Annals of Hematology

https://doi.org/10.1007/s00277-018-3247-3

ORIGINAL ARTICLE

PI3K/Akt inhibitor LY294002 potentiates

homoharringtonine antimyeloma activity in myeloma cells adhered
to stromal cells and in SCID mouse xenograft
Ping Chen 1 & Xiaofang Wen 2 & Bin Wang 2 & Diyu Hou 2 & Hong Zou 3 & Qin Yuan 1 & Hui Yang 2 & Jieqiong Xie 2 &
Huifang Huang 2

Received: 16 November 2017 / Accepted: 18 January 2018

# Springer-Verlag GmbH Germany, part of Springer Nature 2018

Abstract
Homoharringtonine (HHT) is a known anti-leukemia drug that inhibits multiple myeloma (MM) cells both in vitro and in vivo.
Our prior study demonstrated that the potency of HHT in MM cells was compromised significantly when myeloma cells were co-
cultured with BM stromal cells. This study aimed to investigate whether PI3K/Akt inhibitor LY294002 could potentiate the
antimyeloma activity of HHT against MM cells adhered to BM stromal cells and in vivo xenograft models. A co-culture system
composed of MM cells and human stromal cells was employed to mimic MM cells in bone marrow niche. The inhibitory and pro-
apoptotic effect of HHT and LY294002 was determined by CCK-8 assay or flow cytometry. Expression of PI3K/Akt signaling
molecules and anti-apoptotic protein myeloid cell leukemia-1 (Mcl-1) was assessed by western blot analysis and/or reverse
transcription real-time quantitative PCR (RT-qPCR). MM xenografts were used to evaluate antitumor effect of combined therapy
with HHT and LY294002. Adhesion to BM stromal cells rendered MM cells resistant to HHT whereas silencing Mcl-1 partly
reversed the resistance. LY294002 induced apoptosis in MM cells and potentiated the antimyeloma effects of HHT by inhibiting
the PI3K/Akt signal pathway which was abnormally activated during adhesion. LY294002 also enhanced the antimyeloma effect
of HHT in in vivo xenograft models. These findings suggest that activation of PI3K/Akt signal pathway was responsible for the
resistance to HHT in MM cells adhered to stromal cells. LY294002 can potentiate the antimyeloma activity of HHT both in vitro
and in vivo, which may represent a new clinical treatment in MM.

Keywords Multiple myeloma . Stromal cells . Homoharringtonine (HHT) . LY294002 . PI3K/Akt signaling pathways

Introduction immunoglobulin levels, multiple osteolytic bone lesions, and

Multiple myeloma (MM) is a hematologic malignancy charac-
terized by an abnormal clonal expansion of plasma cells in the
bone marrow (BM), leading to overproduction of the monoclo-
nal protein in serum and/or urine, decreased normal
* Huifang Huang
Huanghuif@126.com
1 model [9]. Moreover, the combination of HHT, vincristine, and
Fujian Institute of Hematology, Fujian Provincial Key Laboratory on
Hematology, Fujian Medical University Union Hospital,
Fuzhou, China
2
Central Laboratory, Fujian Medical University Union Hospital,
Fuzhou, China
3
Clinical Laboratory, Fujian Medical University Union Hospital,
Fuzhou, China
anemia [1, 2]. Despite the great progress in the treatment of
MM, this disease is still incurable. A large body of evidence
has demonstrated that residual MM cells in BM microenviron-
ment partially account for MM relapse [3–5].
Homoharringtonine (HHT), a plant alkaloid isolated from the
herb Cephalotaxus mannii in southern China, has been reported
to be effective in the treatment of leukemia [6, 7]. HHT was
shown to inhibit growth and induce apoptosis in MM cell lines
and primary MM cells [8, 9], as well as in in vivo xenograft
dexamethasone obtained good results in the treatment of two
cases of refractory MM [10]. However, we recently found that
BM microenvironment can block the inhibitory and pro-
apoptotic effects of HHT.
Myeloid cell leukemia-1 (Mcl-1) has emerged as a signif-
icant anti-apoptotic protein by preventing the pro-apoptotic

