converti, Partial
purification of fibrinolytic and fibrinogenolytic protease from Gliricidia sepium
seeds by aqueous two-phase system, Biocatalysis and Agricultural Biotechnology
27 (2020), 101669. .
[28] Z. Yao, J.A. Kim, J.H. Kim, Characterization of a fibrinolytic enzyme secreted by Ba-
cillus velezensis BS2 isolated from sea squirt Jeotgal, J. Microbiol. Biotechnol. 29 (3)
(2019) 347–356.
[29] Y. Hu, D. Yu, Z. Wang, J. Hou, R. Tyagi, Y. Liang, Y. Hu, Purification and characteriza-
tion of a novel, highly potent fibrinolytic enzyme from Bacillus subtilis DC27
screened from Douchi, a traditional Chinese fermented soybean food, Sci. Rep. 9
(1) (2019) 9235–9245.
[30] Z. Yao, J.A. Kim, J.H. Kim, Properties of a fibrinolytic enzyme secreted by Bacillus
subtilis JS2 isolated from saeu (small shrimp) jeotgal, Food Sci. Biotechnol. 27 (3)
(2018) 765–772.
[31] Y. Ghasemi, F. Dabbagh, A. Ghasemian, Cloning of a fibrinolytic enzyme (subtilisin)
gene from Bacillus subtilis in Escherichia coli, Mol. Biotechnol. 52 (1) (2012) 1–7.
[32] Z. Li, X. Chen, S. Guo, H. Zhang, H. Dong, G. Wu, A. Hong, J. Gu, Engineering of
Harobin for enhanced fibrinolytic activity obtained by random and site-directed
mutagenesis, Protein Expr. Purif. 129 (2017) 162–172.
[33] G.D. Biji, A. Arun, E. Muthulakshmi, P. Vijayaraghavan, M.V. Arasu, N.A. Al-Dhabi,
Bio-prospecting of cuttle fish waste and cow dung for the production of fibrinolytic
enzyme from Bacillus cereus IND5 in solid state fermentation, 3 Biotech 6 (2)
(2016) 231–236.
[34] S. Pan, G. Chen, R. Wu, X. Cao, Z. Liang, Non-sterile submerged fermentation of fi-
brinolytic enzyme by marine Bacillus subtilis harboring antibacterial activity with
starvation strategy, Front. Microbiol. 10 (2019) 1025–1038.
[35] X. Wei, M. Luo, Y. Xie, L. Yang, H. Li, L. Xu, H. Liu, Strain screening, fermentation,
separation, and encapsulation for production of nattokinase functional food,
Appl. Biochem. Biotechnol. 168 (7) (2012) 1753–1764.
[36] J.H. Seo, S.P. Lee, Production of fibrinolytic enzyme from soybean grits fermented
by Bacillus firmus NA-1, J. Med. Food 7 (4) (2004) 442–449.
[37] P.L. Bhargavi, R.S. Prakasham, Enhanced fibrinolytic protease production by Serra-
tia marcescens RSPB11 through Plackett-Burman and response surface methodo-
logical approaches, J, Appl. Biol. Biotechnol 4 (3) (2016) 006–014.
[38] A. Arshad, M.A. Zia, M. Asgher, F.A. Joyia, M. Arif, Enhanced production of strepto-
kinase from Streptococcus agalactiae EBL-31 by response surface methodology, Pak.
J. Pharm. Sci. 31 (4(Supplementary)) (2018) 1597–1602.
[39] R. Wu, G. Chen, S. Pan, J. Zeng, Z. Liang, Cost-effective fibrinolytic enzyme produc-
tion by Bacillus subtilis WR350 using medium supplemented with corn steep pow-
der and sucrose, Sci. Rep. 9 (1) (2019) 6824–6834.
[40] J.B. Lefkowitz, Coagulation pathway and physiology, in: K. Kottke-Marchant (Ed.),
An Algorithmic Approach to Hemostasis Testing, Thieme Medical Publishers,
New York, USA 2008, pp. 3–12.
[41] R. Chaudhry, H.M. Babiker, in: B.e.a. Abai (Ed.), Physiology, coagulation pathways,
StatPearls, StatPearls Publishing, Florida, USA, 2019.
[42] D. Collen, H. Lijnen, Basic and clinical aspects of fibrinolysis and thrombolysis,
Blood 78 (1991) 3114–3124.
[43] M. Nesheim, Thrombin and fibrinolysis, Chest 124 (3) (2003) 33S–39S.
[44] K. Ito, Effect of water-extractive components from funazushi, a fermented crucian
carp, on the activity of fibrinolytic factors, J. Sci. Food Agric. 100 (2020) 2482–2487.
[45] L. Hedstrom, Serine protease mechanism and specificity, Chem. Rev. 102 (12)
(2002) 4501–4524.
[46] L. Jeffries, D. Buckley, The detection and differentiation of fibrinolytic enzymes in
bacteria, J. Appl. Microbiol. 49 (3) (1980) 479–492.
[47] V. Sekar, J.H. Hageman, Specificity of the serine protease inhibitor,
phenylmethylsulfonyl fluoride, Biochem. Biophys. Res. Commun. 89 (2) (1979)
474–478.
[48] N. Alkjaersig, A.P. Fletcher, S. Sherry, The mechanism of clot dissolution by plasmin,
J. Clin. Investig. 38 (7) (1959) 1086–1095.
[49] D.B. Baruah, R.N. Dash, M. Chaudhari, S. Kadam, Plasminogen activators: a compar-
ison, Vasc. Pharmacol. 44 (1) (2006) 1–9.
[50] B. Wiman, D. Collen, Molecular mechanism of physiological fibrinolysis, Nature
272 (5653) (1978) 549–550.
[51] USFDA, Drugs@FDA: FDA Approved Drug Products, 2020.
[52] Q. Bi, B. Han, Y. Feng, Z. Jiang, Y. Yang, W. Liu, Antithrombotic effects of a newly pu-
rified fibrinolytic protease from Urechis unicinctus, Thromb. Res. 132 (2) (2013)
135–144.
[53] V. Meshram, S. Saxena, K. Paul, M. Gupta, N. Kapoor, Production, purification and
characterisation of a potential fibrinolytic protease from Endophytic Xylaria curta
by solid substrate fermentation, Appl. Biochem. Biotechnol. 181 (4) (2017)
1496–1512.