proteins Bak and Bax from disrupting the mitochondrial mem-
brane and initiating apoptosis [10]. Mcl-1 expression is re-
quired for the survival of MM cells [11]. In primary chronic
lymphocytic leukemia (CLL) cells, HHT reduced Mcl-1 ex-
pression and induced apoptosis [12]. PI3K/Akt is an important
signaling pathway that affects the cell cycle, proliferation,
survival, and apoptosis of hematological malignancy cells
and has been indicated to play a vital role in the interaction
of BM with acute myeloid leukemia (AML) [13, 14].
Involvement of PI3K/Akt in cell survival and proliferation of
MM has been well established [15]. In addition, PI3K/Akt is an
upstream signal pathway of Mcl-1. LY294002, a specific PI3K
inhibitor, can partly reverse multi-drug resistance in AML cells
adhered to BM stroma cells [16]. HHT can inhibit Akt pathway
in MM cells [9]. Till now, the role of PI3K/Akt and Mcl-1 in the
HHT resistance of adhered MM cells remains unclear.
Here, we report that adhesion to HS-5 cells enabled MM
cell lines U266, RPMI 8226, and primary MM cells resistant
to HHT-induced inhibition of cell proliferation and apoptosis.
This adhesion-induced HHT resistance could be reversed par-
tially by silencing Mcl-1 and by the PI3K/Akt inhibitor
LY294002, respectively. In comparison to Mcl-1 silencing,
LY294002 could reverse resistance more effectively.
Furthermore, we evaluated the antimyeloma effect of HHT
in combination with LY294002 in primary MM cells and
in vivo xenografts, and found that the combination therapy
can eradicate MM cells effectively. These results indicate that
LY294002 could enhance the inhibitory effects of HHT in
adhered MM cells and in vivo, suggesting that targeting
PI3K/Akt may be a viable strategy for MM therapy.
Materials and methods
Cell line and primary MM cells
U266 cells were purchased from JENNIO Biological
Technology (Guangzhou, China). RPMI 8226 cells were a gift
from Prof. Zhan Rong. The human stroma cell line HS-5 was
purchased from the Biomedicine and Health of the Chinese
Academy of Sciences (Guangzhou, China). Primary MM cells
were isolated from the patients in the Fujian Medical
University Union Hospital with informed consent and
Table 1 MM patients’ clinical
characteristics Sample no. Gender/age Subtype
1 M/43 IgG, λ
2 F/76 IgG, λ
3 M/51 IgG, κ
4 M/73 IgG
Ann Hematol
institutional review board approval. The BM aspirates were
processed by Ficoll density gradient centrifugation to isolate
mononuclear cells followed by CD138+ selection according to
the manufacturer’s instructions (Miltenyi Biotec, Shanghai,
China). The MM patients’ data are presented in Table 1. The
cell lines and primary cells were cultured in a humidified
incubator at 37 °C and 5% CO2 in RPMI 1640 medium
(Gibco, CA) containing 10% fetal bovine serum (FBS;
Gibco, CA) and conventional concentrations of penicillin
and streptomycin (Sigma-Aldrich, MO).
Drugs
Homoharringtonine (Harbin, China) was dissolved in sterile
PBS to prepare a 1 mg/ml stock solution and was stored at −
80 °C. LY294002 was purchased from Sigma Chemical Co.
Cell viability assay
1 × 104 MM cells were seeded in 96-well plates and cell via-
bility was measured by CCK-8 Kit (Dojindo, Japan) accord-
ing to the manufacturer’s instruction. In brief, 10 μl of CCK-8
was added into each well and mixed in the dark at 37 °C for
2 h. After incubation with CCK-8 for 4 h, the absorbance
value (O.D.) at the dual wavelengths of 450/630 nm was de-
termined using a microplate reader. The rate of inhibition of
cell viability was calculated as follows: inhibition rate % = (1
− the average OD value of the drug-treated cells/the average
OD value of the control group) × 100%. Each experiment was
repeated three times.
Co-culture system and isolation of CD138+ MM cells
1.0 × 105 HS-5 cells were seeded into a 12-well plate first
and 2.0 × 105 MM cell lines (U266 or RPMI 8226) or 3.0 ×
105 primary MM cells were then seeded into the plate
when the HS-5 cells reached 70–80% confluence. The
two types of cells were co-cultured for 48 h and CD138+
cells were isolated by CD138+ magnetic beads (Miltenyi
Biotec Technology & Trading, Shanghai, China). Flow
cytometry-based analysis demonstrated that the purity of
the MM cells was > 90%.
Stage (D-S) FISH
II nuc ish (RB1×1)[134/200],(1q21×3)[85/200],
(IGH×2)(5′IGH sep3’ IGH×1)[65/200]
III nuc ish (RB1×1)[150/200],(D13S319×1)[137/200]
II nuc ish (D13S319×1)[90/200],(TP53×1)[49/200]
I nuc ish (1q21×3)[95/200],(D13S319×1)[87/200]
Ann Hematol
Apoptosis detection
Apoptosis was detected by flow cytometry with Annexin V-
fluorescein isothiocyanate (FITC)/PI double staining.
Apoptosis assays were performed according to the detection
kit’s instruction (Roche, Shanghai) followed by flow cytomet-
ric analysis.
RNA extraction, reverse transcription, and real-time
PCR
Total RNA was extracted, followed by reverse transcription
into cDNA according to the manufacturer’s instructions
(Thermo Scientific, Waltham, MA, USA). Real-time quanti-
tative polymerase chain reaction (PCR) was performed with
QuantiTect SYBR Green PCR Kit (Applied Biosystems,
Foster City, CA, USA) in ABI PRISM 7500 PCR instrument
(Applied Biosystems). The reaction solution (50 μl)
contained 25 μl 2× QuantiTect SYBR Green PCR Master
Mix, 0.2 μmol/l of each primer, 2.5 μl of cDNA, and
RNase-free water. The PCR conditions were as follows:
pre-denaturation at 95 °C for 15 min followed by 40 cycles
of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s,
and extension at 72 °C for 1 min. Each reaction and each
experiment were done in triplicate. Glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) served as an internal
reference. The primers were as follows: GAPDH forward,
5′-GAGTCAACGGATTTGGTCGT-3′, reverse, 5′-CATG
GGTGGAATCATATTG GA-3; and Mcl-1 forward, 5′-
CGAACCATTAG CA GAAAGTA TCAC-3′, reverse, 5′-
AAGAACTCCACAAACCCATCC-3′. Data analysis was
performed using the 2–ΔΔCT method. 2–ΔΔCT ≥ 1.5 was de-
fined as upregulation, and 2–ΔΔCT ≤ 0.5 was defined as
downregulation.
Knockdown of Mcl-1 gene expression by siRNA
Mcl-1-targeted small interfering RNAs (siRNAs) and con-
trol siRNA were synthesized by Shanghai Genechem Co.
(Shanghai, China). Target sequences of siRNA oligonucle-
otides were as follows: control siRNA: 5′-TCCC
AGTAGAACAGACATGAGACC GACCACCTCGGTCT
C AT G T C T G T T C TA C T T- 3 ′ ; si M cl - 1- 1 : 5 ′ - C G T T
GTCTCGA GTGATGAT-3′; siMcl-1-2: 5′-GAGG
AGGAGGACGAGTTGTA-3′; siMcl-1-3: 5′-GCTG
CATCGAACCATTAGCA-3′. The lentivirus vector con-
struction and virus production were performed as previous-
ly described [12]. The viral supernatants were collected
48 h later and either used immediately or frozen on dry
ice and stored at – 80 °C. The U266 cells and RPMI
8226 cells were cultured in 24-well plates with 1 × 105
cells per well in a volume of 0.5 ml RPMI/10% FBS with
polybrene (8 mg/ml). We added 500 ml virus supernatant,
and cells were infected for 96 h at 37 °C.
Western blot analysis
Western blot was performed as previously described [14]. The
following antibodies were used: anti-t-Akt, anti-p-AktSer473,
anti-p-AktThr308, anti-GAPDH, PARP, caspase-3, caspase-9,
and horseradish peroxidase-labeled anti-mouse and anti-
rabbit secondary antibodies were purchased from Cell Signal
Technology (Danvers, MA). GADPH was used as the internal
control for cytoplasmic proteins and nuclear proteins
respectively.
Establishment of MM xenografts and therapy
Severe combined immunodeficient (SCID) mice (Shanghai
Experimental Animal Center of the Chinese Academy of
Sciences, China) were housed and maintained in facilities un-
der an institute-approved animal protocol. 1 × 107 RPMI 8226
cells were subcutaneously injected into the subscapularis in
female SCID mice with the age of 6 weeks. The use of animals
was approved by the Committee of Research Animals of
Fujian Medical University. The tumor volume was measured
every 2 days and calculated with the following formula:
V = [tumor length in mm × (tumor width2 in mm)]/2. When
the tumor volume reached 100 mm3, the mice were randomly
assigned into four groups (n = 10/group). The control group
was intraperitoneally treated with the same volume of normal
saline. The HHT group was administered with HHT at 3 mg/
kg from days 1–5 and days 11–15. The LY294002 group
received LY294002 at 20 mg/kg twice a week. The combina-
tion group was treated with both HHT and LY294002. Tumor
size and animal body weights were measured every 2 days.
The mice were sacrificed 24 h after the last dosing, and the
tumor xenografts were collected for flow cytometry. The dif-
ferences in survival between groups were evaluated using a
log-rank test.
Flow cytometric analysis
The tumor cells were collected to create a single cell suspen-
sion. The percentage of CD138+ cells was detected by staining
with anti-CD138 according to the manufacturer’s specifica-
tion (BD).
Statistical analysis
The significance of differences between experimental condi-
tions was determined using the Student t test. The minimal level
of significance was p < 0.05. Characterization of synergistic
interactions was performed using the synergism quotient (SQ).
 Ann Hematol