[54] J.-H. Choi, K. Sapkota, S. Kim, S.-J. Kim, Starase: a bi-functional fibrinolytic protease
from hepatic caeca of Asterina pectinifera displays antithrombotic potential,
Biochimie 105 (2014) 45–57.
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517
[55] C.T. Wang, B.P. Ji, B. Li, R. Nout, P.L. Li, H. Ji, L.F. Chen, Purification and characteriza-
tion of a fibrinolytic enzyme of Bacillus subtilis DC33, isolated from Chinese tradi-
tional Douchi, J. Ind. Microbiol. Biotechnol. 33 (9) (2006) 750–758.
[56] S.B. Kim, D.W. Lee, C.I. Cheigh, E.A. Choe, S.J. Lee, Y.H. Hong, H.J. Choi, Y.R. Pyun, Pu-
rification and characterization of a fibrinolytic subtilisin-like protease of Bacillus
subtilis TP-6 from an Indonesian fermented soybean, tempeh, J. Ind. Microbiol.
Biotechnol. 33 (6) (2006) 436–444.
[57] Z. Yao, X. Liu, J.M. Shim, K.W. Lee, H.J. Kim, J.H. Kim, Properties of a fibrinolytic en-
zyme secreted by Bacillus amyloliquefaciens RSB34, isolated from Doenjang, J.
Microbiol. Biotechnol. 27 (1) (2017) 9–18.
[58] K. Taneja, B.K. Bajaj, S. Kumar, N. Dilbaghi, Production, purification and character-
ization of fibrinolytic enzyme from Serratia sp. KG-2-1 using optimized media, 3
Biotech 7 (3) (2017) 184–199.
[59] A.E. Sales, F.A. de Souza, J.A. Teixeira, T.S. Porto, A.L. Porto, Integrated process pro-
duction and extraction of the fibrinolytic protease from Bacillus sp. UFPEDA 485,
Appl. Biochem. Biotechnol. 170 (7) (2013) 1676–1688.
[60] L. Cui, M.S. Dong, X.H. Chen, M. Jiang, X. Lv, G. Yan, A novel fibrinolytic enzyme
from Cordyceps militaris, a Chinese traditional medicinal mushroom, World J.
Microbiol. Biotechnol. 24 (4) (2008) 483–489.
[61] M.-H. Shen, J.-S. Kim, K. Sapkota, S.-E. Park, B.-S. Choi, S. Kim, H.-H. Lee, C.-S. Kim,
H.-S. Chun, C.-I. Ryoo, Purification, characterization, and cloning of fibrinolytic
metalloprotease from Pleurotus ostreatus mycelia, J. Microbiol. Biotechnol. 17 (8)
(2007) 1271–1283.
[62] S.-E. Park, M.-H. Li, J.-S. Kim, K. Sapkota, J.-E. Kim, B.-S. Choi, Y.-H. Yoon, J.-C. Lee, H.-
H. Lee, C.-S. Kim, Purification and characterization of a fibrinolytic protease from a
culture supernatant of Flammulina velutipes mycelia, Biosci. Biotechnol. Biochem.
71 (9) (2007) 70193–70199.
[63] S.-Y. Lee, J.-S. Kim, J.-E. Kim, K. Sapkota, M.-H. Shen, S. Kim, H.-S. Chun, J.-C. Yoo, H.-
S. Choi, M.-K. Kim, Purification and characterization of fibrinolytic enzyme from
cultured mycelia of Armillaria mellea, Protein Expr. Purif. 43 (1) (2005) 10–17.
[64] Y.-k. Jeong, J.H. Kim, S.-w. Gal, J.-e. Kim, S.-s. Park, K.-t. Chung, Y.-H. Kim, B.-W. Kim,
W.-H. Joo, Molecular cloning and characterization of the gene encoding a fibrino-
lytic enzyme from Bacillus subtilis strain A1, World J. Microbiol. Biotechnol. 20
(7) (2004) 711–717.
[65] J.-H. Kim, Y.S. Kim, Characterization of a metalloenzyme from a wild mushroom,
Tricholoma saponaceum, Biosci. Biotechnol. Biochem. 65 (2) (2001) 356–362.
[66] A. Krishnamurthy, P.D. Belur, A novel fibrinolytic serine metalloprotease from the
marine Serratia marcescens subsp. sakuensis: purification and characterization,
Int. J. Biol. Macromol. 112 (2018) 110–118.
[67] Y. Devaraj, S.K. Rajender, P.M. Halami, Purification and characterization of fibrino-
lytic protease from Bacillus amyloliquefaciens MCC2606 and analysis of fibrin deg-
radation product by MS/MS, Prep. Biochem. Biotechnol. 48 (2) (2018) 172–180.
[68] S.J. Jeong, K. Heo, J.Y. Park, K.W. Lee, J.Y. Park, S.H. Joo, J.H. Kim, Characterization of
AprE176, a fibrinolytic enzyme from Bacillus subtilis HK176, J. Microbiol.
Biotechnol. 25 (1) (2015) 89–97.
[69] K. Ouriel, A history of thrombolytic therapy, J. Endovasc. Ther. 11 (6_suppl) (2004)
II–128-II-133.
[70] N. Sikri, A. Bardia, A history of streptokinase use in acute myocardial infarction,
Tex. Heart Inst. J. 34 (3) (2007) 318–327.
[71] F. Vermeer, I. Bösl, J. Meyer, F. Bär, B. Charbonnier, J. Windeler, H. Barth, Saruplase
is a safe and effective thrombolytic agent; observations in 1698 patients: results of
the PASS study, J. Thromb. Thrombolys 8 (2) (1999) 143–150.
[72] USFDA, Biologics licence application approval of tenecplase, https://www.
accessdata.fda.gov/drugsatfda_docs/appletter/2000/tenegen060200L.htm 2000.
[73] G.J. del Zoppo, R.T. Higashida, A.J. Furlan, M.S. Pessin, H.A. Rowley, M. Gent,
PROACT: a phase II randomized trial of recombinant pro-urokinase by direct arte-
rial delivery in acute middle cerebral artery stroke, Stroke 29 (1) (1998) 4–11.
[74] A.J. Furlan, A. Abou-Chebl, The role of recombinant pro-urokinase (r-pro-UK) and
intra-arterial thrombolysis in acute ischaemic stroke: the PROACT trials, Curr.
Med. Res. Opin. 18 (sup2) (2002) s44–s47.
[75] K. Swedberg, ISSIS-3 (Third International Study of Infarct Survival) Collaborative
Group. ISIS-3 a randomized trial of streptokinase vs tissue plasmino gen activator
vs anistreplase and aspirin plus heparine vs aspirina lone among 41229 cases of
suspected acute myocardial infarction, Lancet 339 (1992) 753–770.