Results compared to control group. After treatment of MM cells with

20 ng/ml HHT for 24 h, mitochondrial membrane potential
HHT induces apoptosis in MM cells via caspase-9, decreased significantly by flow cytometric analysis (Fig.
caspase-3, and PARP cleavage 1b). The mechanism of HHT-induced apoptosis in MM cells
was studied by western blot analysis. As shown in Fig. 1c,
MM cell line U266 and RPMI 8226 cells were incubated with treatment with HHT induced cleavage of caspase-9, caspase-
10–40 ng/ml HHT for 24 h, and apoptosis was quantitated by 3, and PARP, a hallmark of apoptosis. Furthermore, HHT
Annexin V/PI staining. As shown in Fig. 1a, the apoptosis rate also inhibited cell viability and induced apoptosis in primary
increased significantly in the cells treated with 20 and 40 ng/ml MM cells (Fig. 1d, e).

a b Mono-U266 Mono-U266+HHT

98.4% 0.28% 63.9%

0.063%

60
** Control

JC-1(Red)
10 ng/ml

** 20 ng/ml
Apoptosis Rate %

40 40 ng/ml

*
*
20
1.94% 33.9%
0.051% 1.44%

0 Mono-RPMI 8266 Mono-RPMI8226+HHT

6

0.975% 73.9%
6

0.551% 97.3%
26

22
-U

o-8
o

on
on

M
M

0.884% 1.3% 4.35% 20.8%

U266 RPMI 8266

PARP

c
JC-1 (Green)

pro-Caspase 9

d Patient 1 Patient 2
10 ng/ml-12 h

20 ng/ml-12 h

Cleaved-Caspase 9 80 80 40 ng/ml-12 h

** 10 ng/ml-24 h

60 ** 20 ng/ml-24 h
60 **
pro-Caspase 3 * 40 ng/ml-24 h
**
Inhibition rate(%)

Inhibition rate(%)

40 * 40 **
* *
*
Cleaved-Caspase 3
*
20 20 *
GAPDH
0 0

Con HHT Con HHT

e
Mono-patient 1 Mono-patient 1 +HHT Mono-patient 2 Mono-patient 2+ HHT
0.803% 7.22% 1.08% 13.8% 0.974% 4.92% 0.542% 10.6%
PI

79.6% 12.4% 58.1% 27.0% 87.5% 6.6% 71% 17.8%

Annexin V-FITC

Fig. 1 Effect of HHT on apoptosis in MM cells. a U266 and RPMI 8226 caspase-3 in cell lines treated with HHT was assessed by western blot.
cell lines were cultured alone and treated with HHT at indicated d The inhibitory effect of HHT on primary MM cells. Bone marrow
concentration for different time points. b Cell lines were treated with samples collected from MM patients were treated with HHT at 10 or
20 ng/ml HHT for 24 h and mitochondrial membrane potential was 20 ng/ml for 12 or 24 h respectively. e HHT induced apoptosis of
analyzed by flow cytometry. c The cleavage of PARP, caspase-9, and primary MM cells. *p<0.05; **p<0.01
Ann Hematol

HHT reduced Mcl-1 expression through proteasome
degradation
To study the effect of HHT on Mcl-1, Mono-U266 and
Mono-8226 cells were incubated with 20 ng/ml HHT for
6, 12, and 24 h; the mRNA and protein levels were ana-
lyzed by reverse transcription real-time quantitative PCR
(RT-qPCR) and western blot, respectively. HHT did not
decrease the mRNA levels of Mcl-1 (Fig. 2a) but reduced
the protein level (Fig. 2b). Reduction of the Mcl-1 level in
CLL cells treated by HHT appeared to result from trans-
lation inhibition and proteasome degradation. Therefore,
cycloheximide (CHX) and proteasome inhibition were
used to test the role of HHT in the degradation of Mcl-
1. CHX is widely used as an inhibitor of protein synthe-
sis. After treating cells with HHT for 1 h, CHX was added
to inhibit the new protein synthesis and the Mcl-1 protein
level was detected every 4 h thereafter. As shown in Fig.
2c, compared with PBS group, the reduction of Mcl-1 in
HHT group is more profound. Furthermore, proteasome
inhibitor (MG132 or bortezomib) was used to test if
HHT treatment promoted Mcl-1 degradation in a
proteasome-dependent manner. As shown in Fig. 2d,
U266 cells and RPMI 8226 cells were treated with HHT,
MG132, or bortezomib alone or in combination of HHT
with proteasome inhibitor. MG132 and bortezomib
partially protected Mcl-1 from degradation induced by
HHT treatment. These data suggested that reduction of
Mcl-1 in HHT-treated myeloma cells, at least in part,
was due to an increase in Mcl-1 proteasome degradation.
Silencing Mcl-1 partly potentiated HHT antimyeloma
effect on adhered MM cells
The Mcl-1 protein expression was markedly increased in
U266 and RPMI 8226 cells after adhesion to stromal cells
(Fig. 3a). Since Mcl-1 is a vital factor for MM cell survival,
to examine whether silencing Mcl-1 could abrogate adhesion-
induced resistance to HHT in MM cells, we constructed
lentiviral vectors carrying small hairpin RNAs (shRNA) for
Mcl-1 and transfected the lentiviral vectors into U266 and
RPMI 8266 cells. The detection of Mcl-1 mRNA level and
protein level demonstrated that shMcl-1 markedly reduced
Mcl-1 expression in U266 and RPMI8226 cells in comparison
with control shRNA (Fig. 3b). In comparison with control
shRNA, silencing Mcl-1 could potentiate the inhibition of
10 and 20 ng/ml HHT to Co-U266 and 10 ng/ml HHT to
Co-8226 as well as Mono-U266 and Mono-8226 (Fig. 3c,
d). However, no significant potentiating effect was observed
in 40 ng/ml HHT to Co-U266, and 20 and 40 ng/ml HHT to
Co-8226 (Fig. 3d).

a Mcl-1 mRNA
b U266 RPMI 8226
HHT-4 h Mcl-1
1.5 HHT-6 h
mRNA Relative Multiple

HHT-12 h
GAPDH
HHT-24 h
1.0 HHT 0h 6h 12 h 24 h HHT 0 h 6h 12 h 24 h

MM 1 MM 2
0.5
Mcl-1

GAPD H
0.0
U266 RPMI 8226 HHT 0h 12 h 0h 12 h

c d
U266 RPMI 8226
Mcl-1
Mcl-1
GAPDH
GAPDH
Con H M M+H Con H M M+H

Mcl-1
Mcl-1
GAPDH
GAPDH Con H B B+H Con H B B+H

Fig. 2 HHT-induced Mcl-1 downregulation was largely because of and 24 h, respectively. c The protein level of Mcl-1 in MM cells treated
proteasome degradation. a The mRNA level of Mcl-1 in MM cells with CHX or the combination of CHX and HHT. d The effect of the
treated with 20 ng/ml HHT at 4, 6, 12, and 24 h, respectively. b The combination of HHT and the proteasome inhibitor (BTZ or MG 132)
protein level of Mcl-1 in MM cells treated with 20 ng/ml HHT at 6, 12, on expression of Mcl-1
 Ann Hematol

a U266 RPMI 8226 MM 3

Mcl-1

GAPDH
Mono- Co- Mono- Co- Mono- Co-

b Mcl-1 mRNA
100 Si Con
Relative Multiple/Control

Si Mcl-1
80
Mcl-1
U266
60 GAPDH
*
40
*
Mcl-1
RPMI 8226
20 GAPDH
Con Si Con Si Mcl-1
0
Mono-U266 Mono-8226

c Mono-U266 Mono-8226
80 Si Con+Mono-U266 100 Si Con+Mono-8266

* Si Mcl-1+Mono-U266 Si Mcl-1+Mono-8266
inhibition rate(%)

80
60 * inhibition rate(%) *
* *
60
40 *
40
20
20

0 0
10

20

40

10

20

40
HHT HHT

d U266 Mono-U266 RPMI 8226 Mono-8226

80 Co-U266 100 Co-8226
* Si Con+Co-U266 * Si Con+Co-8226
*
80
inhibition rate(%)

Si Mcl-1+Co-U266 Si Mcl-1+Co-8226
inhibition rate(%)

60
*
60 *
40 *
* *
40
*
20
20

0 0
10 20 40 10 20 40
HHT HHT

Fig. 3 Silencing Mcl-1 partly potentiates HHT antimyeloma effect on Mono-8226. c Silencing Mcl-1 inhibited the cell viability of Mono-U266
MM cells co-cultured with HS-5. a The protein level of Mcl-1 in Co- and Mono-8226. d Silencing Mcl-1 partly potentiates HHT inhibition
U266 and Co-8226. b The effect of silencing Mcl-1 in Mono-U266 and effect on Co-U266 and Co-8226. *p<0.05