[76] C.P. Semba, K. Sugimoto, M.K. Razavi, Alteplase and tenecteplase: applications in
the peripheral circulation, Techn. Vasc. Interv. Radiol. 4 (2) (2001) 99–106.
[77] M. Verstraete, Third-generation thrombolytic drugs, Am. J. Med. 109 (1) (2000)
52–58.
[78] K. Kikuchi, N. Miura, K.-I. Kawahara, Y. Murai, M. Morioka, P.A. Lapchak, E. Tanaka,
Edaravone (Radicut), a free radical scavenger, is a potentially useful addition to
thrombolytic therapy in patients with acute ischemic stroke, Biomed. Rep. 1 (1)
(2013) 7–12.
[79] A. Kumar, K. Pulicherla, K.S. Ram, K. Rao, Evolutionary trend of thrombolytics, Int. J.
BioSci. Biotechnol. 2 (4) (2010) 51–68.
[80] X.X. Liang, Y.N. Zhou, J.S. Chen, P.X. Qiu, H.Z. Chen, H.H. Sun, Y.P. Wu, G.M. Yan,
Enzymological characterization of FII(a), a fibrinolytic enzyme from Agkistrodon
acutus venom, Acta Pharmacol. Sin. 26 (12) (2005) 1474–1478.
[81] G.Q. Dong, X.L. Yuan, Y.J. Shan, Z.H. Zhao, J.P. Chen, Y.W. Cong, Molecular cloning
and characterization of cDNA encoding fibrinolytic enzyme-3 from earthworm
Eisenia foetida, Acta Biochim. Biophys. Sin. 36 (4) (2004) 303–308.
[82] K. Matsubara, K. Hori, Y. Matsuura, K. Miyazawa, Purification and characterization
of a fibrinolytic enzyme and identification of fibrinogen clotting enzyme in a ma-
rine green alga, Codium divaricatum, Comp. Biochem. Physiol. B. Biochem. Mol.
Biol. 125 (1) (2000) 137–143.
[83] Y. Mine, A.H.K. Wong, B. Jiang, Fibrinolytic enzymes in Asian traditional fermented
foods, Food Res. Int. 38 (3) (2005) 243–250.
1515
[84] R. Saini, S. Saini, S. Sharma, Potential of probiotics in controlling cardiovascular dis-
eases, J. Cardiovasc. Dis. Res. 1 (4) (2010) 213–214.
[85] S. Raveendran, B. Parameswaran, S. Beevi Ummalyma, A. Abraham, A. Kuruvilla
Mathew, A. Madhavan, S. Rebello, A. Pandey, Applications of microbial enzymes
in food industry, Food Technol. Biotechnol. 56 (1) (2018) 16–30.
[86] D.N. Avhad, V.K. Rathod, Ultrasound assisted production of a fibrinolytic enzyme in
a bioreactor, Ultrason. Sonochem. 22 (2015) 257–264.
[87] H. Yang, L. Yang, X. Li, H. Li, Z. Tu, X. Wang, Genome sequencing, purification, and
biochemical characterization of a strongly fibrinolytic enzyme from Bacillus
amyloliquefaciens Jxnuwx-1 isolated from Chinese traditional Douchi, J. Gen. Appl.
Microbiol. (2019)https://doi.org/10.2323/jgam.2019.04.005.
[88] D.N. Afifah, M. Sulchan, D. Syah, M.T. Yanti, J.H. Kim Suhartono, Purification and
characterization of a fibrinolytic enzyme from Bacillus pumilus 2.g isolated from
Gembus, an Indonesian fermented food, Prev. Nutr. Food Sci. 19 (3) (2014)
213–219.
[89] B. Wu, L. Wu, L. Ruan, M. Ge, D. Chen, Screening of endophytic fungi with anti-
thrombotic activity and identification of a bioactive metabolite from the endo-
phytic fungal strain CPCC 480097, Curr. Microbiol. 58 (5) (2009) 522–527.
[90] Y.H. Lim, H.L. Foo, T.C. Loh, R. Mohamad, N. Abdullah, Comparative studies of ver-
satile extracellular proteolytic activities of lactic acid bacteria and their potential
for extracellular amino acid productions as feed supplements, J. Anim. Sci.
Biotechnol. 10 (2019) 15–28.
[91] N.S. Choi, J.J. Song, D.M. Chung, Y.J. Kim, P.J. Maeng, S.H. Kim, Purification and char-
acterization of a novel thermoacid-stable fibrinolytic enzyme from Staphylococcus
sp. strain AJ isolated from Korean salt-fermented Anchovy-joet, J. Ind. Microbiol.
Biotechnol. 36 (3) (2009) 417–426.
[92] F. Nailufar, R.R. Tjandrawinata, M.T. Suhartono, Thrombus degradation by fibrino-
lytic enzyme of Stenotrophomonas sp. originated from Indonesian soybean-based
fermented food on Wistar rats, Adv. Pharmacol. Sci. 2016 (2016) 4206908.
[93] D. Dhamodharan, S.J.N. Jemimah, S.K. Merlyn, C.D. Subathra, Novel fibrinolytic pro-
tease producing Streptomyces radiopugnans VITSD8 from marine sponges, Mar.
Drugs 17 (3) (2019) 164–178.
[94] M. Boztas, Y. Cetinkaya, M. Topal, I. Gulcin, A. Menzek, E. Sahin, M. Tanc, C.T.
Supuran, Synthesis and carbonic anhydrase isoenzymes I, II, IX, and XII inhibitory
effects of dimethoxybromophenol derivatives incorporating cyclopropane moie-
ties, J. Med. Chem. 58 (2) (2015) 640–650.
[95] A. Biçer, P. Taslimi, G. Yakalı, I. Gülçin, M.S. Gültekin, G.T. Cin, Synthesis, character-
ization, crystal structure of novel bis-thiomethylcyclohexanone derivatives and
their inhibitory properties against some metabolic enzymes, Bioorg. Chem. 82
(2019) 393–404.
[96] E. Shakhnovich, Protein folding thermodynamics and dynamics: where physics,
chemistry, and biology meet, Chem. Rev. 106 (5) (2006) 1559–1588.
[97] A. Dey, B. Bhunia, Recent advances in strain improvement, production, purification
and applications of industrial enzyme, Recent. Pat. Biotechnol. 13 (1) (2019) 3.