LY294002 inhibited growth of MM cells cell lysates from Mono-U266 cells treated with 10 μM
and potentiated HHT antimyeloma effect on adhered LY294002 for 2–24 h were immunoblotted with p-AktThr308,
MM cells p-AktSer473, and t-Akt. Expectedly, LY294002 inhibited p-
AktThr308 and p-AktSer473 in a time-dependent fashion.
LY294002 inhibited the cell viability of Mono-U266 and Similar results were observed in RPMI 8226 cells treated with
Mono-RPMI 8226 cells in a dose-dependent manner 25 μM LY294002 (Fig. 4c). However, even PI3K/Akt signal
(Fig. 4a). We next examined the inhibitory effect of pathway is a critical upstream regulator of Mcl-1, there was no
LY294002 on PI3K/Akt signal pathway in MM cells. Whole inhibition effect of LY294002 on the expression of Mcl-1
Ann Hematol

LY294002 10 µM- 6 h
a b Mcl-1 mRNA LY294002 10 µM-12 h
LY294002 10 µM-24 h
LY294002 5 µM 1.0 LY294002 25 µM-6 h

Relative Multiple/Control
50 LY294002 10 µM LY294002 25 µM-12 h
**
LY294002 25 µM 0.8
* LY294002 25 µM-24 h
40 LY294002 50 µM
Inhibition rate(%)

0.6
30 *
20
* 0.4
*
10 0.2

0 0.0
Mono-U266 Mono-8226 Mono-U266 Mono-8226

c U266 RPMI 8266

Mcl-1

p-Akt T308

p-Akt S473

t-Akt

GAPDH

Con 2h 4 h 6 h 12 h 24 h Con 2h 4 h 6 h 12 h 24 h
LY294002 (10 μM) LY294002 (25 μM)

d U266
RPMI 8226
80 Mono-U266 100
* Co-U266
* Mono-8226
* * Co-8226
80 * *
inhibition rate(%)

LY294002+Co-U266
Inhibition rate(%)

60 LY294002+Co-8226
* *
60
40
*
*
* * 40
20
20

0 0
10 20 40 10 20 40
HHT HHT

e
U266 RPMI 8266
Mcl-1

p-Akt T308

p-Akt S473

t-Akt

GAPDH

HHT
HS-5
LY294002

Fig. 4 LY294002 potentiates HHT antimyeloma effect on Co-U266 and or 25 nM LY294002 for 12 or 24 h respectively. c LY294002 inhibited the
Co-8226 cells through inhibiting the activated PI3K/Akt signal pathway. PI3K/Akt signal pathway in Mono-U266 or Mono-8226. d LY294002
a Mono-U266 and Mono-8226 cells were treated with LY294002 at potentiates HHT inhibitory effect on the viability of Co-U266 and Co-
indicated concentration for different time points, respectively. b The 8266 cells. e The combination of LY294002 and HHT can inhibit the
mRNA level of Mcl-1 in Mono-U266 and Mono-8226 treated with 10 activated PI3K/Akt pathway in Co-U266 and Co-8226. *p<0.05
 Ann Hematol

mRNA (Fig. 4b) and protein levels (Fig. 4c). We further de-
termined whether LY294002 potentiated the antimyeloma ef-
fects of HHT in adhered MM cells. The combination of
LY294002 and HHT for 48 h synergistically inhibited the
growth of Co-U266 and Co-8226 cells initially resistant to
LY294002 or HHT alone (Fig. 4d). After adhesion, p-Akt
was higher than that of the control. Compared with
LY294002 and HHT alone, the p-Akt and Mcl-1 level de-
creased significantly in combination group (Fig.4e). These
data suggest that LY294002-HHT combination markedly en-
hance the inhibition effect on adhered MM cells compared
with single-agent treatment.
cytometry was used to detect apoptosis after different treat-
ments. As shown in Fig. 5b, the apoptotic rate of the combi-
nation group was significantly higher than that of LY294002
or HHT alone in adhered primary MM cells.
PI3K/Akt signal pathway and Mcl-1 have been demon-
strated to play a crucial role in supporting cell proliferation,
survival, and drug resistance in MM. As shown in Fig. 5c, the
p-AktT308 and p-AktS473 were increased after co-culturing,
indicating PI3K/Akt pathway was activated. However, treat-
ment with LY294002 and HHT combination diminished the
PI3K/Akt activation and Mcl-1 upregulation induced by the
co-culturing (Fig. 5c).

LY294002 potentiated inhibitory effect of HHT LY294002 potentiated HHT antimyeloma effects
against primary MM cells in vivo

The antimyeloma effect of the combination treatment with
LY294002 and HHT was evaluated in primary MM cells ad-
hered to HS-5 cells. Adhesion to HS-5 cells also induced HHT
resistance in primary MM cells. The inhibition rate was 2.4 ±
0.35 and 2.15 ± 0.87, 2.66 ± 0.43 and 2.27 ± 0.77, and 27.13
± 7.03 and 25.78 ± 3.87%, respectively, in MM3 and MM4
primary cells treated with HHT, LY294002 alone, or the com-
bination for 12 h. The inhibition rate was 5.23 ± 0.91 and 5.92
± 1.1, 4.65 ± 0.66 and 4.90 ± 0.83, and 44.16 ± 9.17 and
39.36 ± 6.83%, respectively, in MM3 and MM4 treated with
HHT, LY294002 alone, or the combination for 24 h (Fig. 5a).
To determine whether LY294002 could also potentiate pro-
apoptotic effects of HHT on adhered primary MM cells, flow
We also addressed the issue of whether LY294002 could po-
tentiate the antimyeloma effect of HHT in vivo. The xenograft
model of RPMI 8226 tumors in SCID mice was established
and divided into four groups. One group was treated with
normal saline whereas the other three groups were treated with
LY294002, or HHT alone, or the combination. In a prelimi-
nary experiment, we had used LY294002 dose at 40 mg/kg
twice a week that could efficiently block the PI3K/AKT path-
way in mice as reported by other investigators [17, 18].
Unfortunately, this dose and schedule turned out to be very
toxic on our hands and to the organs of lung, liver, and
intestinum tenue in the mice (data not shown). Therefore, we
opted to use 20 mg/kg LY294002 instead in the study.