[98] C. Kim, K. Ri, S. Choe, A novel fibrinolytic enzymes from the Korean traditional
fermented food—Jotgal: purification and characterization, J. Food Biochem.
(2020)https://doi.org/10.1111/jfbc.13255.
[99] C.W. Kho, S.G. Park, S. Cho, D.H. Lee, P.K. Myung, B.C. Park, Confirmation of Vpr as a
fibrinolytic enzyme present in extracellular proteins of Bacillus subtilis, Protein
Expr. Purif. 39 (1) (2005) 1–7.
[100] P. Katrolia, X. Liu, Y. Zhao, N.K. Kopparapu, X. Zheng, Gene cloning, expression and
homology modeling of first fibrinolytic enzyme from mushroom (Cordyceps
militaris), Int. J. Biol. Macromol. 146 (2020) 897–906.
[101] H.D. Jo, H.A. Lee, S.J. Jeong, J.H. Kim, Purification and characterization of a major fi-
brinolytic enzyme from Bacillus amyloliquefaciens MJ5-41 isolated from Meju, J.
Microbiol. Biotechnol. 21 (11) (2011) 1166–1173.
[102] H.C. Kim, B.-S. Choi, K. Sapkota, S. Kim, H.J. Lee, J.C. Yoo, S.-J. Kim, Purification and
characterization of a novel, highly potent fibrinolytic enzyme from Paecilomyces
tenuipes, Process Biochem. 46 (8) (2011) 1545–1553.
[103] İ. Gülçİn, Ö. İrfan Küfrevİoğlu, M. Oktay, Purification and characterization of poly-
phenol oxidase from nettle (Urtica dioica L.) and inhibitory effects of some
chemicals on enzyme activity, Journal of enzyme inhibition and medicinal chemis-
try 20 (3) (2005) 297–302.
[104] E. Koksal, I. Gulcin, Purification and characterization of peroxidase from cauliflower
(Brassica oleracea L. var. botrytis) buds, Protein and Peptide Letters 15 (4) (2008)
320–326.
[105] E. Koksal, E. Bursal, A.G. Aggul, I. Gulcin, Purification and characterization of perox-
idase from sweet gourd (Cucurbita Moschata Lam. Poiret), Int. J. Food Prop. 15 (5)
(2012) 1110–1119.
[106] J.-H. Choi, D.-W. Kim, S. Kim, S.-J. Kim, Purification and partial characterization of a
fibrinolytic enzyme from the fruiting body of the medicinal and edible mushroom
Pleurotus ferulae, Prep. Biochem. Biotechnol. 47 (6) (2017) 539–546.
[107] M.J. Ahn, H.J. Ku, S.H. Lee, J.H. Lee, Characterization of a novel fibrinolytic enzyme,
BsfA, from Bacillus subtilis ZA400 in kimchi reveals its pertinence to thrombosis
treatment, J. Microbiol. Biotechnol. 25 (12) (2015) 2090–2099.
[108] D. Hutanu, M.D. Frishberg, L. Guo, C.C. Darie, Recent applications of polyethylene
glycols (PEGs) and PEG derivatives, Mod. Chem. Appl 2 (2) (2014) 1–6.
[109] S.S. Nascimento, V.S.V. Santos, E.O. Watanabe, J. de Souza Ferreira, Assessment of
the purification of phycobiliproteins in cyanobacteria through aqueous two-
phase systems with different proportions of PEG/salt, Food Bioprod. Process. 119
(2020) 345–349.
[110] P. Vijayaraghavan, S.G. Prakash Vincent, A low cost fermentation medium for po-
tential fibrinolytic enzyme production by a newly isolated marine bacterium,
Shewanella sp. IND20, Biotechnol. Rep. 7 (2015) 135–142.
1516 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517
[111] P.M. Mahajan, S. Nayak, S.S. Lele, Fibrinolytic enzyme from newly isolated marine
bacterium Bacillus subtilis ICTF-1: media optimization, purification and characteri-
zation, J. Biosci. Bioeng. 113 (3) (2012) 307–314.
[112] X. Xin, R.R. Ambati, Z. Cai, B. Lei, Purification and characterization of fibrinolytic en-
zyme from a bacterium isolated from soil, 3 Biotech 8 (2018) 90–98.
[113] W. Kim, K. Choi, Y. Kim, H. Park, J. Choi, Y. Lee, H. Oh, I. Kwon, S. Lee, Purification
and characterization of a fibrinolytic enzyme produced from Bacillus sp. strain CK
11-4 screened from Chungkook-Jang, Appl. Environ. Microbiol. 62 (7) (1996)
2482–2488.
[114] A.H. Wong, Y. Mine, Novel fibrinolytic enzyme in fermented shrimp paste, a tradi-
tional Asian fermented seasoning, J. Agric. Food Chem. 52 (4) (2004) 980–986.
[115] B. Naveena, K.P. Gopinath, P. Sakthiselvan, N. Partha, Enhanced production of
thrombinase by Streptomyces venezuelae: kinetic studies on growth and enzyme
production of mutant strain, Bioresour. Technol. 111 (2012) 417–424.
[116] S. Zhang, Y. Wang, N. Zhang, Z. Sun, Y. Shi, X. Cao, H. Wang, Purification and char-
acterisation of a fibrinolytic enzyme from Rhizopus microsporus var, tuberosus,
Food Technol. Biotechnol 53 (2) (2015) 243–248.
[117] H. Sumi, N. Nakajima, C. Yatagai, A unique strong fibrinolytic enzyme
(katsuwokinase) in skipjack “Shiokara,” a Japanese traditional fermented food,
Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 112 (3) (1995) 543–547.
[118] Y. Zhang, J. Cui, R. Zhang, Y. Wang, M. Hong, A novel fibrinolytic serine protease
from the polychaete Nereis (Neanthes) virens (Sars): purification and characteri-
zation, Biochimie 89 (1) (2007) 93–103.
[119] M. Fujita, K. Hong, Y. Ito, S. Misawa, N. Takeuchi, K. Kariya, S. Nishimuro, Transport
of nattokinase across the rat intestinal tract, Biol. Pharm. Bull. 18 (9) (1995)
1194–1196.
[120] X. Liu, N.K. Kopparapu, X. Shi, Y. Deng, X. Zheng, J. Wu, Purification and biochemical
characterization of a novel fibrinolytic enzyme from culture supernatant of
Cordyceps militaris, J. Agric. Food Chem. 63 (8) (2015) 2215–2224.