a 60 Co-MM 4
b
Co-MM 3 Co-MM3
* Co-MM3+HHT Co-MM3+LY Co-MM3+LY+HHT
Inhibition rate(%)

*
40
* *
20

0
PI
H 294 T-2 h

H 940 -24 h
H 2 h

T+ 02 h

H 2 h

H 0 h
L 2h

-2 h

L 2h

-2 h
h
h
H 2

2 HT 2
H 400 -12

H 0 4

H 400 -12
LY -24

LY 24
4
LY H Y-1

LY H Y-1
4
T+ -1

T+ -1

T+ 2-
29 HT

29 HT
LY H

LY H

c Annexin V-FITC

MM 3 MM4
Co-MM4 Co-MM4+HHT Co-MM4+LY Co-MM3+LY+HHT
Mcl-1

p-Akt T308

p-Akt S473

t-Akt

GAPDH
PI

HHT ˉ ˇ ˉ ˇ ˉ ˇ ˉ ˇ ˉ ˇ ˉ ˇ
HS-5 ˉ ˉ ˇ ˇ ˇ ˇ ˉ ˉ ˇ ˇ ˇ ˇ
LY294002 ˉ ˉ ˉ ˉ ˇ ˇ ˉ ˉ ˉ ˉ ˇ ˇ

Annexin V-FITC

Fig. 5 The inhibitory effect of the combination of LY294002 and HHT on increased significantly in the combination group than in LY294002, or
primary MM cells co-cultured with HS-5 cells. a The combination HHT alone. c The combination inhibit the PI3K/Akt signal pathway in
inhibited the viability of co-cultured primary MM cells effectively co-cultured primary MM cells. *p<0.05
compared with LY294002, or HHT treatment. b The apoptosis
Ann Hematol

Treatment with HHT alone caused a significant reduction in combination group compared with in the LY294002 or
tumor size when compared with vehicle group (p < 0.05, HHT group. Furthermore, mice treated with combination
Fig. 6a). While the AKT inhibitor alone was ineffective of LY294002 and HHT had a significant survival advan-
against the tumor growth, we found that the combination ther- tage compared to those receiving LY294002 or HHT
apy of the ATK inhibitor and HHT had a strong synergistic treatment alone (Fig. 6d).
effect on the growth of MM cells in vivo. Compared with the
control untreated group, the tumor volume reduction rate was
11.23, 33.03, and 47.1% in the LY294002-, HHT-, and Discussion
LY294002 plus HHT-treated groups, respectively. Moreover,
FACS analysis revealed that CD138+ MM cells in tumor xe- Despite the great improvement in the treatment, MM still
nografts decreased more significantly in combination group remains incurable. The BM niche plays a crucial role in
than in other groups (Fig. 6b). The toxicity was minimal for cell survival and the drug resistance of MM. The sensi-
the three treatment groups since there was no significant tivity of MM cells in BM niche to chemotherapy is com-
weight loss during the period of the experiment (Table 2). promised, which partly results in disease relapse. Thus,
To detect the pro-apoptotic effect in vivo, flow cytom- strategies to eradicate MM cells in the BM niche have
etry was used to detect the apoptosis rate in MM cells become a hot topic in studies of MM treatment. In recent
isolated from tumor xenografts. As shown in Fig. 6c, an years, several studies have shown that the extracted drug
evident increase in apoptosis rate was observed in the from traditional Chinese plants can inhibit MM cells

a b
**
*
Con
1500 80
HHT
*
LY *
% CD138 + Cells in Tumor

60
Tumor Volume(mm 3 )

HHT+LY

1000
*

# 40

500
20

0 0
10 13 16 19 22 25
)
S)

kg
)

02
kg
N

g/

40
g/
9%

29
m

0
0.

LY
(2

(2
l(

02

T+
o

Transplant days (d)

H
tr

40

H
H
on

39

H
C

LY

c Control HHT LY294002 HHT+LY294002

PI

Annexin V-FITC

d Control
HHT
LY294002
100
HHT+LY294002

80
Overall survival

60

40

20

0
0 20 40 60 80
Days

Fig. 6 LY294002 potentiated HHT-mediated antimyeloma effects Mean tumor size, *p < 0.05 vs control, #p < 0.05 vs HHT or BTZ alone. b
in vivo. RPMI 8226 xenograft mice were treated with vehicle control, The percentage of CD138+ cells in tumor, *p < 0.05, **p < 0.01. c The
LY294002, HHT, or in combination. Statistical analysis was carried out apoptosis assessed by flow cytometry in MM tumor xenografts after
with ANOVA and the Bonferroni test. Values represent the mean ± SD. a treatment