[121] B.K. Bajaj, S. Singh, M. Khullar, K. Singh, S. Bhardwaj, Optimization of fibrinolytic
protease production from Bacillus subtilis I-2 using agro-residues, Braz. Arch. Biol.
Technol. 57 (5) (2014) 653–662.
[122] A.M. Gold, D. Fahrney, Sulfonyl fluorides as inhibitors of esterases. II. Formation
and reactions of phenylmethanesulfonyl α-chymotrypsin, Biochem 3 (6) (1964)
783–791.
[123] X.L. Liu, X.Q. Zheng, P.Z. Qian, N.K. Kopparapu, Y.P. Deng, M. Nonaka, N. Harada, Pu-
rification and characterization of a novel fibrinolytic enzyme from culture superna-
tant of Pleurotus ostreatus, J. Microbiol. Biotechnol. 24 (2) (2014) 245–253.
[124] I.S. Park, J.U. Park, M.J. Seo, M.J. Kim, H.H. Lee, S.R. Kim, B.W. Kang, Y.H. Choi, W.H.
Joo, Y.K. Jeong, Purification and biochemical characterization of a 17 kDa fibrino-
lytic enzyme from Schizophyllum commune, J. Microbiol. 48 (6) (2010) 836–841.
[125] S.-K. Lee, D.-H. Bae, T.-J. Kwon, S.-B. Lee, H.-H. Lee, J.-H. Park, S. Heo, M.-G. Johnson,
Purification and characterization of a fibrinolytic enzyme form Bacillus sp. KDO-13
isolated from soybean paste, J. Microbiol. Biotechnol. 11 (5) (2001) 845–852.
[126] A. Undas, R.A. Ariëns, Fibrin clot structure and function: a role in the pathophysiol-
ogy of arterial and venous thromboembolic diseases, Arterioscler. Thromb. Vasc.
Biol. 31 (12) (2011) 88–99.
[127] T. Astrup, S. Müllertz, The fibrin plate method for estimating fibrinolytic activity,
Arch. Biochem. Biophys. 40 (2) (1952) 346–351.
[128] K. Heo, K.M. Cho, C.K. Lee, G.M. Kim, J.H. Shin, J.S. Kim, J.H. Kim, Characterization of
a fibrinolytic enzyme secreted by Bacillus amyloliquefaciens CB1 and its gene clon-
ing, J. Microbiol. Biotechnol. 23 (7) (2013) 974–983.
[129] Y. Hua, B. Jiang, Y. Mine, W. Mu, Purification and characterization of a novel fibri-
nolytic enzyme from Bacillus sp. nov. SK006 isolated from an Asian traditional
fermented shrimp paste, J. Agric. Food Chem. 56 (4) (2008) 1451–1457.
[130] H.P. Li, Z. Hu, J.L. Yuan, H.D. Fan, W. Chen, S.J. Wang, S.S. Zheng, Z.L. Zheng, G.L. Zou,
A novel extracellular protease with fibrinolytic activity from the culture superna-
tant of Cordyceps sinensis: purification and characterization, Phytother. Res. 21
(12) (2007) 1234–1241.
[131] K. Balaraman, G. Prabakaran, Production & purification of a fibrinolytic enzyme
(thrombinase) from Bacillus sphaericus, Indian J. Med. Res. 126 (5) (2007)
459–464.
[132] C. Sharma, G.E.M. Salem, N. Sharma, P. Gautam, R. Singh, Thrombolytic potential of
novel thiol-dependent fibrinolytic protease from Bacillus cereus RSA1, Biomol. 10
(3) (2020).
[133] H. Lineweaver, D. Burk, The determination of enzyme dissociation constants, J. Am.
Chem. Soc. 56 (3) (1934) 658–666.
[134] J.L. Adrio, A.L. Demain, Microbial enzymes: tools for biotechnological processes,
Biomol 4 (1) (2014) 117–139.
[135] A. Madhavan, R. Sindhu, P. Binod, R.K. Sukumaran, A. Pandey, Strategies for design
of improved biocatalysts for industrial applications, Bioresour. Technol. 245 (2017)
1304–1313.
[136] Y. Jia, H. Liu, W. Bao, M. Weng, W. Chen, Y. Cai, Z. Zheng, G. Zou, Functional analysis
of propeptide as an intramolecular chaperone for in vivo folding of subtilisin
nattokinase, FEBS Lett. 584 (23) (2010) 4789–4796.
[137] U. Shinde, G. Thomas, Insights from bacterial subtilases into the mechanisms of in-
tramolecular chaperone-mediated activation of furin, in: M. Majambu, N.G. Seidah
(Eds.), Proprotein Convertases, Humana Press, New Jersey, USA 2011, pp. 59–106.
[138] D. Meng, M. Dai, B.L. Xu, Z.S. Zhao, X. Liang, M. Wang, X.F. Tang, B. Tang, Maturation
of fibrinolytic bacillopeptidase F involves both hetero- and autocatalytic processes,
Appl. Environ. Microbiol. 82 (1) (2016) 318–327.
[139] Y. Kurosawa, S. Nirengi, T. Homma, K. Esaki, M. Ohta, J.F. Clark, T. Hamaoka, A
single-dose of oral nattokinase potentiates thrombolysis and anti-coagulation pro-
files, Sci. Rep. 5 (2015), 11601. .
[140] M. Milner, K. Makise, Natto and its active ingredient nattokinase: a potent and safe
thrombolytic agent, Altern. Complem. Ther. 8 (3) (2002) 157–164.
[141] B.J. Lampe, J.C. English, Toxicological assessment of nattokinase derived from Bacil-
lus subtilis var. natto, Food Chem. Toxicol. 88 (2016) 87–99.
[142] V. Mohanasrinivasan, C.S. Devi, R. Biswas, F. Paul, M. Mitra, E. Selvarajan, V.
Suganthi, Enhanced production of nattokinase from UV mutated Bacillus sp.,
Bangladesh, Aust. J. Pharm. 8 (2) (2013) 110–115.
[143] H. Sumi, Y. Yanagisawa, C. Yatagai, J. Saito, Natto Bacillus as an oral fibrinolytic
agent: nattokinase activity and the ingestion effect of Bacillus subtilis natto, Food
Sci. Technol. Res. 10 (1) (2004) 17–20.
[144] P.S. Khursade, S.H. Galande, P. Shiva Krishna, R.S. Prakasham, Stenotrophomonas
maltophilia Gd2: a potential and novel isolate for fibrinolytic enzyme production,
Saudi Journal of Biological Sciences 26 (7) (2019) 1567–1575.
[145] Z. Khan, M. Shafique, H.R. Nawaz, N. Jabeen, S.A. Naz, Bacillus tequilensis ZMS-2: a
novel source of alkaline protease with antimicrobial, anti-coagulant, fibrinolytic
and dehairing potentials, Pak. J. Pharm. Sci. 32 (4) (2019) 1913–1918.
[146] R.R. Chitte, S.V. Deshmukh, P.P. Kanekar, Production, purification, and biochemical
characterization of a fibrinolytic enzyme from thermophilic Streptomyces sp.
MCMB-379, Appl. Biochem. Biotechnol. 165 (5–6) (2011) 1406–1413.
[147] P. Vijayaraghavan, S.G. Vincent, Statistical optimization of fibrinolytic enzyme pro-
duction using agroresidues by Bacillus cereus IND1 and its thrombolytic activity
in vitro, Biomed. Res. Int. 2014 (2014) 725064.
[148] J.M. Yon, Protein aggregation, in: R.A. Meyers (Ed.), Encyclopedia of Molecular Cell
Biology and Molecular Medicine, Wiley-VCH Verlag GmbH & Co, Weinheim,
Germany 2006, pp. 23–52.
[149] P. Vijayaraghavan, P. Rajendran, S.G. Prakash Vincent, A. Arun, N. Abdullah Al-
Dhabi, M. Valan Arasu, O. Young Kwon, Y.O. Kim, Novel sequential screening and
enhanced production of fibrinolytic enzyme by Bacillus sp. IND12 using response
surface methodology in solid-state fermentation, Biomed. Res. Int. 2017 (2017).
[150] P. Vijayaraghavan, S.G. Vincent, Statistical optimization of fibrinolytic enzyme pro-
duction by Pseudoalteromonas sp. IND11 using cow dung substrate by response
surface methodology, Springerplus 3 (2014) 60.
[151] W. Zeng, W. Li, L. Shu, J. Yi, G. Chen, Z. Liang, Non-sterilized fermentative co-
production of poly(γ-glutamic acid) and fibrinolytic enzyme by a thermophilic Ba-
cillus subtilis GXA-28, Bioresour. Technol. 142 (2013) 697–700.
[152] T.C. Chen, C.-J. Chiang, Y.-P. Chao, Medium optimization for the production of re-
combinant nattokinase by Bacillus subtilis using response surface methodology,
Biotechnol. Prog. 23 (6) (2007) 1327–1332.
[153] I. Mariñas-Collado, M.J. Rivas-López, J.M. Rodríguez-Díaz, M.T. Santos-Martín, Opti-
mal designs in enzymatic reactions with high-substrate inhibition, Chemom. Intell.
Lab. Syst. 189 (2019) 102–109.
[154] P. Pandee, Y. Dissara, Production and properties of a fibrinolytic enzyme by
Schizophyllum commune BL23, Songklanakarin, J. Sci. Technol. 30 (4) (2008)
447–453.
[155] E. Selvarajan, N. Bhatnagar, Nattokinase: an updated critical review on challenges
and perspectives, Cardiovasc. Hematol. Agents Med. Chem. 15 (2017) 128–135.
[156] C. Wang, M. Du, D. Zheng, F. Kong, G. Zu, Y. Feng, Purification and characterization
of nattokinase from Bacillus subtilis natto B-12, J. Agric. Food Chem. 57 (20) (2009)
9722–9729.
[157] I. Torrèns, A.G. Ojalvo, A. Seralena, O. Hayes, J. de la Fuente, A mutant streptokinase
lacking the C-terminal 42 amino acids is less immunogenic, Immunol. Lett. 70 (3)
(2000) 213–218.
[158] V. Regnault, G. Helft, D. Wahl, D. Czitrom, A. Vuillemenot, G. Papouin, L. Roda, N.
Danchin, T. Lecompte, Antistreptokinase platelet-activating antibodies are com-
mon and heterogeneous, J. Thromb. Haemost. 1 (5) (2003) 1055–1061.
[159] D. Collen, Engineered staphylokinase variants with reduced immunogenicity, Fibri-
nolysis Proteolysis 12 (1998) 59–65.
[160] C. Nagata, K. Wada, T. Tamura, K. Konishi, Y. Goto, S. Koda, T. Kawachi, M. Tsuji, K.
Nakamura, Dietary soy and natto intake and cardiovascular disease mortality in
Japanese adults: the Takayama study, Am. J. Clin. Nutr. 105 (2) (2017) 426–431.
[161] F. Dabbagh, M. Negahdaripour, A. Berenjian, A. Behfar, F. Mohammadi, M. Zamani,
C. Irajie, Y. Ghasemi, Nattokinase: production and application, Appl. Microbiol.
Biotechnol. 98 (22) (2014) 9199–9206.
[162] Y. Huang, S. Ding, M. Liu, C. Gao, J. Yang, X. Zhang, B. Ding, Ultra-small and anionic
starch nanospheres: formation and vitro thrombolytic behavior study, Carbohydr.
Polym. 96 (2) (2013) 426–434.
[163] M. Fujita, K. Ohnishi, S. Takaoka, K. Ogasawara, R. Fukuyama, H. Nakamuta, Antihy-
pertensive effects of continuous oral administration of nattokinase and its frag-
ments in spontaneously hypertensive rats, Biol. Pharm. Bull. 34 (11) (2011)
1696–1701.
[164] H. Sumi, H. Hamada, K. Nakanishi, H. Hiratani, Enhancement of the fibrinolytic ac-
tivity in plasma by oral administration of nattokinases, Acta Haematol. 84 (3)
(1990) 139–143.
[165] G.S. Jensen, M. Lenninger, M.P. Ero, K.F. Benson, Consumption of nattokinase is as-
sociated with reduced blood pressure and von Willebrand factor, a cardiovascular
risk marker: results from a randomized, double-blind, placebo-controlled, multi-
center North American clinical trial, Integr. Blood Press. Control 9 (2016) 95–104.
[166] J. Xu, M. Du, X. Yang, Q. Chen, H. Chen, D.-H. Lin, Thrombolytic effects in vivo of
nattokinase in a carrageenan-induced rat model of thrombosis, Acta Haematol.
132 (2) (2014) 247–253.
[167] D. Law, Z. Zhang, Stabilization and target delivery of Nattokinase using compres-
sion coating, Drug Dev. Ind. Pharm. 33 (5) (2007) 495–503.