Table 2 Mouse body weight in the indicated treatment groups
Body weight Control LY294002 HHT H + LY
Day 0 (g) 17.9 ± 0.45 18.02 ± 0.53 17.8 ± 0.59 19.7 ± 0.69
Day 38 (g) 22.93 ± 0.51 23.54 ± 0.67 23.41 ± 0.52 22.51 ± 0.7
effectively in vitro and in vivo [19, 20]. HHT, an anti-
leukemia drug extracted from the herb Cephalotaxus
mannii, has been used for treatment of acute and chronic
myeloid leukemia and myelodysplastic syndrome
[21–23]. It has been shown that HHT exerted an evident
inhibition on MM cells both in vitro and in vivo partially
through inhibiting PI3K/Akt pathway [8]. In our previous
studies, U266 cells and primary MM cells were co-
cultured with HS-5 stromal cells to simulate the growth
and maintenance of MM cells in BM niche [16, 24]. The
results demonstrated that adhesion to HS-5 reduced the
sensitivity of MM cells to HHT. However, underlying
mechanism of resistance to HHT induced by adhesion
remains unclear.
Mcl-1, one of the important members of the Bcl-2 fam-
ily, has emerged as an anti-apoptotic protein that promotes
the survival of MM cells in vitro and in vivo [11]. The
decrease in Mcl-1 protein level, not in mRNA level, was
observed in MM cells treated with HHT in time dependent
and was accompanied by the loss of mitochondrial mem-
brane potential, PARP cleavage, and Annexin V-positive
staining, indicating the induction of apoptosis. In CLL
cells treated with HHT, the reduction of Mcl-1 was due
to translation inhibition and proteasome degradation rath-
er than to transcription inhibition [12]. In our present
studies, HHT induced MM cells apoptosis and down-
regulated Mcl-1 protein level due to proteasome degrada-
tion. The Mcl-1 protein level increased abnormally in
MM cells when adhered to HS-5 stromal cells. Thus,
based on these findings, we hypothesized that Mcl-1 is a
crucial role in the resistance of HHT induced by adhesion
to stromal cells. Down-regulation of Mcl-1 by siRNA
inhibited Mono-MM cells proliferation and was synergis-
tic with HHT in inhibiting adhered MM cells. However,
silencing Mcl-1 only partly reversed the resistance of
HHT. There was no significant difference in 40 ng/ml
HHT and the combination of silencing Mcl-1 and HHT.
Our findings demonstrated that LY294002, a specific
PI3K inhibitor, inhibited Mono-MM cell proliferation and
PI3K/Akt pathway in MM cells. However, LY294002 had
no inhibitory effect on Mcl-1 protein level. The sensitivity
to LY294002 also reduced significantly in MM cells after
adhesion to stromal cells, but LY294002 can rescue HHT
resistance in adhered MM cells, suggesting that adhesion-
induced HHT resistance was partially due to PI3K/Akt
pathway activation. Thus, we checked the PI3K/Akt
Ann Hematol
pathway in MM cells after co-cultured by western blot
and the results showed that the level of p-AktThr308 and
AktSer473 increased, suggesting the abnormal activation of
PI3K/Akt pathway after adhesion. The combination of
LY294002 and HHT could inhibit effectively the adhered
MM cells through inhibiting the activated PI3K/Akt path-
way, suggesting that blocking PI3K/Akt pathway may be
synergistic with HHT to eradicate MM cells in BM niche.
Furthermore, the potential antimyeloma effect of
LY294002 on HHT was also observed in vivo. Compared to
vehicle group, HHT treatment alone could inhibit MM cells in
SCID mice. The combination of LY294002 and HHT could
further augment the antimyeloma activity in vivo, significant-
ly inhibiting the tumor volume, reducing the engraftment of
CD138+ cells, inducing apoptosis in tumor xenograft, and
prolonging the survival in SCID mice.
In summary, we have demonstrated that LY294002 potenti-
ates the antimyeloma activity of HHT on the adhered MM cells
in vitro and in vivo. The underlying mechanism may be rele-
vant to the LY294002-induced inhibition on activated PI3K/
Akt pathway in MM cells adhered to stromal cells. The study
provides support for future clinical trials of the PI3K/Akt inhib-
itor in combination with HHT in patients with MM.
Funding information This research is granted by the Fujian Provincial
Innovation Fund (2014-CX-13), Fujian Provincial Natural Fund
(2015J01472), Fujian Medical University Professor Fund (JS14024),
Personnel Training Program of Fujian Provincial Health System for
Youth Backbone Talents (2014-ZQN-JC-10), Construction Project of
Fujian Medical Center of Hematology (Min201704), and National and
Fujian Provincial Key Clinical Specialty Discipline Construction
Program, P. R. C.
Compliance with ethical standards
Primary MM cells were isolated from the patients in the Fujian Medical
University Union Hospital with informed consent and institutional review
board approval. The use of animals was approved by the Committee of
Research Animals of Fujian Medical University.
Conflict of interest The authors declare that they have no conflict of
interest.
References
1. Kyle RA, Rajkumar SV (2004) Multiple myeloma. N Engl J Med
351(18):1860–1873. https://doi.org/10.1056/NEJMra041875
2. Dispenzieri A, Kyle RA (2005) Multiple myeloma: clinical features
and indications for therapy. Best Pract Res Clin Haematol 18(4):
553–568. https://doi.org/10.1016/j.beha.2005.01.008
3. Ria R, Catacchio I, Berardi S, De Luisi A, Caivano A, Piccoli C,
Ruggieri V, Frassanito MA, Ribatti D, Nico B, Annese T, Ruggieri
S, Guarini A, Minoia C, Ditonno P, Angelucci E, Derudas D,
Moschetta M, Dammacco F, Vacca A (2014) HIF-1alpha of bone