[168] Y. Weng, J. Yao, S. Sparks, K.Y. Wang, Nattokinase: an oral antithrombotic agent for
the prevention of cardiovascular disease, INternationa; Journal of Molecular Sci-
ences 18 (2017) 523.
[169] E. Kotb, Fibrinolytic bacterial enzymes with thrombolytic activity, in: E. Kotb (Ed.),
Fibrinolytic Bacterial Enzymes with Thrombolytic Activity, Springer Verlag, New
York, USA 2012, pp. 1–74.
 A.M. Moula Ali, S.C.B. Bavisetty / International Journal of Biological Macromolecules 163 (2020) 1498–1517
[170] J.Y. Kim, S.N. Gum, J.K. Paik, H.H. Lim, K.-c. Kim, K. Ogasawara, K. Inoue, S. Park, Y.
Jang, J.H. Lee, Effects of nattokinase on blood pressure: a randomized, controlled
trial, Hypertens. Res. 31 (8) (2008) 1583–1588.
[171] Y.-Y. Chang, J.-S. Liu, S.-L. Lai, H.-S. Wu, M.-Y. Lan, Cerebellar hemorrhage provoked
by combined use of nattokinase and aspirin in a patient with cerebral microbleeds,
Intern. Med. 47 (5) (2008) 467–469.
[172] N. Fadl, H. Ahmed, H. Booles, A. Sayed, Serrapeptase and nattokinase intervention
for relieving Alzheimer’s disease pathophysiology in rat model, Hum. Exp. Toxicol.
32 (7) (2013) 721–735.
[173] J.-M. Dogné, J. Hanson, X.d. Leval, D. Pratico, C.R. Pace-Asciak, P. Drion, B. Pirotte, K.-
H. Ruan, From the design to the clinical application of thromboxane modulators,
Curr. Pharm. Des. 12 (8) (2006) 903–923.
[174] E. Kotb, The biotechnological potential of subtilisin-like fibrinolytic enzyme from a
newly isolated Lactobacillus plantarum KSK-II in blood destaining and antimicro-
bials, Biotechnol. Prog. 31 (2) (2015) 316–324.
[175] E. Vicari, S.V. La, C. Battiato, A. Arancio, Treatment with non-steroidal anti-
inflammatory drugs in patients with amicrobial chronic prostato-vesiculitis:
transrectal ultrasound and seminal findings, Italian J. Urology Nephrology 57 (1)
(2005) 53–59.
[176] B. Masschalck, C.W. Michiels, Antimicrobial properties of lysozyme in relation to
foodborne vegetative bacteria, Crit. Rev. Microbiol. 29 (3) (2003) 191–214.
[177] V. Žukaite, G. Biziulevičius, Acceleration of hyaluronidase production in the course
of batch cultivation of Clostridium perfringens can be achieved with bacteriolytic
enzymes, Lett. Appl. Microbiol. 30 (3) (2000) 203–206.
[178] E. Purwaeni, C. Riani, D.S. Retnoningrum, Molecular characterization of bacterial fi-
brinolytic proteins from Indonesian traditional fermented foods, Protein J. 39
(2020) 258–267.
[179] M. Anusree, K. Swapna, C.N. Aguilar, A. Sabu, Optimization of process parameters
for the enhanced production of fibrinolytic enzyme by a newly isolated marine
bacterium, Bioresour. Technol. Rep. 11 (2020).
[180] X. Liu, N.K. Kopparapu, Y. Li, Y. Deng, X. Zheng, Biochemical characterization of a
novel fibrinolytic enzyme from Cordyceps militaris, Int. J. Biol. Macromol. 94(Pt B)
(2017) 793–801.
[181] W. Albuquerque, T. Nascimento, R. Brandão-Costa, T. Fernandes, A. Porto, Static
magnetic field effects on proteases with fibrinolytic activity produced by Mucor
subtilissimus, Bioelectromagnetics 38 (2) (2017) 109–120.
[182] V. Mohanasrinivasan, S. Yogesh, A. Govindaraj, S. Jemimah Naine, C. Subathra Devi,
In vitro thrombolytic potential of actinoprotease from marine Streptomyces
violaceus VITYGM, Cardiovasc. Hematol. Agents Med. Chem. 14 (2) (2016)
120–124.
[183] D. Huy, P. Hao, P. Hung, Screening and identification of Bacillus sp. isolated from
traditional Vietnamese soybean-fermented products for high fibrinolytic enzyme
production, Int. Food Res. J. 23 (1) (2016) 326–331.
[184] B.H. Lee, Y.S. Lai, S.C. Wu, Antioxidation, angiotensin converting enzyme inhibition
activity, nattokinase, and antihypertension of Bacillus subtilis (natto)-fermented pi-
geon pea, J. Food Drug Anal. 23 (4) (2015) 750–757.
[185] R. Kapoor, H. Harde, S. Jain, A.K. Panda, B.P. Panda, Downstream processing, formu-
lation development and antithrombotic evaluation of microbial nattokinase, J.
Biomed. Nanotechnol. 11 (7) (2015) 1213–1224.
[186] P. Vijayaraghavan, S.G. Prakash Vincent, Medium optimization for the production
of fibrinolytic enzyme by Paenibacillus sp. IND8 using response surface methodol-
ogy, Sci. World J. 2014 (2014), 276942. .
[187] D.J. Kumar, R. Rakshitha, M.A. Vidhya, P.S. Jennifer, S. Prasad, M.R. Kumar, P.T.
Kalaichelvan, Production, optimization and characterization of fibrinolytic enzyme
by Bacillus subtilis RJAS19, Pak. J. Biol. Sci. 17 (4) (2014) 529–534.
[188] D.N. Avhad, V.K. Rathod, Ultrasound stimulated production of a fibrinolytic en-
zyme, Ultrason. Sonochem. 21 (1) (2014) 182–188.
[189] X. Zhang, L.J. Yun, L.B. Peng, Y. Lu, K.P. Ma, F. Tang, Optimization of Douchi fibrino-
lytic enzyme production by statistical experimental methods, J Huazhong Univ Sci
Technolog Med Sci 33 (1) (2013) 153–158.
[190] B.-S. Choi, K. Sapkota, J.-H. Choi, C.-h. Shin, S. Kim, S.-J. Kim, Herinase: a novel bi-
functional fibrinolytic protease from the monkey head mushroom, Hericium
erinaceum, Appl. Biochem. Biotechnol. 170 (3) (2013) 609–622.
1517
[191] J. Yuan, J. Yang, Z. Zhuang, Y. Yang, L. Lin, S. Wang, Thrombolytic effects of Douchi
fibrinolytic enzyme from Bacillus subtilis LD-8547 in vitro and in vivo, BMC
Biotechnol. 12 (2012) 36–45.
[192] C.-T. Chang, P.-M. Wang, Y.-F. Hung, Y.-C. Chung, Purification and biochemical
properties of a fibrinolytic enzyme from Bacillus subtilis-fermented red bean,
Food Chem. 133 (4) (2012) 1611–1617.
[193] X. Wei, M. Luo, L. Xu, Y. Zhang, X. Lin, P. Kong, H. Liu, Production of fibrinolytic en-
zyme from Bacillus amyloliquefaciens by fermentation of chickpeas, with the eval-
uation of the anticoagulant and antioxidant properties of chickpeas, J. Agric. Food
Chem. 59 (8) (2011) 3957–3963.
[194] W.-S. Cha, S.-S. Park, S.-J. Kim, D. Choi, Biochemical and enzymatic properties of a
fibrinolytic enzyme from Pleurotus eryngii cultivated under solid-state conditions
using corn cob, Bioresour. Technol. 101 (16) (2010) 6475–6481.
[195] G.M. Kim, A.R. Lee, K.W. Lee, J.Y. Park, J. Chun, J. Cha, Y.S. Song, J.H. Kim, Character-
ization of a 27 kDa fibrinolytic enzyme from Bacillus amyloliquefaciens CH51 iso-
lated from cheonggukjang, J. Microbiol. Biotechnol. 19 (9) (2009) 997–1004.
[196] J.-S. Kim, J.-E. Kim, B.-S. Choi, S.-E. Park, K. Sapkota, S. Kim, H.-H. Lee, C.-S. Kim, Y.
Park, M.-K. Kim, Purification and characterization of fibrinolytic metalloprotease
from Perenniporia fraxinea mycelia, Mycol. Res. 112 (8) (2008) 990–998.
[197] V. Deepak, K. Kalishwaralal, S. Ramkumarpandian, S.V. Babu, S.R. Senthilkumar, G.
Sangiliyandi, Optimization of media composition for Nattokinase production by
Bacillus subtilis using response surface methodology, Bioresour. Technol. 99 (17)
(2008) 8170–8174.
[198] S. Sugimoto, T. Fujii, T. Morimiya, O. Johdo, T. Nakamura, The fibrinolytic activity of
a novel protease derived from a tempeh producing fungus, Fusarium sp. BLB, Biosci.
Biotechnol. Biochem. 71 (9) (2007) 2184–2189.
[199] S.J. Jeong, G.H. Kwon, J. Chun, J.S. Kim, C.S. Park, D.Y. Kwon, J.H. Kim, Cloning of fi-
brinolytic enzyme gene from Bacillus subtilis isolated from Cheonggukjang and its
expression in protease-deficient Bacillus subtilis strains, J. Microbiol. Biotechnol.
17 (6) (2007) 1018–1023.
[200] K.J. Hwang, K.H. Choi, M.J. Kim, C.S. Park, J. Cha, Purification and characterization of
a new fibrinolytic enzyme of Bacillus licheniformis KJ-31, isolated from Korean tra-
ditional Jeot-gal, J. Microbiol. Biotechnol. 17 (9) (2007) 1469–1476.
[201] T. Ge, S.H. Fu, L.H. Xu, Q. Tang, H.Y. Wang, K.P. Guan, G.D. Liang, High density fer-
mentation and activity of a recombinant lumbrokinase (PI239) from Pichia pastoris,
Protein Expr. Purif. 52 (1) (2007) 1–7.
[202] J.-S. Lee, H.-S. Baik, S.-S. Park, Purification and characterization of two novel fibrino-
lytic proteases from mushroom, Fomitella fraxinea, J. Microbiol. Biotechnol. 16 (2)
(2006) 264–271.
[203] J.-S. Kim, K. Sapkota, S.-E. Park, B.-S. Choi, S. Kim, N.T. Hiep, C.-S. Kim, H.-S. Choi, M.-
K. Kim, H.-S. Chun, A fibrinolytic enzyme from the medicinal mushroom Cordyceps
militaris, J. Microbiol. 44 (6) (2006) 622–631.
[204] Y. Peng, X.J. Yang, L. Xiao, Y.Z. Zhang, Cloning and expression of a fibrinolytic en-
zyme (subtilisin DFE) gene from Bacillus amyloliquefaciens DC-4 in Bacillus subtilis,
Res. Microbiol. 155 (3) (2004) 167–173.
[205] Y. Peng, Q. Huang, R.H. Zhang, Y.Z. Zhang, Purification and characterization of a fi-
brinolytic enzyme produced by Bacillus amyloliquefaciens DC-4 screened from
douchi, a traditional Chinese soybean food, Comp. Biochem. Physiol. B. Biochem.
Mol. Biol. 134 (1) (2003) 45–52.
[206] C.-T. Chang, M.-H. Fan, F.-C. Kuo, H.-Y. Sung, Potent fibrinolytic enzyme from a mu-
tant of Bacillus subtilis IMR-NK1, J. Agric. Food Chem. 48 (8) (2000) 3210–3216.
[207] S.H. Kim, N.S. Choi, Purification and characterization of subtilisin DJ-4 secreted by
Bacillus sp. strain DJ-4 screened from Doen-Jang, Biosci. Biotechnol. Biochem. 64
(8) (2000) 1722–1735.
[208] J.-H. Kim, Y.S. Kim, A fibrinolytic metalloprotease from the fruiting bodies of an ed-
ible mushroom, Armillariella mellea, Biosci. Biotechnol. Biochem. 63 (12) (1999)
2130–2136.
[209] M. Fujita, K. Nomura, K. Hong, Y. Ito, A. Asada, S. Nishimuro, Purification and char-
acterization of a strong fibrinolytic enzyme (nattokinase) in the vegetable cheese
natto, a popular soybean fermented food in Japan, Biochem. Biophys. Res.
Commun. 197 (3) (1993) 1340–1347.
[210] J.G. Liu, J.M. Xing, T.S. Chang, H.Z. Liu, Purification of nattokinase by reverse mi-
celles extraction from fermentation broth: effect of temperature and phase volume
ratio, Bioprocess Biosyst. Eng. 28 (4) (2006) 267–273.