marrow endothelial cells implies relapse and drug resistance in
patients with multiple myeloma and may act as a therapeutic target.
Ann Hematol
Clin Cancer Res 20(4):847–858. https://doi.org/10.1158/1078-
0432.ccr-13-1950
4. Hao M, Zhang L, An G, Meng H, Han Y, Xie Z, Xu Y, Li C, Yu Z,
Chang H, Qiu L (2011) Bone marrow stromal cells protect myelo-
ma cells from bortezomib induced apoptosis by suppressing
microRNA-15a expression. Leuk Lymphoma 52(9):1787–1794.
https://doi.org/10.3109/10428194.2011.576791
5. Wang J, Hendrix A, Hernot S, Lemaire M, De Bruyne E, Van
Valckenborgh E, Lahoutte T, De Wever O, Vanderkerken K,
Menu E (2014) Bone marrow stromal cell-derived exosomes as
communicators in drug resistance in multiple myeloma cells.
Blood 124(4):555–566. https://doi.org/10.1182/blood-2014-03-
562439
6. Warrell RP Jr, Coonley CJ, Gee TS (1985) Homoharringtonine: an
effective new drug for remission induction in refractory
nonlymphoblastic leukemia. J Clin Oncol 3(5):617–621. https://
doi.org/10.1200/jco.1985.3.5.617
7. Luo CY, Tang JY, Wang YP (2004) Homoharringtonine: a new
treatment option for myeloid leukemia. Hematology 9(4):259–
270. https://doi.org/10.1080/10245330410001714194
8. M e n g H , Ya n g C , J i n J , Z h o u Y, Q i a n W ( 2 0 0 8 )
Homoharringtonine inhibits the AKT pathway and induces
in vitro and in vivo cytotoxicity in human multiple myeloma cells.
Leuk Lymphoma 49(10):1954–1962. https://doi.org/10.1080/
10428190802320368
9. Lou YJ, Qian WB, Jin J (2007) Homoharringtonine induces apo-
ptosis and growth arrest in human myeloma cells. Leuk Lymphoma
48(7):1400–1406. https://doi.org/10.1080/10428190701411466
10. Yang X, Yang C, Shao K, Ye X, Meng H, Zhou Y, Qian W (2007)
Refractory multiple myeloma treated with homoharringtonine: re-
port of two cases. Ann Hematol 86(12):919–921. https://doi.org/10.
1007/s00277-007-0331-5
11. Zhang B, Gojo I, Fenton RG (2002) Myeloid cell factor-1 is a
critical survival factor for multiple myeloma. Blood 99(6):1885–
1893. https://doi.org/10.1182/blood.V99.6.1885
12. Chen R, Guo L, Chen Y, Jiang Y, Wierda WG, Plunkett W (2011)
Homoharringtonine reduced Mcl-1 expression and induced apopto-
sis in chronic lymphocytic leukemia. Blood 117(1):156–164.
https://doi.org/10.1182/blood-2010-01-262808
13. Wang WL, Zhang YC, Zeng HM, Hua CL, Wei W, Xu J, Zhu XF,
Cheng T, Yuan WP (2012) Regulatory mechanisms of PI3K/AKT
signaling pathway in acute leukemia. J Exp Hematol 20(1):18–21
14. Chen P, Huang H, Wu J, Lu R, Wu Y, Jiang X, Yuan Q, Chen Y
(2015) Bone marrow stromal cells protect acute myeloid leukemia
cells from anti-CD44 therapy partly through regulating PI3K/Akt-
p27(Kip1) axis. Mol Carcinog 54(12):1678–1685. https://doi.org/
10.1002/mc.22239
15. Shi Y, Yan H, Frost P, Gera J, Lichtenstein A (2005) Mammalian
target of rapamycin inhibitors activate the AKT kinase in multiple
myeloma cells by up-regulating the insulin-like growth factor
receptor/insulin receptor substrate-1/phosphatidylinositol 3-kinase
cascade. Mol Cancer Ther 4(10):1533–1540. https://doi.org/10.
1158/1535-7163.mct-05-0068
16. Chen P, Jin Q, Fu Q, You P, Jiang X, Yuan Q, Huang H (2016)
Induction of multidrug resistance of acute myeloid leukemia cells
by cocultured stromal cells via upregulation of the PI3K/Akt sig-
naling pathway. Oncol Res 24(4):215–223. https://doi.org/10.3727/
096504016x14634208143021
17. Cao H, Zhu K, Qiu L, Niu H, Hao M, Yang S, Zhao Z, Lai Y,
Anderson JL, Fan J, Im HJ, Chen D, Roodman GD, Xiao G
(2013) Critical role of AKT protein in myeloma-induced osteoclast
formation and osteolysis. J Biol Chem 288(42):30399–30410.
https://doi.org/10.1074/jbc.M113.469973
18. Fujiwara M, Izuishi K, Sano T, Hossain MA, Kimura S, Masaki T,
Suzuki Y (2008) Modulating effect of the PI3-kinase inhibitor
LY294002 on cisplatin in human pancreatic cancer cells. J Exp Clin
Cancer Res 27(1):76. https://doi.org/10.1186/1756-9966-27-76
19. Lee JH, Kim C, Kim SH, Sethi G, Ahn KS (2015) Farnesol inhibits
tumor growth and enhances the anticancer effects of bortezomib in
multiple myeloma xenograft mouse model through the modulation
of STAT3 signaling pathway. Cancer Lett 360(2):280–293. https://
doi.org/10.1016/j.canlet.2015.02.024
20. Chang H, Qi C, Yi QL, Reece D, Stewart AK (2005) p53 gene
deletion detected by fluorescence in situ hybridization is an adverse
prognostic factor for patients with multiple myeloma following au-
tologous stem cell transplantation. Blood 105(1):358–360. https://
doi.org/10.1182/blood-2004-04-1363
21. Feldman E, Arlin Z, Ahmed T, Mittelman A, Puccio C, Chun H,
Cook P, Baskind P (1992) Homoharringtonine in combination with
cytarabine for patients with acute myelogenous leukemia.
Leukemia 6(11):1189–1191
22. Feldman EJ, Seiter KP, Ahmed T, Baskind P, Arlin ZA (1996)
Homoharringtonine in patients with myelodysplastic syndrome
(MDS) and MDS evolving to acute myeloid leukemia. Leukemia
10(1):40–42
23. O'Brien S, Kantarjian H, Keating M, Beran M, Koller C, Robertson
LE, Hester J, Rios MB, Andreeff M, Talpaz M (1995)
Homoharringtonine therapy induces responses in patients with
chronic myelogenous leukemia in late chronic phase. Blood
86(9):3322–3326
24. Chen P, Yuan Q, Yang H, Wen X, You P, Hou D, Xie J, Cheng Y,
Huang H (2017) Homoharringtonine enhances bortezomib
antimyeloma activity in myeloma cells adhesion to bone marrow
stromal cells and in SCID mouse xenografts. Leuk Res 57:119–126.
https://doi.org/10.1016/j.leukres.2017.04.007